Malaria epidemiology in changing scenario and anopheles vector in Ghaziabad district, Uttar Pradesh, India

International Journal of Mosquito Research 2017; 4(6): 56-64 ISSN: 2348-5906 CODEN: IJMRK2 IJMR 2017; 4(6): 56-64 © 2017 IJMR Received: 22-09-2017 Accepted: 24-10-2017 Alka Rani National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Abhishek Gupta Department of Zoology, D.N.P.G College, Railway Road, Meerut, Uttar Pradesh, India Swati Sinha National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Bhupender Nath Nagpal WHO, SEARCO, World Health House, Indraprastha Estate, Mahatma Gandhi Marg, New Delhi, India Himmat Singh National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Kumar Vikram National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Sanjeev Kumar Gupta National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Sucheta Shah Mehta Department of Zoology, MBGPG college, Kumaun University, NH109, Thapa Colony, Haldwani, Uttarakhand, India Aruna Srivastava National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Anup Anvikar National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Rekha Saxena National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Neena Valecha National Institute of Malaria Research, Sector-8, Dwarka, New Delhi, India Correspondence Bhupender Nath Nagpal WHO, SEARCO, World Health House, Indraprastha Estate, Mahatma Gandhi Marg, New Delhi, India Malaria epidemiology in changing scenario and anopheles vector in Ghaziabad district, Uttar Pradesh, India Alka Rani, Abhishek Gupta, Swati Sinha, Bhupender Nath Nagpal, Himmat Singh, Kumar Vikram, Sanjeev Kumar Gupta, Sucheta Shah Mehta, Aruna Srivastava, Anup Anvikar, Rekha Saxena and Neena Valecha Abstract In the past few decades, there have been change in the malaria distribution pattern due to several environmental and manmade conditions including developmental activities. Ghaziabad district, Uttar Pradesh adjoining the capital of India, Delhi once has rural malaria epidemic, but due to developmental activities by urbanization the breeding patterns of Anopheles is changing resulting in changed malaria transmission dynamics. Vector incrimination using ELISA and its confirmation by PCR is done to know the malaria transmission potential of Anopheles mosquito. Only 2.62 % mosquitoes collected were Anopheles spp. along with Culex quinquefasciatus and Aedes spp. 1.17% anopheles mosquitoes were found infected with Plasmodium parasite as detected by ELISA of which 0.58% were confirmed by PCR. Reportedly An. culicifacies acting as vector of malaria since 1976. It is still doing its part in transmission while urban vector An. stephensi which appeared around 2005 is slowly becoming a major vector for malaria transmission in rural as well as urban along with peri-urban. Keywords: Epidemiology, Urbanization, Primary Health Centre (PHC), Vector 1. Introduction Urbanization in India is occurring since 1950s with the industrial revolution. Population living in urban areas was 28.53% in 2001 which increased to more than 31% in 2011 [1]. Urbanization has caused ecological changes which have influenced vector borne diseases by altering breeding places of mosquitoes causing change in their population structure and distribution. Malaria, most unstable vector borne diseases of tropical environment caused by Anopheles mosquito reportedly responsible for around one million cases and thousands of deaths in 2010 [2-4]. With increasing population and urbanization breeding pattern of Anopheles mosquito is influenced causing change in malaria transmission [5]. Normally Anopheles does not breed in polluted water but some have adapted to contaminated water for breeding [6]. Thus to understand malaria transmission there is a need to study malaria vectors and their bionomics. In India about 58 species of Anopheles are reported of which 6, the primary vectors of malaria are i.e. Anopheles culicifacies, An. stephensi, An. dirus, An. fluviatilis, An. sundaicus and An. minimus, 4 are secondary vectors An. annularis, An. varuna, An. jeyporiensis and An. philippinensis. among anopheles vectors, An. culicifacies, alone is responsible for 70-80 % of malaria cases in India [7]. Ghaziabad, a district of Uttar Pradesh is included under National Capital Region and is witnessing fast growing urban population from around 1.5 lakhs in 1951 to more than 31 lakhs in 2011 (Census 2011) with fast-paced development. Similar change in surrounding rural villages like lifestyle, livelihood and waste generation. New urban settlements have been created by filling wetlands and rivers in Ghaziabad city [8]. Ghaziabad once endemic to malaria had around 20,000 malaria cases in 1977 with An. culicifacies as the principal malaria vector (Ghaziabad PHC).There is significant variation in malaria transmission in different areas of the same district of Ghaziabad with old city, new urban areas, developing rural areas and urban areas proximal to Delhi. Increasing population and urbanization has caused ecological changes which are ~ 56 ~ International Journal of Mosquito Research expected to change malaria scenario in Ghaziabad. For malaria intensity assessment it is important to determine human-vector contact. For determining dynamics of malaria transmission in Ghaziabad serological and molecular-based analysis will be done using ELISA to find out extent of infection and further confirmation of positive samples by PCR [9] . Thus this study on the potential of Anopheles mosquitoes in Ghaziabad for malaria transmission by studying serological prevalence of malaria will help in knowing malaria transmission dynamics. important tributary of Yamuna River passes through the center of the city. Annual precipitation of Ghaziabad is 732 mm limited from June to September and temperature ranging from 7°C to 46°C. Ghaziabad has malaria endemicity with An. culicifacies reportedly a primary malaria vector till 2004 [11] and after 2006 An. culicifacies and An. stephensi as principal malaria vector along with other disease-causing mosquitoes Ae. aegypti and Cx. quinquefasciatus [12]. Our study comprises urban, rural and peri-urban parts among 5 PHCs of Ghaziabad district as follows: 2. Materials and methods 2.1 Study area Ghaziabad District lies at the latitude 28°40’north and longitude 77°25’east. It is situated in the northeastern part of National Capital Region. Rapidly urbanizing Ghaziabad city tagged as the 2nd fastest growing city in world [10]. It is in the middle of the Ganga-Yamuna Doab (land between two rivers) having Meerut on North, Bulandshahar & Noida on South, Delhi on West and Hapur on East side. It is well connected with important cities via three national highways NH-58, NH91 & NH-24. The main railway line and two branches of northern railway pass through the City Ghaziabad. This city falls under severe seismic zone (zone IV) by seismic zoning map (India environmental portal report). Hindon River, the Table 1: Areas selected for mosquito collection in Ghaziabad. Type PHC Bhojpur Muradnagar Rural Loni Razapur Periurban Ghaziabad Urban Ghaziabad Villages Manaki Kalchhina Bhanaira Didauli Pachayara Harampur Bhadoli Mathurapur Duhai Sadarpur Ghaziabad city Latitude 28.796224 28.766509 28.857132 28.818787 28.800211 28.772453 28.770723 28.748526 28.741637 28.704469 Longitude 77.570729 77.579055 77.484298 77.514596 77.211614 77.237706 77.429967 77.410741 77.480184 77.486547 28.669156 77.453758 Fig 1: Ghaziabad Map showing PHCs and study sites and torch between 6 am to 11 am in the morning [17] and collected mosquitoes were transferred to test tubes in batches of 8-10. Prior to collection consent was obtained from each house. 5 houses were selected based on the proximity to breeding sites i.e. the houses within 2 km of breeding sites. The collections were done from human dwelling, cattle sheds, and mixed dwellings 2.2 Data Collection Malaria data collected from all the available sources like Primary Health Centers, sites [13] and books [14-16] and from health data of NVBDCP (National Vector Borne Disease Control Programme) and NIMR (National Institute of Malaria Research). 2.3 Mosquito sample collection Mosquitoes were collected from Ghaziabad in Pre-monsoon (April- June), Monsoon (July-September) and Post-monsoon (October-February) seasons from April 2014 to January 2016 using following methods: 2.3.2 The Space spray method Pyrethrum spray/Aerosol was carried out in few suitable human dwellings. It was done after closing all entry and exit points of the room and covering entire floor space with white bed sheets and sprayed with pyrethrum. After waiting for 1015 minutes, mosquitoes were collected from the bed sheets with the help of a pair of fine forceps and transferred to the 2.3.1 The Hand catch method The indoor resting adults were collected by using suction tube 57 International Journal of Mosquito Research labeled Petri-dishes. The collected mosquitoes were stored after drying in silica gel. variants of circumsporozoite protein of Plasmodium vivax; VK 247, VK 210 [5] and Plasmodium falciparum; Pf were incubated with 50 µl of monoclonal antibody solution in each well making this as the first antibody layer. Well were then filled with 200µl of blocking buffer and incubated again for 1hr at RT. After aspiration, the mosquito triturate, positive control and negative control acting as antigen were loaded and incubated again at RT for 2 hrs. Washing of wells was done two times with PBS-Tween and then peroxidase conjugate solution was added. Finally, 100µl of freshly prepared substrate solution prepared from citric acid, OPD (ophenylenediamine dihydrochloride) and H2O2 (Hydrogen peroxide) was added to each well and incubated in dark for 30 min. The plates were then read visually at 405 nm. 2.3.3 Outdoor larva collection Was done from all the expected breeding sites of anopheles mosquitoes like pools, ponds, rivers, agricultural fields, pits, tanks, irrigation channels, drains, rainwater collections, containers, sintex, flower pots etc. For this standard WHO Dipper of 500 ml volume was used for sampling of larva. The immatures in all instars were then allowed to emerge in insectary. The emerged mosquitoes and collected adult mosquitoes were then identified to species level using keys [1821] . 2.3.4 Temperature and relative humidity were recorded using thermo-hydrograph in each selected village and town of all PHCs. 2.5 PCR confirmation of Parasites DNA was extracted from ELISA lysate stored at -20°C following modified phenol-chloroform method. The target DNA was amplified using Multiplex PCR using veriti TM 96 well thermal cycler as described Cuhna et al. The amplification reaction for the Multiplex PCR is as follows: 96°C for 10 min; 30 cycles of 95°C for 1 min, 55°C for 2 min; and 60°C for 30 min. Positive controls were DNA extracted from Plasmodium vivax and P. falciparum prepared from culture. Vials without DNA served as negative controls. The PCR products were fractionated on 1.5 % agarose gel and stained with ethidium bromide and photo documented. 2.4 Detection of parasite by ELISA For ELISA test primary vectors An. culicifacies and An. stephensi were processed individually while secondary vector An. annularis and non-vector An. subpictus were processed in pools of 5-10 following Protocol of Wirtz et al by macerating head and thorax of anopheles mosquito in 100 µl of grinding buffer using pestles. Pestles were rinsed with 150 µl of grinding solution. Pestles were cleaned in between to prevent cross-contamination. Micro titration plates in replicas of 2 Table 2: Primers for PCR Confirmation Plasmodium sp. Plasmodium falciparum Plasmodium vivax Primers [22] 5’CCTGCATTAACATCATTATATGGTACATCT3’) (5’GATTAACATTCTTGATGAAGTAATGATAATACCTT3’) (5’AAGTGTTGTATGGGCTCATCATATG3’) (5’CAAAATGGAAATGAGCGATTACAT3’) Base pair 273 290 3 Results 3.1 Malaria incidence in Ghaziabad 3.1.1 District wise Data from 1977 to 2015 was taken from books [14-16], District Malaria Officer, Ghaziabad and from NVBDCP report. According to this data, malaria cases were highest in 1970s where population was very low (figure 2). Plasmodium vivax remain major contributor to the malaria cases (80-90%). Overall malaria shows decreasing trend in last 38 years with dominating Plasmodium vivax over P. falciparum. No mortality was reported in the given period. 2.6 Entomological data analysis Entomological analysis will be done using following formulas [23] . A. Man Biting Rate The Man Biting Rate of Anopheles mosquitoes was calculated using formula No. of Vector species caught MBR = No. of occupants in rooms sampled 3.1.2 PHC wise Annual parasite incidence (API) was analyzed from 2011 to 2015 in PHCs of Ghaziabad district (figure 3). API shows a different trend in each PHC. Loni and Ghaziabad PHC has similar trend in which malaria cases increased in 2012 and again started decreasing. Bhojpur and Muradnagar has decreased trend of malaria from 2011 onwards. Ghaziabad is an urban area while Loni is proximal to Delhi region. Thus both suspected of this trend temporarily due to increasing urbanization and changing malaria vector and hence malaria transmission. B. Sporozoite Rate The sporozoite rate is calculated from these results using formula No. of Vector species found infected SR = Total No. of Vector species examined C. Entomological Inoculation Rate EIR is calculated from sporozoite rate and Man biting rate using formula. Entomological Inoculation Rate (EIR) = Sporozoite Rate X Man Biting Rate 58 International Journal of Mosquito Research Fig 2: Trend of malaria in Ghaziabad district. Fig 3: Incidence of malaria in PHCs of Ghaziabad in last 5 years from April 2014 to January 2016 is given in table 3. Among Anopheles species, An. subpictus was the most dominating followed by An. annularis (Secondary vector). Among primary vectors An. culicifacies was dominant followed by An. stephensi (Urban Malaria Vector). 3.2 MHD in field survey Out of total 36,170 mosquitoes were collected, of which 949 mosquitoes were Anopheles mosquito i.e. 2.62 %. Other mosquito species collected were Culex quinquefasciatus and Aedes aegypti. The detailed MHD of Anophelines collected Table 3: Man hour density of Anophelines in our field survey. Species An. culicifacies An. stephensi An. annularis An. subpictus An. pulcherrimus An. nigerrimus Total Rural 39(33.91) 12(6.74) 77(42.3) 124(26.5) 0 0 2014 Periurban 15(13.04) 6(3.4) 4(2.2) 59(12.6) 0 0 Urban 1(0.86) 3(1.7) 0(0) 25(5.3) 0 0 Total 55(5.7) 21(2.2) 81(8.5) 208(22) 0 0 Rural 45(39.13) 118(66.3) 98(53.8) 209(44.65) 3 (3.2) 0 949 2015 Periurban 11(9.56) 28(15.73) 3(1.6) 32(6.8) 0 3(3.2) Urban 4(3.47) 11(6.2) 0(0) 19(4.01) 0 0 Total 60(6.3) 157(16.5) 101(10.6) 260(27.4) 3(0.3) 3(0.3) village (Razapur) and one in Kavi Nagar slums. An. stephensi shows infection of 4.5 %( 3/66) from both Plasmodium vivax and Plasmodium falciparum: one from Pachayara (Loni) and two from Bhadoli village (Razapur). Nonvector An. subpictus also shows infectivity of 0.5% (2/399) with Plasmodium vivax in Bhanera village (Muradnagar) and Manaki village (Bhojpur). Among malaria parasites, only 6.25% was Plasmodium falciparum while rest of the parasite was Plasmodium vivax. 3.3 Detection of Plasmodium Parasite For detection of infection with Plasmodium spp., 680 female Anopheles mosquitoes were analyzed by ELISA. The results for ELISA are given in table 4. Of the analyzed specimens, 74 were An. culicifacies: 66 were An. stephensi: 399 were An. subpictus and 141 were An. annularis in which an infection rate of 1.17% (8/680) was found in Ghaziabad district. Of these An. culicifacies shows infection of 4.05 %( 3/74) with Plasmodium vivax; one in Pachayara (Loni), one in Bhadoli Table 4: Detection of Plasmodium parasite in Ghaziabad mosquito samples using ELISA 59 International Journal of Mosquito Research Anopheles species Samples processed Number of ELISA positive Type of positive 1. Anopheles culicifacies 74 3 PV210(1), PV247(1) PV210+PV247(1) 2. Anopheles stephensi 66 3 Pf+PV 247(1) PV210(2) 3. Anopheles subpictus 399 2 PV247(2) 4. 5. Anopheles annularis Total 141 680 0 8 NA S.no. AREA (PHC) Pachayra (Loni)+ Bhadoli (Razapur)+ Kavi Nagar (Ghaziabad M.B) Pachayra (Loni) Bhadoli (Razapur) Bhanera (Muradnagar) Manaki (Bhojpur) % 4.05 4.5 0.5 1.17 malaria recently) [24, 25] by ELISA hence examination of all positive samples is essential. Out of 8 ELISA positive samples, 4 were confirmed to be positive by Multiplex PCR. The Anopheles found positive for Plasmodium vivax of 293 bp DNA. Of these 4 samples; 2 were An. culicifacies (Rural malaria vector) one An. stephensi (Urban malaria vector) and one An. subpictus. 3.4 PCR confirmation of Malaria parasites The mosquitoes identified positive by ELISA were confirmed using PCR. Elisa Lysate of all samples was used for examination i.e. malaria vectors, non-vectors, and secondary vectors. This was done as ELISA has been reported of false positivity or sometimes non-detection of positives. An. subpictus have been found positive (reported vector of Fig 4: Detection of sporozoites in Anopheles Mosquitoes by Multiplex PCR. Lane 1:100bp ladder; Lanes 2-11, test samples; Lane 12, negative control; Lane 13: Positive Control, Plasmodium vivax; Lane 2,4,5,8, P. vivax positive sample showing an amplification of 293 bp. selected based on high vector density and suitable room for collection. Manaki (Bhojpur) has highest biting rate of 6.16 followed by sadarpur. Maximum MBR for An.culicifacies was 1.0 for Kavi Nagar of Urban Ghaziabad followed by Manaki Village (Bhojpur) having MBR of 0.83. An.stephensi has maximum biting rate of 2.0 in Kavi Nagar (Urban) followed by Mathurapur with biting rate of 1.0. Other Anophelines shows maximum biting rate in Sadarpur of Peri-urban Ghaziabad. 3.5 Entomological Analysis 3.5.1 Man Biting Rate (MBR) As observed in table 5, Maximum Man biting rate was found for the areas selected for total catch collection. The sites were Table 5: Man biting rate of Ghaziabad in Monsoon season PHC Type Bhojpur Rural Rural Razapur Rural Muradnagar Rural Razapur Rural Loni Rural Total Ghaziabad Urban Village/ Colony Manaki (2014-15) Kalchhina (2014-15) Mathurapur (2015-16) Bhanaira (2014-15) Bhadoli (2015-16) Pachayara (2014-15) Kavi nagar No. of rooms visited Total No. of occupants No. of fed An. culicifacies MBR/ person No. of fed An. stephensi MBR/ person No. of other fed anophelines MBR/ person Overall MBR/ Person 1 6 5 0.83 1 0.16 31 5.16 6.16 1 3 2 0.66 2 0.66 14 4.66 6 1 5 4 0.8 5 1.0 9 1.8 3.6 1 5 1 0.2 0 0 18 3.6 3.8 1 2 1 0.5 0 0 6 3.0 3.5 1 4 2 0.5 1 0.25 8 2.0 2.75 1 3 3 1.0 6 2.0 7 2.33 4.3 5.3 60 International Journal of Mosquito Research city Ghaziabad Periurban (2015-16) Sadarpur (2014-15) 1 4 0 0 0 0 24 6.0 6 has low density of An. culicifacies yet has sporozoite rate of 5.2 %. Urban Ghaziabad has higher sporozoite rate compared to rural while no infective mosquito was found in peri-urban Ghaziabad. An. culicifacies and An. stephensi are both incriminated as vector of malaria in Ghaziabad with equal potential for malaria transmission. An. subpictus, a non-vector also found positive for Plasmodium in this study as well as in earlier studies [24, 25]. 3.5.2 Sporozoite rate (SR %) Sporozoite rate was calculated in each village and town of rural, urban and peri-urban Ghaziabad as shown in table 7. Pachayara village of Loni shows the highest sporozoite rate(8.3%) followed by Kavi Nagar,Urban(5.2), Bhadoli village of Razapur (3.4 %), Manaki village of Bhojpur(1.75%) and Bhanaira village of Muradnagar(0.4%). Rural Ghaziabad, therefore, contributing 1.07 % to Ghaziabad district in malaria transmission. Urban Ghaziabad (Kavi Nagar slums) although Table 7: Sporozoite rate of Anophelines Village/ Town Bhanaira Rural Didauli Rural Bhadoli Rural Mathurapur Rural Manaki Rural Kalchhina Rural Harampur Rural Pachayra Rural Total Rural Peri-urban (Duhai+Sadarpur) Urban (all paradigms) Total An. culicifacies Number Number examined positive 12 0 18 0 10 1 5 0 11 0 3 0 0 0 10 1 69 2 An. stephensi Number Number examined positive 3 0 1 0 8 2 12 0 2 0 4 0 1 0 2 1 33 3 0 0 0 5 1 33 74 3 66 0 3 An. subpictus Number Number examined positive 106 1 60 0 39 0 42 0 43 1 15 0 0 0 10 0 315 2 An. annularis Number Number examined positive 132 0 0 0 1 0 6 0 1 0 1 0 0 0 0 0 141 0 0.4 0 3.4 0 1.75 0 0 8.3 1.07 75 0 0 0 0 9 0 0 0 5.2 399 2 141 0 1.17 Ghaziabad i.e. 27.56 which states it to be at high risk of malaria. Rural area has lower EIR 4.6 but still at risk of malaria epidemic. Pachayra (Loni) has high EIR of 22.825 hence at high risk of malaria. 3.5.3 Entomological inoculation rate (EIR) EIR is an important parameter to find out the malaria transmission status of an area. Thus each type of Ghaziabad was studied for its EIR. Highest EIR was found to be of urban Table 8: Entomological Inoculation Rate of village/city Type Rural Manaki Mathurapur Bhanaira Bhadoli Pachayra Urban Peri-urban SR% MBR 4.3 6.16 3.6 3.8 3.5 2.75 5.3 6 SR% 1.07 1.75 0 0.4 0 8.3 5.2 0 EIR 4.601 10.78 0 1.52 0 22.825 27.56 0 Fig 5: Relationship of Annual EIR with Incidence and Prevalence in PHCs of Ghaziabad. 61 International Journal of Mosquito Research Fig 6: Rainfall pattern and its Relation with morbidity in Ghaziabad vectors An. culicifacies and An. stephensi are breeding in urban as well as rural while peri-urban has breeding of mainly Aedes aegypti and Culex quinquefasciatus. This may be due to lifestyle changes in rural Ghaziabad storing practices such as cemented tanks, curing tanks, ground tanks and tube-wells which have become breeding places of An. stephensi. Earlier breeding sites for An. culicifacies used to be rivers, canals, ponds which have become polluted completely thus no breeding is occurring in these sites. Pits in rural as well as urban construction sites has become temporary breeding sites during rainy season for An. culicifacies. Peri-urban has either no provision of drainage or improper drainage which results in water stagnation and became suitable breeding site for Culex quinquefasciatus. Aedes aegypti has breeding sites available everywhere from drums, flowerpots, and tires in urban to coolers and plastic tanks in rural, peri-urban and urban. An.stephensi was mainly collected from the rural areas like Mathurapur, Panchayra, Bhanera villages; and Kavi Nagar slums and Viklang colony in urban but in low density. Above results clearly indicates impact of urbanization on breeding and Plasmodium infection of Anopheles Spp. Increase in population, urban area, and urban lifestyle all have influence on breeding and habitats of malaria vector which in turn has changed pattern of malaria transmission. Thus malaria transmission has decreased in Ghaziabad in last few years due to decrease in breeding sites of rural vector and increase in breeding sites of urban vector. Ghaziabad district is at high risk of malaria in both rural and urban and expected to transmit malaria in peri-urban also in the near future. Aedes which is already breeding in high number is cause of dengue in Ghaziabad that had appeared in 2004 (Ghaziabad PHC) and increasing at rapid rate. Other diseases like filaria and chikungunya may also appear if condition prevails. 4 Discussion Ghaziabad used to be a rural district which has witnessed rapid development in last 20 years due to migration from Delhi and all over India. This increasing population and urbanization has caused various ecological changes in Ghaziabad. Earlier Ghaziabad had unstable rural malaria with spurts of cases seasonally (EIR=0-27.56). But with increasing urbanization due to change in breeding pattern of vector of malaria change in malaria transmission is found. A study was conducted for 5 years (2011-2015) to assess risk of malaria in 3 PHCs i.e. Loni, Muradnagar and Bhojpur, Ghaziabad district from rural whereas the Ghaziabad PHC was taken as suburban and urban. Malaria incidence and the prevalence were found maximum for Ghaziabad PHC to the rural PHCs. Month wise data showed transmission from June to October i.e. during monsoon season only. This may be due to the construction boom leading to presence of breeding sites for urban malaria vector An. stephensi that has caused more cases in urban Ghaziabad. Rural Ghaziabad had seasonal breeding sites like pools of water in which An. culicifacies bred and caused seasonal malaria in whole Ghaziabad district. In our study, density of collected mosquitoes during July to October i.e. rainy season was relatively higher. Figure 6 also shows peaks during rainy season and post rains for rural Ghaziabad i.e. from August to October showing maximum cases. While for Ghaziabad PHC peaks of breeding were present irrespective of monsoon, although highest in rainy season showing presence of malaria. Thus rains showed no significant impact on malaria transmission in urban and periurban Ghaziabad. The infection status of different Anopheles mosquitoes in Ghaziabad showed prevalence of two vectors i.e. An. culicifacies and An. stephensi. Plasmodium vivax is contributing majority of malaria cases. Maximum EIR (Entomological Inoculation Rate) was found in urban Ghaziabad i.e. 27.56 further clarifying the fact that urbanization has changed malaria scenario from rural to urban vector responsible for majority of malaria transmission. A non-vector An. subpictus is found positive for Plasmodium vivax infection due to unknown reasons. Further study is needed for its confirmation. An. subpictus is breeding in rural, urban and peri-urban in habitats like pools, polluted water, muddy water at construction sites etc. i.e. this species is omnipresent with maximum density. Currently, both primary 5 Conclusion Malaria has shown a decreasing trend in Ghaziabad in both at district as well as at PHC level. This might be due to decreasing breeding sites of An. culicifacies which breeds outdoors profusely and is capable of high transmission during the post-monsoon season. In addition to this urbanization has reduced the available breeding sites increased the population density in both urban and rural providing more habitat indoors than outside as a result of which container breeder Aedes aegypti is commonly found in the area and dengue cases are being reported every year now. Thus the transmission of 62 International Journal of Mosquito Research malaria which is mainly due to An. culicifacies in last 38 years and still contributing majorly is decreasing very rapid rate. This species appears mainly in rainy season when its breeding sites are present. Another vector of malaria An. stephensi is increasing at a rapid rate due to availability of its man-made breeding sites and has started contributing to the persistent malaria and is suspected to establish as a major vector of the region in years to come. 9. 10. Acknowledgement Authors are thankful to Indian Council of Medical Research (ICMR) for funding and Director, National Institute of Malaria Research for providing laboratory facilities. Author also like to thank all the technical staff and seniors in NIMR for their help and support and Ghaziabad district Health Department for providing epidemiological and entomological data. The work was supported by grant from Indian Council of Medical Research (ICMR), India, under the research fellowship (3/1/3/JRF-2012/HRD-14 (30404)) to Alka Rani. Institute publication committee is acknowledged for giving consent for publication for manuscript vide Approval number 051/2017. 11. 12. 13. 14. Data statement All the data generated is presented here epidemiological data (district wise and PHC wise) except 15. Ethics in publishing All entomological surveys and collections conducted on private lands or in private residential areas were done with the owners'/residents' permission, consent and presence. These studies did not involve endangered or protected species. 16. 17. Declaration in interest Authors show no competing interest 18. Mission Declaration and verification This work has not been published previously and is not under consideration for publication elsewhere. 19. References 1. Singh KN. Urban development in India. Abhinav Publications, 1978. 2. Garcia LS. Malaria. Clin Lab Med, 2010; 30(1):93-129. 3. Das A et al. Malaria in India: the Center for the study of complex malaria in India. Acta tropica, 2011. 4. Jain S, Chugh T. An overview of malaria burden in India and road-blocks in its control. J Clin Diagnostic Res. 2011; 5:915-916. 5. Gutiérrez LA et al. Natural infectivity of Anopheles species from the Pacific and Atlantic Regions of Colombia. Acta tropica, 2008; 107(2):99-105. 6. Sharma V. Urbanization and Vector Borne Diseases Commentary. Malaria Research Center (ICMR), New Delhi, 2001. 7. Ansari M et al. Residual efficacy of deltamethrin 2.5 WP (K-Othrine) sprayed on different types of surfaces against malaria vector Anopheles culicifacies. Southeast Asian J Trop Med Public Health. 1997; 28:606-609. 8. Nagendra H et al. Sub-regional assessment of India: effects of urbanization on land use, biodiversity and ecosystem services, in Urbanization, Biodiversity and 20. 21. 22. 23. 24. 25. 63 Ecosystem Services: Challenges and Opportunities. Springer. 2013, 65-74. Rath A et al. Development, standardization and validation of molecular techniques for malaria vector species identification, trophic preferences, and detection of Plasmodium falciparum. Journal of Vector Borne Diseases. 2017; 54(1):25. Nagendra H et al. Urbanization and its impacts on land use, biodiversity and ecosystems in India. INTER disciplina. 2014; 2(2). Ansari M, Razdan R. Bio-efficacy and operational feasibility of alphacypermethrin (Fendona) impregnated mosquito nets to control rural malaria in northern India. Journal of vector borne diseases. 2003; 40(1-2):33. Mittal P et al. Efficacy of Advanced Odomos repellent cream (N, N-diethyl-benzamide) against mosquito vectors. The Indian journal of medical research. 2011; 133(4):426. In Wikipedia, T.F.E. Ghaziabad, Uttar Pradesh. 10 November 2014. Available from: https://en.wikipedia.org/w/index.php?title=Ghaziabad,_U ttar_Pradesh. Sharma R, Sharma G, Dhillon G. Epidemiology and control of malaria in India. Intervention measures for transmission control. New Delhi: Directorate of the National Malaria Eradication Programme, Ministry of Health and Family Welfare, Government of India, 1996. Service MW. Demography and vector-borne diseases. Boca Raton (Fla.): CRC press, 1989. Sharma G. Review of malaria and its control in India. in Proceeding of the Indo-UK workshop on malaria education. VP Sharma (MRC ICMR Delhi). 1984. WHO. Manual on practical entomology in malaria. Part II. Methods and techniques. World Health Organization Geneva, Switzerland, 1975. Christophers SR. The Fauna of British India, including Ceylon and Burma. Diptera. Vol. IV. Family Culicidae. Tribe Anophelini. The Fauna of British India, including Ceylon and Burma. Diptera. Vol. IV. Family Culicidae. Tribe Anophelini. 1933. Knight K, Stone A. A catalogue of the mosquitoes of the world (Diptera: Culicidae), 2nd edit. Eutornological Society of America, 1977. Nagpal B, Sharma V. Indian anophelines. Science Publishers, Inc, 1995. Christopher S. The Fauna of British India, including Ceylon and Burma, Diptera Taylor and Francis London, 1933; IV:360. Cunha MG et al. Development of a Polymerase Chain Reaction (PCR) method based on amplification of mitochondrial DNA to detect Plasmodium falciparum and Plasmodium vivax. Acta Tropica, 2009; 111(1):35-38. Ebenezer A, Noutcha AEM, Okiwelu SN. Relationship of annual entomological inoculation rates to malaria transmission indices, Bayelsa State, Nigeria. Journal of vector borne diseases. 2016; 53(1):46. Chatterjee S, Chandra G. Role of Anopheles subpictus as a primary vector of malaria in an area in India. Japanese Journal of Tropical Medicine and Hygiene. 2000; 28(3):177-181. Kumari S et al. Vectorial role of Anopheles subpictus grassi and Anopheles culicifacies giles in Angul district, International Journal of Mosquito Research Orissa, India. Southeast Asian Journal of Tropical Medicine and Public Health. 2009; 40(4):713. 64