Evidence that ABC-transporter-mediated autocrine export of an eicosanoid signaling molecule enhances germ cell chemotaxis in the colonial tunicate Botryllus schlosseri Susannah H. Kassmer*1, Delany Rodriguez1, Anthony De Tomaso 1 1 Molecular, Cellular and Developmental Biology, University of California, Santa Barbara, CA USA. Corresponding author: Susannah.kassmer@lifesci.ucsb.edu Key words: ABC-transporter, eicosanoid, germ cell, migration, 12-S-HETE, Development • Accepted manuscript lipoxygenase © 2020. Published by The Company of Biologists Ltd. Summary Statement: Our results suggest that in the invertebrate chordate Botryllus schlosseri, germ cell chemotaxis towards the primary chemoattractant Sphingosine-1-Phosphate is enhanced by ABC transporter mediated export of a secondary chemoattractant, an eicosanoid signaling Development • Accepted manuscript molecule. Abstract: The colonial ascidian Botryllus schlosseri regenerates the germline during repeated cycles of asexual reproduction. Germline stem cells (GSCs) circulate in the blood and migrate to new germline niches as they develop and this homing process is directed by a Sphigosine-1Phosphate (S1P) gradient. Here, we find that inhibition of ABC transporter activity reduces migration of GSCs towards low concentrations of S1P in vitro. In addition, inhibiting phospholipase A2 (PLA2) or lipoxygenase (Lox) blocks chemotaxis towards low concentrations of S1P. These effects can be rescued by addition of the 12-Lox product 12-SHETE. Blocking ABC transporter, PLA2 or 12-Lox activity also inhibits homing of germ cells in vivo. Using a live-imaging chemotaxis assay in a 3D matrix, we show that a shallow gradient of 12-S-HETE enhances chemotaxis towards low concentrations of S1P and stimulates motility. A potential homolog of the human receptor for 12-S-HETE, gpr31, is expressed on GSCs and differentiating vasa+ germ cells. These results suggest that 12-SHETE might be an autocrine signaling molecule exported by ABC transporters that Development • Accepted manuscript enhances chemotaxis in GSCs migrating towards low concentrations of S1P. Introduction: Cell migration is a fundamental process of development and maintenance of multicellular organisms and mediates tissue organization, organogenesis, immune response and homeostasis (Vicente-Manzanares et al., 2005). Regulation of cell migration requires a complex interplay of signaling cascades that influence cell adhesion, polarization and cell motility. Temporal-spatial cues are tightly controlled, as dysregulation of cell migration can have catastrophic consequences for the organism, including developmental defects and cancer. In many species, germ cells that are specified during embryonic development need to migrate across the embryo to reach the somatic gonad, where they will develop into eggs and sperm (Richardson and Lehmann, 2010). Germ cell migration is studied in a variety of organisms, and many features are widely conserved. Germ cells undergoing active migration toward their somatic niche are often guided by a combination of attractive and repulsive cues (Barton et al., 2016). Research in the last two decades has shown that many lipids, now termed “bioactive lipids”, have critical cell signaling functions (Bieberich, 2012). Some lipid classes such as lysophospholipids (including sphingosine-1-phosphate), eicosanoids (e.g. prostaglandins), and endocannabinoids can signal through receptors in the cell membrane (Bieberich, 2012). G-protein coupled receptors (GPCRs) can be activated by gradients of bioactive lipids and thus influence cell polarity (Rosen and Goetzl, 2005, Renault and Lehmann, 2006, (LPLs) and phosphatidylinositolphosphates (PIPs). LPLs are bioactive lipids that can be generated from glycerophospholipids, a reaction catalyzed by phospholipases (Bieberich, 2012). The biosynthesis of eicosanoids is initiated by the activation of PLA2, leading to the release of arachidonic acid. Arachidonic acid is metabolized to a variety of eicosanoid signaling molecules (Bieberich, 2012, Funk, 2001). Bioactive lipids such as eicosanoids and lysophospholipids have many known roles in stimulating cell migration in a variety of cell types (Funk, 2001, Renault and Lehmann, Development • Accepted manuscript Randolph, 2001). Bioactive lipids associated with cell polarity include lysophospholipids 2006). Yet, very little is known about the roles of bioactive lipids in germ cell migration. A potential role for lipid signaling in germ cells was first discovered in Drosophila, in which mutations in the lipid phosphate phosphatases (LPP), wunen and wunen2, disrupt directed migration of germ cells to the gonad niche (Barton et al., 2016, Starz-Gaiano et al., 2001), but the ligand has not been identified. However, this mechanism appears to be conserved, as LPPs also repel germ cells away from nearby somites in zebrafish (Paksa et al., 2016). Recently, our group discovered that in the colonial ascidian Botryllus schlosseri, migration of germ cells is directed by the lysophospholipid Sphingosine-1-phosphate (S1P) (Kassmer SH, 2015). The ATP binding cassette transporters (ABC) are membrane protein that are conserved in all phyla from prokaryotes to humans (Locher, 2016). Through ATP hydrolysis, ABC transporters shuttle a wide variety of substrates across membranes, including ions, sugars, amino acids, polypeptides, toxic metabolites, xenobiotics and toxins (Xiong et al., 2015). ABC transporters functioning as exporters are found in both eukaryotes and prokaryotes, while importers seem to be present exclusively in prokaryotic organisms (Rees et al., 2009). Among the eukaryotes, members of the seven ABC transporter families (from ABCA to ABCG) are widely distributed, suggesting that they originated before the last common eukaryotic ancestor. A study investigating the structural evolution of the ABC transporter superfamily showed that the ABCB, ABCC, ABCE and ABCF families were found in all 79 eukaryotic genomes studied, suggesting that member of these families are likely to variety of hydrophobic lipophilic compounds across the cell membrane in an ATP-dependent manner, including bioactive lipids such as S1P, leukotrienes and prostaglandins (Neumann et al., 2017). Some ABC-transporters play roles in cell migration. In Drosophila, a germ cell attractant is geranylgeranylated and secreted by mesodermal cells in a signal peptideindependent manner through an ABCB-transporter of the MDR family (Ricardo and Lehmann, 2009). In sea urchin embryos, inhibiting ABC transporter activity disrupts segregation of cell necessary for the production of gametes, termed small micromeres Development • Accepted manuscript be involved in conserved functionalities (Xiong et al., 2015). ABC-transporters also shuttle a (Campanale and Hamdoun, 2012). Chemotaxis of human dendritic cells to CCL19 requires stimulation with the exogenous leukotriene C4, an eicosanoid transported out of the cell via ABCC1 (Randolph, 2001). Cells responding to a primary chemoattractant can secrete secondary chemoattractants that increase the robustness of the primary chemotactic response. This mechanism is termed signal relay (Majumdar et al., 2014, Szatmary et al., 2017). Neutrophils release leukotriene B4 (LTB4) to enhance their chemotactic response to the inflammatory cue fMLP (N-Formylmethionyl-leucyl-phenylalanine). Binding of fMLP to cell surface receptors initiates leukotriene biosynthesis by stimulating the conversion of arachidonic acid (AA) to LTB4. LTB4 is released as a secondary chemoattractant, and stimulates neutrophil motility through its interaction with its cognate receptor BLT1. LTB4 is packaged in exosomes, which are secreted in a polarized fashion to the region of the cell with the highest fMLP concentration, setting up a gradient along the cell itself. Failure to form or detect the secondary chemoattractant causes an impaired chemotactic response (Szatmary et al., 2017). A role of ABC transporters in signal relay during chemotaxis has so far only been investigated in Dictyostelium where the secondary chemoattractant cAMP is released via the ABCC8 transporter (Kriebel et al., 2018). Here, we aimed to investigate the role of ABC transporters during germ cell chemotaxis in Botryllus schlosseri. Botryllus is a unique model to study germline biology, because an individual does not grow by increasing in size, but asexually produced generation, entire bodies including all somatic and germline tissues are formed de novo (Figure S1 A, B). This results in a constantly expanding colony of genetically identical individuals, called zooids, which are linked by a common extracorporeal vasculature (Figure S1). The best understood regenerative process in Botryllus occurs in the germline. Like most metazoans, Botryllus sets aside a population of primordial germ cells early in embryogenesis (Brown et al., 2009). However, unlike most model organisms, Botryllus retains a population of mobile, self-renewing, lineage-restricted adult germline stem cells Development • Accepted manuscript rather by a lifelong, recurring asexual budding process (called blastogenesis). In every (GSCs) that persist for life of the colony (Sabbadin and Zaniolo, 1979). Every time a new body develops, a new germline niche is also formed, and GSCs migrate and home into this new niche. A subset of these differentiate into gametes (zooids are hermaphrodites and make sperm and eggs), while some GSCs self-renew and migrate to the next generation. Oocytes take several asexual cycles to fully develop, and both GSCs and differentiating egg precursors migrate to the new niches. Asexual development is synchronized throughout the colony, and migration occurs over a defined 48h period as germ cells leave the niche of the older individual (called the primary bud) and migrate to the new niche (in the secondary bud) via the vasculature joining the two (Figure S1A, B, C, D). We previously found that homing of GSCs to the secondary bud niche is directed by a gradient of the lipid signaling molecule sphingosine-1-phosphate (S1P). S1P is synthesized within the secondary bud niche and binds to the g-protein-coupled receptor S1PR1 that is expressed on migrating GSCs (Kassmer SH, 2015)(Figure S1D). Here, we show that the activity of both ABCC1 and ABCB1 is required for migration of GSCs towards low concentrations of S1P. We present evidence suggesting that the eicosanoid 12S-HETE is an autocrine secondary chemoattractant exported by ABC transporters that enhances chemotaxis towards shallow gradients of S1P. This could be a novel mechanism for signal relay in migrating GSCs. Results: We used human protein sequences for ABCB1 and ABCC1 to identify potential homologs in our publicly available Botryllus EST database (http://octopus.obs- vlfr.fr/public/botryllus/blast_botryllus.php) by tBLASTn. We identified a transcript that aligns with human P-glycoprotein/ABCB1 (E-value 1e-99, 65% positives) as well as with ABCB1 proteins from the solitary ascidian Ciona and many other metazoan species by BLASTX, but did not produce significant alignments with any other ABC transporter families. A study investigating the evolution of chordate ABC-transporter proteins found that all ABC protein Development • Accepted manuscript Germline progenitor cells express ABCC1 and ABCB1 subfamilies found in Ciona correspond to the human subfamilies (Annilo et al., 2006). Based on these findings, we feel confident that our abcb1 transcript is an ABCB1 homolog. Using the same approach, we identified a transcript that aligns with human ABCC1 protein (Evalue 0.0, 75% positives) as well as ABCC1 proteins from Ciona (E-value 0.0, 79% positives) and many other metazoan species by BLASTX, but did not produce significant alignments with any other ABC transporter families. We have previously found that in Botryllus, GSCs can be isolated by flow cytometry using a monoclonal antibody to integrin-alpha six (IA6), and that these cells express many germ cell related genes, including vasa (Kassmer et al., 2015). We analyzed expression of abcb1 and abcc1 in IA6+ cells by quantitative real time PCR, and found that both are highly enriched in IA6+ cells compared to IA6- cells (Figure S2A,B), with abcb1 being expressed at higher levels than abcc1 (6.2 fold enrichment vs 2.2 fold enrichment, Figure S2C). Using fluorescent in situ hybridization (FISH), we analyzed the expression of abcc1 and abcb1 in vasa+ cells in whole Botryllus colonies. Besides small, round IA6+ GSCs that are present in the blood as well as on primary buds, vasa also labels larger, differentiating oocyte precursors that are present on primary buds. Both cell types migrate from the old niches on primary buds to the new niches in secondary buds at stage B2. Since the larger vasa+ cells are brighter, they are more clearly visible by FISH than the small GSCs. Both Abcb1 and abcc1 transcripts are expressed in vasa-positive germ cells migrating to new germline ABCB1 and ABCC1 activity is required for migration towards low concentrations of S1P To test whether inhibition of ABC-transporter activity affects migration of Botryllus GSCs, we isolated IA6+ cells by flow cytometry and assessed their migratory activity to S1P in our transwell migration assay (Kassmer SH, 2015). In the presence of inhibitors of either ABCC1 or ABCB1, migratory activity to a low concentration of S1P (0.2μM) is significantly reduced (P=0.01, P=0.02, Figure 1B). An inhibitor of both ABCC1 and ABCB1 has a slightly stronger Development • Accepted manuscript niches within secondary buds (Arrows, Figure 1A, Figure S2F). effect. In contrast, migration in the presence of a high concentration of S1P (2μM) is not significantly affected by ABC-transporter inhibition (Figure 1B). In eukaryotes, the majority of ABC transporters function as exporters, and transport a variety of lipids and lipid signaling molecules out of the cell (Fletcher et al., 2010, Wilkens, 2015). Among these are secondary chemoattractants that function in signal relay and are released by cells migrating towards a primary chemoattractant. Examples of secondary chemoattractants that are released by migrating cells include leukotrienes C4 (LTC4) and B4 (LTB4) in human dendritic cells and neutrophils, respectively (Majumdar et al., 2014, Subramanian et al., 2017, Szatmary et al., 2017, Randolph, 2001). In human dendritic cells, the ABC transporter ABCC1 exports LTC4, which functions as an autocrine signal that enhances chemotaxis of dendritic cells migrating towards CCL19 (Randolph, 2001). This type of signal relay serves to amplify the signal of a primary chemoattractant within a shallow gradient to neighboring cells that are too far away to sense the primary signal. Therefore, we hypothesize that in Botryllus GSCs, ABCC1 and ABCB1 might export a secondary chemoattractant that enhances chemotaxis in the presence of low concentrations (= shallow gradients) of the primary chemoattractant S1P (Figure S2C). In the presence of high concentrations of S1P, the resulting steep gradient alone is sufficient to stimulate chemotaxis, and ABC-transporter inhibition has no effect (Figure 1B). Phospholipase A2 activity and lipoxygenase activity are required for migration to S1P ABCC1 and ABCB1. ABC-transporters export a variety of substrates. Among these are a variety of lipid signaling molecules, such as phospholipids and derivatives of arachidonic acid (Neumann et al., 2017, Fletcher et al., 2010). In humans, the cytoplasmic enzyme phospholipase A2 (PLA2, Fig3A) generates the polyunsaturated omega-6 fatty acid arachidonic acid from phospholipids. Arachidonic acid is further metabolized by either lipoxygenases (Lox) or Cyclooxygenases (Cox) to generate bioactive lipids such as Development • Accepted manuscript Next, we aimed to identify a possible secondary chemoattractant that might be exported by leukotrienes or prostaglandins, which are exported out of the cell by ABC transporters (Figure S2D) (Fletcher et al., 2010). To test whether a derivative of arachidonic acid plays a role in migration of GSCs towards low concentrations of S1P, we assessed migratory activity in the presence of an inhibitor of PLA2. GSCs migrating to 0.2μM S1P show a 3.8 fold increase in migratory activity compared to unstimulated control cells (Fig2A). In the presence of a PLA2 inhibitor, this response to 0.2μM S1P is completely blocked, and migratory activity is reduced to control levels (Fig2A, P= 0.058). In contrast, PLA2 inhibition did not significantly affect migration to a high concentration of S1P (2μM, Fig2A, P=0.32). These results show that activity of PLA2 is required for the migratory response to low concentrations of S1P. One of the main products of cytosolic phospholipase A2 is arachidonic acid, which is metabolized by downstream enzymes such as Cox or Lox to a variety of eicosanoid signaling molecules (Leslie, 2015). To assess whether a derivative of arachidonic acid that is metabolized by either Cox or Lox is involved in chemotaxis to S1P, we tested the migratory response to 0.2μM S1P in the presence of several inhibitors of Cox-1 and/or Cox-2 or an inhibitor of Lox. An inhibitor that blocks the activity of all 3 types of human lipoxygenases blocks germ cell migration to 0.2μM S1P (Figure 2B, P=0.065), whereas several different Cox-inhibitors had no effect (Fig 2B). Migration to a high concentration of S1P (2μM) is not significantly affected by Lox inhibition (Fig2B P=0.16). Using the human arachidonate 5-lipoxygenase protein sequence, we blasted to our Botryllus supplement). We blasted this sequence to the human non-redundant protein sequences (BlastX). This sequence produced a significant alignment to the human arachidonate 5lipoxygenase protein (54% positives, e value 7e-66) as well as to the human arachidonate 12-lipoxygenase (49% positives, e value 7e-60) and to human arachidonate 15lipoxygenase (54% positives, e value 1e-56). We found expression of this lox transcript is enriched in IA6+ cells (Fig S3C, E). Furthermore, cyclooxygenases are not expressed at significant levels in IA6+ germ cells when compared to vasa and lox (Fig S3C). Development • Accepted manuscript EST database and found a sequence that produced an alignment (sequence for lox in Inhibition of ABCC1, ABCB1, PLA2 or Lipoxygenases reduces migration of germ cells to secondary bud niches in vivo. To test whether migration of germ cells to secondary buds in vivo requires activity of ABCC1, ABCB1, PLA2 or Lox, we allowed B. schlosseri colonies to develop in the presence of inhibitors. Drugs were added to the seawater at stage A1, when the new secondary buds first begin to develop. During the next 72 hours, germ cells normally migrate and home to secondary buds, and by stage B2, this homing process is complete (Figure 3A, control). We quantified germ cell migration in vehicle treated control and inhibitor treated animals by vasa-FISH (Figure 3). In colonies treated with inhibitors of ABCC1, ABCB1, PLA2 or 5-, 12-, and 15-Lox that were fixed and analyzed at stage B2, significantly fewer secondary buds (white circles) contained vasa+ germ cells (green) (p≤0,01, Figure 3B) compared to vehicle treated controls, indicating a failure of vasa+ cells to home to secondary buds. There was no evidence that exposure to inhibitors affected vasa+ cell numbers or viability in treated colonies. In healthy animals, many vasa-positive cells remain on the primary buds and only a fraction home to the secondary buds by stage B2. In control colonies and colonies treated with inhibitors, similar numbers of vasa+ cells were present on primary buds (Figure 3C), indicating that the inhibitors do not affect viability of vasa+ cells. In colonies treated with inhibitors until stage C1, 24 hours later, when organogenesis begins in secondary buds, many secondary buds contained vasa+ cells in germline niches (Figure S4B). This suggests complete loss of migration, but can cause delayed homing, which may be due to disregulated chemotaxis. Botryllus germ cells express a receptor for the 12-LOX product 12-S-HETE In Figure 2B, we show that an inhibitor that blocks the activity of all 3 human lipoxygenases blocks germ cell migration to 0.2μM S1P. In humans, 3 different types of Lox use arachidonic acid as a substrate to generate a variety of downstream signaling molecules, Development • Accepted manuscript that treatment with inhibitors of ABC-transporters, PLA2 or Lox results does not result in including leukotrienes, lipoxins, and other fatty acids such as different types of hydroperoxyeiocatetraenoic acid (HPETE) and hydroxyicosatetraenoic acid (HETE) (Powell and Rokach, 2015) (Figure S3A). BLAST hits on both the genomes of Botryllus schlosseri and the closely related species Botrylloides diegensis support the presence of only one Lox gene in each species (Voskoboynik et al., 2013, Blanchoud et al., 2018). Since the Botryllus lox transcript aligns with all three types of human lipoxygenases, we wanted to assess which specific Lox-product might be responsible for enhancing migration to S1P. We tested an inhibitor specific to 5-Lox, as well as a cysteinyl leukotriene receptor antagonist. Neither of these significantly affected migration to S1P (Figure S3B). These data suggested that either 12-Lox- or 15-Lox-activity might be involved in migration to low S1P. 12-LOX generates 12S-HETE, a signaling molecule that stimulates migration of cancer cells and smooth muscle cells (Powell and Rokach, 2015). In humans, the G-protein-coupled receptor GPR31 is a high affinity receptor for 12-S-HETE (Guo et al., 2011). Using the human GPR31 protein sequence, we used tBLASTn to identify possible homologs in our publicly available Botryllus EST database (http://octopus.obs-vlfr.fr/public/botryllus/blast_botryllus.php) One transcript (sequence in Supplemental Files) aligned with the human GPR31 protein sequence (Evalue: 4e-05, Total score 50.0) and also showed overlap with GPR31 from Platynereis dumerilii by BLASTX (E-value: 5e-48, 50% positives). In humans, another receptor for 12-SHETE, and for the 15-Lox product 15-S-HETE is the Leukotriene B4 receptor 2 (Yokomizo, 2015), but we were not able to identify a homolog of this receptor in Botryllus. Using cells and expressed at levels comparable to vasa (FigS3C and D). We also identified a Botryllus homolog of the closely related GPCR “Trapped in endoderm” tre-1, a fatty acid receptor that is important for germ cell guidance in Drosophila (Kunwar et al., 2003). IA6+ cells do not express significant levels of this receptor (Fig S3C and D). Using FISH, we confirmed that gpr31 mRNA is expressed exclusively in vasa+ cells migrating to secondary buds (Figure 4A, white arrows). Expression of abcc1, abcb1 or gpr31 does not show any significant changes during the blastogenic cycle in fertile and infertile animals in our Development • Accepted manuscript quantitative real time PCR, we found that gpr31 expression is significantly enriched in IA6+ published transcriptomes (Fig S4C)(Rodriguez et al., 2014), indicating that these genes are always expressed in germ cells. This is in line with our own observation that migratory activity of IA6+ GSCs in vitro is independent of the blastogenic stage of the original colony (Kassmer et al., 2015). The 12-LOX product 12-S-HETE stimulates germ cell migration and rescues inhibition of ABC-transporters, PLA2 and lipoxygenases. As vasa+ cells in Botryllus express the putative receptor for 12-S-HETE, gpr31, we aimed to test whether 12-S-HETE would stimulate migratory activity of GSCs in vitro. 12-S-HETE alone induces migration to nearly the same extent as 0.2μM S1P (Figure 4B). In combination, both molecules induce the same amount of migration as 12-S-HETE or 0.2μM S1P alone. Importantly, adding exogenous 12-S-HETE rescues migratory activity to 0.2μM S1P in the presence of inhibitors of ABCC1, ABCB1, PLA2 or Lox (Figure 4B). These data suggest that 12-S-HETE might be the molecule that is generated by PLA2 and Lox and exported by ABCC1 and ABCB1. We hypothesize that 12-S-HETE then binds to the Gpr31receptor on the cell surface and enhances migration to low concentrations of S1P, acting as a secondary chemoattractant. The inhibition of migration to 0.2μM S1P with the Lox-inhibitor is slightly stronger than with either inhibition of ABCC1 or ABCB1 (Figure 4B), although this difference is not highly significant (P=0.32/P=0.37). This would make sense if both 12-S-HETE acts as a secondary chemoattractant and increases chemotaxis to S1P To further characterize the effect of 12-S-HETE on S1P-induced chemotaxis, we analyzed the migratory behavior of cells embedded in a 3D extracellular matrix and exposed to chemotactic gradients of S1P and/or 12-S-HETE. Cells migrating in the 3D matrix are analyzed by live imaging and computer-assisted cell tracking. This assay allows us to perform detailed analyses of migratory behavior, such as quantifying directional vs random migration, and measuring distance, speed and velocity. Example images of migrating cells Development • Accepted manuscript transporters are involved in exporting the putative Lox product. and videos of live imaging are included in supplemental files (Figure S5, movie 1 and movie 2). The chemotactic gradient was established by adding S1P and/or 12-S-HETE to the left reservoir of a chemotaxis chamber, and filtered seawater to the right reservoir, with the cells embedded in the 3D gel in the middle. In these experiments, cells were isolated directly from the blood as we found in initial experiments that the combination of flow cytometry and embedding resulted in high frequency of damaged or stressed cells and a low frequency of moving cells. Interestingly, only 10% of the total blood cells embedded in the gel responded to S1P (Figure S4D, Supplemental files: Movie 1), which roughly correlates to the frequency of IA6+ cells in the blood (9.7%, Figure S2B). In addition, we had shown in a previous study that only IA6+ cells express the S1P receptor (Kassmer SH, 2015). Therefore, it is likely that only GSCs migrate in this assay, although direct or indirect effects involving other cell types that are present in the blood cell mixture cannot be ruled out. In unstimulated controls, very few cells moved, and those that did move stayed mostly round and did not cover much distance (Figure 5L, Supplemental files: Movie 2, Figure S5). In contrast, cells migrating towards a gradient of S1P exhibited polarized morphology and covered more distance (Figure 5L P=0.001, Supplemental files: Movie 1). Representative images of cells migrating in Matrigel are shown in Supplemental Figure 5. We initially used identical concentrations of S1P and 12-S-HETE to those used in the transwell assays, and both the direction and average distance traveled by IA6+ cells under each condition are shown in Figure 5 A-L. When 0.2μM S1P was added to the left reservoir arrow), and cover more distance than unstimulated controls (P=0.001, Figure 5L). This response required activity of Lox, as addition of Lox-inhibitor abolishes S1P-directed chemotaxis, and also reduced the total distance travelled (P=0.001, Figure 5C and L). This suggests that endogenous production of 12-S-HETE is required for directed migration to 0.2μM S1P. When 500nM 12-S-HETE and 0.2μM S1P are both added to the left reservoir, cells cover more distance than in S1P alone, but lose directionality (P=0.05, Figure 5D, L,). When 500nM 12-S-HETE alone was added to the left reservoir, cells show non-directional Development • Accepted manuscript (steep gradient, Figure 5B), cells directionally migrate towards the left side (Figure 5B, red random migration (Figure 5E) but still cover more distance than unstimulated controls (P=0.001, Figure 5L). Biochemical studies have shown that small fatty acid molecules such as LTB4 or arachidonic acid diffuse rapidly and produce shallow and extremely transient gradients (Uden et al., 1986, Iwahashi et al., 2000). 12-S-HETE is a similarly structured fatty acid molecule of similar size and we expect that it would therefore diffuse rapidly and not produce a stable gradient. Therefore, it is likely that when 500nM 12-S-HETE is added to the left reservoir, this quick diffusion would result in the cells being stimulated by 12-S-HETE from all sides and losing their ability to perform directional migration. Therefore, we next attempted to create a gradient of 12-S-HETE in the chemotaxis chamber by adding a 100 fold lower concentration (5nM) of 12-S-HETE to one of the corners of the left reservoir (prefilled with seawater) immediately before live-imaging, so that 12-S-HETE would diffuse towards the cells and form a gradient. Under these conditions, 12-S-HETE alone still does not induce chemotaxis, but cells cover more distance than controls (Figure 5G, L, P=0.001). We used the same technique to attempt to create a very shallow gradient of S1P, by adding a 10 fold lower final concentration of 0.02μM S1P to the corner of the left reservoir. In this shallow S1P gradient, cells cover more distance compared to controls (Figure 5L, P=0.001), and even compared to cells migrating in a steep S1P gradient (0.2 μM), but they are not able to migrate directionally towards this shallow S1P gradient (Figure 5F, L, P=0.001). It has been shown that in suboptimal concentrations of chemoattractant, cells turn more frequently (Wilkinson, 1985), potentially facilitating the search for regions with optimal concentrations of gradients of S1P may not be sufficient to induce directed migration (Cartoon in Figure 6E). However, when we used the same technique to create a combined shallow gradient of 5nM 12-S-HETE and 0.02 μM S1P, the cells were able to migrate directionally towards S1P, and covered more distance than in any of the other conditions tested (Figure 5H, red arrow, Figure 5 B, Figure 5L). This suggests that when present as a gradient, 12-S-HETE enhances chemotaxis to a shallow gradient of S1P. We next wondered if chemotaxis in a shallow exogenously applied gradient of S1P and 12-S-HETE also required Lox activity. In the Development • Accepted manuscript chemoattractant. These results suggest that very low concentrations or very shallow presence of a 5, 15, 12-lipoxygenase inhibitor, chemotaxis (Figure 5I) and distance (P=0.05, Figure 5L P=0.01) are reduced, even when a high concentration of S1P is present (Figure 5K, L P=0.001). These results suggest that in the presence of an exogenous gradient of 12S-HETE, endogenous Lox-activity is still required to maintain directionality in germ cells migrating towards S1P. Discussion Previously we had shown that in the colonial ascidian Botryllus schlosseri, the migration of GSCs from old to new germline niches is due to chemotaxis along an S1P gradient secreted from the new niche (outlined in Figure S1 (Kassmer SH, 2015)). Here, we show that this chemotactic response of GSCs to S1P requires the activity of ABC-transporters, PLA2 and Lox. Addition of the 12-Lox-product 12-S-HETE rescues chemotaxis to S1P in the presence of inhibitors of ABCC1, ABCB1, PLA2 and Lox, and enhances chemotaxis towards shallow gradients of S1P in vitro. Inhibition of ABC transporter and PLA2 activity also blocked GSC migration in vivo to endogenous S1P gradients. We hypothesize that 12-S-HETE is a secondary chemoattractant secreted by GSCs in response to shallow gradients of the primary chemoattractant S1P, enhancing chemotaxis. The secretion of secondary chemoattractants in response to a shallow gradient of a primary chemoattractant is termed signal relay, and is thought to extend the spatial range over which cells can be directed in a primary gradient (Afonso et al., 2012, Garcia and Parent, 2008). Additionally, in steep the primary gradient is shallow. An example of this mechanism is chemotaxis of human neutrophils along a shallow gradient of fMLP, which requires autocrine secretion of Leukotriene B4 (LTB4) (Afonso et al., 2012, Subramanian et al., 2017). Our data suggest that this signal relay mechanism in GSCs is tightly regulated and depends on the strength of the signal received at the receptors for S1P and 12-S-HETE. In a very shallow gradient of S1P, directed migration can only occur if an exogenous gradient of 12-SHETE is added (Figure 5H), suggesting that this shallow gradient alone does not induce Development • Accepted manuscript gradients, signal relay could potentially help to attract other cells in areas where the slope of autocrine production of 12-S-HETE by Lox. However, when a gradient of 12-S-HETE is added together with a shallow gradient of S1P, lox inhibition does reduce directed migration (Figure 5I), suggesting that the presence of a gradient of 12-S-HETE enhances lox activity in a positive feedback loop. Cells migrating in the presence of a steep gradient of S1P cover less distance than cells in shallow gradients of S1P (Figure 5L). Perhaps regulation of Loxactivity is one of the mechanisms that contributes to fine-tuning the chemotactic response in different concentrations of primary chemoattractant, causing cells to slow down once they reach regions with high concentrations of chemoattractant. When a higher concentration of 12-S-HETE is added directly to one of the reservoirs of the chemotaxis chamber, cells migrate randomly, losing direction (Figure 5E, Illustration in Figure 6D), suggesting that a small molecule such as 12-S-HETE diffuses too quickly to form a stable gradient in the migration chamber. The same phenomenon has been reported for other small fatty acid secondary chemoattractants, such as LTB4 (Majumdar et al., 2016). In human neutrophils migrating towards a primary chemoattractant (fMLP), secreted LTB4 is packaged in exosomes to achieve spatially controlled secretion of LTB4 (Majumdar et al., 2016). Therefore, we hypothesize that the export and release of 12-S-HETE by migrating germ cells might likewise be spatially and temporally controlled. If 12-S-HETE is packaged in such exosomes, ABC-transporters might be involved in controlling secretion of 12-S-HETE from exosomes. Alternatively, 12-S-HETE secretion could be spatially controlled along the axis of the migrating cell, and occur only at the leading edge, to form a gradient along the of 12-S-HETE lose directionality by Lox inhibition (Figure 5 J and K), suggesting that endogenous lox activity is still required for regulating directionality. One explanation for this would be that sensing of a gradient of 12-S-HETE induces localized Lox activity that enhances cell polarization. Cells undergoing directional migration require environmental guidance cues as well as the ability to initiate and sustain motility. Depending on the organism, migrating germ cells must sustain directed migration for twenty-four to forty-eight hours (Barton et al., 2016). In Development • Accepted manuscript cell axis. Cells migrating towards higher concentrations of S1P and an exogenous gradient Botryllus, migration of germ cells to new germline niches occurs during a defined 48h period (Langenbacher and De Tomaso, 2016). It is common for a migrating cell to require more than one signal to induce this type of directed migration and motility. In mice, the chemokine SDF-1 provides the guidance cue to migrating primordial germ cells, whereas signaling of SCF through the receptor c-kit enhances motility (Barton et al., 2016). When a gradient of 12-S-HETE is added to a shallow gradient of S1P, cells cover significantly more distance than in S1P alone (Figure 6L), suggesting that 12-S-HETE acts as secondary chemoattractant that not only enhances directional migration, but also enhances motility. However, it is important to note that due to the fact that we are using a new model system, we were not able to directly test whether 12-S-HETE is being actively secreted by Botryllus germ cells or whether it binds to Gpr31 on the cell surface. It is therefore possible that ABCtransporters, PLA2 and Lox might be regulating chemotaxis towards S1P in ways we have not envisioned here. For example, Lox might be involved in production of other signaling molecules that might be regulating germ cell chemotaxis towards S1P, and exogenous 12-SHETE might only be mimicking the effects of such a molecule. Furthermore, the inhibitors used in these experiments are designed to inhibit human proteins, and we cannot be sure that they act exactly the same in Botryllus. However, their very distinct inhibition of chemotaxis only in the presence of low S1P does suggest that they do target proteins that are specifically involved in regulating chemotaxis towards low S1P. The fact that 12-S-HETE rescues their effect is further indirect evidence these drugs are targeting the proteins more complicated as there are many other cell types that might be affected by the inhibitors, which may result in indirect effects on the migrating germ cells. Until we have the technology to directly target these proteins specifically in migrating germ cells in vivo, the results presented here can only provide indirect support of our hypothesis. However, our combined findings, including: the close homology of Botryllus lox to human 12-LOX and Botryllus gpr31 to human GPR31; the fact that 12-S-HETE rescues inhibition of Lox as well as inhibition of ABC-transporters, and the fact that 12-S-HETE enhances chemotaxis to a shallow gradient Development • Accepted manuscript involved in the pathway we envision here. For the in vivo experiments, the situation is even of S1P, together strongly support our hypothesis that 12-S-HETE is an autocrine secondary chemoattractant secreted by germ cells migrating towards S1P. While Botryllus is a relatively uncharacterized model with these associated caveats, it also has the great advantage of allowing studies of GSC migration both in vivo and in vitro, and all of our results and conclusions have been consistent in independent assays. In assessing the role of 12-S-HETE in vitro, there is one main difference between chemotaxis in the 3D matrix and the transwell migration assay: it is not likely there is a stable gradient of 12-S-HETE in the transwell – this is a small molecule and diffuses too quickly, and, therefore, the cells are likely sensing 12-S-HETE from all directions. This may explain why there was no additive effect of S1P and 12-S-HETE in the transwell migration assay (Figure 4B), but in the 3D matrix, cells migrate faster and further in the presence of a gradient of 12-S-HETE when it is added to a shallow gradient of S1P (Figure 5). In general, migration in a 3D matrix is more physiological than migration on a 2D plastic surface, so the results from the chemotaxis assay are likely mimicking the in vivo situation more closely. However, in vitro migration assays do not perfectly reproduce the in vivo situation and only give us ideas about the physiological processes, but they are useful tools do to start understanding the underlying mechanisms of germ cell chemotaxis. 12-S-HETE has been shown to stimulate cell migration in human cell types. Specifically, it induces migration of cancer cells on laminin (Szekeres et al., 2000). This is relevant since we previously found that Botryllus germ cells also migrate on laminin (Kassmer SH, 2015). increased motility (Powell and Rokach, 2015) and stimulates aortic smooth muscle cell migration (Nakao et al., 1983). Interestingly, upregulation of 12-LOX induces a migratory phenotype in cancer cells (Klampfl et al., 2012), suggesting autocrine stimulation by 12-SHETE plays a role in metastasis. In a carcinoma cell line, activation of beta-4 integrin induces translocation of 12-LOX to the membrane and upregulates its enzymatic activity (Tang et al., 2015). Finally, both 12-S-HETE and GPR31 expression positively correlate to prostate cancer grade and progression in humans, suggesting a role in metastasis (Honn et Development • Accepted manuscript 12-S-HETE induces PKC-dependent cytoskeletal rearrangements in tumor cells, resulting in al., 2016). In context of these observations, we hypothesize that in Botryllus germ cells, S1Psignaling and binding of Integrin-alpha-6 to laminin might activate Lox and /or induce translocation of Lox or ABC transporters to the leading edge, resulting in localized secretion of 12-S-HETE. ABC transporters are highly expressed on many types of stem cells, and it is thought that they are involved in the removal of toxins to help protect the integrity of the DNA (Moitra et al., 2011, Bunting, 2002). ABC transporters are also involved in regulating in dendritic cell and cancer cell migration (Fletcher et al., 2010), but very few studies have investigated their roles in regulating migration of stem cells or germ cells. The ABC transporter MDR49 regulates the export of farnesyl-modified mating factors in yeast and is expressed in the Drosophila mesoderm, and MDR49 mutants have defects in primordial germ cell migration (Ricardo and Lehmann, 2009). In sea urchins, the small micromeres are the progenitors of the germline and migrate to the left and right coelomic pouches during embryonic development. This pattern of segregation is perturbed in the presence of inhibitors of ABCB and ABCC (Campanale and Hamdoun, 2012), and is likely due to suppressed secretion of an unknown signaling molecule. Together, these results and ours suggest that ABC transporters may play some important and potentially conserved roles in regulating germ cell migration. Furthermore, a specific role for ABC-transporters in secondary signal relay during suggest that ABC transporters are involved in the export of a secondary chemoattractant during chemotaxis of Botryllus GSCs. The roles of bioactive lipids in germ cell migration are also not well understood, but there is growing evidence for their importance. In Drosophila germ cell migration, the GPCR Tre1 directs migration through the midgut (Kunwar et al., 2003). While the ligand for Tre1 still unknown, the closest mammalian homolog, GPR84, binds to medium chain fatty acids. In Drosophila and zebrafish, lipid phosphate phosphatases are required for directed migration Development • Accepted manuscript chemotaxis has so far only been reported in Dictyostelium (Kriebel et al., 2018). Our results of germ cells (Starz-Gaiano et al., 2001, Paksa et al., 2016). Here, we show that the bioactive lipids S1P and 12-S-HETE are involved in regulating germ cell migration in an invertebrate chordate, suggesting that bioactive lipids may play conserved roles in directing germ cell migration across phyla. In conclusion, we hypothesize that migration of GSCs towards a shallow gradient of S1P depends on ABC-transporter mediated export of the secondary chemoattractant 12-SHETE, produced by lipoxygenase. 12-S-HETE enhances directional migration towards shallow gradients of the primary chemoattractant S1P. While signal relay had been previously studied in neutrophils and Dictyostelium discoideum (Garcia and Parent, 2008), this is a novel observation for germ cell chemotaxis. Given the role of 12-S-HETE in cancer cell migration (Klampfl et al., 2012), our study suggests that a conserved eicosanoid based signal relay mechanisms might operate in many other cell types across different species. Materials and Methods: Animals Botryllus schlosseri colonies used in this study were lab-cultivated strains, spawned from animals collected in Santa Barbara, California, and cultured in laboratory conditions at 18-20 °C according to (Boyd HC, 1986). Colonies were developmentally staged according to (Lauzon et al., 2002). Genetically identical, stage matched animals were pooled, and a single cell suspension was generated by mechanical dissociation. Whole animals were minced and passed through 70 μm and 40 μm cell strainers in sorting buffer (filtered sea-water with 2% horse serum and 50mM EDTA). Anti-Human/Mouse-CD49f–eFluor450 (Ebioscience, cloneGoH3) was added at a dilution of 1/50 and incubated on ice for 30 min and washed with sorting buffer. Fluorescence activated cell sorting (FACS) was performed using a FACSAria (BD Biosciences) cell sorter. Samples were gated IA6 (CD49f)-positive or –negative based on Development • Accepted manuscript Cell Sorting isotype control staining (RatIgG2A-isotype-control eFluor450, Ebioscience). Analysis was performed using FACSDiva software (BD Biosciences). Cells were sorted using a 70 μm nozzle and collected into sorting buffer. Quantitative real time PCR Sorted cells were pelleted at 700g for 10min, and RNA was extracted using the Nucleospin RNA XS kit (Macherey Nagel), which included a DNAse treatment step. RNA was reverse transcribed into cDNA using random primers (Life Technologies) and Superscript II Reverse Transcriptase (Life Technologies). Quantitative RT-PCR (Q-PCR) was performed using a LightCycler 480 II (Roche) and LightCycler DNA Master SYBR Green I detection (Roche) according to the manufacturers instructions. The thermocycling profile was 5 min at 95, followed by 45 cycles of 95 °C for 10 sec, 60 °C for 10 sec. The specificity of each primer pair was determined by BLAST analysis (to human, Ciona and Botryllus genomes), by melting curve analysis and gel electrophoresis of the PCR product. To control for amplification of genomic DNA, ‘no RT’-controls were used. Primer pairs were analyzed for amplification efficiency using calibration dilution curves. All genes included in the analysis had CT values of <35. Primer sequences are listed in Supplemental table 1. Relative gene expression analysis was performed using the 2-ΔΔCT Method. The CT of the target gene was normalized to the CT of the reference gene actin : ΔCT = CT (target) – CT (actin). To calculate the normalized expression ratio, the ΔCT of the test sample (IA6-positive cells) was first ΔCT(IA6-negative). Second, the expression ratio was calculated: 2-ΔΔCT= Normalized expression ratio. The result obtained is the fold increase (or decrease) of the target gene in the test samples relative to IA6-negative cells. Each qPCR was performed at least three times on cells from independent sorting experiments gene was analyzed in duplicate in each run. The ΔCT between the target gene and actin was first calculated for each replicate and then averaged across replicates. The average ΔCT for each target gene was then used to calculate the ΔΔCT as described above. Data are expressed as averages of the normalized Development • Accepted manuscript normalized to the ΔCT of the calibrator sample (IA6-negative cells): ΔΔCT= ΔCT(IA6-positive)- expression ratio (fold change). Standard deviations were calculated for each average normalized expression ratio (n=6). Statistical analysis was performed using Student’s T-test. In Situ Hybridization Whole mount in situ hybridization was performed as described in (Langenbacher et al.). Briefly, B. schlosseri homologs of genes of interest were identified by tblastn searches of the B. schlosseri EST database (http://octopus.obs-vlfr.fr/public/botryllus/blast_ botryllus.php) using human or Ciona (when available) protein sequences. Primer pairs were designed to amplify a 500-800 bp fragment of each transcript (Primer sequences in Supplemental table 1). PCR was performed with Advantage cDNA Polymerase (Clontech, 639105) and products were cloned into the pGEM-T Easy vector (Promega, A1360). Cloned fragments were sequenced and probe specificity was assessed by BLASTX and by testing sense probes. In vitro transcription was performed with SP6 or T7 RNA polymerase (Roche, 10810274001, 10881767001) using either digoxigenin or dinitrophenol labeling. HRP-conjugated antidigoxigenin antibody (1/500, Roche, 11207733910) or HRP-conjugated anti-dinitrophenol antibody (1/100, Perkin Elmer, FP1129) were used to detect labeled probes by fluorophore deposition (Fluorescein or Cyanine 3) using the TSA Plus System (Perkin Elmer, NEL753001KT). DNA was stained with Hoechst 33342 (Thermofisher). Imaging of labeled samples was performed using an Olympus FLV1000S Spectral Laser Scanning Confocal. Transwell filters with 8μm pore size inserted in a 24 well plate (Corning) were coated with laminin over night at 4°C and briefly air dried before adding 50,000 sorted cells, resuspended in 100μl migration medium (filtered seawater with 10% DMEM (Corning), 1% FBS (Corning) and 1% Primocin (InvivoGen)). Sphingosine-1-phosphate (0.2 - 2μM, Echelon), 12(S)-Hydroxy-(5Z,8Z,10E,14Z)-eicosatetraenoic acid (80nM, Sigma-Aldrich) and 10uM CP 1000356 hydrochloride (ABCB1-inhibitor), 10uM Probenecid (ABCC inhibitor), 10uM Reversan (ABCB1 and ABCC1 inhibitor), 10uM AACOCF3 (inhibitor of phospholipase Development • Accepted manuscript Transwell Migration Assay A2), 0.5uM 2-TEDC (inhibitor of 5-,12- and 15-lipoxygenase), 10uM Zileuton (inhibitor of 5lipoxygenase), 1uM BAY-u 9773 (Cysteinyl leukotriene receptor antagonist), 10uM (S)-(+)Ibuprofen (Non-selective but stronger inhibition of Cox-1), 1mM Naproxen (non-selective Cox inhibitor), 1mM Indomethacin (Non-selective but stronger inhibition of Cox-1), 1mM SC 236 (Cox-2 inhibitor) (all from Tocris) were added to the migration medium in the bottom chamber as indicated. For controls, the bottom chamber contained only migration medium. After 2 hours incubation at room temperature, nuclei in the bottom well were stained with Hoechst 33342 (1/1000, Thermofisher) and manually counted. All assays were performed in triplicates with cells from 4 independent sorts. Statistical analysis was performed using Student’s t-test. Small Molecule Inhibitor Treatment in vivo Botryllus colonies were incubated in 5ml of seawater containing 25μM Reversan (ABCB and ABCC inhibitor), 100μM Probenecid (ABCC inhibitor) 20μM CP 1000356 hydrochloride (ABCB-inhibitor) or 25 μM 2-TEDC (inhibitor of 5-,12- and 15-lipoxygenase) or 14 μM AACOCF3 (inhibitor of phospholipase A2). Controls were incubated in seawater plus vehicle (DMSO). Treatment was started at stage A2, and animals were fixed at stage B2 and analyzed by FISH as described above. Each treatment was performed on 3 genetically identical colonies. Secondary buds containing vasa-positive cells were counted on all treated Chemotaxis Assay Blood was isolated from Botryllus colonies, diluted ½ with filtered seawater, filtered through 10μm cell strainers and mixed with 50% Matrigel (Corning). 6μl of Matrigel-mixture were added to each chamber of an ibidi μ-slide Chemotaxis (ibidi GmbH, Martinsried, Germany). The gel was allowed to polymerize in a humidified chamber for 30 minutes at room temperature before adding filtered seawater to the right reservoir. The left reservoir was filled with filtered seawater containing Sphingosine-1-phosphate (0.2μM, Echelon) or 12(S)- Development • Accepted manuscript and untreated colonies. Statistical analysis was performed using Student’s t-test. Hydroxy-(5Z,8Z,10E,14Z)-eicosatetraenoic acid (500nM, Sigma-Aldrich) or both. For samples containing 0.5uM 2-TEDC (inhibitor of 5-,12- and 15-lipoxygenase), the inhibitor was added to both reservoirs. For controls, both reservoirs contained filtered seawater. To achieve a shallow gradient of S1P, 6μl of 0.2 μM S1P were added to the corner of the left reservoir containing 60μl of filtered seawater. To achieve a shallow gradient of 12-S-HETE, 6μl of 50nM 12-S-HETE were added to the corner of the left reservoir containing 60μl of filtered seawater. Live imaging was performed on a Leica SP8 confocal microscope at 15s intervals over a time period of 45 minutes. Cell paths were tracked manually using the Manual Tracking Plugin in Image J. At least 30 cells were tracked in each field of view, and the data from 3 independent experiments were combined for the final analysis. Cell paths were analyzed using the Chemotaxis and Migration Tool Version 1.01 (https://ibidi.com/chemotaxis-analysis/171-chemotaxis-and-migration-tool.html) for Image J. Representative images of movies are shown in figure S5, and representative movies can be Development • Accepted manuscript found in supplemental files. Acknowledgements: We would like to thank Amro Hamdoun for helpful discussions. We would like to acknowledge the the NRI-MCDB Microscopy Facility for use of the Olympus Fluoview 1000 Spectral Confocal, NIH Grant Number: 1 S10 OD010610-01A1, and the Leica SP8 Resonant Scanning Confocal NSF MRI grant DBI-1625770. Ben Lopez is acknowledged for help with live imaging. Competing interests: The authors state no competing financial interests. Funding: Eunice Kennedy Shriver National Institute of Child Health and Human Development • Accepted manuscript Development (NICHD) https://www.nichd.nih.gov HD092833 to AWD and SHK AFONSO, P. V., JANKA-JUNTTILA, M., LEE, Y. J., MCCANN, C. P., OLIVER, C. M., AAMER, K. A., LOSERT, W., CICERONE, M. T. & PARENT, C. A. 2012. LTB4 is a signal-relay molecule during neutrophil chemotaxis. Dev Cell, 22, 1079-91. ANNILO, T., CHEN, Z. Q., SHULENIN, S., COSTANTINO, J., THOMAS, L., LOU, H., STEFANOV, S. & DEAN, M. 2006. Evolution of the vertebrate ABC gene family: analysis of gene birth and death. Genomics, 88, 1-11. BARTON, L. J., LEBLANC, M. G. & LEHMANN, R. 2016. Finding their way: themes in germ cell migration. Curr Opin Cell Biol, 42, 128-137. BIEBERICH, E. 2012. It's a lipid's world: bioactive lipid metabolism and signaling in neural stem cell differentiation. Neurochem Res, 37, 1208-29. BLANCHOUD, S., RUTHERFORD, K., ZONDAG, L., GEMMELL, N. J. & WILSON, M. J. 2018. De novo draft assembly of the Botrylloides leachii genome provides further insight into tunicate evolution. Sci Rep, 8, 5518. BOYD HC, B. S., HARP JA, WEISSMAN IL 1986. Growth and sexual maturation of laboratory-cultured Monterey Botryllus schlosseri. Biological Bulletin 170, 91– 109. BROWN, F. D., TIOZZO, S., ROUX, M. M., ISHIZUKA, K., SWALLA, B. J. & DE TOMASO, A. W. 2009. Early lineage specification of long-lived germline precursors in the colonial ascidian Botryllus schlosseri. Development, 136, 3485-94. BUNTING, K. D. 2002. ABC transporters as phenotypic markers and functional regulators of stem cells. Stem Cells, 20, 11-20. CAMPANALE, J. P. & HAMDOUN, A. 2012. Programmed reduction of ABC transporter activity in sea urchin germline progenitors. Development, 139, 783-92. FLETCHER, J. I., HABER, M., HENDERSON, M. J. & NORRIS, M. D. 2010. ABC transporters in cancer: more than just drug efflux pumps. Nat Rev Cancer, 10, 147-56. FUNK, C. D. 2001. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science, 294, 1871-5. GARCIA, G. L. & PARENT, C. A. 2008. Signal relay during chemotaxis. J Microsc, 231, 52934. GUO, Y., ZHANG, W., GIROUX, C., CAI, Y., EKAMBARAM, P., DILLY, A. K., HSU, A., ZHOU, S., MADDIPATI, K. R., LIU, J., JOSHI, S., TUCKER, S. C., LEE, M. J. & HONN, K. V. 2011. Identification of the orphan G protein-coupled receptor GPR31 as a receptor for 12-(S)-hydroxyeicosatetraenoic acid. J Biol Chem, 286, 33832-40. IWAHASHI, M., KASAHARA, Y., MATSUZAWA, H., YAGI, K., NOMURA, K., TERAUCHI, H., OZAKI, Y. & SUZUKI, M. 2000. Self-Diffusion, Dynamical Molecular Conformation, and Liquid Structures of n-Saturated and Unsaturated Fatty Acids. J. Phys. Chem. B, 104, 6186-6194. KASSMER SH, R. D., LANGENBACHER AD, BUI C, DE TOMASO AW 2015. Migration of germline progenitor cells is directed by sphingosine-1-phosphate signalling in a basal chordate. Nature Communications, 6. KASSMER, S. H., RODRIGUEZ, D., LANGENBACHER, A. D., BUI, C. & DE TOMASO, A. W. 2015. Migration of germline progenitor cells is directed by sphingosine-1phosphate signalling in a basal chordate. Nat Commun, 6, 8565. Development • Accepted manuscript References Development • Accepted manuscript KLAMPFL, T., BOGNER, E., BEDNAR, W., MAGER, L., MASSUDOM, D., KALNY, I., HEINZLE, C., BERGER, W., STATTNER, S., KARNER, J., KLIMPFINGER, M., FURSTENBERGER, G., KRIEG, P. & MARIAN, B. 2012. Up-regulation of 12(S)-lipoxygenase induces a migratory phenotype in colorectal cancer cells. Exp Cell Res, 318, 768-78. KRIEBEL, P. W., MAJUMDAR, R., JENKINS, L. M., SENOO, H., WANG, W., AMMU, S., CHEN, S., NARAYAN, K., IIJIMA, M. & PARENT, C. A. 2018. Extracellular vesicles direct migration by synthesizing and releasing chemotactic signals. J Cell Biol, 217, 2891-2910. KUNWAR, P. S., STARZ-GAIANO, M., BAINTON, R. J., HEBERLEIN, U. & LEHMANN, R. 2003. Tre1, a G protein-coupled receptor, directs transepithelial migration of Drosophila germ cells. PLoS Biol, 1, E80. LANGENBACHER, A. D. & DE TOMASO, A. W. 2016. Temporally and spatially dynamic germ cell niches in Botryllus schlosseri revealed by expression of a TGF-beta family ligand and vasa. Evodevo, 7, 9. LANGENBACHER, A. D., RODRIGUEZ, D., DI MAIO, A. & DE TOMASO, A. W. Whole-mount fluorescent in situ hybridization staining of the colonial tunicate Botryllus schlosseri. Genesis. LAUZON, R. J., ISHIZUKA, K. J. & WEISSMAN, I. L. 2002. Cyclical generation and degeneration of organs in a colonial urochordate involves crosstalk between old and new: a model for development and regeneration. Dev Biol, 249, 333-48. LESLIE, C. C. 2015. Cytosolic phospholipase A(2): physiological function and role in disease. J Lipid Res, 56, 1386-402. LOCHER, K. P. 2016. Mechanistic diversity in ATP-binding cassette (ABC) transporters. Nat Struct Mol Biol, 23, 487-93. MAJUMDAR, R., SIXT, M. & PARENT, C. A. 2014. New paradigms in the establishment and maintenance of gradients during directed cell migration. Curr Opin Cell Biol, 30, 33-40. MAJUMDAR, R., TAVAKOLI TAMEH, A. & PARENT, C. A. 2016. Exosomes Mediate LTB4 Release during Neutrophil Chemotaxis. PLoS Biol, 14, e1002336. MOITRA, K., LOU, H. & DEAN, M. 2011. Multidrug efflux pumps and cancer stem cells: insights into multidrug resistance and therapeutic development. Clin Pharmacol Ther, 89, 491-502. NAKAO, J., ITO, H., CHANG, W. C., KOSHIHARA, Y. & MUROTA, S. 1983. Aortic smooth muscle cell migration caused by platelet-derived growth factor is mediated by lipoxygenase product(s) of arachidonic acid. Biochem Biophys Res Commun, 112, 866-71. NEUMANN, J., ROSE-SPERLING, D. & HELLMICH, U. A. 2017. Diverse relations between ABC transporters and lipids: An overview. Biochim Biophys Acta Biomembr, 1859, 605-618. PAKSA, A., BANDEMER, J., HOECKENDORF, B., RAZIN, N., TARBASHEVICH, K., MININA, S., MEYEN, D., BIUNDO, A., LEIDEL, S. A., PEYRIERAS, N., GOV, N. S., KELLER, P. J. & RAZ, E. 2016. Repulsive cues combined with physical barriers and cell-cell adhesion determine progenitor cell positioning during organogenesis. Nat Commun, 7, 11288. POWELL, W. S. & ROKACH, J. 2015. Biosynthesis, biological effects, and receptors of hydroxyeicosatetraenoic acids (HETEs) and oxoeicosatetraenoic acids (oxoETEs) derived from arachidonic acid. Biochim Biophys Acta, 1851, 340-55. RANDOLPH, G. J. 2001. Dendritic cell migration to lymph nodes: cytokines, chemokines, and lipid mediators. Semin Immunol, 13, 267-74. Development • Accepted manuscript REES, D. C., JOHNSON, E. & LEWINSON, O. 2009. ABC transporters: the power to change. Nat Rev Mol Cell Biol, 10, 218-27. RENAULT, A. D. & LEHMANN, R. 2006. Follow the fatty brick road: lipid signaling in cell migration. Curr Opin Genet Dev, 16, 348-54. RICARDO, S. & LEHMANN, R. 2009. An ABC transporter controls export of a Drosophila germ cell attractant. Science, 323, 943-6. RICHARDSON, B. E. & LEHMANN, R. 2010. Mechanisms guiding primordial germ cell migration: strategies from different organisms. Nat Rev Mol Cell Biol, 11, 37-49. RODRIGUEZ, D., SANDERS, E. N., FARELL, K., LANGENBACHER, A. D., TAKETA, D. A., HOPPER, M. R., KENNEDY, M., GRACEY, A. & DE TOMASO, A. W. 2014. Analysis of the basal chordate Botryllus schlosseri reveals a set of genes associated with fertility. BMC Genomics, 15, 1183. ROSEN, H. & GOETZL, E. J. 2005. Sphingosine 1-phosphate and its receptors: an autocrine and paracrine network. Nat Rev Immunol, 5, 560-70. SABBADIN, A. & ZANIOLO, G. 1979. Sexual Differentiation and Germ-Cell Transfer in the Colonial Ascidian Botryllus-Schlosseri. Journal of Experimental Zoology, 207, 289304. STARZ-GAIANO, M., CHO, N. K., FORBES, A. & LEHMANN, R. 2001. Spatially restricted activity of a Drosophila lipid phosphatase guides migrating germ cells. Development, 128, 983-91. SUBRAMANIAN, B. C., MAJUMDAR, R. & PARENT, C. A. 2017. The role of the LTB4-BLT1 axis in chemotactic gradient sensing and directed leukocyte migration. Semin Immunol, 33, 16-29. SZATMARY, A. C., NOSSAL, R., PARENT, C. A. & MAJUMDAR, R. 2017. Modeling neutrophil migration in dynamic chemoattractant gradients: assessing the role of exosomes during signal relay. Mol Biol Cell, 28, 3457-3470. SZEKERES, C. K., TRIKHA, M., NIE, D. & HONN, K. V. 2000. Eicosanoid 12(S)-HETE activates phosphatidylinositol 3-kinase. Biochem Biophys Res Commun, 275, 6905. TANG, K., CAI, Y., JOSHI, S., TOVAR, E., TUCKER, S. C., MADDIPATI, K. R., CRISSMAN, J. D., REPASKEY, W. T. & HONN, K. V. 2015. Convergence of eicosanoid and integrin biology: 12-lipoxygenase seeks a partner. Mol Cancer, 14, 111. UDEN, A. M., HAFSTROM, I. & PALMBLAD, J. 1986. Relation to chemotactic factor gradients to neutrophil migration and orientation under agarose. J Leukoc Biol, 39, 27-35. VICENTE-MANZANARES, M., WEBB, D. J. & HORWITZ, A. R. 2005. Cell migration at a glance. J Cell Sci, 118, 4917-9. VOSKOBOYNIK, A., NEFF, N. F., SAHOO, D., NEWMAN, A. M., PUSHKAREV, D., KOH, W., PASSARELLI, B., FAN, H. C., MANTALAS, G. L., PALMERI, K. J., ISHIZUKA, K. J., GISSI, C., GRIGGIO, F., BEN-SHLOMO, R., COREY, D. M., PENLAND, L., WHITE, R. A., 3RD, WEISSMAN, I. L. & QUAKE, S. R. 2013. The genome sequence of the colonial chordate, Botryllus schlosseri. Elife, 2, e00569. WILKENS, S. 2015. Structure and mechanism of ABC transporters. F1000Prime Rep, 7, 14. Development • Accepted manuscript WILKINSON, P. C. 1985. Random locomotion; chemotaxis and chemokinesis. A guide to terms defining cell locomotion. Immunol Today, 6, 273-8. XIONG, J., FENG, J., YUAN, D., ZHOU, J. & MIAO, W. 2015. Tracing the structural evolution of eukaryotic ATP binding cassette transporter superfamily. Sci Rep, 5, 16724. YOKOMIZO, T. 2015. Two distinct leukotriene B4 receptors, BLT1 and BLT2. J Biochem, 157, 65-71. Figures Figure 1: Migration of Integrin-alpha-6-positive germ cell precursors towards low concentrations of sphingosine-1-phosphate (S1P) depends on ABC-transporter activity. A: Representative example of FISH showing expression of abcb1 in vasa+ cells. Dashed line outlines the germ cell niche on the primary bud. All vasa+ cells (red) co-express abcb1 (green). The white arrow indicates a cluster of small germline stem cells, the blue arrow indicates a maturing oocyte. Red and green channels are shown individually with nuclear counterstaining (Hoechst 3342, blue), and merged images on the right show co-expression of both genes migration assay of IA6+ cells in response to different concentrations of S1P, with or without inhibitors of ABC-transporters. Sphingosine-1-phosphate (0.2 - 2μM), ABCB1-inhibitor (10uM CP 1000356 hydrochloride), ABCC1 inhibitor (10uM Probenecid), or ABCB1 and ABCC1 inhibitor (10uM Reversan) were added to the bottom wells where indicated. Control wells contain only migration medium. IA6+ cells were added to the upper chamber of an 8μm transwell filter coated with laminin, and after 2h, migrated cells in the lower chamber were counted. Data are expressed as fold changes of numbers of migrated cells, normalized to controls (n=4). Statistical analysis was performed using Student’s t-test (paired two tailed). Development • Accepted manuscript (yellow). Grey box indicates magnified portion of merged image. Scale bars = 20μm. B: Transwell Figure 2: Migration towards low concentrations requires Phospholipase A2 and lipoxygenase activity. A: migration assay of IA6+ cells in response to S1P in the presence of the PLA2-inhibitor AACOCF3 (10μM). Inhibition of PLA2 completely blocks the migratory response to Data are expressed as fold changes of numbers of migrated cells, normalized to unstimulated controls (n=4). Statistical analysis was performed using Student’s t-test (paired two tailed). B: Migration assay of IA6+ cells in response to S1P, with or without 10uM (S)-(+)-Ibuprofen (Nonselective but stronger inhibition of Cox-1), 1mM Naproxen (non-selective Cox inhibitor), 1mM Indomethacin (Non-selective but stronger inhibition of Cox-1), 1mM SC236 (Cox-2 inhibitor) 0.5uM 2-TEDC (inhibitor of 5-,12- and 15-lipoxygenase), as indicated. Data are expressed as fold changes of numbers of migrated cells, normalized to unstimulated controls (n=4). Statistical analysis was performed using Student’s t-test (paired two tailed). Development • Accepted manuscript 0.2uM of S1P (P=0.058), but has no significant effect on migration towards 2uM of S1P (P=0.32). Figure 3: Homing of germ cells in vivo depends on activity of PLA2 and LOX A: Animals were treated with ABCB1 and ABCC1 inhibitor (25μM Reversan), ABCC1 inhibitor (100μM Probenecid) ABCB1-inhibitor (20μM CP 1000356 hydrochloride), PLA2 inhibitor (14 μM AACOCF3) or 5-,12- and 15-Lox-inhibitor (25 μM 2-TEDC) for 3 days, starting at stage A1, and fixed at stage B2, when the secondary bud forms a closed double vesicle (white circles). Controls were incubated in seawater plus vehicle (DMSO). Vasa-FISH was performed on fixed animals (n=4). Nuclei were counterstained with Hoechst 33342 (blue). Scale bars = 20μm. In control new niche within the double vesicle stage secondary buds (circles). B: The number of new niches in stage B2 secondary buds containing vasa+ germ cells were counted for inhibitor-treated colonies and controls (n=4). Graph in B shows the percentage of double vesicle stage secondary buds containing vasa+ cells for each treatment. All 4 inhibitors significantly reduced migration of vasa+ cells to new niches within secondary buds. Error bars represent the standard deviation for each average (n=4). Statistical analysis was performed using Student’s t-test (paired two tailed). C: The number of vasa+ cells on old niches in each primary bud was counted for inhibitor-treated colonies and controls at stage B2. Graph shows the average number of vasa+ cells present on primary buds. Error bars represent the standard deviation for each average (n=4). Development • Accepted manuscript animals, some vasa+ germ cells (green) leave the old niche in the primary bud and home into the Figure 4: Botryllus germ cells express the 12-S-HETE receptor gpr31, 12-S-HETE rescues migration in the presence of ABC-transporter and lipoxygenase inhibitors. A: Representative examples of double-labeled FISH showing expression of gpr31 (green) in vasa+ cells (red). Dashed line outlines the germ cell niche on the primary bud. All vasa+ (red) cells coexpress gpr31 (green). Red and green channels are shown individually with nuclear counterstaining (blue), and merged images on the right show co-expression of both genes a maturing oocyte. Grey box indicates magnified portion of merged image Grey arrowhead indicates false signal caused by probe trapping. Scale bars = 20μm. B: Migration assay of IA6+ cells in response to 0.2μM S1P and/or 12-S-HETE, with or without inhibitors of ABC-transporters, PLA2 or 5-,12-, and 15-Lox. Data are expressed as fold changes of numbers of migrated cells, normalized to unstimulated controls (n=4). Statistical analysis was performed using Student’s ttest (paired two tailed). Development • Accepted manuscript (yellow). The white arrow indicates a cluster of small germline stem cells, the blue arrow indicates Figure 5: Chemotaxis to low concentrations of S1P is enhanced by shallow gradients of 12-S-HETE. A-K: Chemotaxis assay. Chemotaxis was analyzed by live imaging of cells embedded in Matrigel in a chemotaxis chamber. The right reservoir contained filtered seawater, and for steep gradients the left reservoir contained 500nM 12-S-HETE (pink) or 0.2μM S1P (blue) (final concentrations) were added to the indicated corner of the left reservoir. 5-,12- and 15-Lox inhibitor (2-TEDC) was added to both chambers were indicated. For unstimulated control in A, both reservoirs contained filtered seawater. Data from 3 independent experiments were combined and plotted as rose diagrams showing the directionality of cell paths for each condition tested. Red arrows in rose diagrams indicate direction of chemotaxis. L: Average accumulated distance for cells migrating in each condition (n=3), normalized to unstimulated controls, with standard deviation. The red line indicates the distance migrated by control cells (unstimulated). The colors correspond to the colors in the experiments in A-K. Statistical analysis was performed by comparing distance data points for all cell paths for each condition using Student’s t-test (unpaired two tailed). Development • Accepted manuscript or both (purple). For shallow gradients, 5nM 12-S-HETE (light pink) or 0.02μM S1P (light blue) Figure S1: Morphology of a Botryllus schlosseri colony, mechanism of germ cell migration to secondary buds. A and B: Morphology of a colony of Botryllus schlosseri. All individual bodies (blue outline) within the colony are embedded in an extracellular matrix known as the tunic and share an extracorporeal vasculature. Adult zooids (blue outline) asexually reproduce by giving rise to primary (green outline) and secondary buds (red outline). Scale bar in A 1mm, scale bar in B 200µm C: Migration of vasa+ germ cells to secondary buds. FISH for vasa (green) shows vasa+ germ cells present on the niche within the primary bud (white arrow). The secondary bud is beginning to form (dashed outline). 24h later, the secondary bud has formed a double vesicle, and vasa+ germ cells have migrated into the secondary bud (red arrow), while some remain on the primary bud (white arrow). DNA was stained with Hoechst 3342. Scale bars 20µm. D: Schematic of migration of germ cells to secondary buds. Secondary buds begin as small protrusions of the body wall of primary buds, and grow to form a closed double vesicle. At later stages, this vesicle grows and undergoes invaginations and tissue differentiation, completing development into the adult form. Germline stem cells (GSC, 7-10µM, green) and germ cell precursors (30-50µM, green) migrate from the primary bud into the secondary bud at the time when the double vesicle forms. When the double vesicle is fully formed, germ cells have completed migration. Migration into the secondary bud is directed by a chemotactic gradient of sphingosine-1-phosphate (S1P), which is secreted within the secondary bud, and detected by sphingosine-1-phosphate-receptor-1 (S1PR1) expressed by the migrating germ cells (34). 1 Development • Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Figure S2: A and B: Isolation of Integrin-alpha-6-(IA6) positive cells by flow cytometry. A: Forward-Side-Scatter gating on live cells. B: Cells within the live cell gate, plotted for forward scatter and Integrin-alpha-6-fluorescence. Gate around IA6- cells (p6) was determined using an isotype control antibody. IA6+ cells in p5 comprise about 9.7% of total cells. C: Hypothetical model of ABC-transporter mediated export of an unknown secondary chemoattractant signaling molecule. Migration to shallow gradients of S1P depends on ABC-transporter activity. Low-level stimulation of the S1P-receptor might induce production and ABC-transporter mediated secretion of an unknown signaling molecule, which provides a secondary chemoattractant signal to enhance migration towards S1P. Steeper gradients of S1P are sufficient to stimulate chemotaxis, and ABC-transporter-mediated export of a secondary chemoattractant is not required. D: The cytoplasmic enzyme phospholipase A2 (PLA2) generates arachidonic acid from phospholipids. Arachidonic acid is further metabolized by either lipoxygenases (LOX) or Cyclooxygenases (COX) to generate bioactive lipids such as leukotrienes or prostaglandins, which are exported out of the cytoplasm by ABCtransporters. E: IA6+ and IA6- cells were isolated by flow cytometry, and expression of germ cell marker genes (vasa, pumilio, cnot6) and ABC-transporters (abcb1 and abcc1) was assessed -ΔΔCT by quantitative real time PCR. Relative quantification was performed using the 2 -method, with actin as control gene. Data are expressed as averages of the relative expression ratio (fold change), normalized to IA6-negative cells. Standard deviations were calculated for each average expression ratio (n=3). Statistical analysis was performed using Student’s ttest. F: Representative examples of FISH showing expression of abcc1 in vasa+ cells. All vasa+ (red) germ cell precursors (arrows) co-express abcb1 (green). Red and green channels are shown individually with nuclear counterstaining (Hoechst 3342, blue), and merged images on the right show co-expression of both genes (yellow).White arrows indicate GSCs, blue arrows indicate maturing oocytes. Scale bars = 20µm. 2 Development • Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Figure S3: A: In humans, 3 different types of lipoxygenase metabolize arachidonic acid to various signaling agents. 12-Lox metabolizes arachidonic acid to 12(S)hydroperoxy-5Z,8Z,10E,14Z-eicosatetraenoic acid (12(S)-HpETE). 12(S)-HpETE is rapidly reduced to 12(S)-HETE by ubiquitous cellular peroxidases. B: Migration assay of IA6+ cells in response to 0.2µM S1P, with or without 5-Lox-inhibitor or Cysteinyl Leukotriene Receptor antagonist, as indicated. Data are expressed as fold changes of numbers of migrated cells, normalized to unstimulated controls (n=4). Statistical analysis was performed using Student’s t-test. C: IA6+ cells were isolated by flow cytometry and expression of vasa, gpr31, lox, tre1, cox1 and cox2 were analyzed by quantitative real time PCR. Relative quantification was -ΔΔCT performed using the 2 -method. Data are expressed as averages of the relative expression ratio (fold change), normalized to vasa. Standard deviations were calculated for each average expression ratio (n=4). D: IA6+ and IA6- cells were isolated by flow cytometry and expression of tre1, gpr31, cytosolic phospholipase a2, cpla2) and ABC-transporters (abcb1 and abcc1) was assessed by quantitative real time PCR. Relative quantification was performed using -ΔΔCT the 2 -method, with actin as control gene. Data are expressed as averages of the relative expression ratio (fold change), normalized to IA6-negative cells. Standard deviations were calculated for each average expression ratio (n=4). Statistical analysis was performed using Student’s t-test (n=4). 3 Development • Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Figure S 4: A: Example of mismigrated vasa+ cell in an animal treated with CP 1000356 hydrochloride (ABCB-inhibitor). Vasa-FISH was performed the fixed animal at stage B2. Nuclei were counterstained with Hoechst 33342 (blue). Scale bar = 20µm. B: Examples of vasa+ cells homing to new niches within secondary buds (white circles) at stage C. Colonies were treated with CP 1000356 hydrochloride (ABCB-inhibitor), Probenecid (ABCC inhibitor), or TEDC (inhibitor of 5-,12- and 15-lipoxygenase) for 3 days, starting at stage A1, and fixed at stage C1. Vasa-FISH was performed on fixed animals. Nuclei were counterstained with Hoechst 33342 (blue). Scale bars = 20µm. C: mRNA-seq analysis of changes in gene expression of grp31, abcb1 and abcc1 during the blastogenic cycle and in fertile vs infertile colonies. Tables on the left show fold changes of differential expression for each gene normalized to blastogenic stage A1. Tables on the right show fold changes of differential expression for each gene in fertile animals normalized to infertile animals. mRNA seq analysis was performed at each stage of the blastogenic cycle (A1, A2, B1, B2, C1, C2 and D) on a total of 3 fertile genotypes and 3 infertile genotypes (21). After Quality Control analysis, the sequences were mapped to our publicly available Botryllus schlosseri EST database (http://octopus.obs-vlfr.fr/public/botryllus/blast_botryllus.php) consisting of 50,107 contigs and representing several genotypes, both fertile but non- pregnant and infertile, at different stages of the blastogenic cycle. In order to identify putative homologs of the ESTs in our database, we performed a translated BLAST (blastx) analysis using the non-redundant human protein database (NCBI version 4/ 25/13). Differential expression analysis was performed with DESeq 1.10.1 using triplicates for the analysis. The full dataset is published in (24). 4 Development • Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Figure S5: Cells moving in 3D chemotaxis assay. A: Cells were embedded in Matrigel and imaged at 15s intervals for 45 minutes. The first and last image of the 45 minute period where merged. Closed circles show position of cells on the first image, dashed circles show position of cells on the last image. B: The percentage of cells moving in a combined shallow gradient of S1P and 12-S-HETE was counted in 4 separate experiments. Cells that moved at least one cell diameter were counted as moving. Error bar shows standard deviation. 5 Development • Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Development: doi:10.1242/dev.184663: Supplementary information Movie 1 and 2: Representative movies of 3D chemotaxis live imaging. Blood was isolated from Botryllus colonies, diluted ½ with filtered seawater, filtered through 10µm cell strainers and mixed with 50% Matrigel. To achieve a shallow gradient of S1P and 12-S-HETE, 6µl of 0.2 µM S1P and 6µl of 50nM 12-S-HETE were added to the corner of the left reservoir containing 60µl of filtered seawater. Live imaging was performed on a Leica SP8 confocal microscope at 15s intervals over a time period of 45 minutes. Every particle visible in these movies is a cell, even though many are not Development • Supplementary information within the focal plane. Development: doi:10.1242/dev.184663: Supplementary information Movie1: Cells migrating in unstimulated controls. Most cells do not move at all, and the cells that do move do not travel much distance and migrate in random Development • Supplementary information directions. Development: doi:10.1242/dev.184663: Supplementary information Movie 2: Cells migrating with a shallow gradient of S1P and a low concentration of 12-S-HETE. The gradient is higher to the left. Cell responding to cells turn frequently, yet overall the direction of migration is to the left. Development • Supplementary information the gradient of S1P and HETE are more polarized and migrate greater distances. The Development: doi:10.1242/dev.184663: Supplementary information Supplemental Methods: Abcb1 sequence: GCATATCCGTGAAATTCTGCTCGGTAGTGGTATTGGGAATGACGTTCATGTTGATACAT T GCGTGTAGTTGAAATTACATTGTTGAAATGATCCATAACCGACGAAACTGTCAGTCATA T CGCCGARGAAAATGAACATCACAGGCAGCGACGCACCATGAATGATGGCGCTGATTGTA C CCACAAGTATCAACAGGTAATCCTGCCCGGTTGCAAAGCGAAAAATTCCCGAGTATGAAA CCTCAGGAATGTCTTCAAGCTTTCCTTCAACTTGCGTCTCATGTTCTTCTCCTGGTTTTT TTCCATTGTTGGCGCTAAATCCAGTTATCTCATCGTACATTGGAGGCGGGGTTCTGTCCC CATTCAAAGGCTTAACACCGACGACTTCAACTTGGATGCCGTCGTCATGTTCGCGATACT TGTCCATAGCGAACTAACACCTAATTTAGGGTGGTTTGTTTCGCTATTTGTATACCTGGG CAAAAA 6 Development • Supplementary information CTTGCCCTTCAGTCGAGAGCGAATCGATAGGGCTCCCGATCTATGATTGAAATTTCGCAG CCGCTGCCGAAGCGTTGGAGAAATATTCCATGTTGCTTCCAGACTGTCCCAAAGAGAAGG CGCCAATTAGGACGCCAAAGAACGCAGTGAGAAGATTGCCAATGGTTATTTCCTCGGCTA ACACCAGTGTGGATCCGTACCAGAAAGCCAGGCCGTAAGTCCCAAACATAATCAGAAAG A GGAATCCCAGCGATGCTCCCGTAACCACCCCTTTCTTGATACCAAGGCCACGCGCACCGG ACAGATTCGAGCTATACCTTTCACATTCCTTCATCTCTCCACCAAAGGCCACAACCGTCC TTATGGAGGAAAGTACTTCCTCGGCCACGCTGCCGGCCTTTGCATACGCATCCAATTCCC TTTTTGTGAATGCCGTAGTTATCTTAAACAACATAGCTGCCGATATACCCAACAGCGGAG ACACGGCCAAGATAACCAAAGCTAATTTCCAACTGTACACAAATCCGATGACCAGACCAG CTAGGGCCCGCGCTACCATCTGTATTGAAATCGATACCTTATCGCTAATGCCGTCTTGTA TCTTTTGCACGTCGTCCGCAAGTCTCGTGTTCAATTCCCCGGAAGAGTTCAAATCAAAGA ACCCGATATTTTGACGCAGAATGCTCCGGAAGAAACTGACCCGGATTTGACGCACTTGGC GGACGGCTTGCAGCATCCAACAGTAAACCTGAGTGCTGGCGCACACTATAATAATCAGTG CCAGGTAAACATAGTACAGTGAGTATGTTGCCATTTCACTATTGAGGTCTGATTCACTCA Development: doi:10.1242/dev.184663: Supplementary information Abcc1 sequence: GAATATTGTGTGGTCCGGTCCGCTGCAAATCATCCTTTCCTTGTACTTCTTGTGGAATAT CCTCGGACCTGCGGTACTNGCTGGACTTGCTGTCATGATCCTGCTTATTCCAATCAACGC CGTCATTGCAAGCAAGACTCGATCCTTACAGGTGAAGCAAATGAAGCACAAAGACGACA G AATCAAGTTGATGAACGAGATCTTGAACGGAATCAAGGTCCTCAAGCTGTACGCGTGGG A AGAATCGTTTCAGGAGAAGATCTTGAAGATAAGAAATGACGAATTGCGNATTCTGAGAC A CGCCGCCTACCTCAACGCCGCCTCNTCTTTCACTTGGGTNTGCGCCCCGTTTATGGTTTC TCTGACAACGTTCGCAGTCTATGTTCTGGCGGACACGTCGCACGTTCTGACTGCNGAAAA GGCGTTNGTCTCGCTGTCTCTGTTTAACATCATGAGGTTCCCGATTTCCGTGTTGCCGAT GGTGATATCTTCTCTCGTTCAGGCTAACGTNAGCTTGAAACGTTTGAATAAATTCATGA A CAACCCGGAACTGGAGACAGACGCCGTCGACAGGAAACCGTCTCTGGGACCTGCTATCGT CGTGGAAGACGCCACCCTGTCTTGGGACGCCAGCGAGGAACCCGTCCTTGAAAACATAAC GATGGACGTCGCCGAGGGGTCNCTGGTGGCCATCGTGGGACAGGTAGGGACCGGGAAAT C 7 Development • Supplementary information TTTTCTGGCTGGTCGGTGTTTTGTATTTTTTCTATCTGCGCAAAGTGCCGAGCAACAATA TCCCAGCCTCCAAACTATTCAAGGCTAAGATGGTTGTGACACTTCTGTTATGGTTACTTG CCTGGATTGACTTATTTCGTGGATTGTGGGAATGGGGCCGGGATTTCACTGTTTACGGGG TCGATCTTGTGTCACCTCTTCTACTTGGATCTACAATGGCTTTAGCATCATTCTTCATCA ATTACGAAAGGTTGAAAGGAATAAGGAACTCTGGCTACTTGTTGATATACTGGCTGCTG T GCGTGATCAGCTGGATCATGCCGTTGAAAAGCAAAAAATTCAGCTCGCCACGGAGTCAG A GGACCTATCAGACGGTGACGTGTTGCGGATTTTGCACGTTTTGTGATCTCCTATGTGCTG GTCATGGTGAATTTNGTCTTGTCNTGGTTCTTGGATTCAGCGCCGTCCTTCTGTAACGAG GATGAGTGTGACAAAGTGCCTGCGACAGACGCAGAAAGCAGCGAATTGCTGAAACGTCA G GATTCCGCAGCNAAGGAAAAGAAGAAGCATCCGAGATCGCCGGAGCTGGCGACCACTTT C CTGTCGAAAATTACGTTCTGGTGGTTCACGGGAATGATCATTTTGGGTTACAAAAGACC T ATTGTGGATGAGGATTTGTGGCGCTTGAAAAAGGAGGACGAAGCCGGTAATGTTGCTGA C AGCTTCCTGAAGAATTGGAACGCCTACCTGAAANGNAAGGCGAACAAATACCCAAAAGA A ACCGAAAAGTGGCACTGCTCCTCATGACGGAATTCGAGAGCAGGACGTACTCGTTCAACA ACCAGGTCAAGATAAATCCAAGGGTGAGCCCTCTCTGACTTGGTCTCTCTGCAGAACGTT TGGACCGTACTTTCTGTTTGGGTCCTTCTTCAAATTGGCCCAAGACGTCTTGACTTTCGT GAATCCGCAACTGTTGAAGCTTTTGATCAATTTCACCGTGGACAAGTCTGCGCCTCAGTG GCAAGGCTATATCATGGCAGTCGGATTCTTTGTAACGGCGCTCATTCAGAGCATCTTCCT GCATCAGTACTTTCACGTTTGTTTCGTTGTCGGAATGAGGCTGAGATCTGCCATCGTGTC TGCCATTTACAGAAAGTCTCTTCTGCTTTCGAACGTCGCTAGGAAGTCCAGCACCGTTGG AGAAATTGTCAATCTCATGTCTGTGGATTCTCAACGGTTTATGGACTTGATGACTTATGT Development: doi:10.1242/dev.184663: Supplementary information 8 Development • Supplementary information GTCACTGGTGTCCGCCATGCTCGGCGATATGGAGAAGCTGAGCGGATACGTCAAAGTTCA GGGCTCCGTCGCGTATGTGGCGCAACAGGCGTGGATTCAAAACGCCACCGTGAAAGACAA CATCCTATTCGGAAAGCCGTTGCATCAGTGCAACTACATGGACACGATCAAGCATTGTGA GCTCGTCAGCGATTTCGAGATCTTGCCAGGCGGCGACATGACGGAAATCGGTGAAAAGG G AATCAATTTGTCTGGCGGGCAAAAGCAGAGAGTTTCGATTGCACGCGCTGTTTATCAAG A TGCAGAGGTGTACATCTTCGACGATCCGTTGAGCGCAGTAGACGCCCACGTTGGCAAGAA CATATTCGAAAACGTTATCGGACCCGGCGGCTGCTTACGCAAGAAGACGAGAGTGTTTGT GACACACAACATTACGTACTTACCGCAAACCGACAAGATCTACGTGCTCAAAGACGGAAG AATATCTGAGTCTGGGACGTACCAAGAACTGCAAGACCAAGATGGAGCGTTTGCCGAAT T TCTACGGAACTATGCCGTTACCGATGACGAAGCTTTCGCAGAAGGCGATCCGACAGTGCT GTCGATATCGCCGGAGATCTTGTCGATTACCGAGGACCATGTGGCGACAGACGTGACAAG TTTAGAGGGAGACACTTCTATCGAAGCGAGAAAACGTCTGATGAGCGACATAAGCCGCG A TTCGAAGGTCGTGTACGCCGGTCCTACATGCAAATATGTTCCGCTCAACAAGAGAATGAA AGACGACAACAAGAAGTGCATCATGCCCGATAAAAAAAACGGGCAACGTCGACAGCAAC C TGATCATGAAGGAGACGGCCGAAACTGGAAAGGTGAAATTTTTCCATTTTACGTCTCTT T ACACCAAATCTATCGGCGTCTTGCTCTGCNTANTGATCTGCCTGTTCTATGCCGCACAAA ACGGAATGTCCATCGGATCCAGTATATGGCTATCGGAATGGAGTAATGATCCAGTGATA A ACGGGACTCAGCAGAAGACAAATTTGCGACTGGCTGTGTACGGAGTGTTTGGTGTGGCT C AAGCACTGCTTGTCTTGGGCTCAAGCTTCTTTCTGTGGTACGGATCCGTACGGGCCGCCA AAAAACTCCACCTGGACATGCTCCAGCGCGTTTTCAAGGCGCCG Development: doi:10.1242/dev.184663: Supplementary information gpr31 sequence: TCCCGGCCGCCATGGCGGCCGCGGGAATTCGATTCATTCCCGGTATTCTCGCCAA CGTCATAGCCGACGCTAATCTGTTTTCCTTCGGCATGTGCAACTTCACGGCGCTG ATCGTGTCCTTGAGCTGCCTCGCTTCGATGTACAGCTTGATGTTCGTGGCTATCA ACAGATACGTCGCCGTAGCGCACAGCAATCGCTACACCGACATTTTCACGAAAAA GAAAGTAGCTGCCTTCATCGCCGTGATATGGATATGGTCATTTGTTCTCTCCATA CCGCCAGCATTCGGATGGGGCGACTACAAATACCATGGCAAAGTGCACGTTTGCA TGTATGACTGCAACACCAAGTACTTTTCGTACACCGCCAGCTTTATCGCGCTGTC TATCTTTGTCCCGTTTTTGATTACGTGCTTCTGTTACGTCGGGGTGTTCCATGTC TTCAACAAGAGCAGGAGTCGGTTTAGAAGCATGTCAAATATCAACGCAACCCCCA CCGAAACACTCACTACCAAAGGGAAGGGCGAGCAAGAACTGAAGCGAAGGAAATC AAAAGCGTCAGTCAAGCGTCAAGACAACGAGCGCCGTCTAGTGGTTACTCTATTC TCCGCGGTTTGTCTGTTCACTGTATGCTGGGTTCCGTAATCACTAGTGAATTCGC GGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCT TCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGC ATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGT TGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATG AATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCC TCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAANNAN CATGNGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGT 9 Development • Supplementary information TGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTT Development: doi:10.1242/dev.184663: Supplementary information GTCTCCGACTCAGGCATCCTTCCCAAGTCTGCAACATGGGGCCAACTACAGGAAA TCATTGAAAAAGAACGGCAACACAA CAAGGACAGATTTCCGTGGGTTGAAAAGTCCAATCCGGGTGACGAATCGTGGATG CTGCCGCGATTTACCCCGGCGAAAG ACCTGCACAATGTACCGCACAAGTTGAGGATGGAAGACTCGAGATTTAAGCATAT CAGCGATTTGAGGAGTGCGGCGAAA TTGAATGTGGTTATTGCAAAGTTCAGAGGATTGTTCCGTCCTATCAAAAGTTGGA CGATTACAAGGAGCTCATAACGCAC TTCAGAATCCCAAGCGACCTGAAGCCTTGCATGGAAAGGTGGTATGACGATGAAG AGCAGGGCCGACAAATGATGAATGG AGCAAATCCATTCGCGATGGAGCTTTGTGCTGCGCTCCCACCGTATTGCAAAATC ACAGACAAACATGTTTCGGGTTTCT TAAAATGAAGGAAAAACACTTGAAGACGAAATGAAGAACGGAAGAATATTTATTG TCGATTACACGCAATGGACGCAGGG TTTAAAGAGAAATAAGCGATATAAGTCCGACAGCATCATGTATTGCGCCGACTGT TTGGCCCTATTTTATTCACCCGGAG ACGGACGATTTCTACCGATCGCGATCCAACTCAAACCCGACGATGACGATTACGT TTTTACGCCGGATTGCGGGGAACAC GACTGGATGCTGGCCAAGATGTTTTTTCGTTGCGCCGACACCAACGCACATCAAT GGATTTACCACTTCCTATGGGGGCA CGGAATCGTGGAAACAGTCGCCACTGCCATGTTTCGATGCTTATCACGGACGCAC CCGATGTACAAGCTATGTCGCGGGC ATCTCCAGCACGTGGTCGTCATCGACCAATTCGCGAGGGACGTCCTCATATTTGA CAACAGTCCGTCAAACTACACAAGA TCGATCAATGGTTCTGTGCTGGCACAACGTCGCTTCGAGGTGTTTGATTTCAACG ATCTCAACTTTCCGAAGTTGCTCAA GAAGAAAGGTTTGGACGGTGACAAGCTTCAAAATTACTATTTTCGTGACGACGCC TTGTTGTTATGGGATGCCATAAATT CGTATGTGACGGATACAGTCAAAATCTATTACAAAGAGGATCAGGATGTCCAAAA CGATGGTCAAATGCAGGACTGGATA AATGATTTGGCGACGGAGGGTTTCGGATGGACGGATGGGAATCCTCGAGGCTGTC CAACCACATTGCAGTCTGTAGACGA ATTGATCACGTTCCTGACATCTTGCATCTTCACAAGCAGCGTAATTCACGCGGCG ACTCACAAACCCATGTTCGATCTGT ACAAATTCGCTCCGAACGCACCTGGAGGAATGCGATTGCCGATACANAAACGCGG AGAGGCGACGATGGAGCGCATTTTG GANACCTTGCCGGACGAAACCATGGCCACTATTCTACTGGGATCGGCTTTCGTTT TGTCCGAGCTTCCGAAAGATGAGGT ATACCTGGGAGATTTCCCAATGAATCTGTTCACGGAGCCGGAGCCACGCAAAGTC ATCGACGAATTTCGCGCTCGTCTGG GCGAGATAAGTCGAAAAATTAAAGCTCGGAACGCAGCGGCCGCAGTCCCTTACGA 10 Development • Supplementary information lox sequence: Development: doi:10.1242/dev.184663: Supplementary information GTATCTCATACCGGAAACACTACCC ACCGGTACGACGGCGTAGGCAACACCAAACGGGTAATACCCGGGCTAATTCTAGC TGTTTGGACATGACACATGAGTGAT GATTGCATGGCTTTGGATATTGCTGTATATATGCCAGGGAAAATTTAAGAGATTT ATCAAAAGTGCAAGATCATAAGACA GGCACAGATATCCTCGTTCAATACATTGTGGGTGGTCAACAGCGAGGTATATTTC TTTTTTGCCGTCACCCGAGTTGGTT TTGTCAACTAGTGCTACGTACCCAAGCTGCTTTGACTAATGTAACTTCTTATACT TCAACTAG qPCR Primers: Product size 140-180bp gpr31 qPCR forward TGAAAGATGACTCGTCGCCC grp31 qPCR reverse CTACAAGAGATCGGCGGCTT vasa qPCR forward GGCGGATTTAGCGATGATGAG vasa qPCR reverse TTCCCCCATAGCGACTGTTAGAC pumilio qPCR forward GTCCATGTACGGTTCTGCCA cnot6 qPCR forward CTACGACGACACTGAGCAGG cnot6 qPCR reverse TCGGTGGGGGCATCCTAATA integrin-alpha-6 qPCR forward ACTTCCGGCACGAACAAGAT integrin-alpha-6 qPCR reverse GTACAACAGGGTAACCGGGG abcc1 qPCR forward TGAGGTTCCCGATTTCCGTG abcc1 qPCR reverse CGTCTTCCACGACGATAGCA 11 Development • Supplementary information pumilio qPCR reverse TTCGGGAAACGGTTGTTCCT Development: doi:10.1242/dev.184663: Supplementary information abcb1 qPCR forward CGCCAATTAGGACGCCAAAG abcb1 qPCR reverse GACTTACGGCCTGGCTTTCT lox qPCR forward TCATGTATTGCGCCGACTGT lox qPCR reverse AACATCTTGGCCAGCATCCA pla2 qPCR forward AGGTTATCACGGGGATCGGA pla2 qPCR reverse CGGATTTTCGGTCGGGAGAA tre1 qPCR forward GACCATGAACGCGATGCAAA tre1 qPCR reverse CGGCAAAAGCATCGTCGTAG Cloning primers for FISH probes: abcc1 cloning forward TACGTTCTGGTGGTTCACGG Product size 668 gpr31 cloning forward ACGGAACCCAGCATACAGTG gpr31 cloning reverse CATTCCCGGTATTCTCGCCA Product size 608 vasa cloning forward AGGCACTATGATTCAGCCTGTG vasa cloning reverse ATCATAATCACCCGTCTCGCG 12 Development • Supplementary information abcc1 cloning reverse GCGTACAGCTTGAGGACCTT Development: doi:10.1242/dev.184663: Supplementary information Product size 976 abcb1 cloning forward ACGCAGTGAGAAGATTGCCA abcb1 cloning reverse ACCGAGCAGAATTTCACGGA 13 Development • Supplementary information Product size 742