HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Founder von Willebrand factor haplotype associated with
type 1 von Willebrand disease
Lee A. O’Brien, Paula D. James, Maha Othman, Ergul Berber, Cherie Cameron, Colleen R. P. Notley, Carol A. Hegadorn,
Jeffrey J. Sutherland, Christine Hough, Georges E. Rivard, Denise O’Shaunessey, the Association
of Hemophilia Clinic Directors of Canada, and David Lillicrap
To date, no dominant mutation has been
identified in a significant proportion of
patients with type 1 von Willebrand disease (VWD). In this study, we examined 70
families as part of the Canadian Type 1
VWD Study. The entire VWF gene was
sequenced for 1 index case, revealing
2 sequence variations: intron 30
(5312ⴚ19A>C) and exon 28 at Tyr1584Cys
(4751A>G). The Tyr1584Cys variation was
identified in 14.3% (10 of 70) of the families
and was in phase with the 5312ⴚ19A>C
variation in 7 (10.0%) families. Both variants were observed in 2 of 10 UK families
with type 1 VWD, but neither variant was
found in 200 and 100 healthy, unrelated
persons, respectively. Mean von Willebrand factor antigen (VWF:Ag), VWF ristocetin cofactor (VWF:RCo), and factor VIII
coagulant activity (FVIII:C) for the index
cases in these families are 0.4 U/mL, 0.36
U/mL, and 0.54 U/mL, respectively, and
VWF multimer patterns show no qualitative abnormalities. Aberrant VWF splicing
was not observed in these patients, and
both alleles of the VWF gene are expressed as RNA. Molecular dynamic simulation was performed on a homology
model of the VWF-A2 domain containing
the Tyr1584Cys mutation. This showed
that no significant structural changes occur as a result of the substitution but that
a new solvent-exposed reactive thiol
group is apparent. Expression studies
revealed that the Tyr1584Cys mutation
results in increased intracellular retention of the VWF protein. We demonstrate
that all the families with the Tyr1584Cys
mutation share a common, evolved VWF
haplotype, suggesting that this mutation
is ancient. This is the first report of a
mutation that segregates in a significant
proportion of patients with type 1 VWD.
(Blood. 2003;102:549-557)
© 2003 by The American Society of Hematology
Introduction
Studies in the past 2 decades have confirmed that the most common
inherited bleeding disorder in humans is von Willebrand disease
(VWD). Prevalence rate estimates between 0.01% and 1% in the
population have been proposed based on varying diagnostic
definitions.1-5 The 3 criteria required for a diagnosis of type 1 VWD
are history of excessive mucocutaneous bleeding, quantitative or
qualitative abnormalities of von Willebrand factor (VWF), and
family history of the disorder. In general, type 2 VWD, in which
qualitative mutant forms of VWF are present, and type 3 VWD,
which includes a complete absence of VWF from the plasma,
present few, if any, problems in diagnosis. In contrast, type 1 VWD,
which is the most frequent form of the disease and occurs in
approximately 80% of all VWD patients, is characterized by mild
to moderate reductions in normal plasma VWF levels. Type 1
VWD presents a frequent diagnostic dilemma and often requires
repeated laboratory testing before a definitive conclusion can
be reached.
The inheritance pattern of types 1 and 2 VWD is autosomal
dominant, whereas the inheritance pattern of the rare, severe type 3
form of the disease is recessive. Since the cloning of the VWF gene
in 1985,6-9 significant progress has been made in characterizing the
molecular genetic pathology associated with several of the type 2
mutants, and different VWF null alleles have been documented in
type 3 VWD.10-14 In some cases, such as those associated with large
VWF gene deletions, treatment with VWF-containing plasma
concentrates has been complicated by the development of an
anti-VWF antibody response.15,16
In contrast, progress in defining the molecular genetic basis of
type 1 VWD has been slow and frustrating. Indeed, studies in a
mouse model of type 1 VWD have indicated that locus heterogeneity may be associated with this condition and that defects in genes
involved in various aspects of the VWF biosynthetic pathway may
play a role in at least some of the cases of this purely quantitative
trait.17,18 Nevertheless, the VWF gene itself has remained the
primary candidate location for the sequence variation responsible
for the reduced amount of VWF seen in type 1 VWD. There have
been a few sporadic reports of “candidate” type 1 mutations, some
of which represent the heterozygous inheritance of VWF null
From the Departments of Pathology and Chemistry, Queen’s University,
Kingston, ON; the Department of Hematology, Hopital Sainte-Justine,
Montreal, PQ, Canada; and the Department of Haematology, University of
Southampton, United Kingdom.
Investigator of the Heart and Stroke Foundation of Ontario.
Submitted December 9, 2002; accepted March 5, 2003. Prepublished online as
Blood First Edition Paper, March 20, 2003; DOI 10.1182/blood-2002-12-3693.
Supported in part by a Canadian Institutes of Health Research operating grant
(MOP-42467). L.A.O. is supported by a Canadian Blood Services Graduate
Fellowship. P.D.J. holds an Aventis-Behring-CHS-AHCDC Fellowship in
Hemophilia. J.J.S. is supported by a CIHR doctoral research award. D.L. holds
a Canada Research Chair in Molecular Hemostasis and is a Career
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
A complete list of the members of the Association of Hemophilia Clinic Directors
of Canada appears in the “Appendix.”
Reprints: David Lillicrap, Richardson Laboratory, Department of Pathology,
Queen’s University, Kingston, ON, Canada K7L 3N6; e-mail: lillicrap@
cliff.path.queensu.ca.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2003 by The American Society of Hematology
549
550
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
O’BRIEN et al
alleles.19 To address the molecular basis of type 1 VWD in a more
comprehensive manner, a Canadian, population-based study was
recently initiated. In this article, we report, for the first time, a
recurring VWD mutation, Tyr1584Cys, that associates with a
common haplotype in a significant proportion of patients with type
1 VWD.
Patients, materials, and methods
Patients
The study population comprised 70 families from the Canadian Type 1
VWD Study (samples collected in collaboration with the Association of
Hemophilia Clinic Directors of Canada [AHCDC]). Sixty-four percent of
families are of mixed ethnicity from the province of Quebec, and the
remaining families are from other provinces in Canada. Ten additional
families were found through the Haemophilia Centre at the University of
Southampton in the United Kingdom. All participants in this study were
informed about the experimental nature of the study and gave their consent
to take part. This study was approved by the Institutional Review Board at
Queen’s University and at each of the source institutions. In the 12 families
included in this study, at least one member received a diagnosis of type 1
VWD (index case) because of a personal history of excessive mucocutaneous bleeding, von Willebrand factor antigen (VWF:Ag), and ristocetin
cofactor activity (VWF:RCo) between 0.05 and 0.50 U/mL measured on at
least 2 different blood samples. Whole blood samples for DNA extraction
were collected by phlebotomy in 3.2% sodium citrate (at a ratio of 9:1
vol/vol) from the index case and from available immediate family
members, and a plasma sample was collected from the index case for repeat
VWD phenotypic studies to confirm the diagnosis of type 1 VWD.
patient. These tests were repeated on different plasma samples at the
Clinical Hemostasis Laboratory at Kingston General Hospital (Canada),
and the 2 sets of test results were averaged. VWF:Ag was measured by the
IMUBIND VWF enzyme-linked immunosorbent assay (ELISA) kit according to the procedure supplied by the manufacturer (American Diagnostica,
Greenwich, CT). The VWF:RCo was measured by platelet aggregometry
using freshly prepared, washed normal platelets,20 and FVIII:C was measured
using a 1-stage assay.21 All measurements of VWF:Ag, VWF:RCo, and FVIII:C
were made against a non–ABO-matched commercial reference plasma that
had, in turn, been calibrated against the 91-666 or 97-586 World Health
Organization (WHO) Plasma Standard. VWF multimers were analyzed by
electrophoresis using a 1.6% sodium dodecyl sulfate (SDS) agarose gel
followed by electrotransfer to a nylon membrane, and the multimers were
visualized using the chemiluminescent visualization kit from Amersham
Pharmacia Biotech (Baie D’Urfe, PQ, Canada).22
PCR amplification of genomic DNA and mutation identification
A blood sample was collected from the patient, and genomic DNA was
isolated from leukocytes using a salt extraction method.23 DNA corresponding to the coding sequence of exons 2-52 of VWF and the adjacent
exon/intron boundaries and branch sites was amplified by polymerase chain
reaction (PCR). Some primer sequences of interest are found in Table 1;
other primer sequences are available on request from the authors. Using a
DNA thermal cycler (Perkin Elmer Life Sciences, Shelton, CT), DNA was
amplified for 35 cycles of 45 to 60 seconds at 94°C, 45 to 60 seconds at
53°C to 60°C, and 45 to 60 seconds at 72°C, and the amplified products
were sequenced directly on an ABI model 373 automated sequencer (Cortec
DNA Service Laboratories, Kingston, ON, Canada). All DNA sequences
were compared with normal human VWF DNA sequences with the
assistance of Vector NTI Suite software (InforMax, Bethesda, MD).
Canadian blood group O donors were used as a source of normal DNA.
Coagulation studies
RNA isolation and amplification
Laboratory tests for VWF:Ag, VWF:RCo, and factor VIII coagulant
activity (FVIII:C) were performed at the source clinic attended by the
Cytoplasmic RNA was isolated from the patient’s platelets using TRIzol
reagent (Invitrogen, Burlington, ON, Canada) and was reverse transcribed
Table 1. Primers for VWF gene amplification, site-directed mutagenesis, and construction of pBKVWF29-31 (C and A)
Primer, F/R
Purpose
Sequence, 5⬘ ⬎ 3⬘
Location
VWF-HS-nuc802-F (promoter)
SNP analysis
ATAAGAGCTGGAAGTGGAAA
1-802
VWF-HS-prom905-R (promoter)
SNP analysis
AACCTCCTCCCTTCCCACATA
1-1276
8F
SNP analysis
GGTAAGGGCCTCACAAGAT
5-39
8R
SNP analysis
GTGCTGGCAAGGTCTCTGA
5-420
12F
SNP analysis
TTGAGGCCTTTCTCTGATTAA
9-4
12R
SNP analysis
TGCTAAGGGATGGGCTGTG
9-288
13F
SNP analysis
GCTACCATCCTTTTGAGACAC
10-20
13R
SNP analysis
CACCACACAAAGCCATTCTAC
10-312
18F
SNP analysis
GGTCCATTATCTCCTTCACT
15-159
18R
SNP analysis
CCTGCCTACAAGAAAACT
15-423
28AF
SNP analysis
CAGAAGTGTCCACAGGTTCTTC
24-149
28BR
SNP analysis
GCAGGATTTCCGGTGAC
24-1366
28CF
SNP analysis
CCTGAAGCCCCTCCTCCTACT
24-915
28DR
SNP analysis
AGGATTAGAACCCGAGTCG
24-1684
29F
SNP analysis
ATTGCCCTTGTACTCACG
10335*
31R
SNP analysis
ATCCAAAAGTAACCCCAGGC
11340*
42F
SNP analysis
GCACCCTATAGCATAGCTGA
31-3610
42R
SNP analysis
ATAGTTAATAGCCAAGCAGT
31-4227
Sac I exon 29
Plasmid construction
GAGCTCACTGCAGCCAGCCCCTGGAC
25-44
Spe I exon 32
Plasmid construction
ACTAGTCAGAGCACAGTTTGTGGAGGA
26-435
7912F
cDNA amplification
GCTCCCACGCCTACATC
24-502
25-42
99R
cDNA amplification
TGAAAGCCTTGGCGAAACTCT
10767F
cDNA amplification
AACGTGGTCCCGGAGAAA
10767*
VWFex32nt91-R
cDNA amplification
TTCGATTCGCTGGAGCTTCA
26-380
HS-VWF-nt4740-mutagenic G
SDM
CTGGCCCTGCGGT(G)CCTCTCTGACCAC
24-1264
Sequence mismatches with the VWF pseudogene are indicated in bold and polymorphisms found within the VWF gene are indicated in italic; underlined sequences are
engineered restriction enzyme sites. Nucleotide changed in site directed mutagenesis primer is in brackets. Locations of primer are according to Mancuso,24 unless indicated
by* (numbering from25). F indicates forward primers; R, reverse primers; and SDM, site directed mutagenesis.
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
according to the procedure supplied by the manufacturer (Expand Reverse
Transcriptase; Roche, Laval, PQ, Canada). The cDNA was PCR amplified
from exons 28-29 (primers 7912F and 99R) and exons 30-32 (primers
10767F and 32nt91R), and the resultant PCR product was sequenced.
Genotype analysis
A VWF haplotype was derived from restriction enzyme digests of
PCR-amplified fragments of the VWF gene and from the number of
microsatellite repeats found at STR 2 within intron 40. SNPs that were
included in the haplotype included 2 promoter polymorphisms at nucleotides ⫺1185 (G⫹/A⫺, BstUI) and ⫺1051 (A⫹/G⫺, NlaIII), exon 8, aa 318
(T⫹/A⫺, MslI), exon 12, aa 471 (G⫹/A⫺, AatII), exon 13, aa 484
(G⫹/A⫺, RsaI), exon 18, aa 789 (A⫹/G⫺, RsaI), exon 28, aa 1547
(C⫹/T⫺, BstEII), exon 28, aa 1584 (A⫹/G⫺, KpnI), intron 30, nt ⫺18
(A⫺/C⫹, Bsp1286I), exon 42, aa 2413 (C⫹/T⫺, AciI), and STR 2 in
intron 40.26
Site-directed mutagenesis, plasmid construction,
expression, and characterization
To assess whether the 5312⫺19A⬎C sequence variation induces abnormal
splicing, genomic DNA was PCR amplified (Expand Long Template PCR
System; Roche) from the first nucleotide of exon 29 (nt 5054, in cDNA
sequence) to the last nucleotide of exon 32 (nt 5620, in cDNA sequence)
using the primers SacI exon 29 and SpeI exon 32, which have SacI and SpeI
restriction sites engineered at the 5⬘ end of the primers, respectively (Table
1). The 3390-bp PCR product was subcloned into pCR2.1 (Invitrogen,
Carlsbad, CA), and the sequence between intron 30 and exon 31 was
sequenced to confirm the integrity of the amplified product. pCR2.1 was
digested with Bsp1286I to identify plasmids that contained the A (pCR2.1A)
and C (pCR2.1C) nucleotides at intron 30 (5312⫺19A⬎C). Constructs
pCR2.1A and pCR2.1C and the expression vector pBK-CMV (Stratagene,
La Jolla, CA) were digested with SacI and SpeI, and the excised sequence
from exons 29-32 was cloned into pBK-CMV to generate pBKVWF29-32A
and pBKVWF29-32C.
To assess the effect of the Tyr1584Cys sequence variation, site-directed
mutagenesis was performed on the pCIneoVWFES expression vector
(kindly provided by Dr P. Kroner, Medical College of Wisconsin, Milwaukee). A unique EcoRI restriction site was created by Dr Kroner in exon 28 at
codon 4476 of the VWF cDNA. This EcoRI site, in conjunction with the
unique NotI site present in the multicloning region of pCIneoVWFES, was
used to excise the 3⬘ end of the VWF gene that was subsequently subcloned
into the multicloning site of Bluescript to produce the vector Bluescript
VWF EcoRI-NotI. To introduce the A⬎G transition at nucleotide 4751,
site-directed mutagenesis was performed on Bluescript VWF EcoRI-NotI
using the QuikChange MultiSite-Directed Mutagenesis kit (Stratagene)
according to the manufacturer’s procedures (primer listed in Table 1). The
mutant product was sequenced to verify the presence of the Tyr1584Cys
substitution and to confirm the integrity of the amplified VWF gene. The
EcoRI-NotI mutant fragment was excised from Bluescript and ligated back
into pCIneoVWFES to produce the vector pCIneoC1584, and plasmid
DNA was purified for transfection.
COS-7 cells (catalog no. CRL-1651; American Type Culture Collection, Rockville, MD) were cultured in Dulbecco modified Eagle medium
(DMEM) containing 2 mM L-glutamine, 100 U/mL penicillin, 100 g/mL
streptomycin, and 10% (vol/vol) fetal bovine serum (FBS) at 37°C in 5%
CO2. Cells in the log phase of growth were seeded at a density such that
cells were approximately 50% confluent the following day. To assess the
intron 30 (5312⫺19A⬎C) variant, these cells were transfected with 20 g
pBKVWF29-32A, 20 g pBKVWF29-32C, or 10 g each of pBKVWF2932A and pBKVWF29-32C using calcium phosphate.27 Forty-eight hours
after transfection, RNA was extracted with TRIzol reagent and was reverse
transcribed using an oligo-dT primer. cDNA was PCR amplified with
primers SacI exon 29 and SpeI exon 32 to generate a 567-bp fragment that
was subsequently sequenced.
VWF HAPLOTYPE ASSOCIATED WITH VWD
551
To assess the expression of the Tyr1584Cys variant, COS-7 cells were
transfected with 20 g DNA (10 g pCIneoVWFC1584 plasmid, 10 g
pCIneoVWFY1584 plasmid, or 5 g each of these plasmids; 3.2 g gal
reporter construct, and 6.8 g calf thymus DNA) using the method outlined
above. Forty-eight hours after transfection, media were collected and cells
were lysed. Transfection efficiency was determined for each experiment by
measuring gal activity from the gal reporter transcript using a Berthold
Lumat LB 9501 luminometer (Fisher Scientific, Springfield, NJ) and the
Galacto Light Plus reporter gene assay (Tropix, Bedford, MA). The
quantity of recombinant VWF:Ag present in the media and cell lysates was
determined by ELISA using a polyclonal goat antihuman VWF antibody
(Affinity Biologicals, Hamilton, ON, Canada). The standard curve for the
ELISA was generated using CryoCheck normal human reference plasma
(lot no. 7070; Precision Biologicals, Dartmouth, NS, Canada).
Molecular modeling of the Tyr1584Cys variant
A 3-dimensional homology model of the VWF A2 domain has been
developed in our laboratory, based on the crystallographic structures of
homologous domains from the integrins ␣1-1, ␣2-1, ␣L, and ␣M and
from the VWF A1 and A3 domains (J.J.S., manuscript in preparation).
After the replacement of tyrosine with cysteine, a molecular dynamic
simulation was performed to assess the structural change caused by the
mutation. A 10-nanosecond trajectory of the wild-type and mutant proteins
at physiological conditions was obtained with the program NAMD.28
Results
Phenotype
Seventy families with at least one member who received a
diagnosis of type 1 VWD were examined for the Tyr1584Cys
mutation. As we have suggested, there is no consensus regarding a
diagnostic definition for type 1 VWD. In this study, we used
diagnostic criteria in which each of the 12 index cases with the
Tyr1584Cys mutation has a personal history of excessive mucocutaneous bleeding and for whom VWF:Ag and VWF:RCo levels
were documented on at least 2 occasions to be higher than 0.05
U/mL and lower than 0.5 U/mL. Although our study definition of
type 1 VWD did not require a documented family history of the
disorder, many families in the study have several members with
diagnoses of type 1 VWD, which is consistent with a dominant
mode of inheritance. Hemostatic test results from index cases were
calculated from an average of at least 2 sets of studies; separate
samples were analyzed at the source laboratory at which the sample
was drawn and at the Clinical Hemostasis Laboratory at Kingston
General Hospital. Clinical symptoms and plasma levels of VWF:
Ag, VWF:RCo, and FVIII:C for the index cases that have the
Tyr1584Cys mutation are summarized in Table 2, and the mean
levels for the index cases are 0.40 U/mL, 0.36 U/mL, and 0.54
U/mL, respectively. It is of note that the ABO blood group in all but
one of these index cases is type O. The association of lower VWF
levels with type O blood group has been well established, and there
is evidence that approximately 60% of the heritability of plasma
VWF levels is linked to this genetic locus.29 The FVIII:C level of
the index case from family 17 was significantly lower than the
FVIII levels in our other index cases, but DNA sequencing of exons
encoding the VWF FVIII binding domain revealed no sequence
variations previously associated with type 2N VWD. Whether this
patient has coinherited a mild hemophilia A allele or has a novel
FVIII binding mutation at another location in the VWF gene
remains to be resolved. Plasma VWF multimers on index cases
552
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
O’BRIEN et al
Table 2. Laboratory and clinical phenotypic data for propositi in type 1
families with the Tyr1584Cys mutation
VWF:Ag,
U/mL
VWF:RCo,
U/mL
FVIII:C,
U/mL
Blood
group
Sex
2
0.33
0.36
0.62
A
F
a, d
11
0.47
0.38
0.51
O
F
a, b, d
17
0.36
0.32
0.11
O
M
a, b, c, e, f
31
0.33
0.43
0.37
O
F
d, e, f
33
0.47
0.29
0.44
O
M
b, c, e, f
34
0.50
0.31
0.67
O
F
b
49
0.40
0.32
0.71
O
M
b, c
59
0.47
0.44
0.40
O
F
b
66
0.37
0.37
0.56
O
M
c
70
0.42
0.46
1.01
O
F
a, c, d
A*
0.44
0.32
0.74
O
F
b, d, e
I*
0.24
0.36
0.38
O
M
a, b, f
Mean
0.40
0.36
0.54
—
—
Family no.
Symptoms
—
a indicates easy bruising; b, epistaxis; c, prolonged bleeding from wounds;
d, menorrhagia; e, postoperative bleeding; f, bleeding after dental procedure; and
—, not applicable.
*Families from the United Kingdom.
yielded all sizes of multimers at reduced intensity, which is
consistent with the decreased plasma levels of VWF observed in
patients with type 1 VWD. All the index cases exhibited a bleeding
history with one or more of the following symptoms: epistaxis,
menorrhagia, easy bruising, and excessive bleeding from wounds,
especially after surgery and dental procedures (Table 2).
Sequence variations
DNA corresponding to the coding sequence of the VWF gene from
exons 2-52 or 18-52, including exon/intron boundaries and the
intron branch sites, was PCR amplified and sequenced for the index
cases from families 2 and 34, respectively. Families 2 and 34 were
selected for sequence analysis because the index cases in these
families had a clear type 1 phenotype, and the samples from these
patients were among the first we received that had the Tyr1584Cys
mutation. Sequence analysis revealed an additional A⬎C transversion in intron 30 (5312⫺19A⬎C); aside from common polymorphisms, no other sequence variations were observed in either patient.
The A⬎C transversion in intron 30 is located 19 nucleotides
upstream of exon 31. This sequence variation has previously been
recorded as a rare polymorphism in the VWF database (http://
www.shef.ac.uk/VWF/) with a frequency of 1%, and it creates a
restriction enzyme site for Bsp1286I. Restriction enzyme digest
analysis was used to confirm that both patients were heterozygous
for the nucleotide change (Figure 1A). This sequence variation was
not detected in 200 healthy persons (400 VWF alleles); however, it
was identified in both affected sons from family 2 and the mother
from family 34. This sequence variation was also found in the
heterozygous state in affected or undiagnosed members of 5
additional families from the Canadian Type 1 VWD Study. The
frequency of this variation is 0% in the healthy population and 10%
(7 of 70) in the Canadian type 1 VWD families (16 of 150 [10.7%]
affected persons).
The A⬎G transition in exon 28 at nucleotide 4751
(4751A⬎G), which results in the nonconservative amino acid
substitution of Tyr1584Cys, was also found. This sequence
variation has been recorded as a polymorphism in the VWF
database, with a frequency of 2%, and it creates a restriction
enzyme site for KpnI. Restriction enzyme digest analysis was
used to confirm that both patients were heterozygous for the
nucleotide change (Figure 1B). This sequence variation was
detected in every participant with the intron 30 sequence
variation (5312⫺19A⬎C) and in affected family members from
3 additional families. To assess the general population frequency of this change, DNA from 100 healthy persons was
examined. The sequence variation was found in one person;
however, this person may have undiagnosed type 1 VWD
because the plasma VWF:Ag level was found to be 0.5 U/mL on
the single sample available. If this person does have VWD—and
as an encrypted sample from a blood donor population, it is
impossible to confirm or refute this possibility—the frequency
of this variation is 0% in the healthy population tested and
14.3% (10 of 70) in the Canadian Type 1 VWD Study families
(21 of 150 [14.0%] affected participants). Several of the family
members who have the Tyr1584Cys mutation have not had
diagnoses of type 1 VWD. They do, however, have prolonged in
vitro bleeding times or are unavailable or uninterested in further
diagnostic testing. One participant in this study with the
Tyr1584Cys mutation has a normal VWF:Ag level and no
bleeding history. This demonstrates that the Tyr1584Cys mutation does not have complete penetrance. Analysis of 10 families
with type 1 VWD, ascertained at the Haemophilia Centre in
Southampton, United Kingdom, revealed the coexistence of the
5312⫺19A⬎C and 4751A⬎G sequence variations in 2 families.
One member from 1 of these families, with a significantly lower
VWF:Ag level of 0.24 U/mL, was homozygous for the 4751A⬎G
sequence variation.
RNA analysis for the 5312ⴚ19A>C sequence variation
The 5312⫺19A⬎C sequence variation is located at a putative
consensus branch site sequence 19 nucleotides upstream of exon 31
(Figure 2A). The consensus sequence for a splicing branch site is
Py80 N Py80 Py87 Pu75 A100 Py95, where Py is pyrimidine and Pu is
purine; the numbers indicate the percentage of time that particular
base occurs in that position in the consensus sequence.30 The
second-to-last nucleotide in this consensus sequence is an invariant
A and is essential for correct splicing. The 5312⫺19A⬎C sequence
variation is located at this invariant A in a putative branch site
consensus sequence (GCGTGA/CT); therefore, it was postulated
that the 5312⫺19A⬎C transversion might result in abnormal
splicing. To examine the possibility of abnormal splicing, RNA
isolated from the platelets of the index case of family 2 and of a
Figure 1. Restriction enzyme digest analysis for the 5312ⴚ19A>C and 4751A>G
sequence variations from family 17. (A) The VWF DNA from exons 29-31 was PCR
amplified with primers 29F and 31R. Bsp1286I cuts the wild-type PCR product once,
yielding bands of 893 bp and 131 bp, as is observed in the unaffected members in
lanes 4 and 5. The 5312A⬎C sequence variation creates an additional Bsp1286I
restriction enzyme site cutting the 893-bp band once, yielding 2 fragments of 644 bp
and 249 bp. Four bands of 893 bp, 644 bp, 249 bp, and 131 bp are observed in the
members heterozygous for this change (lanes 2, 3). (B) The 4751A⬎C mutation in
exon 28 (amplified with primers 28CF and 28DR) destroys a restriction enzyme site
for KpnI. Two bands of 389 bp and 380 bp were observed in the unaffected members
(lanes 4, 5), and 3 bands of 389 bp, 380 bp (cut), and 769 bp (uncut) were observed in
the affected members who are heterozygous for this change (lanes 2, 3). Lane 1 is a
100-bp ladder.
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
Figure 2. RNA analysis for 5312ⴚ19A>C sequence variation. (A) DNA sequence
from intron 30 and exon 31 showing the putative branch site, an alternative branch
site, and the acceptor splice (AS) site. The 5312⫺19A⬎C sequence variation is
underlined in the putative branch site. (B) RNA isolated from the platelets of the
index case of family 2 and from a healthy person was reverse transcribed and
PCR amplified from exons 30-32. Only one VWF cDNA product of 311 bp was
observed in both persons, indicating correct splicing (lane 1, patient; lane 2,
healthy person; lane 3, PCR blank; lane 4, 100-bp ladder). (C) Sequence analysis
revealed a correctly spliced product, with exon 30 spliced directly to exon 31. (D)
RNA from the index case of family 2 and a healthy person was reverse transcribed
and PCR amplified from exons 28-29 (amplified product contains aa 1584). The
PCR product was subsequently digested with KpnI, and 3 bands of 1181 bp
(uncut), 780 bp, and 401 bp were observed for the patient, demonstrating that
both alleles are stably expressed as RNA (lane 1). Only one band is observed in
the healthy person because he does not have the mutation (lane 2). Lane 3,
100-bp ladder. (E) RNA isolated from COS-7 cells transfected with pBKVWF2932A, pBKVWF29-32C, or both (which contain either the A or C at 5312) was
reverse transcribed. Only one VWF product of 567 bp was amplified from the
wild-type (lane 1), cotransfected (lane 2), or homozygous sequence variant
(lane 3) cDNAs. Lane 4 is a 100-bp ladder.
healthy person was reverse transcribed and PCR amplified. Only
one VWF cDNA product of 311 bp was observed in each,
suggesting that abnormal splicing did not occur in the index case
(Figure 2B). Furthermore, sequence analysis revealed a correctly
spliced product, with exon 30 spliced directly to exon 31 (Figure
2C). A potential explanation for these findings is that an aberrantly
spliced product is produced by this variant allele but is unstable and
rapidly degraded and is, therefore, not observed in RNA prepared
from platelets. However, amplified cDNA from exon 28 revealed
that both alleles are expressed as RNA in the patient’s platelets
(Figure 2D).
To further assess the potential pathogenic role of the
5312⫺19A⬎C variant, COS-7 cells were transiently transfected
with the pBKVWF29-32A and pBKVWF29-32C constructs, which
contain either A or C at nt 5312. Forty-eight hours after transfection, RNA was extracted from the cells, reverse transcribed, PCR
amplified, and sequenced. Only one VWF PCR product of 567 bp
was amplified from the cDNA of COS-7 cells transfected with the
wild-type (A), sequence variant (C), and cotransfected (A and C)
constructs (Figure 2E).
VWF HAPLOTYPE ASSOCIATED WITH VWD
553
mutant recombinant protein was retained within the cell or was
efficiently secreted, VWF:Ag levels were assayed in cell lysates
and in the conditioned media using ELISA; the data are presented
in Figure 3. Secretion of rVWF protein from COS-7 cells transfected with the pCIneoC1584 construct or cotransfected with both
constructs (heterozygous state) was decreased by 38% (P ⫽ .005)
and 16% (P ⫽ .07), respectively, relative to the secretion of
wild-type rVWF protein (VWF:Ag levels for wild-type, heterozygous, and mutant are 2.681 ⫾ 0.122 U/mL, 2.244 ⫾ 0.168 U/mL,
and 1.649 ⫾ 0.250 U/mL, respectively; n ⫽ 4-6). Intracellular
levels of rVWF were increased by 47% (P ⫽ .04) and 8% (P ⫽ .6),
respectively (VWF:Ag levels for wild-type, heterozygous, and
mutant are 1.735 ⫾ 0.167 U/mL, 1.867 ⫾ 0.141 U/mL, and
2.592 ⫾ 0.320 U/mL, respectively). These results demonstrate that
the Tyr1584Cys mutation results in increased intracellular retention
of the protein.
Molecular modeling of the Tyr1584Cys variant
Molecular modeling was used to assess the effect of the Tyr1584Cys
mutation on protein structure. A homology model of the VWF A2
domain indicated that the cysteine residue is located on alpha helix
4, at the surface of the protein, and the reactive thiol (SH) side
chain on the substituted cysteine is 100% exposed to solvent. A
10-nanosecond molecular dynamics simulation of the mutant
protein indicated that the replacement of tyrosine by cysteine
causes no significant structural changes (at the end of the simulation, Tyr1584Cys has a root-mean-square deviation for ␣-carbons
of 2.0 Å from the starting structure, compared with 2.3 Å for the
wild-type model [J. J. S., manuscript in preparation]), and the thiol
group remains fully exposed to solvent (Figure 4).
VWF haplotype generation
A polymorphic haplotype was generated to determine whether the
2 sequence variations (5312⫺19A⬎C, 4751A⬎G) are in phase and
whether all affected family members with these sequence variations have a common founder haplotype. Nine SNPs located
throughout the VWF gene and 1 microsatellite repeat (STR 2 from
intron 40) were analyzed for 70 families from the Canadian Type 1
VWD Study (Table 3). Analysis of the haplotype generated
confirmed that the 2 sequence variations were in phase and that the
inheritance pattern of the sequence variations is dominant. Five of
the 7 Canadian families positive for the 5312⫺19A⬎C transversion shared a common haplotype for all the SNPs and for the
Expression and characterization of recombinant
Tyr1584Cys VWF
To determine the effect of the Tyr1584Cys substitution on VWF
biosynthesis, site-directed mutagenesis was used to introduce the
substitution to an expression vector containing the full-length VWF
cDNA. The expression vectors pCIneoY1584 (wild-type) and
pCIneoC1584 (mutant) were transiently transfected into COS-7
cells alone or together to generate wild-type, mutant, and heterozygous genotypes. Transfection efficiencies for the mutant and
heterozygous transfections (as determined by gal activity) were
normalized to the wild-type transfection. To determine whether the
Figure 3. Expression studies demonstrating increased intracellular retention
for rVWF protein containing the Tyr1584Cys mutation. Secretion of rVWF
protein from COS-7 cells transfected with the pCIneoC1584 construct or cotransfected with wild-type and mutant constructs (heterozygous state) was decreased
by 38% (P ⫽ .005) and 16% (P ⫽ .07), respectively, relative to the secretion of
wild-type rVWF protein and the intracellular levels of rVWF were increased by
47% (P ⫽ .04) and 8% (P ⫽ .6), respectively. n ⫽ 4-6. u indicates media;
䡺, lysate. Error bars indicate SEM.
554
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
O’BRIEN et al
Discussion
Figure 4. Homology model of VWF A2 domain showing Tyr1584Cys mutation
and common polymorphisms. (A) Homology model of the VWF A2 domain was
developed, based on the crystallographic structures of homologous domains from the
integrins ␣1-1, ␣2-1, ␣L, and ␣M and from the VWF A1 and A3 domains. Tyr1584
was replaced with cysteine on alpha helix 4, and a molecular dynamic simulation was
performed to assess the effect of this substitution on protein structure. No significant
structural changes were observed. The reactive thiol group on the side chain of
Cys1584 (indicated as a yellow ball) is 100% exposed to solvent. Common
polymorphisms are also labeled in the figure.
microsatellite repeat in intron 40 (haplotype 1 ⫽ G, A, T, G, A, C,
G, C, T, 6 for 2 promoter polymorphisms at nucleotides ⫺1185
[G/A] and ⫺1051 [A/G], exon 8, aa 318 [T/A], exon 12, aa 471
[G/A], exon 18, aa 789 [A/G], exon 28, aa 1547 [C/T], exon 28,
aa 1584 [A/G], intron 30, nt ⫺19 [A/C], exon 42, aa 2413 [C/T],
and STR 2 in intron 40) (Table 3). An SNP at amino acid 484 in
exon 13 was originally included in the haplotype analysis but
was later excluded because this sequence variation is found at a
CpG dinucleotide hypermutable element, and the phase of this
SNP often could not be determined. The SNPs in the promoter of
one family were not consistent with haplotype 1, an inconsistency that may be explained by a crossing-over event (haplotype
2 ⫽ A, G, T, G, A, C, G, C, T, 6). The promoter SNPs in one
family are ambiguous, and it is unknown whether this family has
haplotype 1 or haplotype 2. Three additional families have the
4751A⬎G (Tyr1584Cys) sequence variation, but not the
5312⫺19A⬎C intron change. The haplotypes in 2 of these
families are the same up to the exon 28 sequence variation, but
they differ at SNPs and at the microsatellite repeat located
downstream of exon 28, suggesting another crossing-over event
distal to this site (haplotype 3 ⫽ G, A, T, G, A, C, G, A, C, 3)
(Table 3). The third family has haplotype 1 without the
5312⫺19A⬎C intron change.
The frequency of haplotypes 1, 2, and 3 in the Canadian Type 1
VWD Study families are 8.6%, 2.9%, and 2.9%, respectively, and
haplotype 1 or 2 is found in 20% (2 of 10) of the families from the
United Kingdom. These haplotypes have not been observed in the
healthy population. This strongly suggests that the mutation in all
these families is located on a “founder” type 1 VWD chromosome,
and crossing-over events that occurred at the 5⬘ and 3⬘ ends of the
VWF gene resulted in haplotypes 2 and 3 (Figure 5). Evolution of
the core haplotype suggests that the mutation in these families
occurred many generations ago, and the 3 different haplotypes
provide evidence that the families in this study are not
directly related.
It is well recognized that the type 1 VWD phenotype shows
incomplete penetrance and variable expressivity within kindreds.
Recommendations concerning the diagnostic definition of type 1
VWD have been formulated, but no consensus has been reached.31,32
Indeed, in a recent review of this problem,33 a proposal has been
made to significantly re-evaluate and revise the criteria that define
the type 1 VWD phenotype. In addition to the diagnostic challenge
of this disease, the molecular genetic basis of type 1 VWD has been
elucidated in only a few reports, and the inheritance pattern in most
of these atypical cases has been autosomal recessive.34-37 Only 2
mutations with autosomal-dominant inheritance and high penetrance have been described in several families worldwide.38-40 In
this paper, we describe the first report of a recurring VWF mutation
that is associated with a significant proportion, 14.3%, of type 1
VWD patients in a Canadian population and that has been
documented in several patients in the United Kingdom. This
mutation does not have complete penetrance, as is demonstrated by
the patient who has the mutation but has normal VWF:Ag levels
and no bleeding history.
The 5312⫺19A⬎C sequence variation in intron 30 is located at
the invariant “A” in a putative intron branch site. Sequence
variations in branch sites have been reported to cause aberrant
splicing, such as exon skipping, and, ultimately, they can result in
the synthesis of a mutant protein. However, the 5312⫺19A⬎C
transversion does not result in abnormally spliced VWF products or
unstable products, and both alleles of the patient’s DNA are stably
expressed as (platelet) RNA. Splicing is likely occurring at a
different branch site in intron 30, located 27 nucleotides upstream
of exon 31, because this alternative site is 100% homologous to the
consensus branch site sequence, whereas the putative branch site
that was investigated is only 71% identical.
The Tyr1584 residue is conserved in the VWF-A2 domain in 25
different mammalian species.41 In addition, this residue is conserved in 3 of 6 structurally homologous domains (VWF A1
domain and the integrins ␣21 and ␣L), and a conservative change
is found at the analogous position in the VWF A3 domain. This
strong sequence conservation suggests that Tyr1584 has a structural
and a functional role in VWF A–like domains. Residue 1584 is
located on alpha helix 4 of our homology model, and its side chain
is fully exposed to solvent. Molecular dynamic simulations did not
predict any significant structural change caused by the Tyr1584Cys
substitution. This suggests that the associated phenotype results
from exposure of the reactive thiol group rather than from a
significant structural change caused by the amino acid substitution.
This reactive thiol group is capable of interacting with free thiol
groups on other proteins.
The pathogenic significance of amino acid substitutions to or
from cysteine residues has previously been demonstrated in
numerous studies, and it is well established that unpaired cysteines
may prevent the intracellular transport of many proteins.38 Twentyeight reported mutations in the VWF gene involve cysteine residues
that result in different types of VWD.10,42-45 In contrast, only 1
reported “polymorphism” in the VWF gene involves a substitution
to cysteine (Tyr1584Cys), and we have provided evidence demonstrating that this sequence variation is a common mutation in
Canadian families with type 1 VWD.
Patients with a mutation of Cys1149Arg, in exon 26, have
type 1 VWD.38 These patients have markedly reduced VWF:Ag
and VWF:RCo levels, with values ranging from 0.1 to 0.25 U/mL.
Cys1149 forms an intramolecular disulfide bond with Cys1169,
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
VWF HAPLOTYPE ASSOCIATED WITH VWD
555
Table 3. Haplotype data for VWD type 1 families
Family
Relationship
to propositus
Status
Haplotype chromosome 1
Haplotype chromosome 2
Founder
haplotype
2-4
Propositus
Y
G, A, T, G, A, C, G, C, T, 6
G, A, T, G, A, C, A, A, C, 4
1
2-5
Son
Y
G, A, T, G, A, C, G, C, T, 6
A, G, T, G, A, C, A, A, C, 4
1
2-62
Husband
N
G, A, T, A, G, T, A, A, C, 4
A, G, T, G, A, C, A, A, C, 4
NA
2-63
Son
Y
G, A, T, G, A, C, G, C, T, 6
A, G, T, G, A, C, A, A, C, 4
1
17-43
Propositus
Y
G, A, T, G, A, C, G, C, T, 6
A, G, T, G, A, T, A, A, T, 1
1
17-44
Father
U*
G, A, T, G, A, C, G, C, T, 6
A, G, T, A, G, C, A, A, C, 4
1
17-45
Mother
N
A, G, T, G, G, T, A, A, C, 3
A, G, T, G, A, T, A, A, C, 1
NA
17-46
Sister
N
A, G, T, G, G, T, A, A, C, 3
A, G, T, A, G, C, A, A, C, 4
NA
33-107
Propositus
Y
G, A, T, G, A, C, G, C, T, 6
G, A, T, G, A, C, A, A, C, 3
1
33-108
Father
U*
G, A, T, G, A, C, G, C, T, 6
G, A, T, G, A, C, A, A, C, 5
1
33-109
Mother
U
A, G, T, A, G, C, A, A, C, 4
G, A, T, G, A, C, A, A, C, 3
NA
34-110
Propositus
Y
G, A, T, G, A, C, G, C, T, 6
G, A, T, A, G, T, A, A, C, 4
1
34-111
Mother
Y
G, A, T, G, A, C, G, C, T, 6
G, A, T, G, A, C, A, A, C, 4
1
34-112
Sister
N
G, A, T, A, G, T, A, A, C, 4
G, A, T, G, A, C, A, A, C, 4
NA
70-236
Propositus
Y
G, A, T, V, V, C, G, C, T, 6
A, G, T, V, V, C, A, C, C, 4
1
70-237
Brother
Y
G, A, T, V, V, C, G, C, T, 6
G, A, T, V, V, C, A, C, T, 6
1
70-238
Father
Y
G, A, T, V, V, C, G, C, T, 6
A, G, T, V, V, T, A, C, C, 4
1
59-196
Propositus
Y
G, A, T, G, A, C, G, A, T, 6
A, G, T, G, A, C, A, A, C, 4
1‡
59-197
Father
U
A, G, T, G, G, T, A, A, C, 4
A, G, T, G, A, C, A, A, C, 4
NA
59-198
Mother
U†
G, A, T, G, A, C, G, A, T, 6
A, G, T, G, G, T, A, A, C, 4
1‡
59-199
Sister
U†
G, A, T, G, A, C, G, A, T, 6
A, G, T, G, G, T, A, A, C, 4
1‡
66-218
Propositus
Y
A, G, T, G, A, C, G, C, V, 3/6
G, A, T, G, A, C, A, A, V, 3/6
2
66-219
Mother
N
A, G, T, G, A, C, G, C, V, 3/6
A, G, T, G, G, T, A, A, V, 3/6
2
11-22
Propositus
Y
V, V, T, G, V, V, G, C, T, 6
V, V, T, G, V, V, A, A, C, 3
11-23
Mother
U
V, V, T, G, V, V, A, A, C, 4
V, V, T, G, V, V, A, A, C, 3
NA
11-24
Brother
U*
V, V, T, G, V, V, G, C, T, 6
V, V, T, G, V, V, A, A, C, 3
1 or 2
31-100
Propositus
Y
G, A, T, G, A, C, G, A, C, 3/5
G, A, T, G, A, C, A, A, C, 3/5
31-101
Brother
N
G, A, T, G, A, C, A, A, C, 6
G, A, T, G, A, C, A, A, C, 5
NA
31-102
Brother
N
G, A, T, G, A, C, A, A, C, 6
G, A, T, G, A, C, A, A, C, 6
NA
31-103
Brother
N
G, A, T, G, A, C, A, A, C, 6
G, A, T, G, A, C, A, A, C, 6
NA
49-159
Propositus
Y
G, A, T, G, A, C, G, A, C, 3
G, A, T, G, A, C, A, A, C, 3
3
49-160
Father
Y
G, A, T, G, A, C, G, A, C, 3
A, G, T, G, G, T, A, A, C, 4
3
49-161
Mother
N
A, G, T, G, A, T, A, A, C, 1
G, A, T, G, A, C, A, A, C, 3
NA
1 or 2
3
In the left column, the first number indicates the family study number and the second number indicates the individual’s study number, as recorded in our patient database.
Haplotypes were derived from restriction enzyme analysis of amplified VWF and from the number of TCTA repeats found at STR 2 in intron 40. Each haplotype, in the order of
appearance in the table, includes two promoter polymorphisms at nucleotides ⫺1185 (G⫹/A⫺, Bst UI) and ⫺1051 (A⫹/G⫺, NlaIII), exon 8 aa 318 (T⫹/A⫺, Msl I), exon 12 aa
471 (G⫹/A⫺, MaeII), exon 18 aa 789 (A⫹/G⫺, RsaI), exon 28 aa 1547 (C⫹/T⫺, Bst EII), exon 28 aa 1584 (A⫹/G⫺, KpnI), intron 30 nt ⫺19 (A⫺/C⫹, Bsp1286I), exon 42 aa
2413 (C⫹/T⫺, Aci l), and STR 2 in intron 40 (number of TCTA repeats is indicated). The common haplotype segregating with affected patients is underlined. V indicates that
data at that position were ambiguous. Y indicates affected status; N, unaffected; U, unknown; and NA, not applicable.
*Individual has no reported bleeding history and is not available for clinical testing.
†Individual is undiagnosed but has prolonged in vitro bleeding time.
‡Haplotype 1 without the 5312⫺19A⬎C sequence variation.
Figure 5. Evolution of the common VWF haplotype associated with type 1 VWD.
This schematic illustrates the proposed evolution of the common VWF haplotype.
The original VWF DNA had a common core haplotype (H1) of GATGACGCT6
(haplotype includes 2 promoter polymorphisms at nucleotides ⫺1185 [G⫹/A⫺,
Bst UI] and ⫺1051 [A⫹/G⫺, NlaIII]; exon 8, aa 318 [T⫹/A⫺, Msl I]; exon 12, aa 471
[G⫹/A⫺, Aat II]; exon 18, aa 789 [A⫹/G⫺, RsaI]; exon 28, aa 1547 [C⫹/T⫺, Bst EII]; exon
28, aa 1584 [A⫹/G⫺, KpnI] intron 30, nt ⫺19 [A⫺/C⫹, Bsp1286I]; exon 42, aa 2413
[C⫹/T⫺, Aci I]; and STR 2 in intron 40. The site of the Tyr1584Cys mutation is indicated with
an asterisk. At some point in history, a spontaneous mutation of G⬎A occurred at the CpG
dinucleotide in exon 13. This was followed later by 2 crossing-over events in the VWF
gene—one at the 5⬘ end of the gene (H2, AGTGACGCT6) and the other between exon 28
and intron 30 (H3, GATGACGAC3). Black bars indicate the affected chromosome and
white bars indicate the unaffected chromosome. In H2 and H3, the wild-type chromosome
has crossed onto the affected chromosome.
and expression studies have demonstrated that the unpaired thiol
group of Cys1169 does not account for the intracellular
retention of Cys1149Arg. It is unknown whether Cys1149 and
Cys1169 are surface exposed; however, a conformational change
in protein structure is expected because a stabilizing disulfide
bond has been broken. The molecular mechanism of the
Cys1149 mutation has been recently determined.38 Homodimer
and heterodimer formation occurs in the endoplasmic reticulum,
following the synthesis of VWF protein. This dimerization
process is random, and approximately 75% of dimers contain a
mutant subunit. These mutant dimers are retained in the
endoplasmic reticulum, and approximately 25% of the normal
homodimers are transported to the Golgi complex for assembly
into multimers. These numbers are consistent with the VWF:Ag
levels observed in patients. A similar mechanism may explain
the decreased VWF:Ag levels observed in patients with the
Arg1374Cys mutation.
The dominant-negative mechanism described does not explain the decreased levels of VWF in patients with the
Tyr1584Cys mutation because these patients have VWF:Ag
levels of approximately 0.40 U/mL rather than approximately
556
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
O’BRIEN et al
0.25 U/mL. VWF:Ag levels of approximately 0.40 U/mL could
suggest heterozygosity for a null allele (ie, a haploinsufficiency
mechanism); however, one patient described in this study
(Family I-2) is homozygous for the Tyr1584Cys mutation but
still has a detectable VWF:Ag level of 0.24 U/mL rather than 0
U/mL, which would be expected for the inheritance of 2 null
alleles. The VWF:Ag level for the homozygous Cys1584 patient
is significantly lower than in heterozygotes with this mutation,
suggesting that the inheritance of this mutation is codominant.
This in turn suggests that the pathogenic mechanism of the
Tyr1584Cys mutation is more likely to involve an inherent
instability of the mutant protein because of its reactive free
thiol group interacting with VWF or with another protein,
resulting in VWF protein degradation during its intracellular
biosynthesis or in accelerated clearance from the circulation. In
accordance with this, expression studies using recombinant
Tyr1584Cys VWF protein have revealed that the Tyr1584Cys
mutation results in increased intracellular retention. These
results suggest that the low plasma levels of VWF in these
patients are the consequence, at least in part, of reduced
secretion of protein, though other extracellular mechanisms may
also be contributing factors.
We propose that a common founder for the 4751A⬎G
mutation has been indicated in this study by the presence of a
common core VWF haplotype. This haplotype was found in
patients from across Canada and in several patients from
Southampton, United Kingdom, and the fact that 5312⫺19A⬎C
was originally identified in France suggests that this genetic
sequence is common in type 1 VWD patients from multiple
ethnicities. The occurrence of an evolved haplotype provides
support that the mutation in the patients from this study is
ancient. The mutation segregates with the affected members in
each family, demonstrating a codominant mode of inheritance;
this is especially obvious in family 1, in whom all the children of
the homozygous father (4751A⬎G) are affected with type 1
VWD. Several of the members with this genetic sequence
remain undiagnosed and are unavailable for testing or refused
diagnostic testing (33-108, 11-24, 17-44) or are reported to be
unaffected (66-219). Most of these persons are male, emphasizing the fact that women are more likely to report excessive
mucocutaneous bleeding symptoms because of menorrhagia.46
The undiagnosed or reportedly unaffected family members in
this study might have never had a significant hemostatic
challenge that required medical attention or they may have
coinherited traits that nullify the manifestation of VWD (eg,
ABO blood type).
In conclusion, this is the first study to describe a VWF mutation
that is associated with a significant proportion of type 1 VWD
patients from several countries. This mutation has been detected in
families that have a clear autosomal codominant pattern of
inheritance. Molecular genetic testing for the Tyr1584Cys mutation
(4751A⬎G) is straightforward and may now be incorporated into
the diagnostic assessment of patients who are being investigated
for type 1 VWD.
Acknowledgments
We thank Dr Dilys Rapson, Kerry Benford, Dr Sherry Taylor,
Francine Derome, and the Canadian Hemophilia Clinic Nurse
Coordinators for their contributions to this work.
Appendix
Members of the Association of Hemophilia Clinic Directors of Canada
are: John Akabutu, Department of Pediatrics, University of Alberta;
Kaiser Ali, Division of Pediatric Hematology/Oncology, University of
Saskatchewan; Dorothy Bernard, Division of Pediatric Hematology,
Dalhousie University; Victor Blanchette, Division of Pediatric Hematology/
Oncology, University of Toronto; Mason Bond, Division of Pediatric
Hematology/Oncology, University of British Columbia; Josee Brossard,
Department of Pediatrics, University of Sherbrooke; Manuel Carcao,
Division of Pediatric Hematology/Oncology, University of Toronto;
Robert Card, Division of Hematology, University of Saskatchewan;
Anthony Chan, Department of Pediatrics, McMaster University; Michele
David, Department of Hematology/Oncology, Hopital Ste Justine;
Jeffrey Davis, Division of Hematology/Oncology, University of British
Columbia; Christine Demers, Departement d’Hematologie, Hopital du
Saint Sacrement, Quebec; Sean Dolan, Department of Hematology,
Saint John; Bernadette Garvey, Department of Medicine, University of
Toronto; Kulwant Gill, Laurentian Hospital, Sudbury; Gerry Growe,
Division of Hematopathology, University of British Columbia; Jack
Hand, Department of Pediatrics, Memorial University; Rosemary Henderson, Department of Laboratory Medicine, Queen Elizabeth Hospital,
Charlottetown; Donald Houston, Department of Oncology/Hematology,
University of Manitoba; Sara Israels, Division of Pediatric Hematology,
University of Manitoba; Lawrence Jardine, Department of Pediatrics,
University of Western Ontario; Mariette Lepine-Martin, Departement
d’hemato-oncologie, CHUS, Sherbrooke; Reinhard Lohmann, Department of Medicine, University of Western Ontario; Koon-Hung Luke,
Department of Hematology/Oncology, Children’s Hospital of Eastern
Ontario; Patricia McCusker, Division of Pediatric Hematology/
Oncology, University of Manitoba; Mohan Pai, Pediatric Hematology/
Oncology, McMaster University; Man-Chiu Poon, Department of Medicine, University of Calgary; Bruce Ritchie, Department of Medicine,
University of Alberta; Sue Robinson, Department of Medicine, Dalhousie University; Sheldon Rubin, Moncton Hospital, Moncton; Morel
Rubinger, Department of Hematology/Oncology, University of Manitoba; Mary Frances Scully, Department of Medicine, Memorial University; Mariana Silver, Division of Hematology/Oncology, Queen’s University; Jean St-Louis, Hematologie-Oncologie, Hopital du Sacre-Coeur de
Montreal; Kent Stobart, Department of Pediatrics, University of Alberta;
Jerome Teitel, Department of Medicine, University of Toronto; Linda
Vickars, Department of Medicine, University of British Columbia;
Irwin Walker, Department of Medicine, McMaster University; Margaret Warner, Division of Hematology, McGill University; Blair Whittemore, Division of Hematology, McGill University; John Wu, Division
of Pediatric Hematology/Oncology, University of Calgary; John
Wu, Division of Pediatric Hematology/Oncology, University of
British Columbia.
References
Willebrand’s disease among U.S. adults [abstract]. Blood. 1987;70:377.
1. Kekomaki R, Rasi V, Ebeling F, et al. von Willebrand disease in Finland. Haemophilia. 1999;5:
72-74.
Shults J, Abshire TC. Prevalence of von Willebrand disease in children: a multiethnic study.
J Pediatr. 1993;123:893-898.
2. Scheibel E. von Willebrand disease in Denmark:
demography and treatment. Haemophilia. 1999;
5:71.
4. Rodeghiero F, Castaman G, Dini E. Epidemiological investigation of the prevalence of von Willebrand’s disease. Blood. 1987;69:454-459.
6. Lynch DC, Zimmerman TS, Collins CJ, et al. Molecular cloning of cDNA for human von Willebrand
factor: authentication by a new method. Cell.
1985;41:49-56.
3. Werner EJ, Broxson EH, Tucker EL, Giroux DS,
5. Miller CH, Lenzi R, Breen C. Prevalence of von
7. Sadler JE, Shelton-Inloes BB, Sorace JM, Harlan
BLOOD, 15 JULY 2003 䡠 VOLUME 102, NUMBER 2
JM, Titani K, Davie EW. Cloning and characterization of two cDNAs coding for human von Willebrand factor. Proc Natl Acad Sci U S A. 1985;82:
6394-6398.
8. Ginsburg D, Handin RI, Bonthron DT, et al. Human von Willebrand factor (vWF): isolation of
complementary DNA (cDNA) clones and chromosomal localization. Science. 1985;228:14011406.
9. Verweij CL, Diergaarde PJ, Hart M, Pannekoek
H. Full-length von Willebrand factor (vWF) cDNA
encodes a highly repetitive protein considerably
larger than the mature vWF subunit. EMBO J.
1986;5:1839-1847.
VWF HAPLOTYPE ASSOCIATED WITH VWD
20. NCCLS. Collection, transport and preparation of
blood specimens for coagulation testing and performance of coagulation assays. In: National
Committee for Clinical Laboratory (NCCLS) Standards. Vol 11, no 23. Document H21-A2; 1991.
21. Hardisty RM, MacPherson JC. A one-stage factor
VIII assay and its use on venous and capillary
plasma. Thromb Diath Haemorrh. 1962;7:215219.
22. Buddle U, Schneppenheim R, Plendl H, Dent J,
Ruggeri ZM, Zimmerman TS. Luminographic detection of von Willebrand factor multimers in agarose gels and on nitrocellulose membranes.
Thromb Haemost. 1990;63:312-315.
10. Schneppenheim R, Krey S, Bergmann F, et al.
Genetic heterogeneity of severe von Willebrand
disease type III in the German population. Hum
Genet. 1994;94:640-652.
23. Lahiri DK, Nurnberger JI Jr. A rapid non-enzymatic method for the preparation of HMW DNA
from blood for RFLP studies. Nucleic Acids Res.
1991;19:5444.
11. Bahnak BR, Lavergne JM, Rothschild C, Meyer
D. A stop codon in a patient with severe type III
von Willebrand disease. Blood. 1991;78:11481149.
24. Mancuso DJ, Tuley EA, Westfield LA, et al. Structure of the gene for human von Willebrand factor.
J Biol Chem. 1989;264:19514-19527.
12. Zhang ZP, Falk G, Blomback M, Egberg N, Anvret
M. A single cytosine deletion in exon 18 of the von
Willebrand factor gene is the most common mutation in Swedish vWD type III patients. Hum Mol
Genet. 1992;1:767-768.
13. Zhang ZP, Lindstedt M, Falk G, Blomback M, Egberg N, Anvret M. Nonsense mutations of the von
Willebrand factor gene in patients with von Willebrand disease type III and type I. Am J Hum
Genet. 1992;51:850-858.
14. Eikenboom JC, Ploos van Amstel HK, Reitsma
PH, Briet E. Mutations in severe, type III von Willebrand’s disease in the Dutch population: candidate missense and nonsense mutations associated with reduced levels of von Willebrand factor
messenger RNA. Thromb Haemost. 1992;68:448454.
15. Surdhar GK, Enayat MS, Lawson S, Williams
MD, Hill FG. Homozygous gene conversion in
von Willebrand factor gene as a cause of type 3
von Willebrand disease and predisposition to inhibitor development. Blood. 2001;98:248-250.
16. Tout H, Obert B, Houllier A, et al. Mapping and
functional studies of two alloantibodies developed
in patients with type 3 von Willebrand disease.
Thromb Haemost. 2000;83:274-281.
17. Mohlke KL, Nichols WC, Westrick RJ, et al. A
novel modifier gene for plasma von Willebrand
factor level maps to distal mouse chromosome
11. Proc Natl Acad Sci U S A. 1996;93:1535215357.
18. Mohlke KL, Purkayastha AA, Westrick RJ, et al.
Mvwf, a dominant modifier of murine von Willebrand factor, results from altered lineage-specific
expression of a glycosyltransferase. Cell. 1999;
96:111-120.
19. Kroner PA, Foster PA, Fahs SA, Montgomery RR.
The defective interaction between von Willebrand
factor and factor VIII in a patient with type 1 von
Willebrand disease is caused by substitution of
Arg19 and His54 in mature von Willebrand factor.
Blood. 1996;87:1013-1021.
25. Mancuso DJ, Tuley EA, Westfield LA, et al. Human von Willebrand factor gene and pseudogene: structural analysis and differentiation by
polymerase chain reaction. Biochemistry. 1991;
30:253-269.
557
RM, Rodeghiero F. Characterization of the genetic defects in recessive type 1 and type 3 von
Willebrand disease patients of Italian origin.
Thromb Haemost. 1998;79:709-717.
36. Castaman G, Novella E, Castiglia E, Eikenboom
JC, Rodeghiero F. A novel family with recessive
von Willebrand disease due to compound heterozygosity for a splice site mutation and a missense mutation in the von Willebrand factor gene.
Thromb Res. 2002;105:135-138.
37. Casana P, Martinez F, Haya S, Espinos C, Aznar
JA. Association of the 3467C⬎T mutation
(T1156M) in the von Willebrand’s factor gene with
dominant type 1 von Willebrand’s disease. Ann
Hematol. 2001;80:381-383.
38. Bodo I, Katsumi A, Tuley EA, Eikenboom JC,
Dong Z, Sadler JE. Type 1 von Willebrand disease mutation Cys1149Arg causes intracellular
retention and degradation of heterodimers: a possible general mechanism for dominant mutations
of oligomeric proteins. Blood. 2001;98:29732979.
39. Eikenboom JC, Matsushita T, Reitsma PH, et al.
Dominant type 1 von Willebrand disease caused
by mutated cysteine residues in the D3 domain of
von Willebrand factor. Blood. 1996;88:2433-2441.
26. Peake IR, Bowen D, Bignell P, et al. Family studies and prenatal diagnosis in severe von Willebrand disease by polymerase chain reaction amplification of a variable number of tandem repeat
region of the von Willebrand factor gene. Blood.
1990;76:555-561.
40. Castaman G, Eikenboom JC, Missiaglia E, Rodeghiero F. Autosomal dominant type 1 von Willebrand disease due to G3639T mutation (C1130F)
in exon 26 of von Willebrand factor gene: description of five Italian families and evidence for a
founder effect. Br J Haematol. 2000;108:876-879.
27. Graham FL, van der Eb AJ. A new technique for
the assay of infectivity of human adenovirus 5
DNA. Virology. 1973;52:456-467.
41. Jenkins PV, Pasi KJ, Perkins SJ. Molecular modeling of ligand and mutation sites of the type A
domains of human von Willebrand factor and
their relevance to von Willebrand’s disease.
Blood. 1998;91:2032-2044.
28. Kale L, Skeel R, Bhandarkar M, et al. NAMD2:
greater scalability for parallel molecular dynamics. J Comput Phys. 1999;151:283-312.
29. Orstavik KH, Magnus P, Reisner H, Berg K, Graham JB, Nance W. Factor VIII and factor IX in a
twin population: evidence for a major effect of
ABO locus on factor VIII level. Am J Hum Genet.
1985;37:89-101.
30. Keller EB, Noon WA. Intron splicing: a conserved
internal signal in introns of animal pre-mRNAs.
Proc Natl Acad Sci U S A. 1984;81:7417-7420.
31. Dean JA, Blanchette VS, Carcao MD, et al. von
Willebrand disease in a pediatric-based population: comparison of type 1 diagnostic criteria and
use of the PFA-100 and a von Willebrand factor/
collagen-binding assay. Thromb Haemost. 2000;
84:401-409.
32. Scientific and Standardization Committee of the
International Society for Thrombosis and Haemostasis (SSC/ISTH) Subcommittee on von Willebrand Factor. Annual Report of the SSC/ISTH
Subcommittee on VWF. Chapel Hill, NC; 1996.
33. Sadler JE. Von Willebrand disease type 1: a diagnosis in search of a disease. Blood. 2003;101:
2089-2093.
34. Eikenboom JC, Reitsma PH, Peerlinck KM, Briet
E. Recessive inheritance of von Willebrand’s disease type I. Lancet. 1993;341:982-986.
35. Eikenboom JC, Castaman G, Vos HL, Bertina
42. Cooney KA, Nichols WC, Bruck ME, et al. The
molecular defect in type IIB von Willebrand disease: identification of four potential missense mutations within the putative GpIb binding domain.
J Clin Invest. 1991;87:1227-1233.
43. Ware J, Dent JA, Azuma H, et al. Identification of
a point mutation in type IIB von Willebrand disease illustrating the regulation of von Willebrand
factor affinity for the platelet membrane glycoprotein Ib-IX receptor. Proc Natl Acad Sci U S A.
1991;88:2946-2950.
44. Meyer D, Fressinaud E, Gaucher C, et al. Gene
defects in 150 unrelated French cases with type 2
von Willebrand disease: from the patient to the
gene. INSERM Network on Molecular Abnormalities in von Willebrand Disease. Thromb Haemost.
1997;78:451-456.
45. Gaucher C, Hanss M, Dechavanne M, Mazurier
C. Substitution of cysteine for phenylalanine 751
in mature von Willebrand factor is a novel candidate mutation in a family with type IIA von Willebrand disease. Br J Haematol. 1993;83:94-99.
46. Castaman G, Eikenboom JC, Bertina RM, Rodeghiero F. Inconsistency of association between
type 1 von Willebrand disease phenotype and
genotype in families identified in an epidemiological investigation. Thromb Haemost. 1999;82:
1065-1070.