Research in Veterinary Science 94 (2013) 555–561 Contents lists available at SciVerse ScienceDirect Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc Molecular survey of pathogenic trypanosomes in naturally infected Nigerian cattle Michael I. Takeet a,b,c,⇑, Benjamin O. Fagbemi b, Marcos De Donato a,d, Abdulmojeed Yakubu a,e, Hectorina E. Rodulfo d, Sunday O. Peters a,f, Matthew Wheto f, Ikhide G. Imumorin a,⇑ a Dept. of Animal Science, Cornell University, Ithaca, NY 14853, USA Dept. of Veterinary Microbiology and Parasitology, University of Ibadan, Ibadan, Nigeria c Dept. of Veterinary Microbiology and Parasitology, University of Agriculture, Abeokuta, Nigeria d Dept. of Biomedicine, Universidad de Oriente, Cumana, Venezuela e Dept. of Animal Science, Nasarawa State University, Lafia, Nigeria f Dept. of Animal Science, Berry College, Mount Berry, GA 30149, USA b a r t i c l e i n f o Article history: Received 18 June 2012 Accepted 21 October 2012 Keywords: Cattle Molecular diagnostics Nigeria PCR Trypanosomes a b s t r a c t Microscopy and polymerase chain reaction (PCR) were used to survey pathogenic trypanosome infection in naturally infected Nigerian cattle. In 411 animals sampled, microscopy detected 15.1% positive infection of at least one of Trypanosoma brucei, Trypanosoma congolense or Trypanosoma vivax, while PCR detected 63.7% positive infections of at least one of those species and Trypanosoma evansi. PCR detected 4.4%, 48.7%, 26.0% and 0.5% respectively of T. brucei, T. congolense, T. vivax and T. evansi infections. All of the T. congolense detected were savannah-type, except for two forest-type infections. Prevalence of mixed infections was 13.9%, being primarily co-infection by T. congolense and T. vivax while prevalence of mixed infections by T. evansi, T. vivax and T. congolense was 1.5%. Microscopy showed poor sensitivity but specificity greater than 94%. Infection rates were much higher in Southern than in Northern Nigeria. Infections were lowest in N’dama compared to Muturu, Sokoto Gudali and White Fulani breeds. Animals with T. vivax monoinfection and mixed infections showed significantly lower packed cell volume (PCV) values. Those infected with any Trypanosoma species with <200 parasites/ll showed higher PCV values than those infected with >200 parasites/ll. The new finding of savannah- and forest- type T. congolense in Nigeria and the relatively high abundance of mixed infections are of significant clinical relevance. This study also suggests that T. congolense is the most prevalent species in Nigeria. Ó 2012 Elsevier Ltd. All rights reserved. 1. Introduction Trypanosomosis is a complex infectious disease of animals caused by a range of extra-erythrocytic protozoan parasites of the genus Trypanosoma, responsible for production losses, morbidity and sometime mortality in infected herds (Abenga et al., 2002). The clinical signs of trypanosomosis depend on the species and strain of the infecting trypanosome, breed of the animal involved (Anene et al., 1991a,b; Matioli et al., 1998) and the prevalence of vectors (Leak et al., 1990; Onyiah, 1997; Merkuria and Gadissa, 2011). Clinical signs include anemia, intermittent fever, parasitaemia, lymphadenopathy, jaundice, progressive emaciation, loss of production, weakness and death, if left untreated (Akinwale ⇑ Corresponding authors. Addresses: Dept. of Veterinary Microbiology and Parasitology, Federal University of Agriculture, Abeokuta, Nigeria. Tel.: +234 (803) 7872682 (M.I. Takeet), Dept. of Animal Science, 267 Morrison Hall, Cornell University, Ithaca, NY 14853, USA. Tel.: +1 (607) 255 2850; fax: +1 (607) 255 9829 (I.G. Imumorin). E-mail addresses: takeetm@yahoo.com (M.I. Takeet), igi2@cornell.edu (I.G. Imumorin). 0034-5288/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rvsc.2012.10.018 et al., 1999; Merkuria and Gadissa, 2011). While Muturu and N’dama are considered trypanotolerant breeds because they strive well under the pressure of trypanosome infections, they act as reservoirs of the infection for other animals (Moloo et al., 1992). In Nigeria, diagnosis of bovine trypanosomosis largely depends on parasitological and immunological methods. Parasitological techniques have significant limitations exemplified by inability to differentiate between Trypanosoma brucei and Trypanosoma evansi except through the molecular composition of their kinetoplast DNA (kDNA) (Artama et al., 1992; Feng-Jun et al., 2007). Within species, parasitological methods can identify Trypanosoma congolense but not sub groups of the parasite. Hence, this technique lacks the sensitivity and the precision required for the purpose of adequate therapeutic and prophylactic control measures, exacerbated by a high proportion of false negative results. Immunological techniques (i.e. enzyme linked immunosorbent assays, card agglutination and fluorescent antibody tests) on the other hand are good for large scale epidemiological studies (Greiner et al., 1997) but not sensitive enough to detect and differentiate between current and previous infections, also leading to false positive results (Desquesnes and Tresse, 1996). Molecular technique such as polymerase chain 556 M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 reaction (PCR) has shown to be more sensitive and precise than the aforementioned techniques (Moser et al., 1989; Pinchbeck et al., 2008). This technique, though expensive and relatively new to certain parts of Africa, is so sensitive that parasitaemia as low as 10 parasites per milliliter of blood can be detected using PCR (Desquesnes and Davila, 2002; Delespaux et al., 2003). Due to its sensitivity, it has been used in some parts of Africa to ascertain the incidence, prevalence and characterization of trypanosome strains (Solano et al., 1999; Mugittu et al., 2001; Simukoko et al., 2007; Balmer and Caccone, 2008; Cordon-Obras et al., 2009). However, only Trypanosoma vivax Y58 strain, a field isolate with unknown isolation year (Feng-Jun et al., 2007) has been characterized in Nigeria (Morlais et al., 2001). The prevalence of trypanosomosis has been extensively studied using parasitological and immunological methods in Eastern and Northern parts of Nigeria (Daniel et al., 1993; Kalu, 1995; Kalu and Lawani, 1996; Abenga et al., 2004; Oluwafemi et al., 2007; Ezeani et al., 2008; Qadeer et al., 2008; Enwezor et al., 2009; Kamani et al., 2010). The only recent records of trypanosomosis in the Western part of the country are 3.9% and 36.8% prevalence in Ogbomoso, Oyo and Ogun states, respectively (Ameen et al., 2008; Sam-Wobo et al., 2010). The use of PCR as a better diagnostic tool to ascertain the incidence and prevalence of trypanosomosis has been advocated (Desquesnes and Tresse, 1996; Miyamoto et al., 2006; El-Metanaway et al., 2009) but has not yet been applied in Nigeria. The present study was designed to determine the prevalence and characteristics of trypanosome species and strains in Nigerian cattle using PCR for the first time. 2. Materials and methods 2.1. Study population and sample collection Random sampling was not possible due to lack of data on national reference census of nomadic herds. Therefore, working with owners, sampling was carried out on selected cattle herds in areas where cattle converge to rest during migration. Two major abattoirs were used for sampling. The animals to be sampled were selected by systematic random sampling technique whereby the sampling interval (j) is computed as the study population size divided by the required sample size and the first study subject is chosen randomly from among the first j study subjects, then every jth study subject after that is included in the sample (Dohoo et al., 2009). A total of 411 cattle (129 males and 282 females) ranging in age from 9 months to 6 years consisting of Muturu (112), N’dama (31), Sokoto Gudali (68) and White Fulani (200) breeds were sampled in Ogun and Kaduna states (Southern and Northern regions respectively). Animals aged one and under were considered young calves, while those over one year were regarded as adults. Animals with histories of recent trypanocidal treatment and those from institutional farms were excluded from the study. Age was determined by dentition and for the purpose of this study the body conditions were assessed and scored as described by Nicholson and Butterworth (1986). Blood samples were collected from the jugular vein of each animal into 5 ml tubes containing ethylenediaminetetraacetic acid (EDTA) as anticoagulant. The samples were transported in a mobile refrigerator to the laboratory within 3 h of collection, and were stored at 4oC prior to DNA extraction. 2.2. Parasitological diagnosis From each tube containing anticoagulant, blood was transferred into three capillary tubes which were sealed at one end with plasticine. The capillary tubes were spun in a microhaematocrit centri- fuge at 10,000 rpm for 3 min. After centrifugation, the packed cell volume (PCV) was determined. The buffy coat and upper most layers of red blood cells of one capillary tube were extruded onto a microscope slide and examined with a phase-contrast microscope at 400 magnification (Murray et al., 1977) for the presence of motile trypanosomes. At least 50 fields were examined before positive or negative was declared for each sample. Positive samples were further processed as thin smear stained with Giemsa for trypanosome species identification. Thick blood smears were also prepared, stained with Giemsa and examined with 100 oil immersion objective lens (1000 magnification). Parasitaemia was determined as described by Hebert and Lumsden (1976). 2.3. DNA extraction DNA was extracted from the blood using Quick-gDNA™ MiniPrep (Zymo Research Corporation, Irvine, CA, USA) as described by the manufacturer. Briefly, 400 ll of genomic lysis buffer was added to 100 ll of blood, thoroughly mixed and incubated at room temperature for 5–10 min. The mixture was transferred to a spin column in a collection tube and centrifuged at 10,000  g for 60 s after which the collection tube with the flow through was discarded and the spin column transferred to a new collection tube. A volume of 200 ll of prewash buffer was added to the spin column and centrifuged at 10,000  g for 60 s, after which 500 ll of genomic DNA wash buffer was added to the spin column and centrifuged at 10,000  g for 60 s. The soluble DNA was eluted into 50 ll nuclease free water from the spin column into a clean 1.5 ml microcentrifuge tube, incubated at room temperature for 2–5 min and centrifuged at 16,000  g for 30 s. Quantification of DNA yield and assessment of quality were done using Nanodrop ND-100 UV/Vis Spectrophotometer (Nanodrop Technologies, Inc., DE, USA). The eluted DNA was stored at 20 °C until use. 2.4. Primer sets and optimization Polymerase chain reaction (PCR) primers were selected for optimization based on previously published work. These primers were optimized with DNA extracted from the blood of cattle parasitologically positive for T. vivax, T. congolense, T. brucei and T. evansi which led to final selection of six primer sets for this study. Details of primer sets are presented in Table 1. 2.5. Trypanosome detection by PCR PCR amplification was performed in 20 ll final reaction volume containing equivalent of 20 ng of genomic DNA, 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 50 lM KCl, 200 lM each of dNTPs, 40 ng of each of the primers and 1unit of Taq DNA polymerase (Bioneer, Inc. Alameda, CA USA). The reactions were placed in a C-1000 series thermocycler (Biorad, Hercules, CA, USA). The reaction conditions were as follows: T. brucei and T. evansi; Initial denaturation at 94 °C for 4 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min; and final extension at 72 °C for 5 min. T. congolense; initial denaturation at 94 °C for 4 min followed by 35 cycles of 94 °C at 30 s, 60 °C for 30 s and 72 °C for 30 s with final extension at 72 °C for 5 min. T. vivax; initial denaturation at 94 °C for 4 min followed by 35 cycles of 94 °C for 30 s, 60 °C for 45 s and 72 °C for 30 s followed by final extension at 72 °C for 5 min. Ten microliters of the PCR products were electrophoresed through 1% agarose gel in 1 TBE (89 mM Tris, 89 mM boric acid 1 mM EDTA) at 90 V for 80 min. along with 10 ll of GENEMate Quanti-Marker 100 bp DNA ladder (BioExpress, Kaysville, UT, USA). Gels were stained with GelRedÒ Nucleic Acid Stain (Phenix Research Products, Candler, NC, USA) at 5 ll/100 ml of the agarose gel suspension. After electrophoresis, PCR products were 557 M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 Table 1 Sequences of the oligonucleotide primers used in this study and their expected fragment sizes. Primer set Species Sequences Expected sizes References TBR 1 TBR 2 TBR 1⁄ TBR 2⁄ TCS 1 TCS 2 TCF 1 TCF 2 TCK 1 TCK 2 ILO1264 ILO1265 T. evansi GAATATTAAACAATGCGCAG CCATTTATTAGCTTTGTTGC CGAATGAATAAACAATGCGCAGT AGAACCATTTATTAGCTTTGTGC CGAGCGAGAACGGGCAC GGGACAAACAAATCCCGC GGACACGCCAGAAGGTACTT GTTCTCGCACCAAATCCAAC GTGCCCAAATTTGAAGTGAT ACTCAAAATCGTGCACCTCG CAGCTCGCCGAAGGCCACTTGGCTGGG TCGCTACCACAGTCGCAATCGTCGTCTCAAGG 164 bp Masiga et al. (1992)) 177 bp Sloof et al. (1983) 316 bp Majiwa and Otieno (1990) 350 bp Masiga et al. (1992) 294 bp Masiga et al. (1992) 400 bp Masake et al. (1997) T. brucei T. congolense savannah-type T. congolense forest-type T. congolense kilifi-type T. vivax TBR 1⁄ & TBR 2⁄; the primer set has different sequences from TBR1&2. visualized on a UV transilluminator and were photographed using an AlphaImager HP System (Protein Simple, Santa Clara, CA, USA). All positive samples were tested twice to confirm the PCR diagnosis and positive and negative (no DNA) samples were used as controls in each run. 2.6. DNA sequencing and sequence analysis To confirm and validate our results, five positive samples each of T. vivax, T. congolense savannah, T. brucei and the two positive samples each for T. evansi and T. congolense forest were selected. The PCR products of T. vivax and T. congolense (savannah and forest subgroups) were sequenced directly using Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) with the forward amplification PCR primers and AmpliTaq-FS DNA Polymerase while 30 ll of the PCR products of T. brucei and T. evansi were purified from the agarose gel using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research Corporation, Irvine, CA, USA) and then sequenced as described above. The sequences obtained were viewed and compared on Finch Trace Viewer and Sequence Scanner (Applied Biosystems, Foster City, CA, USA) before they were aligned with each other and with published sequences of various Trypanosoma species from GenBank using the Molecular Evolutionary Genetic Analysis software (MEGA 5.05). 2.7. Statistical analysis The data were summarized using descriptive statistics. Prevalence of trypanosomes in studied cattle using parasitological and molecular techniques were compared statistically using Student’s t-test (paired t-test) while the difference in the mean PCV values and the prevalence of infections within breeds of cattle were compared using one-way ANOVA using SPSS version 19 software. 3.2. Parasitological and molecular (PCR) detection of parasites Parasite detection by microscopy observation showed 62 samples infected by one or more species of Trypanosomes, for a prevalence of 15.1% (95% CI, 12–18%). T. vivax was seen more frequently, followed by T. congolense and T. brucei (Table 2). However, PCR detection showed 262 samples infected by one or more species of Trypanosoma, for an overall prevalence of 63.7% (95% CI, 59.4– 68.8%) and T congolense was the most prevalent 48.7% (95% CI, 4.2–54.3%), T. congolense was also the species most often missed by microscopy observation, followed by T. vivax 26.0% (95% CI, 21.8–31.1%) and T. brucei 4.4% (95% CI, 3.3–7.1%) (Table 3). All of the T. congolense detected were savannah-type, except for 2 samples which were single infections by T. congolense forest-type (48.2% and 0.5%, respectively). Of those 2 samples, only one was detected by the parasitological method. Additionally, we found 2 samples infected with T. evansi (0.5%), one was also infected with T. vivax and the second was also infected with T. vivax and T. congolense savannah-type. Prevalence of mixed infections was 13.9% (95% CI, 10.6–17.4%) being co-infection by T. congolense and T. vivax. We found 6 samples co-infected by T. brucei, T. vivax and T. congolense savannah-type, and one sample co-infected by T. evansi, T. vivax and T. congolense savannah-type. No infections by T. congolense Kilifi-type were detected. Parasitaemia in the samples detected by microscopy observation ranged between 1 and 5,600 parasites per ll. Infection by T. congolense had the lowest number of parasites with 60% of the samples showing <10 parasites/ll, compared to T. brucei and T. vivax with only 33.3% and 8.9% of the samples showing <10 parasites/ll, respectively. Mixed infections also showed <10 parasites/ll in 60% of the samples as well. Two T. congolense and 4 T. vivax samples detected by the parasitological method were not detected by PCR. Compared to PCR method as the gold standard of parasite diagnosis, microscopy shows poor sensitivity for detection of all Trypanosoma species (Table 3), but specificity was high in all cases (P94%). 3. Results 3.1. Sequence analysis of the amplified PCR products 3.3. Effect of sex, age and body condition on prevalence of trypanosomosis Using sequences retrieved from GenBank, the aligned T. brucei sequence had 97% homology with the sequence of T. brucei satellite DNA (K00392.1), T. congolense savannah-type had 100% homology with T. congolense IL300 (HE578911.1), T. vivax had 98 and 99% homology with the T. vivax Y486 and T. vivax diagnostic antigen (HE573027.1 and U43183.1), respectively, T. congolense forest type had 94% homology with T. congolense (F) TSW 10 (S50876.1) and T. evansi had 94% homology with T. brucei gambiense (FN554966.1). Prevalence was similar in both sexes, regardless of the type of infection (Table 4). However, age affected the infection rate of T. vivax and mixed infections, being more prevalent in younger animals (less than 1 year old). Prevalence for all Trypanosoma infections were much higher in Ogun state (Southern Nigeria) than in Kaduna state (Northern Nigeria). Cattle with poor body condition showed higher infection rate than cattle in good condition, regardless of the type of infection. N’dama cattle had lower prevalence than 558 M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 Table 2 Comparison of the diagnostic results obtained in this study by parasitological and molecular methods. Microscopy PCR Tb Tc Tv Tb/Tc Tb/Tv Tc/Tv Tb/Tc/Tv Negatives Totals (%) Tb Tc Tv Tb/Tc Tb/Tv Tc/Tv Tb/Tc/Tv Negatives 1 1 1 0 0 0 0 4 5 10 10 0 0 0 0 119 4 5 7 0 0 2 0 36 0 0 1 0 0 0 1 2 0 0 0 0 0 0 0 1 3 1 2 1 0 0 0 39 1 0 0 0 0 0 0 5 0 2 4 0 0 0 0 143 14(3.4) 19(4.6) 25(6.1) 1(0.2) 0(0.0) 2(0.5) 1(0.2) 349(84.9) Totals (%) 7(1.7) 144(35.0) 54(13.1) 4(1.0) 1(0.2) 46(11.2) 6(1.5) 149(36.3) 411 Tb: Trypanosoma brucei, Tc: T. congolense savannah-type, Tv: T. vivax. The two samples infected with T. evansi were not included in this analysis. Table 3 Prevalence of Trypanosoma species in naturally infected cattle in Nigeria, and the sensitivity and specificity of the microscopic detection, using PCR as a gold standard. Parasite T. brucei T. congolense T. vivax Prevalence Sensitivity Specificity Prevalence Sensitivity Specificity Prevalence Sensitivity Specificity Estimated 95% CI Lower 95% CI Upper 4.4 0.17 0.97 48.7 0.07 0.95 26.0 0.10 0.94 3.3 0.04 0.94 44.2 0.04 0.91 21.8 0.06 0.91 7.1 0.42 0.98 54.3 0.11 0.98 31.1 0.18 0.97 the other breeds of cattle. Non-significant differences were found in parasitaemia levels among breeds. 3.4. PCV values of infected and non-infected animals PCV values were affected by the type of infection so that animals with T. vivax monoinfection and mixed infections showed significantly lower PCV values than non-infected animals (Table 5). Animals with T. brucei and T. congolense monoinfections showed no differences in PCV values, compared to non-infected and those infected with T. vivax or mixed infections. Non-infected N’dama cattle showed slightly higher PCV values than the other breeds of cattle without infection. In general, PCV values were lower in infected cattle but only significantly lower in Trypanosoma infected N’dama and White Fulani cattle, compared to non-infected animals of those breeds, respectively (Table 6), while the differences were non-significant between Muturu and Sokoto Gudali cattle. In general, PCV values were different depending on the body condition. PCV in animals with poor condition (28.79% ± 0.61) was on average 16.8% lower than animals with good body condition (34.50% ± 0.28). In addition, animals in good condition and with Trypanosoma infection had a significantly lower PCV value (p < 0.05) than those not infected (34.11 ± 0.34 and 35.13% ± 0.45, respectively), but animals with poor condition did not showed any difference in PCV values between the groups of infected and non-infected (28.79% ± 0.68 and 28.80% ± 0.46, respectively). In addition, PCV values were significantly different in animals infected with Trypanosoma at different levels of parasitaemia, with higher PCV (33.68% ± 0.97) in animals with <200 parasites/ll compared to those with >200 parasites/ll (30.19% ± 1.55). 4. Discussion Existing parasitological and serological diagnostic techniques for screening blood samples to detect and differentiate bovine trypanosomes are not suited to large-scale epidemiological analysis and precise species identification (El-Metanaway et al., 2009; Fernándeza et al., 2009). The results of microscopy screening in this study was 15.1%, which falls within the range of 5.3–18.57% reported in other studies (Kalu and Lawani, 1996; Abenga et al., 2002; Enwezor et al., 2009) in Nigeria and elsewhere in Africa (Mamoudou et al., 2006; Merkuria and Gadissa, 2011). The use of PCR showed a much higher 63.7% prevalence of trypanosome infection in this study, a remarkably higher percentage than previously reported in Nigeria. This underscores the sensitivity of molecular screening based on PCR, and related to the difficulty of microscopic detection of parasites and low levels of parasitaemia in subclinical infections. This corroborates the results of earlier Table 4 The prevalence of trypanosomosis detected by PCR according to sex, geographical regions, age groups, body condition and breed. Factor N Overall prevalence T. congolense T. vivax Mixed infections Sex Male Female 129 282 60.5a 63.5a 48.1a 48.2a 26.4a 24.8a 17.1a 12.8a Age group 61 year >1 year 86 325 59.3a 63.4a 41.9a 49.8a 18.6a 27.1b 4.7a 16.6b Zone Kaduna Ogun 146 265 37.0a 76.6a 39.0a 53.2b 19.9a 28.3b 8.2a 17.4b Body condition Good Poor 340 71 60.7a 71.4b 46.0a 58.6b 23.2a 35.7b 11.7a 25.7b Breed Muturu N’Dama S. Gudali W. Fulani 112 31 68 200 67.0a 29.0b 51.5a 65.5a 45.5a 19.4b 42.6a 52.5a 33.0a 9.7a 22.1a 23.0a 15.2a 0.0a 14.7a 14.0a 411 62.5 48.2 25.3 14.1 Average Values with different superscripts are significantly different (P < 0.05). M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 Table 5 Comparison of the mean PCV values of the Nigerian cattle infected or non-infected with T. brucei, T. congolense and T. vivax. Data from cattle infected with T. evansi was not included because it was found only in two animals infected with other species of Trypanosome. N: number of animal sampled. Type of infection Mean (%) ± SE (N) Non-Infected T. brucei T. congolense T. vivax Mixed infections 35.13 ± 0.45 34.19 ± 1.36 33.97 ± 0.45 32.95 ± 0.69 33.15 ± 0.80 (149)a (7)a,b (144)a,b (54)b (57)b Values with different superscripts are significantly different (P < 0.05). Table 6 Comparison of the mean PCV values of the different Nigerian cattle breeds infected or not infected with Trypanosoma spp. N: number of animal sampled. Cattle breed Non-Infected Mean ± SE (N) Muturu N’Dama Sokoto Gudali White Fulani 34.47 ± 0.99 36.00 ± 1.31 34.75 ± 1.05 35.51 ± 0.61 (37)a (22)a (33)a (69)a Infected Mean ± SE (N) 33.38 ± 0.56 33.33 ± 1.36 33.84 ± 0.89 33.88 ± 0.49 (75)a (9)b (35)a (131)b Values with different superscripts are significantly different (P < 0.05). workers (Desquesnes and Davila, 2002; Delespaux et al., 2003; Karimuribo et al., 2011). The significantly higher prevalence of trypanosomal infections in Ogun State (Southern Nigeria) is consistent with heavy infestation of both obligate (Glossina spp) and mechanical (Tabanids) vectors of trypanosomes (Ahmed, 2004). In western Kenya and Uganda, T. b. brucei and T. b. rhodesiense were found in the CNS of native cattle and were associated with significant mortality (Wellde et al., 1989), hence the detection of T. brucei and T. evansi in Nigerian cattle might portend serious danger not only to cattle and other livestock but also to livestock owners and the communities at large as T. evansi infection has been reported in cattle and humans in India (Laha and Sasmal, 2009; Joshi et al., 2005). Higher prevalence of T. congolense savannah-type followed by T. vivax and T. brucei in this study using molecular methods contrasts with other reports in which T. vivax was reported to have higher prevalence, followed by T. congolense and T. brucei, when using parasitological methods in Nigeria (Anene et al., 1991a,b; Kalu, 1995; Omotainse et al., 2000). But the present findings are in consonance with the report of Ogunsanmi et al. (2000) who reported higher incidence of T. congolense in a survey carried out in Southwestern Nigeria and Merkuria and Gadissa (2011) in Northwestern Ethiopia. This could be related to lower parasitaemia of T. congolense infections compared to those infected with T. vivax in this study. Our parasitological findings agree with the low level of mixed infections detected by parasitological techniques by earlier workers in the country (Kalu, 1995; Abenga et al., 2002; Enwezor et al., 2009). However, PCR results revealed higher levels of mixed infections, consistent with elsewhere in Africa (Pinchbeck et al., 2008). We detected T. congolense riverine forest-type in two of the animals sampled and to the best of our knowledge this is the first report of this subgroup of T. congolense in Nigeria. Lefrancois et al. (1998) also reported this in three animals in Sideradougou, Burkina Faso. The apparently higher prevalence of T. congolense could be an indication that its transmission is highly favored by the obligate cyclical vector or the T. vivax and T. brucei respond better to the trypanocidal drugs, diminazene aceturate and homidium chloride, respectively. It could also be due to over-representation of T. vivax infections through more serious symptoms that induces 559 producers to seek diagnosis and treatment, compared to infections by T. congolense. The highest prevalence of T. congolense savannah type in this study is in partial agreement with Solano et al. (1995) and De La Rocque et al. (1999) who indicated that the savannahtype was predominant in tsetse flies as well as in cattle, but disagrees with their observations that the riverine/forest-type was only present in the vectors since we detected this in two of the cattle studied. While morphological identification error could be responsible for the inability of the PCR assay to detect two T. congolense and four T. vivax – positive animals detected by microscopy in this study, it could also be attributed to high concentration of template DNA that result in inhibition of the PCR amplification processes and or due to primers sets used. Similar observations were reported by Desquenses (1997) and Gonzales et al. (2003) who after diluting sera and blood spot eluate samples, respectively, obtained improvement in PCR detection rates and Gonzales et al. (2003) who were able to amplify T. vivax DNA using a set of new primers (TVW A/B) from four of the samples that were classed as PCR negative when primer sets (TWJ1/2) were used. The PCV results for infected and non-infected cattle are in accordance with the reports of Van den Bossche and Rowland (2001) and Simukoko et al. (2011) who reported that factors such as nutrition affect the PCV of rural cattle. Anemia, one of the cardinal signs of trypanosomosis (Getachew, 2005), could also be caused by other haemoprotozoan parasites and helminthes (Radostits et al., 2007). As a result of this, PCV values alone should not be used as a diagnostic parameter for trypanosomosis, except where diseases causing anemia are unapparent, then low PCV may be a good indicator of trypanosomal infection (Marcotty et al., 2008). Mean PCV of T. vivax-infected and mixed infected were significantly higher than non-infected cattle. T. vivax infection also had more cases of high levels of parasitaemia than infections by T. congolense. While this could be an indication that T. vivax is more pathogenic in cattle than T. congolense and T. brucei, as reported by Anosa (1983) and Saidu et al. (1984), it does not agree with the findings of Sekoni et al. (1990). The high percentage of cases of mixed infections with low levels of parasitaemia may be explained by parasite interactions similar to mixed plasmodium infections of more than one species in human, where some form of cross-species regulation of parasitaemia exists (Bruce et al., 2000; Bruce and Day, 2002, 2003). Trail et al. (1994) and Rowlands et al. (2001) reported significantly low infection rate in calves below 15 months, similar to our findings in which there were significant differences between the prevalence of T. vivax and mixed infections between calves below 12 months and those above one year. This could be due to longer exposure of older animals to the disease vectors and higher chances of being infected and possession of stronger immunity. Although we found lower prevalence in N’dama cattle, a reportedly trypanotolerant breed (Mattioli et al., 1998), similarly low prevalence in trypanotolerant Muturu may be due to high numbers of this breed in Ogun state. This contrasts with twice the prevalence in Kaduna state where Sokoto Gudali and White Fulani are found in higher numbers. Since some of the animals sampled may be crossbreds with trypanotolerant breeds, this could play a role in low parasitaemia levels since crossbred offspring may display appreciable levels of low parasitaemia (Orenge et al., 2011) because there are no structured breeding programs by small cattle producers in Nigeria. In conclusion, this study has shown that PCR can be used effectively in extensive epidemiological surveys to validate carrier status of animal trypanosoma infection in Nigerian cattle. The finding of new subgroup of Trypanosoma spp. in Nigeria and the relatively high abundance of mixed infections are of clinical significance. This study also suggests that T. congolense is the most prevalent species in Nigeria. 560 M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 Acknowledgements We thank the entire staff of the Department of Parasitology and Entomology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria, Nigeria for allowing us to make use of their laboratory and facilities for part of this study, our gratitude especially go to Prof. I. A. Lawal and Dr. O.O. Okubanjo of the same department. This research was funded by Education Trust Fund for Staff Training and Development of the Federal Republic of Nigeria and supported by College of Agriculture and Life Sciences, Cornell University. The approval of visiting scholars MIT and AY to Cornell University by Prof. W. Ron Butler is gratefully acknowledged. References Abenga, J.N., Enwezor, F.N.G., Lawani, F.A.G., Ezebuiro, C., Sule, J., David, K.M., 2002. Prevalence of trypanosomosis in trade cattle at slaughter in Kaduna, Nigeria. Nigerian Journal of Parasitology 23, 107–111. Abenga, J.N., Enwezor, F.N.G., Lawani, F.G., Osue, H.O., Ikemereh, E.C.D., 2004. Trypanosome prevalence in cattle in Lere area in Kaduna State, North central Nigeria. Revue d’elevage et de Medecine Veterinaire des Pays Tropicaux 57 (1– 2), 45–48. Ahmed, A.B., 2004. A peridomestic population of the tsetse fly Glossina palpalis palpalis robineau-desvoidy, 1830 (diptera: glossinidae) at Kontagora town, Niger state, Nigeria. Entomological Vectors 11 (4), 599–610. Akinwale, O.P., Nock, I.H., Esievo, K.A.N., Edeghere, H.U.F., 1999. The effect of experimental T. vivax infection and treatment on the PCV of three breeds of Nigeria goats. Nigeria Journal of Parasitology 20, 27–32. Ameen, S.A., Joshua, R.A., Adedeji, O.S., Raheem, A.K., Akingbade, A., Leigh, O.O., 2008. Preliminary studies on prevalence of ruminant trypanosomosis in Ogbomoso area of Oyo state, Nigeria. Middle-East Journal of Science Research 3 (4), 214–218. Anene, B.M., Chime, A.B., Jibike, G.I., Anika, S.M., 1991a. Prevalence of trypanosomiasis in Zebu cattle at Obudu ranch – a tsetse-free zone in Nigeria. Preventive Veterinary Medicine 10, 257–260. Anene, B.M., Chime, A.B., Jibike, G.I., Anika, S.M., 1991b. Comparative study of clinical signs, haemotology and prevalence of trypanosomosis in Holstein Friesian and White Fulani Zebu cattle exposed to natural infection in a rain forest zone of Nigeria. Angewandte Parasitolgie 32 (2), 99–104. Anosa, V.O., 1983. Diseases produced by Trypanosoma vivax in ruminants, horses and rodents. Zentralblatt fur Veterinarmedizin 30, 717–741. Artama, W.T., Agey, M.W., Donelson, A.E., 1992. DNA comparison of Trypanosoma evansi (Indonesia) and Trypanosoma brucei spp. Parasitology 104, 67–74. Balmer, O., Caccone, A., 2008. Multiple-strain infections of Trypanosoma brucei across Africa. Acta Tropica 107 (3), 275–279. Bruce, M.C., Donnelly, C.A., Alpers, M.P., Galinski, M.R., Barnwell, J.W., Walliker, D., Day, K.P., 2000. Cross-species interactions between malaria parasites in humans. Science 287, 845–848. Bruce, M.C., Day, K.P., 2002. Cross-species regulation of malaria parasitaemia in the human host. Current Opinion in Microbiology 5, 431–437. Bruce, M.C., Day, K.P., 2003. Cross-species regulation of Plasmodium parasitaemia in semi- immune children from Papua New Guinea. Trends in Parasitology 19, 271–277. Cordon-Obras, C., Berzosa, P., Ndong-Mabale, N., Bobuakasi, L., Buatiche, J.N., Ndongo-Asumu, P., Benitol, A., Canol, J., 2009. Trypanosoma brucei gambiense in domestic livestock of Kogo and Mbini foci (Equatorial Guinea). Tropical Medicine and International Health 14 (5), 535–541. Daniel, A.D., Dadah, A.J., Kalejaye, J.O., Dalhatu, A.D., 1993. Prevalence of bovine trypanosomiasis in Gongola state of Nothern Nigeria. Revue d’elevage et de Medecine Veterinaire des Pays Tropicaux 46 (4), 571–574. De La Rocque, S., Bengaly, Z., Michel, J.F., Solano, P., Sidibe, I., Cuisance, D., 1999. Importance des interfaces spatiales et temporelles entre les bovins et les glossines dans la transmission de la trypanosomose animale en Afrique de l’Ouest. Revue d’elevage et de Medecine Veterinaire des Pays Tropicaux 52 (3– 4), 215–222. Delespaux, V., Ayral, F., Geysen, D., Geerts, S., 2003. PCR-RFLP using Ssu-rDNA amplification: applicability for the diagnosis of mixed infections with different trypanosome species in cattle. Veterinary Parasitology 117, 185–193. Desquenses, M., 1997. Evaluation of a simple of PCR technique for the diagnosis of Trypanosoma vivax infection in the serum of cattle in comparison to parasitological technique and antigen-enzyme-linked immune sorbent assay. Acta Tropica 65, 139–148. Desquesnes, M., Davila, A.R.M., 2002. Application of PCR-based tools for detection and identification of animal trypanosomes: a review and prospective. Veterinary Parasitology 109, 213–231. Desquesnes, M., Tresse, L., 1996. Evaluation of sensitivity of PCR for detecting DNA of Trypanosoma vivax with several methods of blood sample preparations. Revue d’elevage et de Medecine Veterinaire des Pays Tropicaux 49 (4), 322–327. Dohoo, I., Martin, W., Stryhn, H., 2009. Veterinary Epidemiology Research, second ed. AVC Inc. Charlottetown, PEI, Canada. El-Metanaway, T.M., El-Beih, N.M., El-Aziz, M.M., Hassanane, M.S., El-Aziz, T.H., 2009. Comparative studies on diagnosis of Trypanosoma evansi in experimentally infected goats. Global Veterinaria 3, 348–353. Enwezor, F.N.C., Umoh, J.U., Esievo, K.A.N., Halid, I., Zaria, L.T., Anere, J.I., 2009. Survey of bovine trypanosomosis in the Kachia Grazing Reserve, Kaduna state, Nigeria. Veterinary Parasitology 159, 121–125. Ezeani, M.C., Okoro, H., Anosa, V.O., Onyenekwe, C.C., Meludu, C.E., Azikiwe, C.C., 2008. Immunodiagnosis of bovine trypanosomiasis in Anambra and Imo states, Nigeria, using enzyme linked immunosorbent assay: zoonotic implications to human health. Journal of Vector Borne Diseases 45, 292–300. Feng-Jun, L., Robin, B., Gasser, B.C., De-Hua, L.A., Filip, C.D., Xing-Quan, Z., ZhaoRong, L., 2007. PCR approach for the detection of Trypanosoma brucei and T. equiperdum and their differentiation from T. evansi based on maxicircle kinetoplast DNA. Molecular and Cellular Probes 21, 1–7. Fernándeza, D., González-Baradata, B., Eleizaldea, M., González-Marcanob, E., Perroneb, T., Mendoza, M., 2009. Trypanosoma evansi: a comparison of PCR and parasitological diagnostic tests in experimentally infected mice. Experimental Parasitology 121 (1), 1–7. Getachew, A., 2005. Trypanosomosis in Ethiopia. Addis Ababa University, Faculty of Veterinary Medicine, Debrezeit, 18–21. Gonzales, J.L., Jones, T.W., Picozzi, K., Cuellar, H.R., 2003. Evaluation of a polymerase chain reaction assay for the diagnosis of bovine trypanosomiasis and epidemiological surveillance in Bolivia. Kinetoplastid Biology and Disease 2, 8. Greiner, M., Kumar, S., Kyeswa, C., 1997. Evaluation and comparison of antibody ELISAs for serodiagnosis of bovine trypanosomosis. Veterinary Parasitology 73 (3–4), 179–205. Herbert, W.J., Lumsden, W.H., 1976. Trypanosoma brucei: a rapid ‘‘matching’’ method for estimating the host’s parasitemia. Experimental Parasitology 40 (3), 27–31. Joshi, P.P., Shegokar, V.R., Powar, R.M., Herder, S., Katti, R., Salkar, H.R., Dani, V.S., Bhargava, A., Jannin, J., Truc, P., 2005. Human trypanosomiasis caused by Trypanosoma evansi in India: the first case report. American Journal of Tropical Medicine and Hygiene 73, 491–495. Kalu, A.U., 1995. Prevalence of trypanosomiasis among trypanotolerant cattle at the lower Benue river area of Nigeria. Preventive Veterinary Medicine 24, 97–103. Kalu, A.U., Lawani, F.A., 1996. Observation on the epidemiology of ruminants trypanosomosis in Kano state Nigeria. Revue d’elevage et de Medecine Veterinaire des Pays Tropicaux 49 (3), 213–217. Kamani, J., Sannusi, A., Egwu, O.K., Dogo, G.I., Tanko, T.J., Kemza, S., Tafark, A.E., Gbise, D.S., 2010. Prevalence and significance of haemoparasites infections in cattle in North-Central, Nigeria. Veterinary World 3 (10), 445–448. Karimuribo, E.D., Morrison, L.J., Black, A., Michael, C., Turner, R., Kambarage, D.M., Ballingall, K.T., 2011. Analysis of host genetic factor influencing African trypanosome species infection in a cohort of Tanzania Bos indicus cattle. Veterinary Parasitology 179, 35–42. Laha, R.E., Sasmal, N.K., 2009. Detection of T. evansi infection in clinically ill cattle, buffaloes and horses using various diagnostic tests. Epidemiology and Infection 137, 1583–1585. Leak, S.G.A., Collardelle, C., Coulibaly, L., Dumont, P., Feron, A., Hecker, P., Dieteren, G.D., Jeannin, P., Minengu, M., Minja, S., Mulatu, W., Nankodaba, G., Ordner, G., Rowland, G.I., Sauverouche, B., Tikubet, G., Trail, J.C.M., 1990. Relationship between tsetse challenge and trypanosome prevalence in trypanotolerant and susceptible cattle. Insect Science and its Applications 11 (3), 293–299. Lefrancois, T., Solano, P., Bengaly, Z., De La Rocque, S., Reifenberg, J.M., Kabore, I., Cuisance, D., 1998. New epidemiological features on animal trypanosomosis by molecular analysis in the pastoral zone of sideradougou, Burkina Faso. Molecular Ecology 7, 897–904. Majiwa, P.A., Otieno, L.H., 1990. Recombinant DNA probes reveal simultaneous infection of tsetse flies with different trypanosome species. Molecular and Biochemical Parasitology 40 (2), 245–253. Mamoudou, A., Zoli, A., Mbahin, N., Tanenbe, C., Bourdanne, Clausen, P.H., Marcotty, T., Van den Bossche, P., Geerts, S., 2006. Prevalence and incidence of bovine trypanosomosis on the Adamaoua plateau in Cameroon 10 years after the tsetse eradication campaign. Veterinary Parasitology 142 (1–2), 16–22. Marcotty, T., Simukoko, H., Berkens, D., Vercruysse, J., Praet, N., Van den Bossche, P., 2008. Evaluating the use of packed cell volume as an indicator of trypanosomal infection in cattle in Eastern Zambia. Preventive Medicine 87, 288–300. Masake, R.A., Majiwa, P.A.O., Moloo, S.K., Makau, J.M., Njuguna, J.T., Maina, M., Kabata, J., ole-MoiYoi, O.K., Nantulya, V.M., 1997. Sensitive and specific detection of Trypanosoma vivax using the polymerase chain reaction. Experimental Parasitology 85, 193–205. Masiga, D.K., Smyth, A.J., Hayes, P., Bromidge, T.J., Gibson, W.C., 1992. Sensitive detection of trypanosomes in tsetse flies by DNA amplification. International Journal for Parasitology 22, 909–918. Mattioli, R.C., Jaitner, J., Clifford, D.J., Pandey, V.S., Verhulst, A., 1998. Trypanosome infections and tick infestations: susceptibility in N’Dama, Gobra zebu and Gobra x N’Dama crossbred cattle exposed to natural challenge and maintained under high and low surveillance of trypanosome infections. Acta Tropica 71 (1), 57–71. Merkuria, S., Gadissa, F., 2011. Survey of bovine trypanosomosis and its vector in Metekel and Awi zones of North West Ethiopia. Acta Tropica 117, 146–151. Miyamoto, C.T., Gomes, M.L., Marangon, A.V., Araújo, S.M., Bahia, M.T., Lana, M., Toledo, M.J., 2006. Trypanosoma cruzi: sensitivity of the polymerase chain reaction for detecting the parasite in the blood of mice infected with different clonal genotypes. Experimental Parasitology 112 (3), 198–201. M.I. Takeet et al. / Research in Veterinary Science 94 (2013) 555–561 Moloo, S.K., Olubayo, R.O., Kabata, J.M., Okumu, I.O., 1992. A comparison of African buffalo, N’dama and Boran cattle as reservoirs of Trypanosoma congolense for different Glossina species. Medical Veterinary Entomology 6 (3), 225–230. Morlais, I., Ravel, S., Grébaut, P., Dumas, V., Cuny, G., 2001. New molecular marker for Trypanosoma (Duttonella) vivax identification. Acta Tropica 80 (3), 207–213. Moser, D.R., Cook, G.A., Ochs, D.E., Bailey, C.P., Mckane, M.R., Donelson, J.E., 1989. Detection of T. congolense and T. brucei subspecies by DNA amplification using PCR. Parasitology 99 (1), 57–66. Mugittu, K.N., Silayo, R.S., Majiwa, P.A., Kimbita, E.K., Mutayoba, B.M., Maselle, R., 2001. Application of PCR and DNA probes in the characterization of trypanosomes in the blood of cattle in farms in Morogoro, Tanzania. Veterinary Parasitology 94, 177–189. Murray, M., Murray, P.K., McIntyre, W.I.M., 1977. An improved parasitological technique for the diagnosis of African trypanosomiasis. Transactions of the Royal Society Tropical Medicine and Hygiene 71, 325–326. Nicholson, M.J., Butterworth, M.H., 1986. A Guide to Condition Scoring of Zebu Cattle. ILCA (International Livestock Centre for Africa), Addis Ababa, Ethiopia, 29. Ogunsanmi, A.O., Ikede, B.O., Akpavie, S.O., 2000. Effect of management, season, vegetation zones and breed on the prevalence of bovine trypanosomosis in Southwestern Nigeria. Israel Journal of Veterinary Medicine 55 (2). Oluwafemi, R.A., Ilemobade, A.A., Laseinde, E.A.O., 2007. The impact of African animal trypanosomosis and tsetse on the livelihood and wellbeing of cattle and their owner in the BICOT study area of Nigeria. Scientific and Research Essays 2 (9), 380–383. Omotainse, S.O., Atawodi, S., Edeghere, H., Oduwoye, L., 2000. Some biochemical changes in ovine with Trypanosoma vivax infection. Journal of African Clinical Experimental Microbiology 1 (2), 103–107. Onyiah, J.A., 1997. African animal trypanosomosis: an overview of the current status in Nigeria. Tropical Veterinarian 15, 111–116. Orenge, C., Munga, L., Kimwele, C., Kemp, S., Korol, A., Gibson, J., Hanotte, O., Soller, M., 2011. Expression of trypanotolerance in N’dama  Boran crosses under field challenge in relation to N’dama genome content. BMC Proceedings (Suppl. 4), S23. Pinchbeck, G.L., Morrison, L.J., Tait, A., Langford, J., Meehan, L., Jallow, S., Jallow, J., Jallow, A., Christley, R.M., 2008. Trypanosomosis in the Gambia: prevalence in working horses and donkeys detected by whole genome amplification and PCR, and evidence for interactions between trypanosome species. BMC Veterinary Research 4, 7. Qadeer, M.A., Danbirni, S., Usman, M., Akogun, O.B., Gundiri, M.A., Bobbo, A.G., 2008. Prevalence of bovine trypanosomiasis in bassa local government area, Plateau state, Nigeria. Nigerian Journal of Parasitology 29 (2), 136–139. 561 Radostits, O.M., Gay, C.C., Hinchcliff, K.W., Constable, P.D., 2007. Vet. Med. In: A Text Book of Diseases of Cattle, Horses, Sheep, Pigs and Goats. tenth ed. Saunders Publishers, Philadelphia, USA, pp. 1536–1596. Rowlands, G.J., Leak, S.G.A., Peregrine, A.S., Nagda, S.M., Mulatu, W., d’Ieteren, G.D.M., 2001. The incidence of new and the prevalence and persistence of recurrent trypanosome infections in cattle in southwest Ethiopia exposed to a high challenge with drug-resistant parasites. Acta Tropica 79 (2), 149–163. Saidu, S.N.A., Abdulkadir, I.A., Akerejola, O.O., 1984. Theileria mutans infection in Nigeria cattle. Tropical Animal Health Production 16, 149–152. Sam-Wobo, S.O., Igenezoa, A.J., Idowu, O.A., Otesile, E.B., Ekpo, U.F., Kehinde, O.O., 2010. Bovine trypanosomosis and its impact on cattle in derived savanna areas of Ogun state, Nigeria. Journal of Public Health and Epidemiology 1 (3), 43–47. Sekoni, V.O., Saror, D.I., Njoku, C.O., Kumi-Diaka, J., Paluwa, G.I., 1990. Comparative haematological changes following Trypanosoma vivax and Trypanosoma congolense infections in Zebu bulls. Veterinary Parasitology 35, 11–19. Simukoko, H., Marcotty, T., Phiri, I., Geysen, D., Vercruysse, J., Van den Bossche, P., 2007. The comparative role of cattle, goats and pigs in the epidemiology of livestock trypanosomosis on the plateau of eastern Zambia. Veterinary Parasitology 147, 231–238. Simukoko, H., Marcotty, T., Vercruysse, J., Van den Bossche, P., 2011. Bovine trypanosomiasis risk in an endemic area of the eastern plateau of Zambia. Research in Veterinary Science 90, 51–54. Sloof, P., Bos, J.L., Konings, A.F.J.M., Menke, H.H., Borst, P., Gutteridge, W.E., Leon, E., 1983. Characterization of satellite DNA in Trypanosoma brucei and Trypanosoma cruzi. Journal of Molecular Biology 167, 1–23. Solano, P., Argiro, L., Reifenberg, J.M., Yao, Y., Duvallet, G., 1995. Field application of the polymerase chain reaction (PCR) to the detection and characterization of trypanosomes in Glossina longipalpis in Ĉote d’Ivoire. Molecular Ecology 4, 781– 785. Solano, P., Michel, J.F., Lefrancois, T., de La Rocque, S., Sidibe, I., Zoungrana, A., Cuisance, D., 1999. Polymerase chain reaction as a diagnosis tool for detecting trypanosomes in naturally infected cattle in Burkina Faso. Veterinary Parasitology 86 (2), 95–103. Trail, J.C.M., Wissocq, N.M., d’Ieteren, G.D.M., Kakiese, O., Mulungo, M., Murray, M., 1994. Patterns of Trypanosoma vivax and Trypanosoma congolense infection differ in young N’Dama cattle and their dams. Veterinary Parasitology 55, 175–183. Van den Bossche, P., Rowland, G.J., 2001. The relationship between the parasitological prevalence of trypanosoma infection in cattle and herd average packed cell volume. Acta Tropica 78, 163–170. Wellde, B.T., Chumo, D.A., Reardon, M.J., Mwangi, J., Asenti, A., 1989. Presenting features of rhodesian sleeping sickness patients in the Lambwe valley. Kenya Annal of Tropical Medicine and Parasitology 1989 (83), 73–89.