Journal of Invertebrate Pathology 105 (2010) 190–193 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Short Communication High levels of genetic diversity in Spodoptera exempta NPV from Tanzania Elizabeth M. Redman a,b, Kenneth Wilson c, David Grzywacz d, Jenny S. Cory a,e,* a Centre for Ecology and Hydrology, Mansfield Road, Oxford OX1 3SR, United Kingdom Institute of Comparative Medicine, Faculty of Veterinary Medicine, University of Glasgow, Bearsden Road, Glasgow G61 1QH, United Kingdom c Insect and Parasite Ecology Group, Lancaster Environment Centre, Lancaster University, Lancaster LA1 4YQ, United Kingdom d Natural Resources Institute, University of Greenwich, Central Avenue, Chatham Maritime, Kent ME4 4TB, United Kingdom e Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby, BC, Canada V5A 1S6 b a r t i c l e i n f o Article history: Received 16 February 2010 Accepted 18 June 2010 Available online 22 June 2010 Keywords: Armyworm Lepidoptera Baculovirus Nucleopolyhedrovirus Genetic diversity Phylogeny a b s t r a c t The African armyworm, Spodoptera exempta, is a major pest in sub-Saharan Africa. A nucleopolyhedrovirus (NPV) is often recorded in later population outbreaks and can cause very high levels of mortality. Research has been addressing whether this NPV can be developed into a strategic biological control agent. As part of this study, the variation in natural populations of NPV is being studied. An isolate of S. exempta NPV was cloned in vivo and found to contain at least 17 genetically-distinct genotypes. These genotypes varied in size from approximately 115 to 153 kb. Ó 2010 Elsevier Inc. All rights reserved. 1. Introduction The African Armyworm, Spodoptera exempta (Walker) (Lepidoptera: Noctuidae) is an episodic migratory pest of the Old World tropics but is most prevalent in sub-Saharan Africa, especially on the eastern half of the continent. During almost annual population outbreaks, S. exempta larvae can devastate large areas of rangeland and graminaceous crops (Haggis, 1987) and are capable of achieving densities of 200–1000 larvae per m2 (Rose et al., 2000; Grzywacz et al., 2008). The limited availability and prohibitive cost of effective chemical control measures means that subsistence farmers can do little to counter this rampant pest in outbreak years (Njuki et al., 2004), although larvae at the end of the outbreak season are often killed in large numbers by an NPV (Rose et al., 2000). The development of S. exempta NPV (SpexNPV) into a biological control agent may offer a viable control option. SpexNPV is a specific and extremely pathogenic natural mortality agent of S. exempta, which has shown considerable potential in field spray-trials carried out in northern Tanzania (Grzywacz et al., 2008). To support this work, a basic understanding of the diversity and genetic composition of SpexNPV is required. Briefly, we report on the isolation of individual SpexNPV genotypes and their genetic characterisation using Restriction Fragment Length Polymorphism (RFLP) * Corresponding author at: Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby, BC, Canada V5A 1S6. E-mail address: jsc21@sfu.ca (J.S. Cory). 0022-2011/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2010.06.008 profiling. The approximate size of individual genomes is estimated and the phylogenetic relationship between genotypes is also investigated. 2. Materials and methods The SpexNPV isolate was collected in 1972 from S. exempta populations in Tanzania, amplified in vivo and stored at ÿ20 °C. Restriction endonuclease (REN) analysis of its DNA suggested the presence of multiple genotypes. SpexNPV is a multiple nucleopolyhedrovirus (MNPV) that can routinely package numerous genotypes within a single occlusion body (OB). In vivo cloning was undertaken to isolate the individual genotypes and was chosen over in vitro methodologies to avoid the introduction of artificial selection pressures. Smith and Crook (1988) developed in vivo cloning as a simple technique to isolate genotypes from mixed populations of baculoviruses. Slight modifications to their original technique have allowed the successful in vivo cloning of genotypes from Spodoptera exigua NPV (SeNPV) (Muñoz and Caballero, 2000) and Panolis flammea NPV (Cory et al., 2005) populations. In vivo cloning involves the serial infection of larvae using low viral doses until mortality is assumed to have initiated from a single virus genotype. Individual genetically-distinct isolates are provisionally identified by a lack of sub-molar bands in their REN profiles. The purity of suspected single-genotype isolates can be confirmed through the stability of REN patterns through additional rounds of infection. In vivo cloning involved the infection of 600 newly- E.M. Redman et al. / Journal of Invertebrate Pathology 105 (2010) 190–193 Table 1 Mean size (kb) of EcoRV, BamHI and XhoI fragments of S. exempta NPV estimated from a minimum number of three independently run agarose gels. REN fragments EcoRV BamHI XhoI A B C D E F G H I J K L M N O P Q R S T U V W X Y Z a b c 18.56 16.01 14.38 10.53 9.57 8.4 8.25 7.96 7.00 5.80 5.25 5.12 4.78 4.34 3.96 3.6 2.5 2.36 2.32 2.20 2.2 2.1 2.07 1.86 1.67 1.66 1.33 0.84 0.61 17.87 16.54 15.2 14.05 12.82 11.53 10.18 9.20 8.53 8.1 7.56 6.58 5.63 4.46 2.98 2.31 1.68 1.55 22.50 21.4 18.74 16.21 7.3 5.47 5.08 4.63 4.26 3.43 3.25 3.01 2.96 2.46 1.94 1.83 1.03 0.94 191 moulted 3rd instar S. exempta larvae in the first round and batches of 35 larvae in subsequent rounds, with a viral dose of 1200 OBs (LD10 estimated from Reeson et al., 1998), using the diet-plug contamination method. The S. exempta larvae used for cloning came from a culture maintained on a wheatgerm-based semi-synthetic diet at the NERC Centre for Ecology and Hydrology, Oxford. The insects were originally collected from Tanzania in 1996 (Vilaplana et al., 2010). A total mortality of 18% was achieved from the initial round of infection from which 37% of the cadavers were characterised with EcoRV. After two rounds of cloning, 18 genetically distinct single-genotype isolates had been identified, which remained stable through a third in vivo passage. The profile of one of the isolates produced sub-molar bands when BamHI and XhoI were introduced into the screen at this point and was therefore discarded. A fourth and final in vivo passage of the remaining 17 single genotypes confirmed their stability. The S. exempta culture used for in vivo cloning was known to support a high level of covert infection (Vilaplana et al., 2010); however, the profiles of the SpexNPV clones did not change during passage, indicating that expression of the covert virus was not an issue. A minimum number of three gels per enzyme (XhoI, BamHI and EcoRV) were used to estimate fragment sizes and total genome size (Table 1). In order to investigate the phylogeny of baculovirus species with no existing sequence information, one approach that has proved successful is to use a concatenated sequence from just a few phylogenetically informative genes (Herniou et al., 2004; Lange et al., 2004; Jehle et al., 2006). For this study, four different genes were selected for their proven phylogenetic potential: (1) the highly-conserved polh gene, encoding the OB protein (Zanotto Fig. 1. Restriction endonuclease (REN) analysis used for the estimation of the genome size of in vivo cloned S. exempta NPV genotypes. (A) EcoRV profiles of 17 genetically distinct, in vivo cloned, SpexNPV genotypes and wild-type SpexNPV fragments, resulting from digestion with EcoRV, named alphabetically, largest to smallest (Vlak and Smith, 1982); (B) mean genome size estimates for the 17 genotypes (± 1 SE) resulting from REN analysis with three different enzymes namely EcoRV, BamHI and XhoI. All fragments sized from a minimum of three separate agarose gels. 192 E.M. Redman et al. / Journal of Invertebrate Pathology 105 (2010) 190–193 et al., 1993); (2) lef-8, an essential late-expressed gene involved in transcription (Herniou et al., 2004); (3) egt, an auxiliary gene that interferes with insect moulting (Clarke et al., 1996); and (4) chitinase (chiA), another auxiliary gene, important for horizontal transmission (Kang et al., 1998). For the investigation of the phylogeny of the 17 SpexNPV genotypes, total DNA was extracted and used as template for the specific amplification of partial regions of each of the genes (polh, F:AGCGGCAAAGAGTTTCTCAG, R:GGTGTACTCGGA ATGCAGGT; lef-8, F:CATGGTGAAATGACTGTGGC, R:GGCGAACATTG AAAGATGGT; chiA, F:TCGCATGTGTTGTATGGATTC, R:GACGGCTAT TTTATCGTTTCC; egt, F:ATCCGGTTTTCGACAACAATC, R:AAGTGTACC AAACTGCCTTG). PCR reaction parameters have been published previously (Vilaplana et al., 2008). The PCR products were directly sequenced in triplicate and multiple alignments of gene sequence were produced with ClustalX (Thompson et al., 1997). Bayesian inference of nucleotide substitution parameters and topology was performed in MrBayes v3.1 (Ronquist and Huelsenbeck, 2003) using a partitioned model. A separate general time-reversible model with an inverse gamma distribution of rate variation across sites was estimated for each gene partition, allowing for potential variability of overall evolutionary rate between genes. The MCMC chain was run for 100,000 iterations (sampled every 10 iterations) and its convergence was determined from the average standard deviation of split frequencies. 3. Results and discussion The identification of 17 different genotypes from a natural isolate revealed a considerable level of genetic diversity and, with only a third of the viral cadavers analysed, it is likely that other genotypes remain as yet unidentified (Fig. 1A). Restriction fragment length polymorphisms have been reported for a number of species, suggesting that genome variation is common among many baculoviruses (Croizier and Ribeiro, 1992; Muñoz et al., 1999; Cooper et al., 2003; Graham et al., 2004; Cory et al., 2005; Li et al., 2005). For MNPVs, the possibility of the co-occlusion of different genotypes within the same OB means that it is premature to define these, single-genotype isolates as ‘‘clones” until their purity has been validated. Although the genome size estimates of the individual SpexNPV genotypes varied considerably from approximately 115 kb to 153 kb (Fig. 1B) they were all within the range of other Lepidopteran-specific NPVs (alphabaculoviruses). Thirty-six of the 50 completely sequenced baculovirus genomes published to date (deposited in genbank: December 2009) are alphabaculoviruses whose genome size varies from 111.7 kb (Adoxophyes orana NPV) to 168.0 kb (Leucania separata NPV). The nature and causes of the genome size differential of the SpexNPV genotypes has yet to be resolved, but could represent the presence of large insertions and deletions, as has been identified in other species. Investigation of the intra-specific genome size variation identified in SpliNPV was successfully mapped to large genomic deletions (4.5 kb) of the pif gene (Kikhno et al., 2002). An earlier phylogeny based on the polh gene showed an Egyptian SpexNPV isolate to be most closely related to S. exigua NPV (SeNPV), followed by, Spodoptera litura NPV (SpltNPV) and Spodoptera frugiperda NPV (SfNPV) (Herniou and Jehle, 2007). We used four partial gene sequences to confirm that SpexNPV was indeed most closely related to SeNPV (Fig. 2A). The phylogeny of SpexNPV genotypes shows a number of genotypes are very closely related to each other. High posterior probability values (PP) support the close relationships of genotype 1 with genotype 3, genotype 2 with genotype 6 and genotype 12 with genotype 16. There is also statistical support for the formation of two distinct clusters of genotypes Fig. 2. Consensus phylogram (50% majority rule) of consensus SpexNPV sequence and closely related species (A) and SpexNPV genotypes (B). Both figures result from Bayesian analysis of partial polh, lef-8, ChiA and egt sequence alignment using MrBayes v3.1 (Ronquist and Huelsenbeck, 2003). Analysis carried out using a partitioned model and a general time-reversible model with an inverse gamma distribution of rate variation across sites (GTR + I + C). Values at nodes represent posterior probabilities. Shaded areas represent clusters with statistical support. Estimates of evolutionary divergence between sequences also measured as the number of base substitutions per site. Analyses were conducted using the Kimura 2-parameter method in MEGA4 (Tamura et al., 2007) based on the pairwise analysis of 20 sequences. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 1628 positions in the final dataset (C). E.M. Redman et al. / Journal of Invertebrate Pathology 105 (2010) 190–193 (Fig. 2B, grey shading). The first cluster (cluster 1) consists of the relatively closely related genotypes 5, 10, 13 and 17 (PP = 0.96) and cluster 2 is made up of more phylogenetically divergent genotypes 4, 11, 12, 16, 15, 14, 2 and 6 (PP = 0.81). Re-running the analysis without the polh sequence data significantly alters this clustering pattern. Cluster 1 is lost completely and genotypes 4 and 11 are lost from cluster 2, whose posterior probability is reduced to 0.67 (data not shown). Such a discrepancy between phylograms caused by the inclusion of the polh gene may be evidence of the mosaic nature of this gene, as noted in AcMNPV (Jehle, 2004). For the combined gene sequence, the intra-specific sequence divergence was no more than 0.019, representing just a tiny proportion of the total sequence divergence observed between SpexNPV and other closely related species (Fig. 2C). SpexNPV is currently being sequenced and should allow for a much more detailed examination of its genetics and phylogenetics. Acknowledgments We would like to thank Tim Carty for rearing the laboratory colony of S. exempta and for producing insect diet. This work was funded by the United Kingdom Department for International Development (DFID) for the benefit of developing countries. The views expressed are not necessarily those of the DFID R7954 Crop Protection Research Programme. References Clarke, E.E., Tristem, M., Cory, J.S., O’Reilly, D.R., 1996. Characterisation of the ecdysteroid UDP-glucosyltransferase gene from Mamestra brassicae nucleopolyhedrosis virus. J. Gen. Virol. 77, 2865–2867. Cooper, D., Cory, J.S., Theilmann, D.A., Myers, J.H., 2003. Nucleopolyhedroviruses of forest and western tent caterpillars: cross-infectivity and evidence for activation of latent virus in high-density field populations. Ecol. Entomol. 28, 41–50. Cory, J.S., Green, B.M., Paul, R.K., Hunter-Fujita, F., 2005. Genotypic and phenotypic diversity of a baculovirus population within an individual insect host. J. Invertebr. Pathol. 89, 101–111. Croizier, G., Ribeiro, H.C.T., 1992. Recombination as a possible cause of genetic heterogeneity in Anticarsia gemmatalis nuclear polyhedrosis virus wild populations. Virus Res. 26, 183–196. Graham, R.I., Tyne, W.I., Possee, R.D., Sait, S.M., Hails, R.S., 2004. Genetically variable nucleopolyhedroviruses isolated from spatially separate populations of the winter moth Operophtera brumata (Lepidoptera: Geometridae) in Orkney. J. Invertebr. Pathol. 87, 29–38. Grzywacz, D., Mushobozi, W.L., Parnell, M., Jolliffe, F., Wilson, K., 2008. Evaluation of Spodoptera exempta nucleopolyhedrovirus (Spex NPV) for the field control of African armyworm (Spodoptera exempta) in Tanzania. Crop Protect. 27, 17–24. Haggis, M.J., 1987. Distribution of the African armyworm, Spodoptera exempta (Walk) (Lepidoptera: Noctuidae), and the frequency of larval outbreaks in Africa and Arabia. Bull. Entomol. Res. 76, 151–170. 193 Herniou, E.A., Jehle, J.A., 2007. Baculovirus phylogeny and evolution. Curr. Drug Targets 8, 1043–1050. Herniou, E.A., Olszewski, J.A., O’Reilly, D.A., Cory, J.S., 2004. Ancient coevolution of baculoviruses and their insect hosts. J. Virol. 78, 3244–3251. Jehle, J.A., 2004. The mosaic structure of the polyhedron gene of Autographa californica nucleopolyhderovirus (Ac MNPV). Virus Genes 29, 5–8. Jehle, J.A., Lange, M., Wang, H., Zhilong, H., Wang, Y., Hauschild, R., 2006. Molecular identification and phylogenetic analysis of baculovirus from Lepidoptera. Virology 346, 180–193. Kang, W., Tristem, M., Maeda, S., Crook, N.E., O’Reilly, D.R., 1998. Identification and characterisation of the Cydia pomonella granulovirus cathepsin and chitinase genes. J. Gen. Virol. 79, 2283–2292. Kikhno, I., Gutierrez, S., Croizier, L., Croizier, G., Lopez-Ferber, M., 2002. Characterisation of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J. Gen. Virol. 83, 3013–3022. Lange, M., Wang, H., Zhilong, H., Jehle, J.A., 2004. Towards a molecular identification and classification system of lepidopteran-specific baculoviruses. Virology 325, 36–47. Li, L., Li, Q., Willis, L.G., Erlandson, M., Theilmann, D.A., Donly, C., 2005. Complete comparative genome analysis of two field isolates of Mamestra configurata nucleopolyhedrovirus-A. J. Gen. Virol. 86, 91–105. Njuki, J., Mushobozi, W., Day, R., 2004. Improving Armyworm Forecasting and Control in Tanzania: A Socio-economic Survey. CABI Africa Regional Centre Nairobi, vol. 39, p. 49. Muñoz, D., Caballero, P., 2000. Persistence and effects of parasitic genotypes in a mixed population of the Spodoptera exigua nucleopolyhedrovirus. Biol. Control 19, 259–264. Muñoz, D., Murillo, R., Krell, P.J., Vlak, J.M., Caballero, P., 1999. Four genotypic variants of a Spodoptera exigua nucleopolyhedrovirus (Se-SP2) are distinguishable by a hypervariable genomic region. Virus Res. 59, 61–74. Reeson, A.F., Wilson, K., Gunn, A., Hails, R.S., Goulson, D., 1998. Baculovirus resistance in the Noctuid Spodoptera exempta is phenotypically plastic and responds to population density. Proc. R. Soc. Lond. B 265, 1787–1791. Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rose, D.J.W., Dewhurst, C.F., Page, W.W., 2000. The African Armyworm Handbook: The Status, Biology, Ecology, Epidemiology and Management of Spodoptera exempta (Lepidoptera: Noctuidae), second ed. Chatham. Natural Resources Institute, UK. Smith, I.R., Crook, N.E., 1988. In vivo isolation of baculovirus genotypes. Virology 166, 240–244. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25, 4876–4882. Vilaplana, L., Redman, E.M., Wilson, K., Cory, J.S., 2008. Density related variation in vertical transmission of a virus in the African armyworm. Oecologia 155, 237– 246. Vilaplana, L., Wilson, K., Redman, E.M., Cory, J.S., 2010. Pathogen persistence in migratory insects: high levels of vertically-transmitted virus infection in field populations of the African armyworm. Evol. Ecol. 24, 147–160. Vlak, J.M., Smith, G.E., 1982. Orientation of the genome of the Ac MNPV: a proposal. J. Virol. 41, 1118–1121. Zanotto, P.M.A., Kessing, B.D., Maruniak, J.E., 1993. Phylogenetic interrelationships among baculoviruses: evolutionary rates and host associations. J. Invertebr. Pathol. 62, 147–164.