Comp Clin Pathol DOI 10.1007/s00580-011-1238-z ORIGINAL ARTICLE Study on Salmonella contamination of traditionally produced edible poultry eggs Mahdi Askari Badouei & Babak Mohammadian Ghalejooghi & Omid Madadgar Received: 18 November 2010 / Accepted: 5 April 2011 # Springer-Verlag London Limited 2011 Abstract One of the important issues of food hygiene is Salmonella contamination of eggs that may cause foodborne infection and disease in humans. The aim of this study was to investigate Salmonella contamination of traditionally produced poultry eggs in Tehran. Contamination of eggs to other Enterobacteriaceae was also investigated. For this purpose, 200 eggs including 131 egg samples from chickens and 69 from quails, geese, and ducks (23 samples from each species) were investigated. After conventional isolation procedures, Salmonella contamination was detected in five chicken eggs. Serological tests revealed that all of the isolated genera belonged to D serogroup and multiplex PCR showed that all strains carried spv and sefA genes and also random sequence (specific for the genus Salmonella); therefore, all strains confirmed as Salmonella Enteritidis. Antimicrobial susceptibility test revealed sensitivity of all Salmonella isolates to florfenicol, ceftriaxone, trimethoprim– sulfamethoxazole, chloramfenicol, and oxytetracycline. In addition, except the quail eggs, 29 enteric bacteria were isolated from eggs including 21 Enterobacter spp., 4 Klebsiella spp., 3 Escherichia coli, and 1 Proteus spp. This study indicated that traditionally produced poultry eggs were M. Askari Badouei (*) Department of Pathobiology, Faculty of Veterinary Medicine, Islamic Azad University, Garmsar Branch, Garmsar, Iran e-mail: askarim@vetmed.ut.ac.ir B. Mohammadian Ghalejooghi Department of poultry disease, Faculty of Veterinary Medicine, Shahid Chamran University, Ahvaz, Iran O. Madadgar Department of Microbiology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran highly contaminated by Enterobacteriaceae. Moreover, the chicken eggs were contaminated by Salmonella Enteritidis; therefore, non-commercial chicken eggs can be considered as an important threat for public health. Keywords Poultry eggs . Salmonella . Multiplex PCR . Antimicrobial susceptibility . Enterobacteriaceae Introduction The numerous motile serovars of Salmonella are often referred to as paratyphoid (PT) salmonella. This organism can infect a wide variety of hosts including invertebrate and vertebrate wildlife, domestic animals, and humans to yield either asymptomatic intestinal carriage or clinical disease. Since the first report of avian salmonellosis in 1895 due to outbreak of infectious enteritis in pigeons, PT infections have long been known to cause significant disease losses in young poultry. More recently, PT salmonella have been additionally identified as important agent of food-borne disease in humans. Although Salmonella spp. are generally inactivated during standard cooking practices, improper handling and preparation of contaminated poultry eggs and meat continue to contribute to human salmonellosis. Raw meat and poultry products are recognized as the primary source for transmitting Salmonella species to humans, and 40% of the clinical cases attributed to the consumption of egg and poultry products (Li et al. 2007). Advances in poultry production practices, changes in consumer lifestyles and preferences, and increase in nutritional awareness have all elevated poultry products importance as the leading source of animal proteins worldwide. The tendency of societies to consume natural and organic food products has been resulted in selling of traditionally produced food stuffs Comp Clin Pathol in the cities. Non-commercial poultry eggs are produced in rural areas and are also available in the cities for human consumption. Controlling PT infections in poultry flocks has thus become an important objective from both the economic and public health perspectives (Dyda et al. 2009; Madadgar et al. 2009; Gast 2008). The aim of this study was to estimate the prevalence of Salmonella contamination in traditionally produced poultry eggs (chickens, quails, ducks, and goose) in Tehran. The serovars and antibiotic susceptibility of the isolated strains were determined and contamination by other enteric bacteria was also assessed. TSI, urea, SIM, citrate, MR-VP, and LIA (lysine iron agar). Any types of bacterial colonies which were grown on MacConkey or XLD agar were also identified by means of conventional biochemical tests (Downes and Ito 2004; Holt 1994; Gast 2008). Serogrouping of Salmonella isolates Serogrouping was performed by conventional serotyping method using commercial antisera (Difco, BD, Detroit, MI, USA) and comparison with Kauffmann-White schema. Multiplex PCR test for Salmonella Enteritidis Materials and methods Poultry eggs In this study, 131 samples were taken from chicken eggs, and 69 from duck, goose, and quail eggs (23 from each species) which were collected from different parts of Tehran. Sample preparation and bacterial isolation Samples were taken from the surface of the egg shells and its contents separately. First, samples were collected from the surface of the shells using wet sterilized swabs and then cultured into two separate primary enrichment media including lactose broth and tripticasein soy broth. Then, the eggs were brushed, soaked in 70% ethanol solution for 10 min, and cleansed. The contents were taken by breaking the shells and mixed thoroughly. In the next stage, approximately 25 g of each sample was weighed, added to 225 ml of lactose broth, and was shaken for 25–30 times. If the sample was less than 25 g, the whole egg contents were used for enrichment. One gram of each sample was also cultured into tripticasein soy broth. After overnight incubation at 37°C, 1 ml of the previously inoculated lactose broth medium was transferred into selenite cystine as an enrichment media. After 12–18 h of incubation at 37°C, a loopful was taken from tripticasein soy broth and selenite cystine and streaked on xylose lysine deoxycholate (XLD) and MacConkey agar and incubated overnight at 37°C. Finally, the suspected colonies were checked using differential media including Table 1 Primers sequences used for determination of Salmonella Enteritidis isolates by multiplex PCR (Pan and Liu 2002) PCR test were carried out according to Pan and Liu (2002) method. This test was performed in 25 μl reaction: PCR buffer included 50 mM KCL and 10 mM Tris–HCl (pH=8). Amounts of each primer, Taq DNA polymerase, DNA template, dNTPs, and MgCl2 were 0.5 μM, 1 unit, 5 μl, 250 μM, and 1.5 mM, respectively. PCR products were electrophoresed on 1.2% agarose gels at 110 V for 60 min and stained with ethidium bromide (0.5 μg/ml). Primer sequences and target genes of multiplex PCR are shown in Table 1. Antimicrobial susceptibility test The antimicrobial susceptibility test was performed based on standard disk diffusion method (Kerby-Bauer) and analyzed according to CLSI recommendations (2005). Antibiotics used for this process were nalidixic acid, tiamulin, erythromycin, colistin, penicillin, streptomycin, neomycin, lincomycin, kanamycin, cefalotin, flumequine, gentamicin, ciprofloxacin, ampicillin, tetracycline, furazolidone, oxytetracycline, chloramfenicol, trimethoprim– sulfamethoxazole, ceftriaxone, and florfenicol. Results Salmonella contamination of eggs Salmonella strains were isolated from five chicken eggs of which four strains were isolated from the shells and one from the egg contents. Therefore, Salmonella contamination Primer Target gene Primer Sequences(5′-3′) ST11 ST14 S1 S4 SEFA 2 SEFA 4 Random Sequence spv GCCAACCATTGCTAAATTGGCGCA GGTAGAAATTCCCAGCGGGTACTGG GCCGTACACGAGCTTATAGA ACCTACAGGGGCACAATAAC GCAGCGGTTACTATTGCAGC TGTGACAGGGACATTTAGCG sef A Product (bp) 429 250 310 Comp Clin Pathol Table 2 Enterobacteriaceae contamination of poultry eggs Genus Enterobacter spp. Klebsiella spp. Escherichia coli Proteus spp. Chicken Goose Duck Shell Content Shell Content Shell Content 4 0 2 1 2 1 0 0 0 0 1 0 4 0 0 0 10 3 0 0 1 0 0 0 in chicken eggs was 3.8% (5/131), while no Salmonella contamination was found in other tested poultry eggs. Other Enterobacteriaceae bacterial contamination Bacteriological study showed that the most contaminated poultry eggs were the duck eggs (60.8%) and the most frequent isolated bacteria belonged to genus Eneterobacter. No germ was isolated from the quail eggs. Enterobacter spp., Klebsiella spp., Proteus spp., and E. coli were generally isolated from the eggs (Table 2). Serogrouping and multiplex PCR Based on the serogrouping test results, all of the five isolated Salmonella belonged to D serogroup. Multiplex PCR revealed the presence of genes including spv, sefA, and random sequence (specific for the genus Salmonella) in all of the isolates; therefore, all strains confirmed to be Salmonella Enteritidis genotypically (Fig. 1). Antimicrobial susceptibility test Antibiotic susceptibility of five Salmonella isolates were evaluated using 21 various antibiotic disks, and the results showed 100% resistance to nalidixic acid, tiamulin, erythromycin, colistin, penicillin, streptomycin, neomycin, lincomycin, kanamycin, cefalotin, flumequine, and gentamicin; in contrast, all of the isolates were sensitive to oxytetracycline, chloramfenicol, trimethoprim–sulfamethoxazole, ceftriaxone, and florfenicol. According to the antibiogram results, four distinct resistance patterns were observed in five Salmonella Enteritidis isolates (Table 3). Discussion From 1985 to 1996, 79% of Salmonella Enteritidis infections were caused by consumption of contaminated eggs (Gast 2008). The results of the present study revealed that Salmonella Enteritidis was isolated from the chicken eggs at the rate of 3.8%. According to the Center for Disease Control and Prevention (2004), Salmonella Enteritidis and Typhimurium are the two most common serovars associated with human disease and therefore are of high importance to public health. Table 3 Resistance patterns of five Salmonella Enteritidis strains isolated from poultry eggs Number (%) Resistance patterns 1 (20) Fig. 1 Results of multiplex PCR for detection of Salmonella Enteritidis on five isolates of this study. 1–5 isolates of this study, C+ positive control which was a poultry clinical isolate of Salmonella Enteritidis confirmed by reliable antisera (Difco, BD, Detroit, MI, USA), and C−negative control. The 250, 310, and 429 bp band sizes indicate spv (Salmonella plasmid virulence), sefA (Salmonella Enteritidis fimbria), and random sequence (for detection of Salmonella genus) genes, respectively 1 (20) 1 (20) 2 (40) AM, CF, CP, NA, S, P, FM, TM, TE, E, GM, N, CL, LM, K, FR AM, CF, CP, NA, S, P, FM, TM, E, GM, N, CL, LM, K AM, CF, NA, S, P, FM, TM, E, GM, N, CL, LM, K CF, CP, NA, S, P, FM, TM, E, GM, N, CL, LM, K AM Ampicillin, CF Cefalotin, CP Ciprofloxacin, NA Nalidixic acid, S Streptomycin, P Penicillin, FM Flumequine, TM Tiamulin, TE Tetracycline, E Erythromycin, GM Gentamicin, N Neomycin, CL Colistin, LM Lincomycin, K Kanamycin, FR Furazolidone Comp Clin Pathol Some other works which were conducted in other countries indicated the existence of Salmonella in eggs. Arnold et al. (2010) estimated the prevalence rate of Salmonella Enteritidis and Typhimurium to be 14% in egg-laying holdings of UK. In a survey by Hadian (1998), 1,200 egg yolk samples in Tehran were checked and 8% Salmonella contamination was reported and the most contaminating serotype was Salmonella Enteritidis. However, in a report presented by Bozorgnia et al. (2008) in the 6th Convention of Iranian Veterinary Clinicians, no contamination was detected in a total of 120 commercial eggs in Tabriz. In the present study, five Salmonella strains were obtained from chicken eggs of which four strains were isolated from the shells and one from the contents. Prevalence rate of Salmonella Enteritidis infection in this study was 3.8% in traditionally produced chicken eggs. These findings indicated noticeable contamination of non-commercial eggs with Salmonella Enteritidis in Iran. According to the results of these studies, rate of Salmonella contamination is variable in different studies, but contamination of eggs still occurs, and considering the importance of Salmonella contamination of eggs, the problem should not be unnoticed. This may be resulted from the lack of hygiene management implemented by farmers. Salmonella was not isolated from goose, duck, and quail eggs in the present study, but it may be either resulted from the limited number of samples or lower sensitivity of these species to Salmonella infection. In this research, the number of chicken eggs was twice than other birds because availability and consuming traditional chicken eggs are much more common than other kinds of poultry eggs. The most frequent serovars detected among avian and poultry birds belonged to B, C, and D serogroups in different studies (Gast 2008; Mirzaie et al. 2010), and five Salmonella isolates in this study belonged to D serogroup. In the present work, two different isolation protocols were carried out to isolate Salmonella from poultry eggs at the same time, and most of the isolates were recovered in the method that tripticasein soy broth (TSB) used as an enrichment and XLD as selective medium. This may be due to the presence of more enriching nutrient materials in TSB and more sensitivity of XLD agar for isolation of Salmonella. Nowadays, the enteric bacteria like Enterobacter, Serratia, Klebsiella, and Escherichia are considered as an important cause of nosocomial and opportunistic infections in humans. Immunocompromised patients like HIV-infected individuals, the patients receiving medication for cancers, and graft recipients who receive immunosuppressive agents are particularly susceptible to opportunistic enterobacterial infections. Urinary tract infections and infections of the oral cavity have been reported in immunocompromised patients (Diz Dios et al. 1993; Manfredi et al. 2001). Twenty-nine bacteria that belonged to the family Enterobacteriaceae in this study were isolated from the eggs surfaces and also from the eggs contents. Surprisingly, no bacterium was isolated from the quail eggs. This finding is in contrast to Erdugrul et al. (2002) which reported the isolation of Salmonella Enteritidis from quail eggs. However, other poultry eggs were highly contaminated by Enterobacteriaceae, and due to their pathogenic capabilities, they may infect the patients if they overcome the immune system. Besides, as there are many stresses and immunosuppressive diseases and conditions like AIDS, cancers, hepatitis, etc., it may be necessary to control these food-borne pathogens by public health surveillance authority systems. Bajaj et al. (2003) studied antimicrobial susceptibility of 66 Salmonella isolates and indicated that the most resistance was observed against penicillin and then to vancomycin, erythromycin, trimethoprim, streptomycin, tetracycline, and gentamicin with 96.9%, 83.3%, 81.8%, 42.4%, 24.2%, 9%, and 3% of frequencies, respectively. In addition, in 2005 report presented by National Antimicrobial Resistance Monitoring System 27.1%, 19.5% and 0.4% of salmonella isolates from chickens in year 2003 were resistant to tetracycline, streptomycin and nalidixic acid respectively. In another study, the most contaminant Salmonella was Salmonella Typhimurium that was resistant to several antibacterials and the least frequent serovar was Salmonella Kentucky which was sensitive to most antibiotics. Additionally, 63.4% of isolated Salmonella were resistant to tetracycline, 63.4% to nalidixic acid and 61% to streptomycin (Musgrove et al. 2006). In a study performed by Sepehri et al. (2007) on broiler chickens, 2.5% of the isolated bacteria belonged to genus Salmonella and all isolates were sensitive to florfenicol, lincospectin, and enrofloxacin but were resistant to tylosin. Antimicrobial resistance analysis of five Salmonella isolates in the present study against 21 antimicrobials indicated 100% resistance to nalidixic acid, tiamulin, erythromycin, colistin, penicillin, streptomycin, neomycin, lincomycin, kanamycin, cefalotin, flumequine, and gentamicin, but 100% sensitivity to oxytetracycline, chloramfenicol, trimethoprim–sulfamethoxazole, ceftriaxone, and florfenicol. In conclusion, the results of the current study indicated that non-commercial poultry eggs are noticeably contaminated by Salmonella and other Enterobacteriaceae; therefore, monitoring by the related authorities may be a practical and beneficial approach to prevent possible food-borne and opportunistic infections in societies. References Arnold ME, Papadopoulou C, Davies RH, Carrique-Mas JJ, Evans SJ, Hoinville LJ (2010) Estimation of Salmonella prevalence in UK egg-laying holdings. Prev Vet Med 94(3–4):306–309 Comp Clin Pathol Bajaj BK, Sharma V, Thakur RL (2003) Prevalence and antibiotic resistance profiles of Salmonella spp. in poultry eggs. J Food Sci Technol 40:682–684 Bozorgnia M, Khakpur M, Javadi A, Babapur A, Aghili A, Hooshangi M (2008) Survey on bacterial contamination of commercial eggs in Tabriz. In: 6th Convention of Iranian Veterinary Clinicians, 27–29 July 2008 Tehran, Iran Center for Disease Control and Prevention (2004) Salmonella surveillance: annual summary. US Department of Health and Human Services, Atlanta Clinical and Laboratory Standards Institute (2005) Performance standards for antimicrobial susceptibility testing, approved standard M100-S15. Clinical and Laboratory Standards Institute, Wayne Diz Dios P, Feijoo J, Alvarez FJ, Castro M, Varela J (1993) Oral Enterobacteriaceae in HIV patients. In: International Conference on AIDS, Santiago de Compostela University, Spain Downes FP, Ito K (2004) Compendium of methods for the microbiological examination of foods, 4th edn. American Public Health Association, Washington D.C Dyda A, Hundy R, Moffat CR, Cameron S (2009) Outbreak of Salmonella Typhimurium 44 related to egg consumption. Commun Dis Intell 33(4):414 Erdoğrul OT, Özkan N, Çakiroğlu E (2002) Salmonella Enteritidis in quail eggs. Turk J Vet Anim Sci 26:321–323 Gast RK (2008) Paratyphoid infection. In: Saif YM, Fadly AM, Glisson JR, Mc Dougald LR, Nolan LK, Swayne DE (eds) Disease of poultry, 12th edn. Blackwell, Ames, pp 636–651 Hadian Z (1998) Survey on Salmonella contamination of commercial edible eggs in Tehran province. National Nutrition and Food Technology Research Institute, Iran Holt GJ (1994) Bergey’s manual of determinative bacteriology, 9th edn. Lippincott Williams & Wilkins Li X, Payne JB, Santos FB, Levine JF, Anderson KE, Sheldon BW (2007) Salmonella populations and prevalence in layer feces from commercial high-rise houses and characterization of the Salmonella isolates by serotyping, antibiotic resistance analysis and pulsed field gel electrophoresis. Poult Sci 86:591– 597 Madadgar O, Salehi TZ, Ghaffari MM, Tamai IA, Madani SA, Yahyareyat R (2009) Study of an unusual paratyphoid epornitic in canaries (Serinus canaria). Avian Pathol 38(6):437– 441 Manfredi R, Nanetti A, Ferri M, Chiodo F (2001) Enterobacter spp. Infections complicating the course of HIV disease. J Chemother 13:195–201 Mirzaie S, Hassanzadeh M, Ashrafi I (2010) Identification and characterization of Salmonella isolates from captured house sparrows. Turk J Vet Anim Sci 34(1):181–186 Musgrove MT, Jones DR, Northcutt JK, Cox NA, Harrison MA, Fedorka-Cray PJ, Ladely SR (2006) Antimicrobial resistance in Salmonella and Escherichia coli isolated from commercial shell eggs. Poult Sci 85(9):1665–1669 National Antimicrobial Resistance Monitoring System (2005) NARMS data. http://www.fda.gov/AnimalVeterinary/SafetyHealth/Anti microbialResistance/NationalAntimicrobialResistanceMonitoring System/ucm093691.htm. Accessed Sept 2010 Pan TM, Liu YJ (2002) Identification of Salmonella Enteritidis isolates by polymerase chain reaction and multiplex polymerase chain reaction. J Microbiol Immunol Infect 35:147– 151 Sepehri G, Abbaszade H, Akbarpur P, Nekubin M (2007) The microbial resistance in broilers samples to routine antibiotics in Kerman. Journal of Veterinary Research. Tehran Faculty of Veterinary Medicine, Iran, no: 2