ISSN 2310-4090 Marker Assisted Approach for Developing Drought Tolerant Rice Cultivars Saumya Awasthi1, J. P. Lal 1 Department of Genetics and Plant Breeding, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi- 221 005 (India) Keywords: Oryza sativa; Drought; Marker assisted selection; QTLs; Foreground selection; Background selection. Abstract Correspondence: recent estimate on climate change predicts the water deficit to deteriorate Saumya Awasthi. Department of Genetics and Plant Breeding, Institute of Agricultural Sciences, Banaras Hindu Un i vers i t y, Varanasi - 221 005 (India) E-mail: sand.saumya@gmail.com The frequent occurrence of abiotic stresses such as drought and submergence has been identified as the key to the low productivity of rain fed ecosystems. A further in years to come and the intensity and frequency of drought are predicted to become worse. Drought was the cause of reduced production on 11 occasions. In the present study, molecular markers that were linked or flanking Funding Information: qDTY2.3 and unlinked to qDTY2.3 were used to apply foreground and background selection, respectively, in backcrosses between a drought No funding information provided. tolerant donor and the high yielding and widely grown recurrent parent HUR Received: October 2014; Accepted: December 2014 105. By the BC1F2 generation a drought tolerant plant was identified that possessed HUR 105 type simple sequence repeat (SSR) alleles on all fragments International Journal of Scientific Footprints 2014; 2(6):1 –14 analyzed except the segment of rice chromosome 2 that possessed the qDTY2.3 QTL. This approach demonstrates the effective use of marker assisted selection for a major QTL in a molecular breeding program. Introduction Drought is a more complex phenomenon than duration, have posed a major challenge for most agricultural other stresses, such as salinity, scientists. The genetic submergence, pests, and diseases. It can occur mechanisms that condition the expression of at any point during crop production and for drought tolerance in rice plants are poorly any length of time, affecting a large array of understood. Since drought tolerance is a physiological, biochemical, and molecular complex trait controlled by polygenes, and is processes. These complexities, along with the dependent on the phenotype evaluated it is uncertainty in drought timing, intensity, and one of the most difficult traits to study and 2014. The Authors, International Journal of Scientific Footprints This is an open access article which permits use, distribution and reproduction in any medium, with the condition that original work is properly cited. Int. j. sci. footpr. Awasthi & Lal. (2014) characterize. A linkage map using DNA markers is available for the rice plant (McCouch et al. 1998). Utilization of DNA markers and the linkage map will clarify the of MAS for rice breeding include: Lower population sizes than conventional breeding that require less genotyping. linkage between gene controlling characters The existence of widely-grown rice cultivars and DNA markers and therefore selection (“mega varieties”) that possess the essential assisted by DNA markers will be possible. features of high grain quality, yield and local Moreover, quantitative character locus (QTL) adaptation, but lack specific traits such as analysis will permit the selection of the stress tolerance. quantitative character by DNA marker. Existence of major QTLs and major genes Mapping studies are performed to detect that could add value to many elite rice linkage of a molecular marker to a gene cultivars. affecting a trait of interest. It then becomes possible to select for the desirable allele of those genes based on marker genotype rather Minimization of linkage drags surrounding the locus being introgressed. than, or in addition to, field phenotype Rapid breeding of new genotypes with (Jongdee et al., 2002).This technique, known favorable traits. as marker assisted selection (MAS), is theoretically more reliable than selection based solely on phenotype, as a marker tightly liked to the desirable gene would represent selection with a heritability of near unity for that specific gene (Bernardo, 2002). Markerassisted selection may be useful to improve traits that are either controlled by a few genes or where phenotypic evaluation is difficult/ costly to perform. The relative difficulty associated with drought-resistance phenotyping suggests that there is scope for The effectiveness of MAS depends on the availability of closely linked markers and/or flanking markers for the target locus, the size of the population, the number of backcrosses and the position and number of markers for background selection (Frisch et al. 1999a; Frisch and Melchinger 2005). MAS has previously been used in rice breeding to incorporate the bacterial blight resistance gene Xa21 (Chen et al. 2000) and waxy gene (Zhou et al. 2003) into elite varieties. the use of MAS in breeding for drought The identification of QTLs with a major effect resistance (Bernardo, 2002). The advantages on grain yield raises a new hope of improving Int. j. sci. footpr. Awasthi & Lal. (2014) grain yield under drought through marker during three seasons i.e. 2010, 2011 and 2012 assisted breeding. The availability of the at Agricultural Research Farm, Institute of major effect QTL for drought tolerance, a Agricultural theoretical frame-work for marker assisted University, Varanasi and off season, 2010- selection and the existence of intolerant 2011 at CRRI, Cuttack, Odisha. HUR – 105, varieties that are widely accepted by farmers is a mutant of MPR 7 – 2. It is a semi dwarf provides an opportunity to develop cultivars variety which is resistant to leaf roller. It that would be suitable for larger areas of yields up to 52 – 54 q/ ha. The variety was drought prone rice (Mackill, 2006). notified in 2008 for Uttar Pradesh. Nagina 22, However, in this study, QTL was not detected; QTL analysis with DNA markers of the linkage between excellent agricultural characters and DNA markers requires further research. Banaras Hindu a selection from Rajbhog was used as donar parent. Nagina – 22 was notified in 1978. It takes around 85-102 days. Grains are short, bold and white. The variety is susceptible to blast, BLB and resistant to drought. It gives yield of about 20-25 Q/ha and grown well in Moreover, positional cloning using DNA markers will make it possible to isolate agriculturally useful genes, and it will also contribute Sciences, to breeding in the future. Understanding the genetic basis of drought tolerance in rice is fundamental to enable breeders and molecular biologists to develop new varieties with more drought tolerance characters. We performed this study “Marker assisted approach for developing drought tolerant rice” with the purposes: (1) to introduce and to apply new approaches through molecular techniques; (2) to develop new rice varieties for drought tolerance. Materials and Methods Uttar Pradesh as upland crop. The seeds of drought tolerant variety (Nagina 22) and drought susceptible variety (HUR 105) were sown in raised nursery beds in the last week of June, 2010 at the Research Farm, Banaras Hindu University. Twenty one days old seedlings were transplanted in the well puddled field at a spacing of 30 × 15 cm between row to row and plant to plant, respectively with row length of 3 m in a crossing block on three different dates at the interval of seven days in three replications. Standard agronomic practices were followed to raise good crop. Five rows of drought tolerant variety (male parents) were transplanted in separate block on different The present investigation was conducted Int. j. sci. footpr. Awasthi & Lal. (2014) dates at the interval of 7 days to synchronize assisted selection (MAS) and harvested the flowering for making the crosses. separately. Sample Size - 20 plants in parents Half of the F1 seeds of the cross with their parents were transplanted at the Research Farm at Central Rice Research Institute (C.R.R.I.), Cuttack, at the spacing of 30 × 15 cm between row to row and plant to plant, respectively with a row length of 3.0m in three replications. F1s and 50 plants in F2 per replication. Marker assisted selection was applied for selecting drought tolerant plants. Plant progenies derived from the tolerant plants were selfed to produce BC1F2 generation for marker assisted selection (MAS). Similar to that of moisture non-stress condition plant progenies derived from the tolerant plants Screening of the F1s was done at different were selfed to produce BC1F2 generation for growth marker assisted selection (MAS). stages vegetative i.e., stage. seedling stage and Depending upon the screening test, backcrosses with drought susceptible parents were done. Seeds from the cross and F2 seeds were harvested separately. Marker validation and hybrid confirmation were done before commencing marker assisted selection. F1 plant progeny, along with the parents were grown to raise F2 generation. Compact family randomized block design with three replications was followed. Drought susceptible and drought tolerant plants were screened on the basis of leaf rolling and were harvested separately. Fresh crosses were also made to get F1 seeds. Young leaves were collected from 20- 25 days old seedlings and immediately stored in -20°C till further processing. The DNA was extracted following CTAB extraction method (Doyle and Doyle, 1987). Polymerase chain reaction was performed to selectively amplify in vitro a specific segment of the total genomic DNA to a billion fold (Mullis et al., 1986). The most essential requirement of PCR is the availability of a pair of short (typically 20- 25bp nucleotides) primers having sequence complementary to either end of the target DNA segment (called template DNA) to be synthesized in large amount. The BC1F1 along with the parents were also components of the PCR reaction were first grown in compact family randomized block added in a sterilized 1.5ml microcentifuge design in three replications. Drought tolerant tube thoroughly in a sequence as mentioned in and drought susceptible plants were selected table 3.3 and then mixed thoroughly by and selfed to produce BC1F2 seeds for marker vortexing. To each PCR tubes (0.2ml), 14 µl Int. j. sci. footpr. Awasthi & Lal. (2014) of reaction mixture was distributed, and finally template DNA of individual rice genotpyes was added. The tubes containing reaction mixture were placed in the wells of the thermal cycler block (Eppendorf Thermo – cycler, USA) and amplification reaction was carried out with the thermal cycler programme. The amplified DNA fragments generated through SSR primers were resolved through electrophoresis in 2.5% agarose gel prepared in TAE [242g Tris – base; 57.1ml glacial acetic acid and 100ml 0.5 M EDTA (pH 8.0) bring final volume to 1000ml] buffer. Ethidium bromide solution at a final concentration of 0.03 ng/µl was added to the agarose solution. future use. SSR markers linked to the QTLs for drought tolerance on various linkage groups were used for foreground selection to select the individuals presumably having the donor allele. Particular target (drought tolerance QTL) was flanked by these markers. The tighter the markers are linked to the QTL, the greater the chance that the QTL mapped between a pair of flanking marker has indeed been transferred. Therefore, phenotypic testing of final products of the MAS exercise needs to be performed in order to confirm the transfer of drought tolerance QTL. At the same time selected markers unlinked to drought tolerance have been used to select For electrophoresis, 15µl of the PCR product those individuals with minimal linkage drag was mixed with 2µl of 6x loading dye (0.25% (background selection). bromophenol blue in 30% glycerol) and loaded in the slot of the agarose gel. In order to determine the molecular size of the Results Parental polymorphism survey amplified products, each gel was also loaded with 6 µl of 50 bp DNA size marker (Fermentas, USA). Gel electrophoresis was performed at a constant voltage of 65V for about 3.5 hours. Finally, the gels were visualized under a UV light source in a gel documentation system (Gel DocTM XR +, BIO RAD, USA) and the images of amplification products were captured and stored in a computer for further analysis and Initially, parental polymorphism survey was performed among parental genotypes, HUR – 105 (drought susceptible) and Nagina - 22 (drought tolerant). 19 SSR markers were used to validate for the drought tolerance in the parental lines. Out of 19 SSRs, only 10 SSRs produced reproducible and polymorphic bands. These markers clearly distinguished drought susceptible and tolerant parents. In rice, hundreds of microsatellite markers were Int. j. sci. footpr. Awasthi & Lal. (2014) developed which are publicly available and 105 × Nagina - 22 were back crossed with the are being used for MAS, gene tagging, recurrent parent HUR - 105 to produce around mapping and phylogenetic studies. 236 seeds at Agricultural Farm, Institute of Agricultural Hybrid confirmation in F1’s Sciences, Banaras Hindu University. Oryza sativa is basically a self-pollinated crop, with limited degree of outcrossing (< 0.5%). The factors limiting the receptivity of Marker assisted foreground selection in BC1F1 and production of BC1F2 seeds rice flowers to outcrossing include a short BC1F1 plants were screened for the presence style and stigma (1.5 to 4 mm in combined of qDTY2.3 with the linked and validated length), short anthers, limited pollen viability SSR markers RM 263 – RM 530 from the and brief period between opening of florets cross (HUR - 105 × Nagina - 22) × HUR - and release of pollen (between 30 seconds and 105. SSR markers used in the study are co- 9 minutes) (Morishima, 1984; Oka, 1988). It dominant in nature therefore, in BC1F1 therefore became essential to confirm the true population, two types of banding patterns type hybrid condition in the F1s. RM 263 and were amplified i.e., homozygous susceptible RM 530 which are co dominant in nature, type and heterozygous types. The segregation gave promising results. Heterozygous plants of BC1F1 plants into drought tolerant and were susceptible can be seen clearly in the selected for further generation representative gel picture of screening of 110 advancement and backcrossing. BC1F1 plants for qDTY2.1 with linked Improvement of HUR - 105 by introgression of qDTY2.3 from the source molecular marker RM 263 – RM 530. Nagina - 22 Production of BC1F1 generation SSR markers RM 263 - RM 530 linked with Since, flanking markers were used in the qDTY2.3 were reported to be responsible for study; emphasis was given on the selection of polymorphism between donor (Nagina - 22) only and recipient parent (HUR - 105) (Vikram et heterozygous banding pattern for both the al., 2012) (Table 1). markers i.e. RM 263 and RM 530. Thus plant those plants which exhibited number SA- N- 3, SA- N- 7, SA- N- 13, SAProduction of BC1F1 generation Six plants in F1 generation of the cross HUR - N- 16, SA- N- 24, SA- N- 31 and SA- N- 32 (seven plants) from the cross (HUR - 105 × Int. j. sci. footpr. Awasthi & Lal. (2014) Nagina - 22) × HUR - 105 were selfed to the strongest condition is found, selection produce BC1F2 seeds. between them can be performed on the basis of analysis of other marker loci (located either Marker assisted foreground and background selection in BC1F2 generation and production of BC1F3 seeds on the carrier or on non-carrier chromosome) to determine the most desirable individual for producing BC2 (Tanksley et al., 1989). Foreground selection: BC1F2 plants from the cross (HUR - 105 × Nagina - 22) × HUR 105 were screened with qDTY2.3 with the linked and validated markers. The success of marker assisted backcross breeding (MAB) depends upon several factors, including the distance between the closest markers and the target gene, the Background selection: The gene positive number of target genes to be transferred, the plants in BC1F2 generation were further genetic base of the trait, the number of observed for their morphological similarity individuals that can be analyzed and the with the recurrent parent HUR - 105 and genetic background in which the target gene plants has to be transferred, the type of molecular which were close enough phenotypically to recurrent parent were taken marker(s) used and available technical for background selection using polymorphic facilities (Weeden et al., 1992; Francia et al., primers between each pairs. A total of 369 2005). Identification of molecular markers SSR were randomly selected from the linkage that should co- segregate or be closely linked map of rice (minimum two polymorphic with the desired trait (if possible, physically markers from the long arm and one from the located beside or within genes of interest) is a short arm were used). Maximum genome critical step for the success of MAB. The most recovery in BC1F2 for qDTY2.3 was found to favourable case for MAB is when the about 82.1%. molecular marker is located directly within the gene of interest (direct markers). MAB Discussion conducted using direct markers is called gene Marker assisted foreground selection was assisted selection (Dekkers, 2003). proposed by Tanksley (1983) and investigated Alternatively, the marker is genetically linked in the context of introgression of tolerant to the trait of interest. Before a breeder can genes by Melchinger (1990). If in BC1 utilize linkage – based associations between a generation more than one individual satisfying trait and markers, the associations have to be Int. j. sci. footpr. Awasthi & Lal. (2014) assessed with a certain degree of accuracy so farmers seems to be small. New developments that marker genotypes can be used as and improvements in marker technology, the indicators or predictors of trait genotypes and integration of functional genomics with QTL phenotypes. mapping and the availability of more high density maps are the other factors that will The lower the genetic distance between the marker and the gene, the more reliable is the application of the marker in MAS. However only in few cases will the selected marker allele be separated from the desired trait due to a recombination event (appearance of false positives). The presence of a tight linkage between desirable trait(s) and a molecular greatly affect the efficiency and effectiveness of QTL mapping and MAS in the future. The development of high density maps that incorporate new marker types, such as single nucleotide polymorphism (SNPs) and expressed sequence tags (EST) will provide researchers with a great arsenal of tools for QTL mapping and MAS. marker(s) may be useful in MAS to increase gain from selection. Based on the studies by Lee (1995) and Ribaut et al. (2002), it could be generalized that whenever a target gene is introduced for the first time from either wild or un adapted germplasm, flanking markers as close as 2cM is considered an ideal option, while in the transfer of the same target gene in subsequent phases from elite into elite lines, positioning the flanking markers nearby might be effective in reducing the required size of the backcross population. MAS have generated a good deal of Conclusion From the cross (HUR – 105 × Nagina - 22) × HUR – 105, plant numbers, SA- A – 2, SA – A – 5, SA – A – 13, SA – A – 16, SA- A – 24, SA- A – 32, and SA – A – 56 were found to have drought tolerant gene qDTY2.3. These lines have been subjected to further breeding and trial tests. Agronomic performances and physiological behavior of these lines are also under track References expectations, which in some cases has leaded to over optimism disappointment and because in others to many of the expectations have not yet been realized. Although documentation is limited the current impact of MAS on products delivered to [1] Babu, RC, Nguyen, B D, Chamarerk, V, Shanmugasundaram, P, Chezhian, P, Jeyaprakash, P, Ganesh, SK, Palchamy, A, Sadasivam, S, Sarkarung, S, Wade, LJ, and Nguyen, HT, Genetic analysis of Int. j. sci. footpr. Awasthi & Lal. (2014) drought resistance in Rice by molecular [8] Francia, E, Tacconi, G, Crosatti, C, markers, Association between Secondary Barabaschi, D, Bulgarelli, D, Dall’Aglio, Traits and Field Performance, Crop sci, E and Vale, G, Marker assisted selection 43, 1457- 1469, 2003. in crop plants. Plant Cell Tissue Organ [2] Bernardo, R, 2002, Breeding for quantitative traits in plants, Stemma Cult, 82, 317- 342, 2005. [9] Frisch, M., Bohn, M. and Melchinger, A. E. Minimal sample size and optimal Press, Woodburn, Minnesota, [3] Blum A, Plant Breeding for Stress positioning of flanking markers in markr Environments, CRC Press, Boca Raton, assisted backcrossing for transfer of a FL, 1988. target [4] Boyer, J. S.1982. Plant productivity and [5] Chen, S., Lin, X. H., Xu, C. G. Zhang, Q. of bacterial Crop sci. 39: 967- 975.1999a. [10] Frisch, M. and Melchinger, A. E. environment. Science. 218: 443. Improvement gene. blight resistance of “Minghui 63’, an elite Selection theory for Marker assisted backcrossing. Genet. 170: 909- 917. 2005. restorer line of hybrid rice, by molecular [11] Fukai, S, Pantuwan, G, Jongdee, B, marker assisted selection. Crop Sci. and Cooper, M, Screening for drought 40(1): 239- 244. 2000. resistance in rainfed lowland rice, Field [6] Dekkers, JCM, commercial application of marker and gene assisted selection in Crop Res, 64, 61-74, 1999. [12] Jongdee, B, Fukai, S, and Cooper, M, livestock: stategies and lessons, Paper Leaf water potential and osmotic presented at the 54th annual meeting of adjustment as physiological traits to the European association for animal improve drought tolerance in rice, Field production, Rome, Italy, 31st August – Crop Res, 76, 153-163, 2002. [13] Kamoshita, A, Zhang, J, Siopongco, J, 3rd September. [7] Edmeades, GO, Bolanos, J, Lafitte, HR, Sarkarung, S, Nguyen, HT, and Wade, Rajaram, S, Pfeiffer, W, and Fischer, LJ, Effects of phenotyping environment RA, Traditional approaches to breeding on identification of quantitative trait loci for drought resistance in cereals, In, for rice root morphology under anaerobic Baker, F,W,G, (ed,), Drought Resistance conditions, Crop Sci, 42, 255-265, 2002. in Cereals, CAB International, Wallingford, Oxon, UK, 27-52, 1989. Int. j. sci. footpr. Awasthi & Lal. (2014) [14] Lee, M, DNA markers and plant breeding programs, Adv Agron, 55, 265- in rice, Progress, problems and prospects, Plant Growth Regul, 29, 123- 133, 1999. [22] Ribaut, JM, Banziger, M, Betran, J, 344, 1995. [15] Mackill, D. J. Breeding for resistance Jiang, C, Edmeades, GO, Dreher, K and to abiotic stresses in rice: the value of Hoisington, D, Use of molecular markers QTLs. Plant breeding: The Arnel R in plant breeding: drought tolerance Hallauer International Symposium. 2006. improvement in tropical maize , in Kang [16] Melchinger, AE, Use of molecular MS(ed) Quantitative genetics, genomics markers in breeding for oligogenic and plant breeding, Wallingford, CABI, disease resistance, Pl Breeding, 104(1), 85- 99, 2002. [23] Rosielle, 1- 19, 1990. AA, and Hamblin, J, and Theoretical aspects of selection for yield domestication, In, Tsunoda, S, and in stress and nonstress environments, Takahashi, N, (ed) Biology of rice, Crop Sci, 21, 943-946, 1981. [17] Morishima, H, Wild plants Elsevier, Amsterdam, 3-30, 1984. [18] Oka, HI, Origin of cultivated rice, Elsevier, Amsterdam, 1988. [19] Pantuwan, G, Fukai, S, Cooper, M, Rajatasereekul, S, and O’ Toole, JC, [24] Singh, MP, Rice productivity in India under variable climates,www,niaes,affrc,go,jp/marco/m arco2009/english/,,,/W202_Singh_P,pdf, 2009. Yield response of rice (Oryza sativa L,) [25] Tanksley, SD, Molecular markers in genotypes to drought under rainfed plant breeding. Plant Mol Biol, 1: 3– 8, lowland, Plant factors contributing to 1983. drought resistance, Field Crop Res, 73, 181- 200, 2002. [26] Tanksley, SD, Young, ND, Paterson, AH, and Bonierbale, MW, RFLP [20] Petit, J. R., Jouzel, J. and Raynaud, D. mapping in plant breeding, new tools for 1999. Climate and atmospheric history of an old science, Biotechnol, 7, 257–264, the past 420 000 years from the Vostok 1989. ice core, Antarctica. Nature. 399: 429– 436. [27] Vikram, P, Swamy, BPM, Dixit, S, Ahmed, HA, Cruz, MTS, Singh, AK, [21] Price, A, and Courtois, B, Mapping Yec, G, Kumar, A, Bulk segregant QTLs associated with drought resistance analysis, “An effective approach for mapping consistent-effect drought grain Int. j. sci. footpr. yield QTLs in rice”, Field Crops Res, 134, 185–192, 2012. [28] Weeden, NR, Muehlbauer, FJ and Ladizinky, G, Extensive conservation of linkage relationships between pea and lentil genetic maps, J. Hered, 83, 123129, 1992. [29] Yadav, R, Courtois, B, Huang, N, and McLaren, G, Mapping genes controlling root morphology and root distribution in a double-haploid population of rice, Theor, Appl, Genet, 94, 619-632, 1997. [30] Zhou, P., Tan, Y., He, Y., Xu, C., Zhng, Q. Simultaneous improvement for four quality traits of Zhenshan 97, an elite parent of hybrid rice, by molecular marker-assisted selection. Theor Appl Genet. 106(2): 326- 331. Awasthi & Lal. (2014) Int. j. sci. footpr. Awasthi & Lal. (2014) Figure 1: Representative gel picture of foreground selection for qDTY2.3 in BC1F1 generation of (HUR – 105 × Nagina – 22) × HUR – 105). Int. j. sci. footpr. Awasthi & Lal. (2014) Figure 2: Representative gel picture of foreground selection for qDTY2.3 in BC1F2 generation of (HUR – 105 × Nagina – 22 × HUR – 105). Figure 3: Representative gel picture of background selection in BC1F2 of (HUR – 105 × Nagina - 22) × HUR – 105 using polymorphic markers Int. j. sci. footpr. Awasthi & Lal. (2014) Table 1: Details of SSR primers associated with drought QTL qDTY2.3 QTL Reverse sequence R2 Tm Reference CCCAGGCTAGCTCATGAACC GCTACGTTTGAGCTACCACG 4.6 60°C Vikram et al., 2012 GCACTGACCACGACTGTTTG ACCGTAACCCGGATCTATCC Flanking LG Forward sequence markers qDTY2..3 RM 263 RM 530 2 57°C ”