Vol. 152: 147–158, 2022
https://doi.org/10.3354/dao03700
DISEASES OF AQUATIC ORGANISMS
Dis Aquat Org
Published online December 22
OPEN
ACCESS
Development of a TaqMan quantitative reverse
transcription PCR assay to detect tilapia lake virus
Dorothea V. Megarani1, 2, Lowia Al-Hussinee1, 2, Kuttichantran Subramaniam1, 2,
Preeyanan Sriwanayos1, 2, 8, Kamonchai Imnoi1, 2, 8, Bill Keleher3, Pamela Nicholson4,
Win Surachetpong5, Puntanat Tattiyapong5, Paul Hick6, Lori L. Gustafson7,
Thomas B. Waltzek1, 2, 9,*
1
Department of Infectious Diseases and Immunology, College of Veterinary Medicine, University of Florida,
Gainesville, Florida 32610, USA
2
Emerging Pathogens Institute, University of Florida, Gainesville, Florida 32610, USA
3
Kennebec River Biosciences, Richmond, Maine 04357, USA
4
Next Generation Sequencing Platform, University of Bern, Bern 3012, Switzerland
5
Department of Veterinary Microbiology and Immunology, Kasetsart University, Bangkok 10900, Thailand
6
Virology Laboratory, New South Wales Department of Primary Industries, Elizabeth Macarthur
Agricultural Institute, Menangle, NSW 2568, Australia
7
Animal and Plant Health Inspection Services, US Department of Agriculture, Fort Collins, Colorado 80526, USA
8
Present address: Aquatic Animal Health Research and Development Division, Department of Fisheries, Bangkok 10900, Thailand
9
Present address: Animal and Plant Health Inspection Services, US Department of Agriculture, Gainesville, Florida 32608, USA
ABSTRACT: Tilapia lake virus disease (TiLVD) is an emerging viral disease associated with high
morbidity and mortality in cultured tilapia worldwide. In this study, we have developed and
validated a TaqMan quantitative reverse transcription PCR (RT-qPCR) assay for TiLV, targeting a
conserved region within segment 10 of the genome. The RT-qPCR assay was efficient (mean ± SD:
96.71 ± 3.20%), sensitive with a limit of detection of 10 RNA viral copies per reaction, and
detected TiLV strains from different geographic regions including North America, South America,
Africa, and Asia. The intra- and inter-assay variability ranged over 0.18−1.41% and 0.21−2.21%,
respectively. The TaqMan RT-qPCR assay did not cross-react with other RNA viruses of fish,
including an orthomyxovirus, a betanodavirus, a picornavirus, and a rhabdovirus. Analysis of 93
proven-positive and 185 proven-negative samples yielded a diagnostic sensitivity of 96.8% and a
diagnostic specificity of 100%. The TaqMan RT-qPCR assay also detected TiLV RNA in infected
Nile tilapia liver tissue extracts following an experimental challenge study, and it successfully
detected TiLV RNA in SSN-1 (E-11 clone) cell cultures displaying cytopathic effects following
their inoculation with TiLV-infected tissue homogenates. Thus, the validated TaqMan RT-qPCR
assay should be useful for both research and diagnostic purposes. Additionally, the TiLV qPCR
assay returns the clinically relevant viral load of a sample which can assist health professionals
in determining the role of TiLV during disease investigations. This RT-qPCR assay could be
integrated into surveillance programs aimed at mitigating the effects of TiLVD on global tilapia
production.
KEY WORDS: Tilapia · Oreochromis spp. · Tilapia lake virus · Tilapia tilapinevirus · TaqMan ·
Quantitative PCR · Diagnostic accuracy
*Corresponding author: tomwaltzek@gmail.com
© The authors 2022. Open Access under Creative Commons by
Attribution Licence. Use, distribution and reproduction are unrestricted. Authors and original publication must be credited.
Publisher: Inter-Research · www.int-res.com
Dis Aquat Org 152: 147–158, 2022
148
1. INTRODUCTION
Tilapia lake virus disease (TiLVD), caused by
tilapia lake virus (TiLV), is a contagious disease in
cultured and wild tilapia (Oreochromis spp. and their
hybrids). TiLVD often causes mass mortality in naive
fish populations (Tattiyapong et al. 2020), with clinical signs such as lethargy, anorexia, and abnormal
swimming behavior (Surachetpong et al. 2020). Further, infected fish usually display gross lesions including exophthalmia (protruding eyes), skin darkening, ulcerated or hemorrhaged skin, and ascites
(Eyngor et al. 2014, Dong et al. 2017, Surachetpong
et al. 2017, 2020). TiLV is a single-stranded, negative-sense RNA virus with 10 genomic segments
(Eyngor et al. 2014, Bacharach et al. 2016, Surachetpong et al. 2017) encapsidated within enveloped
virus particles ranging from 50 to 100 nM in diameter
(Eyngor et al. 2014, Ferguson et al. 2014, del-Pozo et
al. 2017, Surachetpong et al. 2017). TiLV is the sole
species (Tilapia tilapinevirus) in the family Amnoonviridae (Adams et al. 2017).
Since the first report of TiLV in Ecuador and Israel
(Eyngor et al. 2014, Ferguson et al. 2014), the virus
has been detected in tilapia species in 15 other countries: USA (Al-Hussinee et al. 2018), Mexico (WOAH
2022), Colombia (Contreras et al. 2021), Peru (Pulido
et al. 2019), Egypt (Nicholson et al. 2017), Israel (Eyngor et al. 2014), Uganda and Tanzania (Mugimba et
al. 2018), India (Behera et al. 2018), Bangladesh
(Chaput et al. 2020, Debnath et al. 2020), Thailand
(Dong et al. 2017, Surachetpong et al. 2017), Chinese
Taipei (WOAH 2022), Malaysia (Amal et al. 2018),
Philippines (WOAH 2022), Vietnam (Tran et al.
2022), and Indonesia (Koesharyani et al. 2018).
Although TiLVD has not been fully investigated,
high morbidity and mortality associated with infections have been described in tilapia species,
including Nile tilapia O. niloticus, red hybrid tilapia
(Oreochromis spp.), mango tilapia Sarotherodon
galilaeus, redbelly tilapia Tilapia zilli, blue tilapia O.
aureus, and wild tilapia Tristamella simonis (Eyngor
et al. 2014, Ferguson et al. 2014, Surachetpong et al.
2017, Tattiyapong et al. 2017, Mugimba et al. 2018).
TiLV is also known to cause disease in other species
experimentally infected by intraperitoneal injection,
including red hybrid tilapia (Tattiyapong et al. 2017),
gray tilapia (O. niloticus × O. aureus) (Mugimba et
al. 2019), Mozambique tilapia O. mossambicus
(Waiyamitra et al. 2021), and zebrafish Danio rerio,
although zebrafish exposed by immersion did not
similarly succumb (Rakus et al. 2020). In other experimental studies, giant gourami Osphronemus goramy
were prone to TiLV infection, while warmer-water
fish species did not develop the disease (Jaemwimol
et al. 2018). An additional experimental study, again
by injection, also suggested the susceptibility of
ornamental African cichlids (Aulonocara spp.) to
TiLV with high mortality, clinical signs, and
histopathological findings similar to the infected
tilapia (Yamkasem et al. 2021). To date, the complete
genome sequences of TiLV from Thailand, Ecuador,
Israel, Peru, USA, and Bangladesh have been
deposited in the National Center for Biotechnology
Information GenBank database (Bacharach et al.
2016, Surachetpong et al. 2017, Al-Hussinee et al.
2018, Pulido et al. 2019, Subramaniam et al. 2019,
Ahasan et al. 2020, Chaput et al. 2020, Debnath et al.
2020). Genetic analysis of TiLV sequences originating from different countries revealed that the Israeli
TiLV and TiLV isolated from Asia and South America
shared a high sequence identity of 95−99% (Surachetpong et al. 2017, Al-Hussinee et al. 2018). TiLV
shares some common characteristics with rapidly
evolving negative-sense RNA viruses (e.g. orthomyxoviruses), and thus, there is concern that genetic
variation among TiLV strains may affect the sensitivity of current molecular assays. Thus, there is a need
to develop diagnostic methods that could be applied
to detect various TiLV isolates.
A number of diagnostic methods have been utilized for the detection of TiLV in fish tissues: (1)
molecular assays including reverse transcriptase
PCR (RT-PCR) (Eyngor et al. 2014, Dong et al. 2017,
Kembou Tsofack et al. 2017, Mugimba et al. 2018),
real-time RT-quantitative PCR (RT-qPCR) (Kembou
Tsofack et al. 2017, Tattiyapong et al. 2018, Waiyamitra et al. 2018), and RT loop-mediated isothermal
amplification (RT-LAMP) (Yin et al. 2019, Phusantisampan et al. 2020); (2) virus isolation in susceptible
cell lines (Eyngor et al. 2014, Kembou Tsofack et al.
2017, Behera et al. 2018), (3) in situ hybridization
(Bacharach et al. 2016, Dong et al. 2017, Behera et
al. 2018); and (4) immunohistochemistry (Piewbang
et al. 2021). Among these techniques, the RT-PCR,
semi-nested RT-PCR, nested RT-PCR, and RT-qPCR
assays have been commonly used for the detection of
TiLV, which all target segment 3 of the virus. However, none of these diagnostic assays have been fully
validated for the detection of TiLV from different
geographic locations. The objective of the current
study was to develop and validate a TaqMan RTqPCR assay for the detection of TiLV in RNA extracts
derived from fish tissues during field outbreaks and
laboratory challenge studies, as well as cell cultures
displaying cytopathic effects.
Megarani et al.: Tilapia lake virus TaqMan RT-qPCR
2. MATERIALS AND METHODS
2.1. In silico TaqMan RT-qPCR primer and
probe design
Eight TiLV genome sequences retrieved from GenBank were aligned by segment in MAFFT (Katoh &
Toh 2008) using default settings. The alignments for
each of the 10 segments were imported into Geneious R10 to generate a consensus sequence with the
threshold set to 100%. The consensus sequences for
each segment were then individually imported into
PrimerExpress v2.0 to design primers and hydrolysis
probes using default settings. They were scrutinized
to determine the primer and probe combination with
the lowest penalty value.
2.2. Generation of TiLV complementary
RNA standards
An endpoint RT-PCR reaction using a Qiagen
OneStep RT-PCR Kit was carried out in 30 μl volumes
containing 0.8 μM of each primer (TiLVstdF and
TiLVstdR), 0.4 μM of dNTP mix, 4.8 μl of nucleic acid
template, 1.2 μl of enzyme mix, 6 μl of 5× buffer, 6 μl
of 5× Q-solution, and 8.4 μl of molecular-grade water.
The reaction was carried out using a SimpliAmp
thermal cycler (Applied Biosystems) using the following conditions: 50°C for 30 min and 95°C for
15 min; followed by 30 cycles at 94°C for 30 s, 56°C
for 30 s and 72°C for 30 s; and a final elongation at
72°C for 5 min. The amplified product was subjected
to electrophoresis on a 1% agarose gel stained with
ethidium bromide. The PCR product was purified
using a QIAquick PCR Purification Kit (Qiagen) and
cloned using a TOPO® TA Cloning® Kit (ThermoFisher Scientific) according to the manufacturer’s
instructions. Recombinant plasmids were purified
using a QIAprep Spin Miniprep Kit (Qiagen) and linearized using the restriction enzyme NotI (New England Biolabs). In vitro transcription was carried out
with 1 μg of linearized plasmid DNA using an Ambion® MAXIscript® T3 In Vitro Transcription Kit
(Invitrogen) followed by DNase treatment and cleanup using RNeasy columns (Qiagen). The amount of
viral complementary RNA (cRNA) transcripts was
determined by fluorometry using a Qubit RNA Broad
Range (BR) Assay Kit (Invitrogen) and a Qubit 2.0
fluorometer and converted to molecular copies using
the formula described by Krieg (1990). The cRNA
stock was then serially diluted 10-fold using nuclease-free water and stored at −80°C until use.
149
2.3. Detection of TiLV RNA by the TaqMan
RT-qPCR assay
The RT-qPCR assays were carried out in triplicate,
using TaqMan™ Fast Virus 1-Step Master Mix (Applied Biosystems), in 20 μl volumes containing
0.9 μM of each primer (TiLV-F and TiLV-R), 0.25 μM
of probe (TiLV-P), 4 μl of nucleic acid template or
RNA standards, 5 μl of 4× universal RT-qPCR mix,
and 8 μl of molecular-grade water. The VetMAX™
Xeno™ Internal Positive Control was added into
the fourth well of every sample, containing 0.8 μl
of 25× VetMAX™ Xeno™ Internal Positive Control VIC™ Assay (Applied Biosystems), 1 μl of VetMAX™
Xeno™ Internal Positive Control RNA (Applied
Biosystems), 4 μl of nucleic acid template, 5 μl of 4×
universal RT-qPCR mix, and 9.2 μl of moleculargrade water. In addition, 50 ng of TiLV-negative
tilapia RNA was added to the RT-qPCR reactions
for RNA standards. The reaction mixtures were
loaded in 96-well polypropylene plates (Applied Biosystems) sealed with 50 μm polyolefin film (Applied
Biosystems), and at least 3 no-template negative controls (molecular-grade water) were included. Reactions were carried out in a QuantStudio 5 Real-Time
PCR System (Applied Biosystems) using the fast protocol thermocycling conditions: 50°C for 5 min and
95°C for 20 s; followed by 40 cycles at 95°C for 3 s
and 62°C for 30 s. The result was interpreted as positive if the calculated cycle threshold (Ct) from the 6carboxy-X-rhodamine (ROX)-normalized 6-carboxyfluorescein (FAM) signal exceeded the threshold
assigned by the Applied Biosystems software. As
specified by the manufacturer, a Ct value returned
by the VetMAX™ Xeno™ Internal Positive Control
(IPC) assay of between 29 and 33 indicates that the
sample is free of PCR inhibitors.
2.4. Estimation of the TiLV TaqMan RT-qPCR
assay parameters
Triplicate 10-fold dilutions of the TiLV cRNA standard (107−101 copies) were used in each of the 19
experiments (plates) to estimate the correlation coefficient (R2), y-intercept, slope, efficiency, dynamic
range, analytical sensitivity, repeatability, and reproducibility of the RT-qPCR assay as previously described (Clark et al. 2018, Stilwell et al. 2018). The
RT-qPCR assay was carried out based on the reactions and methods described in Section 2.3. The RTqPCR assay limit of detection (LOD or analytical sensitivity) was defined as the lowest dilution at which
Dis Aquat Org 152: 147–158, 2022
150
50% of positive samples (wells) were detected (OIE
2021). The coefficient of variation (CV% = [SD/
mean] × 100%) for intra-assay (repeatability) and
inter-assay (reproducibility) variability were calculated from the mean and SD of the Ct values within
(repeatability) using either the data generated from a
single representative RT-qPCR plate (cRNA standards [107−101 copies] in triplicate) or among (reproducibility) the 19 plates. For the analytical specificity, the RT-qPCR assay was tested against RNA
extracts from infected tissues or isolates in cell
culture supernatant including an orthomyxovirus
(infectious salmon anemia virus), a betanodavirus
(red-spotted grouper nervous necrosis virus), a picornavirus (clownfish picornavirus), and a rhabdovirus
(infectious hematopoietic necrosis virus).
2.5. TiLV challenge study
A TiLV challenge study was performed for the purpose of generating known positive and negative control tilapia (liver) samples for the development and
validation of the TiLV RT-qPCR assay. Sixty juvenile
Nile tilapia were obtained from a commercial producer in Florida, USA. They were weighed (mean =
54.5 g, SD = 10.4 g) and acclimated for 30 d in a 567 l
tank receiving single-pass dechlorinated municipal
water maintained at 25.5 ± 0.5°C. Water flow-rate
was set such that complete exchange occurred 4
times per hour and the tank was supplemented with
multiple airstones. Water quality parameters (pH,
ammonia, nitrite, hardness, dissolved oxygen) were
recorded once a week using a Fish Farming Test Kit
Model FF-1A (Hach) and a portable dissolved oxygen meter (Hach HQ30D). No ammonia or nitrite was
detected, the pH consistently measured 7.0, the average total hardness was 164.4 mg l−1, and the average
dissolved oxygen was 6.6 mg l−1. Fish were maintained at a 12:12 h day:night photoperiod and fed 4%
of their body weight per day with a commercial
tilapia pellet diet.
After the 30 d acclimation period, 50 tilapia were
haphazardly assigned to 1 of 6 tanks (84 l capacity).
Husbandry continued as described above during the
acclimation period. Fish in the treatment groups
received either 200 μl (high dose) or 100 μl (low dose)
of TiLV supernatant with a viral titer of 3.05 ×
105 TCID50 ml−1 (methods described below) by intracoelomic (IC) injection. The experimental infection
included duplicate high and low dose treatment
tanks (10 tilapia tank−1) as well as a single control
tank (receiving cell culture supernatant without
virus) for both the high and low dose treatments (5
tilapia tank−1). Fish were monitored for external
lesions and behavioral abnormalities for 22 d post
virus exposure. Daily mortalities were weighed and
necropsied to obtain liver tissues for virus isolation
and RNA extraction for testing against the TiLV TaqMan RT-qPCR assay (methods described below).
Surviving tilapia at 22 d post virus exposure and the
unexposed fish (negative controls) were euthanized
with an overdose of buffered tricaine methanesulfonate (1000 mg l−1) and processed for virus isolation
and RNA extraction to be tested using the TiLV TaqMan RT-qPCR assay.
The TiLV isolate (WVL18053-01A) used for injection has been described previously (Al-Hussinee et
al. 2018) and was prepared from a frozen stock inoculated into a 175 cm2 flask containing confluent
striped snakehead (SSN-1; E11 clone) cells. The
SSN-1 cells were maintained at 25°C and grown in
L-15 media (Leibovitz; Gibco) containing 10% fetal
bovine serum (FBS; Gibco) with 1× antibiotic/
antimycotic (AA; Gibco), resulting in a concentration
of 100 IP penicillin ml−1, 100 μg streptomycin ml−1,
and 0.25 μg amphotericin B ml−1. After the cytopathic
effect (CPE) was complete, the supernatant was clarified by centrifugation at 5000 × g (20 min at 10°C).
The clarified supernatant was then used for IC injection as well as to determine the TiLV titer by TCID50
endpoint analysis using the Reed-Muench method
(Reed & Muench 1938). The viral titer was determined by performing 10-fold dilutions of the clarified
supernatant onto replicate wells (5 replicates dilution−1) of a 96-well plate (200 μl well−1) containing
confluent SSN-1 cells.
The presence/absence of viable TiLV in the liver
tissues of dead fish and fish surviving 22 d post virus
exposure (including controls) was evaluated using
standard virological methods (Ganzhorn & LaPatra
1994). Tilapia were necropsied to obtain liver tissue
samples for virus isolation and RNA extraction for
testing against the TiLV TaqMan RT-qPCR assay (see
below). For virus isolation, each liver tissue sample
was diluted 1:25 in L-15 media containing 2% FBS
and then homogenized at high speed with a stomacher (Seward stomacher 80, Biomaster Lab system)
for 30 s. The liver tissue homogenates were then clarified by centrifugation at 5000 × g (20 min at 10°C) to
pellet cellular debris. The clarified supernatant was
added to an equal volume of L-15 media containing
2% FBS and 2% AA (Gibco) to make a final dilution
of 1:50. The presence/absence of TiLV in the clarified
tissue homogenate samples was assessed by inoculating each sample onto replicate wells (5 replicates
Megarani et al.: Tilapia lake virus TaqMan RT-qPCR
sample−1) of a 96-well plate (200 μl well−1) containing
confluent SSN-1 cells. The plates were incubated at
25°C and observed daily for CPE for 14 d, at which
time blind passages were performed on all samples
not showing CPE. After an additional 14 d, all blindpassaged samples were scored. Supernatants from
all samples that resulted in CPE and those that did
not result in CPE on the initial passage or after the
blind passage were tested using the TiLV TaqMan
RT-qPCR assay as described below.
Liver tissue and cell culture supernatant samples
generated during the challenge study were subjected to RNA extraction using an RNeasy Mini Kit
following the manufacturer’s instructions (Qiagen).
The RNA concentration of each sample was measured using a Qubit 2.0. Samples were diluted to
12.5 μg μl−1 for use in the downstream TiLV TaqMan
RT-qPCR assay.
2.6. Estimation of TiLV TaqMan RT-qPCR assay
diagnostic sensitivity and specificity
The diagnostic sensitivity and specificity of the
TiLV TaqMan RT-qPCR assay were determined by
evaluating its performance on RNA tissue extracts
from reference populations of fish defined by their
TiLV exposure status. The proven-positive reference
group included fish that had received an IC injection
of TiLV (high and low dose treatment groups, N = 38;
see Section 2.5) and fish derived from field outbreaks
of TiLVD that had previously been confirmed to be
positive by another RT-PCR assay (described below).
The proven-negative reference group (not exposed
to TiLV) included the control fish from the challenge
study (N = 10) and fish from a health inspection of
apparently healthy Florida-farmed Nile tilapia fingerlings (N = 175) that had previously tested negative by conventional TiLV RT-PCR (Eyngor et al.
2014), with no history of exposure. The liver was the
organ used to generate all tissue RNA extracts,
except for the Nile tilapia from the health inspection
in Florida in which kidney−liver−spleen tissues were
pooled by individual.
The known-exposed reference group also incorporated RNA tissue extracts derived from a range of
field settings. Thirty-one red tilapia and 14 Nile
tilapia (N = 45) samples were collected from various
populations in Thailand experiencing TiLV outbreaks at the time of sampling. The sampled tilapia
varied in size from fry to broodstock reared in cages
within rivers, earthen ponds, or cement ponds reared
indoors. More than half (27/45) of these Thai tilapia
151
displayed clinical signs consistent with TiLVD, 16
were subclinical, and the clinical state of 2 fish was
not recorded. These 45 samples were confirmed to
be TiLV positive by both conventional RT-PCR (Eyngor et al. 2014) and SYBR Green RT-qPCR (Tattiyapong et al. 2018) assays. Samples from additional
TiLV field outbreaks, involving Nile tilapia in Peru
(N = 1) and Egypt (N = 4) (Nicholson et al. 2017),
were included in the known-exposed reference
group as they tested positive for TiLV by the same 2
RT-PCR assays. A red tilapia (70 g) from Malaysia
(Waiyamitra et al. 2018), a Nile tilapia from Indonesia
(800 g) reared in cages within natural waterways,
and 2 TiLV isolates recovered from Nile tilapia
reared in the USA (Ahasan et al. 2020) were included
after they tested positive for TiLV by conventional
RT-PCR (Eyngor et al. 2014). A red tilapia cultured in
Colombia (12 g), which was sampled during a TiLV
outbreak and displayed clinical signs of TiLVD (E.
Pulido Bravo & P. Nicholson unpubl. data), was also
included as it tested positive by nested RT-PCR
(Kembou Tsofack et al. 2017).
2.7. Statistical methods
The difference in mean viral load between tilapia
showing clinical signs of TiLVD and those that were
subclinical, from the experimental challenge study
and the Thailand field outbreaks, were analyzed by
comparing the mean Ct values of each group. The
Shapiro-Wilk test of normality was used to assess the
distribution of Ct values. An independent t-test or a
Mann-Whitney test was utilized when the data distribution was normal or skewed, respectively. In all
analyses, results were considered statistically significant at p < 0.05 and confidence intervals for diagnostic sensitivity and specificity were set at 95%. Data
were examined by commercial software (IBM SPSS
Statistics, version 28).
3. RESULTS
3.1. In silico TiLV TaqMan RT-qPCR primer
and probe design
The consensus sequence of segment 10, encoding
a hypothetical protein, returned the only suitable
primers (TiLV-F and TiLV-R) and probe (TiLV-P)
combination (Table 1, Fig. 1). An in silico analysis of
the primers and probe combination for the developed
TiLV RT-qPCR assay revealed no mismatches for
Dis Aquat Org 152: 147–158, 2022
152
Table 1. Primers and probe sequences used in the tilapia lake virus (TiLV) TaqMan RT-qPCR and endpoint PCR assays
Primer/probe
name
Sequence (5’−3’)
TiLVstdF
TiLVstdR
TiLV-F
TiLV-R
TiLV-P
TGAGTGTGGCAGATTATTTGTCA
CGGAAAATCGAGATAGGTCACTC
GGCAAGAAAGCTGCTTCAAAGA
CGCTCTCGTCAGCACCATAC
CGAAGTTGGAAGAATG
Melting
temp. (°C)
Position in
gene (5’−3’)
Amplicon size (nt)
including primers
59.2
62.8
56.3
58
45
2−24
282−304
91−112
135−154
115−130
303
64
Fig. 1. Alignment of partial (64 bp) segment 10 sequences for 13 tilapia lake virus (TiLV) strains illustrating the in silico specificity of the TaqMan RT-qPCR primers (TiLV-F and TiLV-R) and TaqMan probe (TiLV-P). TiLV strains were identified by a
unique identifier, the country of isolation, and the associated GenBank accession number
many TiLV isolates (Thailand = 7, Colombia = 1,
Israel = 2, Indonesia = 1), 1 mismatch for some TiLV
strains (Egypt = 2, Malaysia = 1, Thailand = 1, Peru =
1, USA = 2, Bangladesh = 3), and 2 mismatches for
a few TiLV strains (Ecuador = 1, Egypt = 1, Thailand =
1) (Fig. S1 in the Supplement at www.int-res.com/
articles/suppl/d152p147_supp.pdf).
a betanodavirus (red-spotted grouper nervous necrosis virus), a picornavirus (clownfish picornavirus),
and a rhabdovirus (infectious hematopoietic necrosis
virus) were all negative. The IPC was positive for all
samples, and the Ct values ranged between 29.41
and 32.17, indicating that PCR inhibitors were not
present in the RNA extracts.
3.2. Estimation of TiLV TaqMan RT-qPCR
assay parameters
3.3. TiLV challenge study
The amplification plot revealed that the RT-qPCR
assay was linear over 7 orders of magnitude (107−101
copies) (Fig. 2A). The mean parameters (± SD) for the
RT-qPCR assay averaged over the 19 experiments
(plates) were as follows: slope = −3.41 ± 0.08, y-intercept = 40.93 ± 0.67, R2 = 0.996 ± 0.002, and efficiency =
96.71 ± 3.20% (Fig. 2B). The LOD of the assay (analytical sensitivity) was determined to be 10 copies of
TiLV cRNA (positive in 52/57 reactions, or 91.2% of
the reactions). The CV of intra-and inter-assay mean
Ct values ranged from 0.18 to 1.41% and from 0.21 to
2.21%, respectively (Table 2). For the analytical
specificity, the previously tested positive samples for
an orthomyxovirus (infectious salmon anemia virus),
Between 7 and 22 d post virus exposure, tilapia in
the low and high dose treatments exhibited clinical
signs of TiLVD, including lethargy, gill pallor, cutaneous hemorrhages, ascites, liver pallor, enlarged
gall bladder, splenomegaly, and hemorrhages in the
brain. Mortality began at 7 d post virus exposure and
continued until the trial was terminated on Day 22
with cumulative mortality of 75% (15/20) and 90%
(18/20) in the low and high dose treatments, respectively. All 10 negative control fish appeared healthy
throughout the experiment. One fish from each of the
low and high dose treatments was found dead and
determined to be too autolyzed for downstream processing for virus isolation or testing using the TiLV
TaqMan RT-qPCR assay. TiLV was isolated from the
Megarani et al.: Tilapia lake virus TaqMan RT-qPCR
A
153
10
1
Δ Rn
0.274219
0.1
0.01
0.001
2
TiLV
B
4
6
8
10
12
14
16
18
20
22
24
Cycle number
26
28
30
32
34
36
38
40
45
40
Ct value
35
30
25
20
15
Slope = -3.41 ± 0.08
y-intercept: 40.93 ± 0.67
Correlation coefficient: 0.996 ± 0.002
Efficiency: 96.71 ± 3.20
10
5
0
1
10
100
1000
10 000
Copy number
100 000
1 000 000
10 000 000
Fig. 2. Tilapia lake virus (TiLV) TaqMan RT-qPCR assay (A) amplification plot and (B) standard curve generated using triplicate 10-fold serial dilutions of the TiLV complementary RNA (cRNA) standard ranging from 107 to 101 copies. In (A), the red
curves indicate amplification of individual TiLV TaqMan RT-qPCR assays. The horizontal red line indicates the automatic
threshold assigned by the Applied Biosystems software. The normalized reporter (Rn) is calculated as the ratio of the fluorescence emission intensity of the reporter dye (FAM) divided by the fluorescence emission intensity of the passive reference dye
(ROX). The ΔRn is the magnitude of the signal generated during the PCR at each time point as determined by the following
equation: ΔRn = (Rn+) − (Rn). Rn+ is the Rn value of a reaction containing all components, including the template, and Rn is the
Rn value of an unreacted sample. In (B), the mean RT-qPCR assay parameters (± SE) averaged over the 19 experiments
(plates) are provided. Ct: cycle threshold value
liver of 16/19 tilapia in the high dose treatment,
12/19 tilapia in the low dose treatment, and none
(0/10) of the negative control tilapia. Of the samples
positive for virus isolation, CPE was observed on the
initial passage for all samples except 1 sample generated from the low dose treatment that only displayed
CPE following the blind passage. Thus, 28/38 tilapia
injected with TiLV were positive by virus isolation,
resulting in a diagnostic sensitivity of 73.7% (95%
confidence limits: 56.6−86.0%). Supernatants from
all samples displaying CPE were positive using the
TiLV TaqMan RT-qPCR assay. Samples that did not
show CPE after blind passage were confirmed to
be negative using the RT-qPCR assay. TiLV was
detected by RT-qPCR in the liver RNA extracts of
19/19 tilapia in the high dose treatment, 16/19 tilapia
in the low dose treatment, and none (0/10) of the
negative control tilapia. Among the 10 virus-injected
fish that were negative by virus isolation, 5 generated high Ct values (range 33.20−39.24), 2 generated
low Ct values (14.18 and 19.04), and 3 samples
also tested negative using the TiLV TaqMan RT-
Dis Aquat Org 152: 147–158, 2022
154
Table 2. Inter-assay (reproducibility) and intra-assay (repeatability) of the tilapia lake virus (TiLV) TaqMan RT-qPCR assay. To
determine reproducibility, the reactions for each complementary RNA (cRNA) standard (107−101 copies) were run in triplicate
across 19 experiments (plates). To determine repeatability, data obtained in a single representative TaqMan RT-qPCR plate
using a cRNA standard (107−101 copies) in triplicate are shown. Ct: threshold cycle number; CV: coefficient of variation
Standard
dilution
Inter-assay reproducibility
Ct
CV
No. of wells
Mean
SD
(%)
positive (n = 57)
Intra-assay repeatability
Ct
CV
No. of wells
Mean
SD
(%)
positive (n = 3)
107
106
105
104
103
102
101
17.21
20.55
23.85
27.18
30.57
34.08
37.77
17.71
21.01
24.23
27.57
30.92
34.55
37.85
0.11
0.04
0.09
0.10
0.15
0.49
0.84
0.62
0.21
0.36
0.35
0.49
1.44
2.21
57
57
57
57
57
57
52
qPCR assay. The majority of these virus isolation
negative samples were derived from the survivors
(7/10 samples).
3.4. Estimation of TiLV TaqMan RT-qPCR assay
diagnostic sensitivity and specificity
In total, 93 TiLV proven-positive RNA extracts and
185 TiLV proven-negative RNA extracts were used to
estimate the diagnostic performance (Table 3).
Among 93 TiLV-positive RNA extracts, 90 samples
tested positive by the current TaqMan RT-qPCR
assay, indicating a diagnostic sensitivity of 96.8%
(95% confidence limits: 90.9−99.3%). Diagnostic
specificity of 100% (98.1−100%) was generated after
185 TiLV-negative RNA extracts all tested negative.
3.5. Difference in viral load between clinically
diseased and subclinically infected tilapia
Using an independent t-test, we found that the
mean viral loads of fish with clinical signs (mean:
82 048 404 viral genome copies) were significantly
higher than surviving fish (mean: 31 viral genome
copies) in the experimental challenge study (t-test,
t33 = −25.736, p = 0.001). For the samples originating
from field outbreaks in Thailand, we calculated the
statistical difference between the viral load of the
same 2 groups (clinically diseased vs. subclinically
infected) using a Mann-Whitney test. Again, tilapia
displaying clinical signs of disease had higher viral
loads (mean: 24 171 293 viral genome copies) as compared to those with subclinical infections (mean:
8 786 247 viral genome copies) (Mann-Whitney U =
108, p = 0.007).
0.08
0.04
0.06
0.05
0.17
0.25
0.53
0.48
0.18
0.24
0.18
0.55
0.72
1.41
3
3
3
3
3
3
3
4. DISCUSSION
The availability of rapid, cost-effective, and validated molecular diagnostic assays capable of detecting TiLV has become increasingly important given
the global emergence and impact of TiLV strains
(WOAH 2022). In this study, a TiLV TaqMan RTqPCR targeting a conserved region of segment 10 of
the TiLV genome was developed, validated, and
shown to successfully detect TiLV in tilapia tissue
RNA extracts derived from TiLVD field outbreaks in
South America (Colombia, Peru), Africa (Egypt), and
Asia (Indonesia, Malaysia, Thailand) (Table 3). In
contrast to the TiLV samples tested in this study from
Colombia, Egypt, USA, Indonesia, and Malaysia, the
tested samples from Peru and Thailand were not
specifically tied to the TiLV partial sequences presented in Fig. S1. Compared to previously developed
TiLV RT-PCR and RT-qPCR assays, our study included more samples collected from disparate geographic regions to generate validation data for the
TiLV TaqMan RT-qPCR (Eyngor et al. 2014, Dong
et al. 2017, Kembou Tsofack et al. 2017, Mugimba
et al. 2018, Tattiyapong et al. 2018, Waiyamitra et al.
2018). The TaqMan RT-qPCR assay also detected
TiLV RNA in infected Nile tilapia liver tissue extracts
following an experimental challenge study with a
TiLV strain isolated from diseased Nile tilapia in the
USA (Ahasan et al. 2020). Finally, the TaqMan RTqPCR assay successfully detected TiLV RNA in SSN1 (E-11 clone) cell cultures displaying CPE following
their inoculation with TiLV-infected tissue homogenates. Thus, the validated TaqMan RT-qPCR assay
should be useful for both research and diagnostic
purposes.
An in silico analysis of the primers and probe combination for the developed TiLV TaqMan RT-qPCR
Megarani et al.: Tilapia lake virus TaqMan RT-qPCR
155
Table 3. Description of the tilapia lake virus (TiLV) proven-positive and TiLV proven-negative samples used to estimate the
diagnostic performance of the TiLV TaqMan RT-qPCR. SYBR Green RT-qPCR (Tattiyapong et al. 2018); conventional
RT-PCR(Eyngor et al. 2014); nested RT-PCR (Kembou Tsofack et al. 2017). IC: intracoelomic
Origin
Sample
Type
Florida,
Infection
USA
trial
Florida,
Infection
USA
trial
Florida,
Health
USA
inspection
Thailand
Field
outbreak
Peru
Field
outbreak
Egypt
Field
outbreak
Colombia
Sample
number
Initial tests
Initial tests
RT-qPCR
Reference
positive (current study)
positive
38
TiLV IC injection
38
35
Current study
10
Sham IC Injection
0
0
Current study
175
Conventional RT-PCR
0
0
Current study
45
SYBR Green RT-qPCR
& conventional RT-PCR
SYBR Green RT-qPCR
& conventional RT-PCR
SYBR Green RT-qPCR
& conventional RT-PCR
45
45
1
1
4
4
W. Surachetpong & P. Nicholson
(unpubl. data)
W. Surachetpong & P. Nicholson
(unpubl. data)
Nicholson et al. (2017) (our Fig. S1,
GenBank acc. nos. ON099425,
ON099426, ON990427)
E. A. Pulido Bravo & P. Nicholson
(unpubl. data) (our Fig. S1,
GenBank acc. no. OL539829)
Waiyamitra et al. (2018) (our Fig. S1,
GenBank acc. no. OL539827)
W. Surachetpong & P. Nicholson
(unpubl. data) (our Fig. S1,
GenBank acc. no. OL539828)
Ahasan et al. (2020) (our Fig. S1,
GenBank acc. nos. MN193522,
MN193532)
1
4
Field
outbreak
1
Nested RT-PCR
1
1
Field
outbreak
Indonesia
Field
outbreak
1
Conventional RT-PCR
1
1
1
Conventional RT-PCR
1
1
2
Conventional RT-PCR
2
2
Malaysia
USA
Field
outbreak
assay revealed between 0 and 2 mismatches for 24
TiLV strains from different geographic localities
(Thailand, USA, Colombia, Peru, Ecuador, Israel,
Egypt, Indonesia, Malaysia, and Bangladesh) (Fig. S1).
Primer and probe mismatches can affect assay performance, including assay efficiency (Clark et al.
2018, Stilwell et al. 2018). Mapping of the probe
and/or primer sequences to the same 24 TiLV strains
revealed a higher number of mismatches for previously developed RT-PCR (Eyngor et al. 2014), nested
RT-PCR (Kembou Tsofack et al. 2017), SYBR Green
RT-qPCR (Tattiyapong et al. 2018), and TaqMan RTqPCR (Waiyamitra et al. 2018) assays (Figs. S2−S4).
The robustness of the newly developed TaqMan RTqPCR assay for disease diagnostics was confirmed
with the positive results of the isolates from Egypt
and Malaysia, even though mismatches were detected. In addition, while another TaqMan RT-qPCR
assay (Waiyamitra et al. 2018) could not detect TiLV
in Nile tilapia tissues samples from Egypt, our assay
successfully confirmed the presence of the virus.
Similarly, the Colombian sample was positive by
both a nested RT-PCR (Kembou Tsofack et al. 2017)
and the TaqMan RT-qPCR assay presented here,
while the same sample tested negative by RT-PCR
(Eyngor et al. 2014) and by a different TaqMan RTqPCR assay (Waiyamitra et al. 2018).
Analysis of the analytic performance of the TiLV
TaqMan RT-qPCR assay revealed that it was efficient with a high correlation coefficient, and it was
also sensitive, specific, repeatable, and reproducible (Table 2, Fig. 2). The TiLV TaqMan RTqPCR assay detected 10 copies of in vitro transcribed TiLV RNA in 91.2% of the reactions and
did not amplify the other tested RNA viruses of
fish (infectious salmon anemia virus, red-spotted
grouper nervous necrosis virus, clownfish picornavirus, and infectious hematopoietic necrosis
virus). The TiLV TaqMan RT-qPCR assay possessed
a mean efficiency of 96.7% over a linear range
from 101 to 107 copies of TiLV cRNA standards. The
TiLV TaqMan RT-qPCR assay developed in this
study more accurately reflects the true analytical
performance as compared to previously designed
RT-qPCR assays that used plasmid DNA standards
(Tattiyapong et al. 2017, Waiyamitra et al. 2018)
because our in vitro transcribed RNA standards
better imitate the RNA genome of TiLV.
Dis Aquat Org 152: 147–158, 2022
156
The diagnostic performance of the TiLV TaqMan
RT-qPCR assay was evaluated using tilapia RNA tissue extracts originating from various TiLVD field outbreaks, a TiLV experimental challenge study, and a
health inspection of a tilapia producer. The assay
diagnostic sensitivity was 96.8% (95% confidence
limits: 89.9−99.1%) and the diagnostic specificity
was 100% (97.5−100%) (Table 4). The TiLV TaqMan
RT-qPCR developed in this study generated Ct values ranging from 39.22 to 11.74, equivalent to 5 to
537 744 640 viral genome copies, in tilapia tissue
RNA extracts originating from TiLV field outbreaks
and our TiLV experimental challenge study. Moribund tilapia, originating from field outbreaks in
Thailand and our experimental challenge study, had
higher viral loads as compared to subclinically
infected animals. These data underscore the ability
of the TiLV TaqMan RT-qPCR assay to detect TiLV
RNA in tissue extracts from fish with high viral loads
(e.g. lethal systemic infection) as well as those with
low to moderate viral loads (e.g. inapparent infections in individuals with low susceptibility, individuals in an early course of TiLVD, or those in a late
course of TiLVD [i.e. recovering]). As expected,
highly sensitive molecular assays (e.g. semi-nested
RT-PCR and RT-qPCR assays) have been shown to be
superior to less sensitive testing methods (e.g. RTPCR and virus isolation) in detecting TiLV in tissues
from fish with inapparent infections (Tattiyapong et
al. 2017, Liamnimitr et al. 2018, Senapin et al. 2018,
Waiyamitra et al. 2018). Additionally, the presented
TiLV qPCR assay returns the clinically relevant viral
load of a sample which can assist health professionals in determining the role of TiLV during disease
investigations (e.g. high TiLV loads are expected in
animals displaying symptoms of TiLVD).
Analysis of our experimental challenge study data
set confirmed that virus isolation is less sensitive than
the TiLV TaqMan RT-qPCR assay. The TiLV TaqMan
RT-qPCR detected viral RNA in certain samples in
which virus isolation was negative. This discrepancy
can be explained by the expected lower sensitivity of
virus isolation as compared to the RT-qPCR assay,
Table 4. Estimation of the tilapia lake virus (TiLV) TaqMan
RT-qPCR assay diagnostic sensitivity and specificity
Expected
TiLV status
Positive
Negative
Total
TaqMan RT-qPCR
Positive Negative
90
0
90
3
185
188
Total
93
185
278
that the virus was no longer viable, and/or there
were neutralizing antibodies in the sample. Thus,
using virus isolation as a sole diagnostic test might
result in false negative results in the case of subclinically infected fish (i.e. fish with low viral loads). The
2 samples testing negative by virus isolation and positive by RT-qPCR with low Ct values (i.e. high viral
loads) were unexpected results and may have resulted from errors that occurred during virus isolation. The 3 fish that tested negative by both assays
may never have become infected with TiLV (e.g.
error during injection or fish were refractory to infection at the challenge dose), the virus may have been
cleared by the immune system, or the infection was
below the LOD of both assays. Some tilapia exposed
to TiLV mount an immune response resulting in viral
clearance, and these survivors develop immunity
that protects them from disease if re-exposed to the
virus (Pierezan et al. 2020, Tattiyapong et al. 2020). If
these 3 fish never became infected and/or cleared
the virus, then we underestimated the diagnostic
sensitivity for the TiLV virus isolation and RT-qPCR
assays.
Based on the analytic and diagnostic performance
of the developed TiLV qPCR assay, we recommend
its use and continued validation for the diagnosis and
surveillance of this globally emerging viral pathogen. To our knowledge, this is the first study to report
both the analytic (stage 1) and diagnostic (stage 2)
performance for a TiLV RT-qPCR assay as outlined
by the OIE for diagnostic assay validation (OIE 2021).
An inter-laboratory ring trial involving 6 laboratories
is underway as part of evaluating the reproducibility
(stage 3) of the TiLV TaqMan RT-qPCR assay (Subramaniam et al. 2022).
Acknowledgements. We thank Dr. Edgar Andrés Pulido
Bravo for providing the Colombian sample in this study. This
study was funded by USDA National Institute of Food and
Agriculture (grant number 2019-67030-29840).
LITERATURE CITED
Adams MJ, Lefkowitz EJ, King AMQ, Harrach B and others
(2017) Changes to taxonomy and the international code
of virus classification and nomenclature ratified by the
International Committee on Taxonomy of Viruses (2017).
Arch Virol 162:2505−2538
Ahasan MS, Keleher W, Giray C, Perry B and others (2020)
Genomic characterization of tilapia lake virus isolates
recovered from moribund Nile tilapia (Oreochromis
niloticus) on a farm in the United States. Microbiol
Resour Announc 9:e01368-19
Al-Hussinee L, Subramaniam K, Ahasan MS, Keleher B,
Waltzek TB (2018) Complete genome sequence of a
Megarani et al.: Tilapia lake virus TaqMan RT-qPCR
tilapia lake virus isolate. Genome Announc 6:e00580-18
Amal MNA, Koh CB, Nurliyana M, Suhaiba M and others
(2018) A case of natural co-infection of Tilapia Lake
Virus and Aeromonas veronii in a Malaysian red hybrid
tilapia (Oreochromis niloticus × O. mossambicus) farm
experiencing high mortality. Aquaculture 485:12−16
Bacharach E, Mishra N, Briese T, Zody MC and others
(2016) Characterization of a novel orthomyxo-like virus
causing mass die-offs of tilapia. MBio 7:e00431-16
Behera BK, Pradhan PK, Swaminathan TR, Sood N and others (2018) Emergence of Tilapia Lake Virus associated
with mortalities of farmed Nile tilapia Oreochromis
niloticus (Linnaeus 1758) in India. Aquaculture 484:
168−174
Chaput DL, Bass D, Alam MM, Al Hasan N and others
(2020) The segment matters: probable reassortment of
Tilapia Lake Virus (TiLV) complicates phylogenetic
analysis and inference of geographical origin of new isolate from Bangladesh. Viruses 12:258
Clark AS, Behringer DC, Moss Small J, Waltzek TB (2018)
Partial validation of a TaqMan real-time quantitative
PCR assay for the detection of Panulirus argus virus 1.
Dis Aquat Org 129:193−198
Contreras H, Vallejo A, Mattar S, Ruiz L, Guzmán C,
Calderón A (2021) First report of tilapia lake virus emergence in fish farms in the department of Córdoba,
Colombia. Vet World 14:865−872
Debnath PP, Delamare-Deboutteville J, Jansen MD, Phiwsaiya K and others (2020) Two-year surveillance of tilapia
lake virus (TiLV) reveals its wide circulation in tilapia
farms and hatcheries from multiple districts of Bangladesh. J Fish Dis 43:1381−1389
del-Pozo J, Mishra N, Kabuusu R, Cheetham S and others
(2017) Syncytial hepatitis of tilapia (Oreochromis niloticus L.) is associated with orthomyxovirus-like virions in
hepatocytes. Vet Pathol 54:164−170
Dong HT, Siriroob S, Meemetta W, Santimanawong W and
others (2017) Emergence of tilapia lake virus in Thailand
and an alternative semi-nested RT-PCR for detection.
Aquaculture 476:111−118
Eyngor M, Zamostiano R, Kembou Tsofack JE, Berkowitz A
and others (2014) Identification of a novel RNA virus
lethal to tilapia. J Clin Microbiol 52:4137−4146
Ferguson HW, Kabuusu R, Beltran S, Reyes E, Lince JA, del
Pozo J (2014) Syncytial hepatitis of farmed tilapia, Oreochromis niloticus (L.): a case report. J Fish Dis 37:
583−589
Ganzhorn J, LaPatra SE (1994) General procedures for virology. In: Thoesen JC (ed) Suggested procedures for the
detection and identification of certain finfish and shellfish pathogens, 4th edn. Fish Health Section, American
Fisheries Society, Bethesda, MD
Jaemwimol P, Rawiwan P, Tattiyapong P, Saengnual P,
Kamlangdee A, Surachetpong W (2018) Susceptibility of
important warm water fish species to tilapia lake virus
(TiLV) infection. Aquaculture 497:462−468
Katoh K, Toh H (2008) Recent developments in the MAFFT
multiple sequence alignment program. Brief Bioinform 9:
286−298
Kembou Tsofack JE, Zamostiano R, Watted S, Berkowitz A
and others (2017) Detection of tilapia lake virus in clinical samples by culturing and nested reverse transcription-PCR. J Clin Microbiol 55:759−767
Koesharyani I, Gardenia L, Widowati Z, Khumaira K, Rustianti D (2018) Studi kasus infeksi Tilapia Lake Virus
157
(TiLV) pada ikan nila (Oreochromis niloticus). J Riset
Akuakult 13:85−92
Krieg PA (1990) Improved synthesis of full-length RNA
probe at reduced incubation temperatures. Nucleic
Acids Res 18:6463
Liamnimitr P, Thammatorn W, U-thoomporn S, Tattiyapong
P, Surachetpong W (2018) Non-lethal sampling for
Tilapia Lake Virus detection by RT-qPCR and cell culture. Aquaculture 486:75−80
Mugimba KK, Chengula AA, Wamala S, Mwega ED and
others (2018) Detection of tilapia lake virus (TiLV) infection by PCR in farmed and wild Nile tilapia (Oreochromis
niloticus) from Lake Victoria. J Fish Dis 41:1181−1189
Mugimba KK, Tal S, Dubey S, Mutoloki S, Dishon A,
Evensen A, Munang’andu HM (2019) Gray (Oreochromis
niloticus × O. aureus) and red (Oreochromis spp.) tilapia
show equal susceptibility and proinflammatory cytokine
responses to experimental tilapia lake virus infection.
Viruses 11:893
Nicholson P, Fathi MA, Fischer A, Mohan C and others
(2017) Detection of Tilapia Lake Virus in Egyptian fish
farms experiencing high mortalities in 2015. J Fish Dis
40:1925−1928
OIE (2021) Principles and methods of validation of diagnostic assays for infectious diseases. In: Manual of diagnostic tests for aquatic animals 2021. https://www.oie.int/
fileadmin/Home/eng/Health_standards/aahm/current/
1.1.02_VALIDATION.pdf (accessed 23 March 2022)
Phusantisampan T, Rawiwan P, Roy SRK, Sriariyanun M,
Surachetpong W (2020) Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the
specific and rapid detection of tilapia lake virus. J Vis
Exp 2020:6−11
Pierezan F, Yun S, Piewbang C, Surachetpong W, Soto E
(2020) Pathogenesis and immune response of Nile tilapia
(Oreochromis niloticus) exposed to Tilapia lake virus by
intragastric route. Fish Shellfish Immunol 107:289−300
Piewbang C, Tattiyapong P, Techangamsuwan S, Surachetpong W (2021) Tilapia lake virus immunoglobulin G
(TiLV IgG) antibody: Immunohistochemistry application
reveals cellular tropism of TiLV infection. Fish Shellfish
Immunol 116:115−123
Pulido LLH, Mora CM, Hung AL, Dong HT, Senapin S
(2019) Tilapia lake virus (TiLV) from Peru is genetically
close to the Israeli isolates. Aquaculture 510:61−65
Rakus K, Mojzesz M, Widziolek M, Pooranachandran N and
others (2020) Antiviral response of adult zebrafish (Danio
rerio) during tilapia lake virus (TiLV) infection. Fish
Shellfish Immunol 101:1−8
Reed LJ, Muench H (1938) A simple method of estimating
fifty-percent endpoints. Am J Hyg 27:493−497
Senapin S, Shyam KU, Meemetta W, Rattanarojpong T,
Dong HT (2018) Inapparent infection cases of tilapia lake
virus (TiLV) in farmed tilapia. Aquaculture 487:51−55
Stilwell NK, Whittington RJ, Hick PM, Becker JA and others
(2018) Partial validation of a TaqMan real-time quantitative PCR for the detection of ranaviruses. Dis Aquat Org
128:105−116
Subramaniam K, Ferguson HW, Kabuusu R, Waltzek TB
(2019) Genome sequence of tilapia lake virus associated
with syncytial hepatitis of tilapia in an Ecuadorian
aquaculture facility. Microbiol Resour Announc 8:
e00084-19
Subramaniam K, Megarani DV, Vann JA, Tong C, Warg JV,
Waltzek TB (2022) Interlaboratory reproducibility of a
158
Dis Aquat Org 152: 147–158, 2022
TaqMan RT-qPCR assay for detection of Tilapia Lake
Virus. 9th International Symposium on Aquatic Animal
Health, September 5−8, 2022, Santiago, Chile
Surachetpong W, Janetanakit T, Nonthabenjawan N, Tattiyapong P, Sirikanchana K, Amonsin A (2017) Outbreaks of tilapia lake virus infection. Emerg Infect Dis 23:
1031−1033
Surachetpong W, Roy SRK, Nicholson P (2020) Tilapia lake
virus: the story so far. J Fish Dis 43:1115−1132
Tattiyapong P, Dachavichitlead W, Surachetpong W (2017)
Experimental infection of tilapia lake virus (TiLV) in Nile
tilapia (Oreochromis niloticus) and red tilapia (Oreochromis spp.). Vet Microbiol 207:170−177
Tattiyapong P, Sirikanchana K, Surachetpong W (2018)
Development and validation of a reverse transcription
quantitative polymerase chain reaction for tilapia lake
virus detection in clinical samples and experimentally
challenged fish. J Fish Dis 41:255−261
Tattiyapong P, Dechavichitlead W, Waltzek TB, Surachetpong W (2020) Tilapia develop protective immunity
including a humoral response following exposure to
tilapia lake virus. Fish Shellfish Immunol 106:666−674
Tran TH, Nguyen VTH, Bui HCN, Tran YBT and others
(2022) Tilapia Lake Virus (TiLV) from Vietnam is geneti-
cally distantly related to TiLV strains from other countries. J Fish Dis 45:1389–1401
Waiyamitra P, Tattiyapong P, Sirikanchana K, Mongkolsuk
S, Nicholson P, Surachetpong W (2018) A TaqMan RTqPCR assay for Tilapia Lake Virus (TiLV) detection in
tilapia. Aquaculture 497:184−188
Waiyamitra P, Piewbang C, Techangamsuwan S, Liew WC,
Surachetpong W (2021) Infection of Tilapia tilapinevirus
in Mozambique tilapia (Oreochromis mossambicus), a
globally vulnerable fish species. Viruses 13:1104
WOAH (World Organization for Animal Health) (2022)
Infection with tilapia lake virus (TiLV) — a novel Orthomyxo-like virus. Disease Information card. https://www.
woah.org/app/uploads/2022/11/a-woah-tilv-diseasecard-sept-2022.pdf (accessed 2 December 2022)
Yamkasem J, Piewbang C, Techangamsuwan S, Pierezan F,
Soto E, Surachetpong W (2021) Susceptibility of ornamental African cichlids Aulonocara spp. to experimental
infection with Tilapia lake virus. Aquaculture 542:
736920
Yin J, Wang Q, Wang Y, Li Y and others (2019) Development
of a simple and rapid reverse transcription−loopmediated isothermal amplification (RT-LAMP) assay for sensitive detection of tilapia lake virus. J Fish Dis 42:817−824
Editorial responsibility: James Jancovich,
San Marcos, California, USA
Reviewed by: 2 anonymous referees
Submitted: June 22, 2022
Accepted: September 27, 2022
Proofs received from author(s): December 15, 2022