Page 1 of 16
Title
Transcriptome profiling data of Botrytis cinerea infection on whole plant Solanum
lycopersicum
Authors
Dhruv Aditya Srivastava 1, Gulab Chand Arya 1, Eswari PJ Pandaranayaka 1, Ekaterina
Manasherova 1, Dov Prusky 2, Yigal Elad 3, Omer Frenkel 3, and Arye Harel*1
1 Department
of Vegetable Research, Institute of Plant Sciences; 2 Department of
Postharvest and Food Sciences, and 3 Department of Plant Pathology and Weed Research,
Volcani Center, 68 HaMaccabim Road, P.O. Box 15159, Rishon LeZion 7505101, Israel
* Correspondence: aryeharel@volcani.agri.gov.il; Tel.: +972-3-968-3644
Page 2 of 16
Abstract
Botrytis cinerea is a foliar necrotrophic fungal-pathogen capable of infecting >580 genera
of plants, is often used as model organism for studying fungal-host interactions. We used
RNAseq to study transcriptome of B. cinerea infection on a major (worldwide) vegetable
crop, tomato (Solanum lycopersicum).
Value to the scientific community. Most previous works explored only few
infection stages, using RNA extracted from entire leaf-organ diluting the expression of
studied infected region. Many studied B. cinerea infection, on detached organs assuming
that similar defense/physiological reactions occurs in the intact plant. We analyzed
transcriptome of the pathogen and host in 5 infection stages of whole-plant leaves at the
infection site. We supply high quality, pathogen-enriched gene count that facilitates
future research of the molecular processes regulating the infection process.
Keyword – Botrytis cinerea, Solanum lycopersicum, Transcriptome, Plant response to
pathogen, Fungus-Plant interaction
Transcriptome Announcement
Botrytis cinerea, is an important pathogen which is commonly used as a model organism
of necrotrophic fungal phytopathogen (Williamson et al., 2007; Dean et al., 2012). B.
cinerea, the causal agent of the gray mold disease, is capable of infecting over 580 genera
including abundantly used crops such as tomatoes, grapevines and berries (Dean et al.,
2012; Elad et al., 2016). The infection affects foliar organs of the plant causing severe
symptoms, such as soft rot, lesions, and fruit drop, ultimately leading to host death.
Tomato, Solanum lycopersicum, is the second major crops in the world,
(http://www.fao.org/land-water/databases-and-software/crop-information/tomato/en/).
The gray mold disease is abundant in greenhouse tomato due to optimal conditions of
high humidity and foliar density (Stall, 1991) and to susceptibility to stem infection that
often follows the pruning of leaves and side shoots.
Page 3 of 16
The importance of obtaining the transcription profiling of B. cinerea infection in
S. lycopersicum (cv. M82). A) Transcriptomics was shown to be a major research tool
used to understand dynamics of underline molecular changes supporting biotic
interactions during the infection process. However many interesting studies of B. cinerea
infection process were directed only to analysis of plant-host transcriptome in
Arabidopsis (Windram et al., 2012), tomato (Vega et al., 2015), tomato fruit (BlancoUlate et al., 2013) and strawberry fruits (Haile et al., 2019). Other studies were focused
on transcript dynamics involved in the plants showing limited analysis of B. cinerea
transcriptome. The transcriptome of B. cinerea infection was previously studied in
various hosts such as: i) lettuce (De Cremer et al., 2013) with less than 80K reads
mapped to each B. cinerea sample of early infection (12, and 24 hpi); ii) wild tomatoes
(Smith et al., 2014) detached leaves with less than 10K reads mapped to B. cinerea in
each of the infection stages; iii) grapevine fruits (Kelloniemi et al., 2015; Haile et al.,
2020); and iv) cucumber late infection stage (96 hpi) (Kong et al., 2015). Few exceptions
that also used high read counts to study the B. cinerea transcriptome were performed in
fruits of grape vine as opposed to leaf tissue in our work (Haile et al., 2020), and in late
infection stage (96 hpi) of cucumber infection which is part of Cucurbitaceae (Kong et
al., 2015) as opposed to 4 infection stages in Solanaceae representative in our study.
Other interesting studies have used high depth sequencing from detached leaves tissue to
explore genetic variability in transcriptomes of 96 B. cinerea isolates at 16 hours post
infection of the Arabidopsis wild-type (Col-0) (Soltis et al 2020) and two mutants with
jasmonate or salicylic acid compromised immunities (Zhang et al. 2019). The authors
acknowledge that although sequence depth is critical to obtain measurements on numbers
of genes, at a certain depth there is a rapid loss of new gene information per unit read,
and it is better to use more samples to obtain better statistical power, as done in this work
by using 3 samples per treatment. B) Previous study of B. cinerea infection on tomato has
illustrated that inhibition of host photosynthetic electron transport was restricted to the
direct vicinity of the infection site (Berger et al., 2004). This work illustrates the
importance of measuring transcription at the infections site, as opposed to extraction of
RNA from entire leave tissue which would dilute expression of interest related to
infection by non infected background. However, distal host responses to B. cinerea
Page 4 of 16
infection (e.g., in the infected organ or in systemic acquired resistance) could play an
important role in plant fungal interactions. Therefore, for studies which are aimed to gain
more holistic understanding of plant defense mechanism it is important to explore
transcriptome in remote regions. C) The danger posed by fungal pathogens is enhanced
by accelerated pathogens evolution mainly due to continues fungicides utilization in
monoculture practice, human or climate dependent dispersal, and their "genomic
plasticity" enabling formation of genetic variations in these phytopathogens that allows
them to adapt quickly to human systems (Raffaele and Kamoun, 2012; Giraldo and
Valent, 2013; Niño-Sánchez et al., 2015; Srivastava et al., 2018). In B. cinerea this
process is reflected by the emergence of isolates which are resistant to several classes of
fungicides in multiple geographical locations (Hahn, 2014; Rupp et al., 2017), and even
in by the emergence of multiple fungicide resistance strains (Elad et al., 2016; Rupp et
al., 2017). Improving our understanding of the infection process using advanced
genomics and transcriptomics technologies (e.g., (Pandaranayaka et al., 2019)), should
facilitate future development of new and existing strategies that will enable to control
plant pathogens.
In this study we supply high quality data of 5 infection stages of B. cinerea strain
B05.10 (Van Kan et al., 1997) on S. lycopersicum (cv. M82), in each stage 3 biological
replicates were used. B05.10 strain used throughout this study was routinely cultured on
Potato dextrose agar (PDA, Difco; adjusted to 2% agar; with 0.25 w/v chloramphenicol,
Sigma) at 18 ºC in dark, unless otherwise specified. Tomato seedlings were routinely
grown in green house at 25°C for 4-5 weeks (under 16/8 hours fluorescent based
light/dark regimes in Green quality soil mix, Tuff soil, Merom Golan, Israel) before
inoculation of whole plants. Plants were transferred to 2 L plastic pots in growth chamber
controlled at 21°C with 16/8 hours of fluorescent based light/dark regimes, acclimatized
for one week before inoculation. Adaxial side of tomato plant leaves were inoculated
with 1000 spores of B. cinerea (six inoculation sites per leaf, four leaves per plant),
suspended in 5 µl of 1/4 PDB (Potato dextrose broth, Difco) to facilitate better
synchronization of spore germination and to achieve infection of 100% of the inoculated
sites (Elad et al., 1994; Srivastava et al., 2018). Disease progression was monitored at 0,
16, 23, 40 and 47 hours post infection (hpi), 23 and 47 hpi measures were taken under red
Page 5 of 16
light one hour before light was turned on. Minor necrotic patches started to appear only at
23 hpi, and establishment of necrotic growth was observed at 40 hpi. Note that the plant
responds to the red light via the phytochrome system, while B. cinerea genome contains
receptors which respond to both red and green light (the latter is often used for sampling
of plants in the dark) (Schumacher, 2017). However, red light was shown to represses
conidiation while green light inhibits conidial germination and mycelial growth which are
pivotal for the infection process of B. cinerea (Schumacher, 2017; Zhu et al., 2013).
Therefore, to obtain minimal effect on fungal virulence, we have used red light in the
sampling procedure. Each biological sample consisted pool of three independent plants
(i.e., separate plants were used for each time point), four leaves per plant (i.e., 12 leaves,
inoculated altogether with 72 spots). For 0 hpi, RNA was extracted from whole leaf with
mock infection (infection medium) immediately taken for extraction and mix with 20%
(by weight) RNA extracted from spores of B. cinerea.
RNA extraction was done following manufacturer's instructions (Norgen,
Canada), followed by DNase treatment (Qiagen, Hilden, Germany). Total RNAs
extractions were tested for quality using nanodrop and subsequently with Bioanalyzer
(Agilent technologies). RNA sample having RIN number >4.1, 260/280 >1.8 and
260/230 >1.9 were used to prepare libraries. Libraries were prepared at the Crown
Genomics institute of the Nancy and Stephen Grand Israel National Center for
Personalized Medicine, Weizmann Institute of Science (G-INCPM). 500 ng of total RNA
for each sample was processed using the in house poly A based RNAseq protocol.
Libraries were evaluated by Qubit and TapeStation. Samples were sequenced on 4 lanes
of Illumina NextSeq machine, using the Single-Read 75 protocol. The output was on
average 32.5 million reads per sample. Altogether, transcriptome of 15 biological
samples was studied, i.e., 3 biological replicates for each infection stage.
Analysis of fungal expression in the course of infection could be hampered by
high enrichment of plant host RNA, which is even higher in early stages of the infection
that hardly contain visible hyphae. Thus, to allow the analysis of fungal expression,
earlier infection stages (up to 16 and 23 hpi), were sequenced with high depth
(approximately 46 million reads/sample), and later infection stages with lower, but still
Page 6 of 16
high depth (approximately 23 million/reads per sample). Reads were trimmed using
cutadapt (Martin, 2011) and mapped to B. cinerea B05.10 genome (Ensembl id
ASM83294v1 (Van Kan et al., 2017)) and S. lycopersicum genomes assemblies
(ITAG3.1 Solanaceae Genomics Network, SGN, http://solgenomics.net/), using STAR
(Dobin et al., 2013) v2.4.2a (using End To End option, and out Filter Mismatch NoverL
max set to 0.04). Approximately 97% of the uniquely mapped reads were counted using
Htseq-count (Anders et al., 2015) (intersection-strict or union mode for fungi or tomato,
respectively). Approximately 23 million reads per sample were mapped to tomato, and
6.7 million reads per sample for fungi (average for all 15 samples in each organism).
Minimum reads that were mapped per sample within each genome were: 7,741,620, and
582,037 for the tomato and the fungi, respectively. Hierarchical clustering based on
RPKM values enabled separating all treatments of tomato and fungi. Multidimensional
scaling (MDS, using limma, R package (Ritchie et al., 2015)), were distances on the
plot are in terms of fold-changes, enabled the separation of treatments of plant and fungal
transcriptomes.
Illustrating expression for of more than 63% of fungal CDSs in early infection
stages (Table 1), this study was able to answer an important challenge of B. cinerea
transcriptome during infection, showing a major increase compared to most other studies
(except e.g., to Haile et al., (2020) that worked on grape vine fruits, and Kong et al.
(2015) which worked on single late infection stage (96 hpi) of cucumber). This study will
assist to shed light on both pathogen infection and defense processes. The presented
fungal transcriptome will help plant pathologist to design experiments aimed to study
fungal genes required for infection. The transcriptome sequence data in this study was
deposited in NCBI sequence read archive with accession numbers: SRR11624722,
SRR11624720, SRR11624721, SRR11624402, SRR11611206, SRR11639198,
SRR11639193, SRR11639196, SRR11639194, SRR11639197, SRR11639195,
SRR11625188, SRR11625189, SRR11625190, and SRR11624505. The Real-time RTPCR validation, and MDS of samples are available in Supplementary Fig. S1-S3, and
Supplementary information file.
Page 7 of 16
Literature Cited
Anders, S., Pyl, P. T., and Huber, W. (2015). HTSeq-A Python framework to work with
high-throughput sequencing data. Bioinformatics 31, 166–169.
doi:10.1093/bioinformatics/btu638.
Berger, S., Papadopoulos, M., Schreiber, U., Kaiser, W., and Roitsch, T. (2004).
Complex regulation of gene expression, photosynthesis and sugar levels by
pathogen infection in tomato. Physiol. Plant. 122, 419–428. doi:10.1111/j.13993054.2004.00433.x.
Blanco-Ulate, B., Vincenti, E., Powell, A. L. T., and Cantu, D. (2013). Tomato
transcriptome and mutant analyses suggest a role for plant stress hormones in the
interaction between fruit and Botrytis cinerea. Front. Plant Sci. 4, 142.
doi:10.3389/fpls.2013.00142.
De Cremer, K., Mathys, J., Vos, C., Froenicke, L., Michelmore, R. W., Cammue, B. P.
A., et al. (2013). RNAseq-based transcriptome analysis of Lactuca sativa infected
by the fungal necrotroph Botrytis cinerea. Plant, Cell Environ. 36, 1992–2007.
doi:10.1111/pce.12106.
Dean, R., Van Kan, J. A. L., Pretorius, Z. A., Hammond-Kosack, K. E., Di Pietro, A.,
Spanu, P. D., et al. (2012). The Top 10 fungal pathogens in molecular plant
pathology. Mol. Plant Pathol. 13, 414–430. doi:10.1111/j.1364-3703.2011.00783.x.
Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., et al. (2013).
STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21.
doi:10.1093/bioinformatics/bts635.
Elad, Y., Köhl, J., and Fokkema, N. J. (1994). Control of infection and sporulation of
Botrytis cinerea on bean and tomato by saprophytic bacteria and fungi. Eur. J. Plant
Pathol. 100, 315–336. doi:10.1007/BF01876443.
Elad, Y., Vivier, M., and Fillinger, S. (2016). “Botrytis, the Good, the Bad and the Ugly,”
in Botrytis – the Fungus, the Pathogen and its Management in Agricultural Systems
(Cham: Springer International Publishing), 1–15. doi:10.1007/978-3-319-233710_1.
Giraldo, M. C., and Valent, B. (2013). Filamentous plant pathogen effectors in action.
Nat. Rev. Microbiol. 11, 800–814. doi:10.1038/nrmicro3119.
Hahn, M. (2014). The rising threat of fungicide resistance in plant pathogenic fungi:
Botrytis as a case study. J. Chem. Biol. 7, 133–41. doi:10.1007/s12154-014-0113-1.
Haile, Z. M., Malacarne, G., Pilati, S., Sonego, P., Moretto, M., Masuero, D., et al.
(2020). Dual transcriptome and metabolic analysis of Vitis vinifera cv. Pinot Noir
berry and Botrytis cinerea during quiescence and egressed infection. Front. Plant
Sci. 10, 1704. doi:10.3389/fpls.2019.01704.
Haile, Z. M., Nagpala-De Guzman, E. G., Moretto, M., Sonego, P., Engelen, K., Zoli, L.,
et al. (2019). Transcriptome profiles of strawberry (Fragaria vesca) fruit interacting
with Botrytis cinerea at different ripening stages. Front. Plant Sci. 10.
doi:10.3389/fpls.2019.01131.
Kelloniemi, J., Trouvelot, S., Héloir, M.-C., Simon, A., Dalmais, B., Frettinger, P., et al.
(2015). Analysis of the molecular dialogue between gray mold ( Botrytis cinerea )
and grapevine ( Vitis vinifera ) reveals a clear shift in defense mechanisms during
berry ripening. Mol. Plant-Microbe Interact. 28, MPMI-02-15-0039.
Page 8 of 16
doi:10.1094/MPMI-02-15-0039-R.
Kong, W., Chen, N., Liu, T., Zhu, J., Wang, J., He, X., et al. (2015). Large-Scale
Transcriptome analysis of cucumber and Botrytis cinerea during infection. PLoS
One 10, e0142221. doi:10.1371/journal.pone.0142221.
Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput
sequencing reads. EMBnet.journal 17, 10. doi:10.14806/ej.17.1.200.
Niño-Sánchez, J., Tello, V., Castillo, V. C. del, Thon, M. R., Benito, E. P., and DíazMínguez, J. M. (2015). Gene expression patterns and dynamics of the colonization
of common bean (Phaseolus vulgaris L.) by highly virulent and weakly virulent
strains of Fusarium oxysporum. Front. Microbiol. 6. doi:10.3389/fmicb.2015.00234.
Pandaranayaka, E. P. J., Frenkel, O., Elad, Y., Prusky, D., and Harel, A. (2019). Network
analysis exposes core functions in major lifestyles of fungal and oomycete plant
pathogens. BMC Genomics 20, 1–15. doi:10.1186/s12864-019-6409-3.
Pontier, D., Miao, Z.-H., and Lam, E. (2001). Trans-dominant suppression of plant TGA
factors reveals their negative and positive roles in plant defense responses. Plant J.
27, 529–538. doi:10.1046/j.1365-313X.2001.01086.x.
Raffaele, S., and Kamoun, S. (2012). Genome evolution in filamentous plant pathogens:
Why bigger can be better. Nat. Rev. Microbiol. 10, 417–430.
doi:10.1038/nrmicro2790.
Ritchie, M. E., Phipson, B., Wu, D., Hu, Y., Law, C. W., Shi, W., & Smyth, G. K.
(2015). Limma powers differential expression analyses for RNA-sequencing and
microarray studies. Nucleic Acids Research, 43(7), e47.
https://doi.org/10.1093/nar/gkv007
Rupp, S., Weber, R. W. S., Rieger, D., Detzel, P., and Hahn, M. (2017). Spread of
Botrytis cinerea strains with multiple fungicide resistance in German horticulture.
Front. Microbiol. 7. doi:10.3389/fmicb.2016.02075.
Schumacher, J. (2017). How light affects the life of Botrytis. Fungal Genetics and
Biology, 106, 26–41. https://doi.org/10.1016/J.FGB.2017.06.002
Smith, J. E., Mengesha, B., Tang, H., Mengiste, T., and Bluhm, B. H. (2014). Resistance
to Botrytis cinerea in Solanum lycopersicoides involves widespread transcriptional
reprogramming. BMC Genomics 15, 334. doi:10.1186/1471-2164-15-334.
Soltis, N. E., Caseys, C., Zhang, W., Corwin, J. A., Atwell, S., & Kliebenstein, D. J.
(2020). Pathogen genetic control of transcriptome variation in the Arabidopsis
thaliana - Botrytis cinerea pathosystem . Genetics, 215(1), genetics.303070.2020.
https://doi.org/10.1534/genetics.120.303070
Srivastava, D. A., Yakubov, M., Feldbaum, R., Tish, N., Shoyhet, H., Manasherova, E.,
et al. (2018). Multiparametric analysis of diversity in Botrytis cinerea isolates from
Israel. Phytoparasitica, 1–13. doi:10.1007/s12600-018-0684-4.
Stall, R. . (1991). Gray mold in compendium of tomato diseases. APS Press. J.B. Jones,
16–17.
Van Kan, J. A. L., Stassen, J. H. M., Mosbach, A., Van Der Lee, T. A. J., Faino, L.,
Farmer, A. D., et al. (2017). A gapless genome sequence of the fungus Botrytis
cinerea. Mol. Plant Pathol. 18, 75–89. doi:10.1111/mpp.12384.
Van Kan, J. A., Van’t Klooster, J. W., Wagemakers, C. A., Dees, D. C., and Van der
Vlugt-Bergmans, C. J. (1997). Cutinase A of Botrytis cinerea is expressed, but not
essential, during penetration of gerbera and tomato. Mol. Plant. Microbe. Interact.
Page 9 of 16
10, 30–38. doi:10.1094/MPMI.1997.10.1.30.
Vega, A., Canessa, P., Hoppe, G., Retamal, I., Moyano, T. C., Canales, J., et al. (2015).
Transcriptome analysis reveals regulatory networks underlying differential
susceptibility to Botrytis cinerea in response to nitrogen availability in Solanum
lycopersicum. Front. Plant Sci. 6, 911. doi:10.3389/fpls.2015.00911.
Williamson, B., Tudzynski, B., Tudzynski, P., and Van Kan, J. A. L. (2007). Botrytis
cinerea: The cause of grey mould disease. Mol. Plant Pathol. 8, 561–580.
doi:10.1111/j.1364-3703.2007.00417.x.
Windram, O., Madhou, P., McHattie, S., Hill, C., Hickman, R., Cooke, E., et al. (2012).
Arabidopsis defense against Botrytis cinerea: chronology and regulation deciphered
by high-resolution temporal transcriptomic analysis. Plant Cell 24, 3530–57.
doi:10.1105/tpc.112.102046.
Zhang, W., Corwin, J. A., Copeland, D. H., Feusier, J., Eshbaugh, R., Cook, D. E.,
Atwell, S., & Kliebenstein, D. J. (2019). Plant–necrotroph co-transcriptome
networks illuminate a metabolic battlefield. ELife, 8.
https://doi.org/10.7554/eLife.44279
Zhu, P., Zhang, C., Xiao, H., Wang, Y., Toyoda, H., & Xu, L. (2013). Exploitable
regulatory effects of light on growth and development of Botrytis cinerea. Journal
of Plant Pathology (Vol. 95, pp. 509–517). Springer.
https://doi.org/10.2307/23721571
Page 10 of 16
eXtra figure titles
Supplementary Figure S1 - Multidimensional scaling (generated by plotMDS, limma
package, R) of all fifteen samples for Botrytis cinerea (B05.10) and Solanum
lycopersicum (cv. M82) (Red 0 hpi , Blue 16 hpi, Green 23hpi, Violet 40 hpi,
Orange 47 hpi). Distances represent leading log2-fold changes between samples.
Supplementary Figure S2 - Infection and sampling point (asterisks indicate sampling
under red light).
Supplementary Figure S3 - Pearson correlation of qPCR of fold change compared with
normalized RPKM.
Supplementary Information – Method used to perform qPCR analysis.
Page 11 of 16
Table 1 - Transcriptome statistics of Botrytis cinerea (B05.10) and Tomato (Solanum lycopersicum cv. M82)
during infection
Total read *
Mapped reads *a
Mapped CDS b
Ref CDS (%) c
d
High Count CDS
Ref high CDS (%)
mapped reads a
Mapped CDS
b
Ref CDS (%) c
d
High Count CDS
Ref high CDS (%)
0 hpi
16 hpi
23 hpi
40 hpi
47 hpi
71,437,565
135,776,539 146,040,697 73,059,701 62,568,364
Botrytis cinerea (B05.10)
2,404,324
6,265,170
29,849,404 35,571,601 23,589,882
(582,037 minimal sample)
10,496
9,870
10,844
11,096
10,916
87.39%
82.18%
90.29%
92.39%
90.89%
9,647
80.32%
9,352
77.87%
8,174
7,671
9,288
68.06%
63.87%
77.34%
Solanum lycopersicum (cv. M82)
49,344,680
(7,741,620 minimal sample) 93,327,812 77,880,059
24,234,150 22,679,766
22,797
24,665
24,259
22,543
22,213
65.36%
70.72%
69.55%
64.63%
63.69%
18,753
53.77%
21,435
61.46%
20,670
59.26%
17,840
51.15%
17,225
49.39%
* Results represent sum of 3 replicates unless otherwise specified.
a Mapped reads - reads which were finally mapped to fungi or tomato.
b Mapped CDS - number of CDS’s having non-zero count for at least one biological replicate.
c Percent of CDS's in reference genomes of B. cinerea and S. lycopersicum.
d High count CDS- CDS’s mapping based only for genes having average count of 10 or more for at least one
biological replicate.
Page 12 of 16
Figure S1
Supplementary Figure S1 - Multidimensional scaling (generated by plotMDS, limma package, R) of all fifteen samples for Botrytis
cinerea (B05.10) and Solanum lycopersicum (cv. M82) (Red 0 hpi , Blue 16 hpi, Green 23hpi, Violet 40 hpi, Orange 47 hpi).
Distances represent leading log2-fold changes between samples.
Page 13 of 16
Figure S2
Supplementary Figure S2 - Infection and sampling point (asterisks indicate sampling under red light).
Page 14 of 16
Figure S3
Supplementary Figure S3 - Pearson correlation of qPCR of fold change compared with normalized RPKM.
Page 15 of 16
Title
Transcriptome profiling data of Botrytis cinerea infection on whole plant Solanum lycopersicum
Authors
Dhruv Aditya Srivastava 1, Gulab Chand Arya 1, Eswari PJ Pandaranayaka 1, Ekaterina
Manasherova 1, Dov Prusky 2, Yigal Elad 3, Omer Frenkel 3, and Arye Harel*1
1
Department of Vegetable Research, Institute of Plant Sciences; 2 Department of Postharvest and
Food Sciences, and 3 Department of Plant Pathology and Weed Research, Volcani Center,
68 HaMaccabim Road, P.O. Box 15159, Rishon LeZion 7505101, Israel
* Correspondence: aryeharel@volcani.agri.gov.il; Tel.: +972-3-968-3644
Keywords: Botrytis cinerea, virulence, pathogenicity, defense mechanisms, Solanum
lycopersicum
Transciptome data was validated for selected B. cinerea genes using Real-time RT-PCR (qPCR)
reactions (based on 3 biological repeats). The qPCR cDNAs were made using Thermo Scientific
Maxima First strand kit (cat- K1671) from 500ng total RNA following manufacturer
instructions. Primer for selected genes were designed based on B. cinerea genome sequence
(Van Kan et al., 2017), and subsequently tested (utilizing BLASTN in the National Center for
Biotechnology Information, NCBI, database) on B. cinerea and S. lycopersicum DNA/cDNA to
make sure that the primers specifically amplify cDNA of the fungal tissue. These PCR products
were sequenced by Sanger sequencing, which was carried out by Hy Laboratories Ltd. (Rehovot,
Israel) on an ABI PRISM 3730xl DNA Analyzer. Real-time RT-PCR (qPCR) reactions were
performed using Dream Taq master mix (Thermo, Massachusetts, United States) on rotor gene
6000 (Corbett, Thermos Fisher, Massachusetts, United States). B. cinerea housekeeping gene
Page 16 of 16
encoding for ubiquitin-conjugating enzyme (UCE) was used as control (Ren et al., 2017). The
Real-time RT-PCR was used to analyze 4 genes (Table S1), for each gene 3 biological repeats
(from different RNA extractions) were tested.
Project overview NCBI link (BioProject id: PRJNA628162):
https://dataview.ncbi.nlm.nih.gov/object/PRJNA628162?reviewer=cpub8ag2dppf443hl705npck5
7
Table S1. Primers used in the study
D_Primer1
D_Primer2
D_Primer3
D_Primer4
D_Primer5
D_Primer6
D_Primer7
D_Primer8
D_Primer9
D_Primer10
Bcin09g02630
Bcin09g02630
Bcin01g04550
Bcin01g04550
Bcin02g01590
Bcin02g01590
Bcin12g01950
Bcin12g01950
Bcin02g04920 - UCE (control)
Bcin02g04920 - UCE (control)
TACAGCCTCGGAAGGTACGA
ACGGACTTCGACCAGTCAAC
GGGCTCTCTCCAAGCAAGTT
ATCTTTACCTGTTGGGGCGG
TTGGCCGGTAGTTGTAGGTC
AAAGTTGGCTGGGTCTCTGG
TGTGGGAGAAGTTGGGGGTA
TATTGCTGAGTGGAGTGGCG
ATCACCCAAACATCAACT
CATAGAGCAGATGGACAA
Literature Cited
Ren, H., Wu, X., Lyu, Y., Zhou, H., Xie, X., Zhang, X., & Yang, H. (2017). Selection of reliable
reference genes for gene expression studies in Botrytis cinerea. Journal of Microbiological
Methods, 142, 71–75. https://doi.org/10.1016/J.MIMET.2017.09.006
Van Kan, J. A. L., Stassen, J. H. M., Mosbach, A., Van Der Lee, T. A. J., Faino, L., Farmer, A.
D., Scalliet, G. (2017). A gapless genome sequence of the fungus Botrytis cinerea.
Molecular Plant Pathology, 18(1), 75–89. https://doi.org/10.1111/mpp.12384