Molecular Ecology Notes (2005) 5, 30–32 doi: 10.1111/j.1471-8286.2004.00820.x PRIMER NOTE Blackwell Publishing, Ltd. Trinucleotide microsatellite loci in the yellow dung fly Scathophaga stercoraria (Diptera: Scathophagidae) PHILLIP C. WATTS, DEREK DALY, ANNA KAYANI, FRANCESCA A. CULVER, V I C T O R I A M . K E L L Y , G E O F F A . P A R K E R and S T E P H E N J . K E M P School of Biological Sciences, The Biosciences Building, University of Liverpool, Liverpool, L69 7ZB UK Abstract We describe six polymorphic, trinucleotide microsatellite loci that were isolated from the yellow dung fly Scathophaga stercoraria (Diptera: Scathophagidae), a model system for examining the mechanisms behind sperm competition in species with internal fertilization. These microsatellites yielded between 3 and 11 alleles per locus in a sample of 20 –48 dung flies collected from several sites in Cheshire, UK. Observed and expected heterozygosities varied between 0.195 and 0.900 and 0.335 –0.842, respectively. These markers should allow us to investigate postcopulatory sexual selection processes in this fly much more fully than has been possible in the past. Keywords: microsatellite, Scathophaga stercoraria, Scatophaga sperm competition, yellow dung fly Received 12 August 2004; revision accepted 2 September 2004 The yellow dung fly, Scathophaga (Scatophaga) stercoraria, has served as a model system for examining the mechanisms behind sperm competition in species with internal fertilization (Parker 1970; Hosken 1999). Paternity relates to copula duration in S. stercoraria (Parker 1970), which in turn relates linearly to the amount of sperm transferred (Simmons et al. 1999). The relative quantities of product of (microsatellite) alleles after polymerase chain reaction (PCR) may be used to compare the proportions of stored sperm in females (on completion of oviposition after mating with two males) with the proportions of progeny from each male. Significant fertilization skews may be attributed to cryptic female choice if random processes arising from incomplete sperm mixing can be discounted (Harvey & Parker 2000). Garner et al. (2000) characterized eight dinucleotide microsatellite loci for S. stercoraria, however, these loci may be unsuitable for estimating genotype proportions from PCR product ratios since dinucleotide microsatellite loci commonly produce stutter bands. As part of an effort to better understand postcopulatory sexual selection processes we developed a panel of trinucleotide microsatellite loci that typically amplify single peaks and could be used for ‘quantitative PCR’. We constructed two partial genomic libraries that were enriched for (CAG) and (TGG/CAA) motifs using Correspondence: Phill Watts. Fax: 44 (0) 151 795 4512; E-mail: p.c.watts@liv.ac.uk genomic DNA extracted (see Sunnucks & Hales 1996 for protocol) from the muscle tissue of 40 adult dungflies. For each library, 40 units of Sau3AI (Boehringer-Mannheim) were used to digest 8 –10 µg of genomic DNA that was ligated to 50 pmol of phosphorylated linkers (S61 5′-GGCCAGAGACCCCAAGCTTCG-3′ annealed to S62 5′-PO4-GATCCGAAGCTTGGGGTCTCTGGCC-3′ Refseth et al. 1997). DNA fragments between 500 and 1000 bp were excised from a 1.8% NuSieve GTG agarose gel (FMC Bioproducts) and purified using a QIAquick gel extraction kit (Qiagen). Full details of the enrichment procedure (based on Gardner et al. 1999) are provided elsewhere (Bloor et al. 2001); briefly, we hybridized the DNA fragments with M2-80 streptavadincoated magnetic beads (Dynal) that had been incubated with 3′-biotin-labelled (CAG)8 or a mixture of (TGG)8 and (CAA)8 oligonucleotides (MWG Biotech). After a series of differential stringency washes in 2X SSC and 1X SSC, the enriched DNA was made double stranded and amplified in a 25 µL PCR (75 mm Tris-HCl, 20 mm (NH)4SO4, 0.01% (v/v) Tween 20, 0.2 mm each dNTP, 1.5 mm MgCl2, 25 pmol primer S61 and 1.25 units of Taq polymerase (ABgene)). The thermal profile of the PCR was: 95 °C 5 min, 25 –30 × [95 °C 50 s, 56 °C 1 min, 72 °C 2 min], 72 °C 10 min. The DNA was purified using a QIAquick PCR purification kit (Qiagen), ligated into pGEM®-T vector (Promega) and transformed into JM109 E. coli competent cells (Promega). Recombinant clones were identified using © 2005 Blackwell Publishing Ltd P R I M E R N O T E 31 Table 1 Primer sequences and summary polymorphism information for six trinucleotide microsatellite loci isolated from the yellow dung fly, Scathophaga stercoraria. Sample size is 48 for all loci except LIST9-011, which was tested on 20 individuals only. R and Y indicate A or G and C or T, respectively; Ta, annealing temperature (°C); Mg, magnesium chloride concentration (mm); Na, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; * indicates a significant (P < 0.05, k = 6) heterozygote deficit (after sequential Bonferroni correction, Rice 1989) Locus Accession No. LIST9-004 BV209003 LIST9-011 BV209004 LIST9-012 BV209010 LIST9-015 BV209005 LIST9-018 BV209007 LIST9-020 BV209008 Dye D4 D3 D4 D4 D4 D3 F: Primer sequence (5′−3′) R: CAGCACATTCAACAACTGCAACA CCGCCACCACTGTCATCAAC GCTCAACCGCACAATCAG AATGAAGCCGATGCTCTGTT GTCGTCGTGCAATTACTCTT CTACAGTCGTGCATTACGTT TGTTGCTGGTATGGGTATGC TTGTATGGTGTCAGTGCTGC AATAATGTGCTGATGGCTGC CTAATACAACAACCACCACC ACTAATGGTGGTGGTGTAGG AGGGCTGATGATGATGCTGC black/white screening on S-gal (Sigma) agar/ampicillin plates. Plasmids containing an insert with a microsatellite were identified by two or more amplified products after PCR primed with 50 pmol SP1 and 25 pmol of (nonbiotinylated) microsatellite oligonucleotide [either (CAG)8 (TGG)8 or (CAA)8 see Gardner et al. 1999]. Positive clones were cycle sequenced using Big Dye chemistry (PE Applied Biosystems) and electrophoresis on an ABI377. Primers flanking microsatellites were designed using primer 2 (S.J. Kemp, unpublished). Sequences for 57 clones (out of 84 putative positives identified from 1440 colonies) yielded only 20 distinct microsatellite regions with suitable flanking sequence for primer design. Twelve of the loci for which primer pairs could be designed showed either inconsistent PCR amplification or multiple bands. The remaining loci were tested for polymorphisms using DNA extracted from flight muscle of up to 48 S. stercoraria caught at several sites in Cheshire, UK. Alleles were amplified by PCR in a 10 µL reaction volume on a Dyad DNA engine (MJ Research Inc.). PCR conditions were: 95 °C 1 min; 6 × [95 °C 30 s, Ta °C 30 s, 72 °C 45 s]; 26 × [92 °C 30 s, Ta °C 30 s, 72 °C 55 s]; and 72 °C 10 min; Ta is the annealing temperature at each locus (Table 1). Each reaction contained 75 mm Tris-HCl, 20 mm (NH)4SO4, 0.01% (v/v) Tween 20, 0.2 mm each dNTP, 1.5 – 3.0 mm MgCl2 (Table 1), 10– 50 ng template DNA, 10 pmol each primer and 0.25 units of Taq polymerase (ABgene). The forward primers were 5′ labelled with either D3 or D4 fluorescent dyes (Proligo) (Table 1). PCR products were pooled with a 400 bp (D1) size standard (Beckman Coulter) and separated by capillary electrophoresis through a denaturing acrylamide gel on a Ceq8000XL automated sequencer (Beckman Coulter). Genotypic linkage equilibrium © 2005 Blackwell Publishing Ltd, Molecular Ecology Notes, 5, 30–32 Repeat array (CAR)20 (CAA)2CCA(CAA)9 (CAA)5CAG(CAA)2 (ACC)5N38(GYT)5 GCA(GYT)6 (GYT)3GTG(GYT)8 (GTT)5ATT(GGT)2 Ta (Mg) Clone size (bp) (size range) 55 (3.0) 55 (3.0) 50 (1.5) 55 (1.5) 55 (1.5) 55 (1.5) 216 (195 –228) 152 (129 –153) 170 (160 –178) 228 (228 –234) 142 (121–168) 253 (249 –258) Na 11 9 5 3 11 4 HO (HE) 0.638 (0.596) 0.900 (0.824) 0.521 (0.486) 0.195* (0.335) 0.737 (0.842) 0.311 (0.527) (Fisher’s exact test), observed and expected heterozygosity and also deviations from expected Hardy–Weinberg equilibrium conditions were calculated for each locus using the online (http://wbiomed.curtin.edu.au/genepop/) version (3.1c) of genepop (Raymond & Rousset 1995). Two of the eight loci were monomorphic and are not considered further. None of the polymorphic loci showed significant (α = 0.05, k = 6) linkage disequilibrium (after sequential Bonferroni correction, Rice 1989). The observed number of alleles at the polymorphic loci varied from three up to 11, with the HO and HE varying between 0.195 and 0.900 and 0.335–0.842, respectively (Table 1). One locus (LIST9-015) demonstrated a significant (P < 0.05) heterozygote deficit (Table 1) that may reflect either the presence of null alleles or population subdivision. Genetic variability at these trinucleotide loci is comparable with the level of polymorphism reported for eight dinucleotide microsatellites previously developed for S. stercoraria (Garner et al. 2000). These trinucleotide polymorphic loci should present a panel of genetic markers that may be used to examine postcopulatory sexual selection processes in S. stercoraria much more fully than has been previously possible. References Bloor PA, Barker FS, Watts PC, Noyes HA, Kemp SJ (2001) Microsatellite Libraries by Enrichment. Protocol available at: http:// www.genomics.liv.ac.uk/animal/research/protocols.htm. Gardner MG, Cooper SJB, Bull CM, Grant WN (1999) Isolation of microsatellite loci from a social lizard, Egernia stokesii, using a modified enrichment procedure. Journal of Heredity, 90, 301– 304. Garner TWJ, Brinkmann H, Gerlach G, Meyer A, Ward PI, Spörri M, Hosken DJ (2000) Polymorphic DNA microsatellites identified 32 P R I M E R N O T E in the yellow dung fly (Scathophaga stercoraria). Molecular Ecology, 9, 2207–2208. Harvey IF, Parker GA (2000) ‘Sloppy’ sperm mixing and intraspecific variation in sperm precedence (P2) patterns. Proceedings of the Royal Society of London B, 267, 2537–2542. Hosken DJ (1999) Sperm displacement in yellow dung flies: a role for females. Trends in Ecology and Evolution, 14, 251–252. Parker GA (1970) Sperm competition and its evolutionary effect on copula duration in the fly Scatophaga stercoraria L. Journal of Insect Physiology, 16, 1301–1328. Raymond M, Rousset F (1995) genepop, Version 1.2. Population genetics software for exact tests and ecumenicisms. Journal of Heredity, 86, 249–249. Refseth UH, Fangan BM, Jakobsen KS (1997) Hybridization capture of microsatellites directly from genomic DNA. Electrophoresis, 18, 1519–1523. Rice WR (1989) Analyzing tables of statistical tests. Evolution, 43, 223–225. Simmons LW, Parker GA, Stockley P (1999) Sperm displacement in the yellow dung fly, Scatophaga stercoraria: an investigation of male and female processes. American Naturalist, 153, 302– 314. Sunnucks P, Hales DF (1996) Numerous transposed sequences of mitochondrial cytochrome oxidase I–II in aphids of the genus Sitobion (Hemiptera: Aphididae). Molecular Biology and Evolution, 13, 510–524. © 2005 Blackwell Publishing Ltd, Molecular Ecology Notes, 5, 30–32