Article
Angiotensin II profile and mRNA
encoding RAS proteins during bovine
follicular wave
Journal of the Renin-AngiotensinAldosterone System
12(4) 475–482
© The Author(s) 2011
Reprints and permission:
sagepub.co.uk/journalsPermissions.nav
DOI: 10.1177/1470320311403786
jra.sagepub.com
Rogério Ferreira1, Bernardo Gasperin1, Joabel Santos1,
Monique Rovani1, Robson AS Santos2, Karina Gutierrez1,
João Francisco Oliveira1, Adelina M Reis2 and
Paulo Bayard Gonçalves1
Abstract
Angiotensin II (AngII) has a role in ovarian follicle development, ovulation, and oocyte meiotic resumption. The objective
of the present study was to characterise the AngII profile and the mRNA encoding RAS proteins in a bovine follicular
wave. Cows were ovariectomised when the size between the largest (F1) and the second largest follicle (F2) was not
statistically different (day 2), slightly different (day 3), or markedly different (day 4). AngII was measured in the follicular
fluid and the mRNA abundance of genes encoding angiotensin-converting enzyme (ACE), (pro)renin receptor, and reninbinding protein (RnBP) was evaluated in the follicular cells from F1 and F2. The AngII levels increased at the expected
time of the follicular deviation in F1 but did not change in F2. However, the expression of the genes encoding ACE,
(pro)renin receptor, and RnBP was not regulated in F1 but was upregulated during or after the follicular deviation in F2.
Moreover, RnBP gene expression increased when the F1 was treated with the oestrogen receptor-antagonist in vivo. In
conclusion, the AngII concentration increased in the follicular fluid of the dominant follicle during and after deviation and
further supports our finding that RAS is present in the ovary regulating follicular dominance.
Keywords
ACE, angiotensin II, follicular growth, (pro)renin receptor, RnBP
Introduction
The renin–angiotensin system (RAS) is well known for its
systemic control that regulates blood pressure and fluid
homeostasis. According to the systemic overview, angiotensinogen is expressed by the liver and is cleaved by
renin, an enzyme secreted by the kidneys, to produce the
decapeptide angiotensin I (AngI). AngI is cleaved by the
angiotensin-converting enzyme (ACE), largely present in
endothelial cells,1 to form angiotensin II (AngII), a more
powerful and active peptide of the RAS. However, the presence of the RAS components in specific tissues, such as in
the ovarian follicle, takes on a new concept of ‘local’ or
‘tissue’ renin–angiotensin systems. Moreover, the regulation of local system is independent of systemic control.
The local renin–angiotensin systems act as an autocrine/
paracrine factor, with a different role in heart, vessels, kidney, brain, and endocrine gland.2,3 The concentrations of
AngII in the follicular fluid were higher than those in
plasma in human chorionic gonadotrophin (hCG)-treated
rodents.4 Also, high follicular fluid levels of AngII were
found after bilateral nephrectomy,4 and in vitro perfusion of
rabbit ovaries exposed to hCG.5
The angiotensin-converting enzyme catalyses the formation of AngII from AngI and the breakdown of bradykinin into inactive products. Bovine theca cells, but not
granulosa cells, expressed ACE,6-8 and this enzyme had
activity in the follicular fluid.7 However, the role of ACE
in ovary physiology is not fully understood. Captopril
(ACE inhibitor) did not inhibit ovulation in the perfused
rabbit ovaries.9 In contrast, the AT2 blocker inhibited ovulation and oocyte maturation.10-12 It is suggested that in
extra-renal tissues there are other enzymes that may be
Laboratory of Biotechnology and Animal Reproduction – BioRep,
Federal University of Santa Maria, Brazil
2 Department of Physiology, Institute of Biological Sciences, Federal
University of Minas Gerais, Brazil
1
Corresponding author:
Paulo Bayard Gonçalves, Departamento de Clínica de Grandes Animais,
Hospital Veterinário, Universidade Federal de Santa Maria,
Postal code 97105-900, Santa Maria, RS, Brazil.
Email: bayard@biorep.ufsm.br
Downloaded from jra.sagepub.com by guest on July 27, 2016
476
Journal of the Renin-Angiotensin-Aldosterone System 12(4)
responsible for the production of AngII.13,14 Husain et al.4
obtained AngII in vitro from angiotensinogen, using plasminogen activator as catalyst enzyme. Moreover, ACE
inhibitors may prevent the hydrolysis of bradykinin15,16 and
the clearance of Ang1-(1–7).17
Prorenin is the precursor of renin and has been assumed
to be an inactive precursor form.18 Renin is activated in
kidneys and is not detected in nephrectomised animals.19
However, AngII concentration in the follicular fluid
remains unaffected in the bilaterally nephrectomised
rats.4 More recently, it was demonstrated that prorenin
can have a proteolytic or a non-proteolytic activation.20,21
In the former, the propeptide is removed by various renal
processing enzymes, including proconvertase 1 and
cathepsin B. The latter is reversible, characterised by an
unfolding of the propeptide from the enzymatic cleft.21
The (pro)renin receptor ((P)RR) not only binds renin and
prorenin, but also activates prorenin by inducing a conformational change in the prorenin molecule.20,22,23.
Interestingly, the rat prorenin that is not activated by
human (pro)renin receptor (h(P)RR) binds and induces
signalling through this receptor.24 The plasma and the tissue angiotensin levels were unaltered in transgenic rats
that overexpress the h(P)RR. However, these animals displayed increased levels of aldosterone in the blood plasma
and cyclo-oxygenase-2 in the renal cortex.24 These results
are in agreement with the concept that (P)RR induces
angiotensin-independent effects. Also, proteins that interact with renin, such as a renin-binding protein (RnBP),
appear to inhibit renin in vivo RnBP.25 However, the
physiological role of RnBP and the relationship between
RnBP and renin metabolism, and the tissue-specific regulation of RnBP gene expression are not yet understood.
Moreover, to the best of the authors’ knowledge, the presence of (P)RR and RnBP has not been demonstrated in
the mammalian ovary.
In addition to the well-known AngII effects on smooth
muscle contraction, aldosterone secretion, and blood
pressure regulation, the group has demonstrated that this
peptide has a pivotal role on ovulation11 and oocyte maturation.12 However, the profile of RAS components had not
been demonstrated during follicular wave development
and it can be helpful to understand the mechanisms
involved in the dominant follicle selection of monovular
species. Cattle provide an excellent model for studying
the role of local factors in the control of follicle development, as the follicular wave can be accurately monitored
on a day-to-day basis by ultrasonography in vivo26-28 and
the follicular environment can be easily modified by an
ultrasound-guided intrafollicular injection.11,29 The
present study characterised the expression of elements of
new concept of local RAS, such as (P)RR and RnBP, during follicular development. The authors have also induced
follicular atresia by the intrafollicular injection of an
oestradiol-receptor inhibitor to test the regulation of local
RAS during health/atresia transition.
Materials and methods
Experiment 1: angiotensin II and mRNA encoding
RAS proteins during bovine follicular wave
Thirty-six weaned beef cows (predominantly Hereford and
Aberdeen Angus), with an average body condition score of
3 (1–5, emaciated to obese), were used in this study. The
cows were given two doses of a PGF2a analogue (cloprostenol, 125 µg; Schering-Plough Animal Health, Brazil)
intramuscularly (i.m.), 12 h apart. They were observed in
oestrus within 3–5 days after PGF2a, and the experiment
was performed during the first follicular wave of the
oestrous cycle. Ovaries were then examined once a day by
transrectal ultrasonography, using an 8-MHz linear-array
transducer (Aquila Vet scanner, Pie Medical, Netherlands),
and all follicles larger than 5 mm were drafted using three to
five virtual slices of the ovary allowing a three-dimensional
localisation of follicles and monitoring individual follicles
during follicular wave.30 The day of the follicular emergence
was designated as day 0 of the wave and was retrospectively
identified as the last day on which the dominant follicle was
4 or 5 mm in diameter.31 The cows were randomly assigned
to be ovariectomised by colpotomy at days 2, 3, and 4 of
the follicular wave (four cows for each day) to recover the
largest and the second largest follicle from each cow. This
approach allowed the authors to investigate the RAS components and follicular fluid content before, during, and after
follicular divergence.
Experiment 2: mRNA encoding RAS proteins during
initial atresia
To further demonstrate that RAS proteins’ mRNA expression is upregulated during initial atresia, 20 Bos taurus
taurus adult cyclic cows (as previously described) were
synchronised with a progesterone-releasing intravaginal
device (1 g progesterone, DIB – Intervet Schering Plough),
an injection of 2 mg oestradiol benzoate i.m. (Genix,
Anápolis, Brazil), and two injections of 250 µg sodium cloprostenol i.m. (12 h apart; Ciosin – Intervet Schering
Plough). All treatments performed at the same time on day
0. Four days later, the progesterone devices were removed
and the ovaries were monitored daily until the largest follicle of the growing cohort reached a diameter of 7–8 mm. At
this moment, an intrafollicular injection of fulvestrant (a
selective oestrogen receptor antagonist) in a final concentration of 100 µM (based on a previous dose–response
experiment; data not shown) or saline was given. The cows
were ovariectomised 12 (n = 3/group) or 24 hours (n = 4/
group) after the intrafollicular injection. The injections
were given as previously described.11
Follicles
After ovariectomy, follicular fluid, granulosa, and theca
cells were recovered from F1 and F2 (experiment 1) and
Downloaded from jra.sagepub.com by guest on July 27, 2016
477
Ferreira et al.
Table 1. Primers used in the expression analysis of candidate genes. Primer sequences and concentrations used to amplify each
product are described
Gene
Sequence
Conc.
(µM)
Reference or accession no.
ACE
F
R
ACTCCTGGAGGTCCATGTACGA
ACGTAGGCGTGCAGGTTCAG
200
200
AJ309016.1
Aromatase
F
R
GTGTCCGAAGTTGTGCCTATT
GGAACCTGCAGTGGGAAATGA
300
300
Luo and Wiltbank52
CYP17
F
R
GAATGCCTTTGCCCTGTTCA
CGCGTTTGAACACAACCCTT
200
200
Buratini et al.32
GAPDH
F
R
GATTGTCAGCAATGCCTCCT
GGTCATAAGTCCCTCCACGA
200
200
NM_001034034.1
(pro)renin receptor
F
R
TGATGGTGAAAGGAGTGGACAA
TTTGCCACGCTGTCAAGACT
200
200
ENSBTAT00000023668
RnBP
F
R
GGCAGGACATGGAGAAGGAA
TGGGAATGATCCAGCCAGAA
200
200
NM_001046223.1
F: forward primer, R: reverse primer, Conc.: primer concentration used for gene amplification
from fulvestrant- or saline-treated follicles (experiment 2)
and stored at –80ºC. Follicular fluid oestradiol levels from
all follicles were determined by ELISA following the manufacturer’s instructions (Cayman Biochemical). Crosscontamination of the theca and the granulosa cells was
tested by RT-PCR to detect cytochrome P450 aromatase
(CYP19A1) and 17a-hydroxylase (CYP17A1) mRNA.
The granulosa cells that expressed CYP17A1 and the theca
cells that expressed CYP19A1 were discarded.32
Follicular fluid from F1 and F2 (experiment 1) was
recovered to measure AngII and stored in the presence of
the following protease inhibitors: 10-5 M phenylmethylsulfonyl fluoride, 10-5 M pepstatin A, 10-5 M EDTA, 10-5 M
p-hydroxymercuribenzoate, and 9 × 10-4 M orthophenanthroline, all purchased from Sigma-Aldrich Corp. AngII
was measured as described by Costa et al.33
Nucleic acid extraction and real-time RT-PCR
Total RNA was extracted using Trizol (theca cells) or a silicabased protocol (granulosa cells; Qiagen, Mississauga, ON,
Canada) according to the manufacturer’s instructions and
was quantified by absorbance at 260 nm. Total RNA (1 µg)
was first treated with 0.2 U DNase (Invitrogen) at 37°C for
5 min to digest any contaminating DNA, followed by heating to 65°C for 3 min. The RNA was reverse transcribed
(RT) in the presence of 1 µM oligo(dT) primer, 4 U
Omniscript RTase (Omniscript RT Kit; Qiagen, Mississauga,
ON, Canada), 0.5 µM dideoxynucleotide triphosphate
(dNTP) mix, and 10 U RNase Inhibitor (Invitrogen) in a
volume of 20 µl at 37°C for 1 h. The reaction was terminated by incubation at 93°C for 5 min.
Real-time polymerase chain reaction (PCR) was conducted in a Step One Plus instrument (Applied Biosystems,
Foster City, CA) with Platinum SYBR Green qPCR
SuperMix (Invitrogen) and bovine-specific primers (table 1).
Common thermal cycling parameters (3 min at 95°C, 40
cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C) were
used to amplify each transcript. Melting-curve analyses
were performed to verify product identity. The samples
were run in duplicate and were expressed relative to
GAPDH as the housekeeping gene. The relative quantification of gene expression across treatments was evaluated
using the ddCT method 34. Briefly, the dCT is calculated as
the difference between the CT of the investigated gene and
that of GAPDH in each sample. The ddCT of each investigated gene is calculated as the difference between the dCT
in each treated sample and the dCT of the sample with
lower gene expression (higher dCT). The fold change in
relative mRNA concentrations was calculated using the formula 2–ddCT. Bovine-specific primers (table 1) were taken
from the literature or designed using Primer Express
Software v. 3.0 (Applied Biosystems) and synthesised
by Invitrogen.
Statistical analysis
The differences in continuous data between the dominant
and the subordinate follicle were assessed by a paired
Student’s t test using the cow as subject. The regulation of
AngII and mRNA-encoding RAS proteins was analysed by
ANOVA and a multicomparison between days or groups
was performed by least square means. Data were tested for
normal distribution using the Shapiro–Wilk test and normalised when necessary. All analyses were performed using
JMP software (SAS Institute Inc., Cary, NC) and p < 0.05
was considered statistically significant. Data are presented
as means ± SEM.
Downloaded from jra.sagepub.com by guest on July 27, 2016
478
Journal of the Renin-Angiotensin-Aldosterone System 12(4)
Results
Follicular Diameter
(mm)
Follicular Size
**
12
Ovarian follicle model
*
9
The cows were ovariectomised at days 2, 3, and 4 of the
first wave of follicular development. This experimental
design allowed the recovery of follicles when the follicular
size of the largest and the second largest was not different
(day 2; p > 0.05), slightly different (day 3; p < 0.05), or
markedly different (day 4; p < 0.01) (figure 1).28 The mRNA
abundance levels of CYP19 in granulosa cells increased in
the dominant follicles and decreased in the subordinate follicles during development (figure 1). These results confirm
that the ovaries obtained at days 2, 3, and 4 of the first follicular wave were before, during, and after follicular deviation, respectively. The samples were discarded when
cross-contaminations between the theca and the granulosa
cells were detected, or the amount of the follicular fluid or
the extracted RNA was insufficient to be processed. When
one follicle was discarded, the data of both follicles (the
largest and the second largest) from the same cow were
excluded from the statistical analysis.
6
3
0
CYP19
Relative mRNA
abundance
2,5
**
*
2
1,5
1
0,5
0
Estradiol
Estradiol (ng/mL)
500
**
400
*
300
200
Follicular fluid AngII concentration
100
The concentration of AngII was measured in the follicular
fluid to test the hypothesis that AngII is differentially regulated in the dominant and the subordinate follicles during
the follicular wave. The AngII concentrations increased in
the follicular fluid during deviation only in the dominant
follicle (figure 2). In the second largest follicle, AngII
concentration did not significantly change throughout
the follicular wave and the deviation was very high (data
not shown).
0
Day 2
Day 3
Day 4
Relative to Follicular Wave
Figure 1. Follicular diameter, granulosa cells aromatase
(CYP19) relative mRNA abundance and follicular fluid oestradiol
concentration of the largest (black bar) and the second largest
(open bar) follicle (mean ± SEM) collected at days 2 (n = 4),
3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle.
Asterisk (* or **) indicates statistical difference between the
largest and the second largest follicle assessed by a paired
Student’s t test using the cow as subject.
*p ≤ 0.05.
**p ≤ 0.001.
RAS component gene expression
The results provide evidence that ACE, (P)RR, and RnBP
are differentially regulated in the granulosa cells of the
F1
a
AngII (pg/mL)
200
150
F2
a
500
400
b
300
100
200
50
100
0
0
Day 2
Day 3
Day 4
Relative to Follicular Wave
Day 2
Day 3
Day 4
Relative to Follicular Wave
Figure 2. Angiotensin II (AngII) in the follicular fluid of the largest (F1) and the second largest follicle (F2) from cows ovariectomised
at days 2 (n = 2), 3 (n = 4), and 4 (n = 4) of the first follicular wave of a cycle. A paired Student’s t test did not point to a difference
between F1 and F2, values are represented in different graphs. Bars with no common letter are different (a ≠ b, p ≤ 0.05).
Downloaded from jra.sagepub.com by guest on July 27, 2016
479
Ferreira et al.
ACE
Relative mRNA
abundance
**
1500
1000
500
Relative mRNA
abundance
3
2000
ACE
2
1
0
0
(pro)renin receptor
(pro)renin receptor
2,5
*
Relative mRNA
abundance
Relative mRNA
abundance
15
12
9
6
3
2
1,5
1
0,5
0
0
RnBP
RnBP
*
Relative mRNA
abundance
Relative mRNA
abundance
60
4
**
40
20
*
3
2
1
0
0
12h
24h
Time after fulvestrant treatment
Day 2
Day 3
Day 4
Relative to Follicular Wave
Figure 3. Expression of renin–angiotensin system-related
genes in granulosa cells during follicular development. Granulosa
cells were recovered from the largest (black bar) and the
second largest (open bar) follicle (mean ± SEM) collected at
days 2 (n = 3), 3 (n = 4), and 4 (n = 4) of the first follicular
wave of a cycle. Asterisk (* or **) indicates statistical difference
between the largest and the second largest follicle assessed by a
paired Student’s t test using the cow as subject.
*p ≤ 0.05.
**p ≤ 0.001.
ACE: angiotensin-converting enzyme, RnBP: renin-binding protein.
second largest follicle during follicular wave development
(figure 3). The mRNA expression of (P)RR was upregulated in the granulosa cells at the expected moment of
follicular deviation, while RnBP mRNA increased during
and after the deviation process. Nevertheless, ACE mRNA
expression upregulation was only observed after the
expected moment of follicular deviation, when the subordinate follicle undergoes atresia (figure 3). On the theca cells,
there was no regulation of ACE, (P)RR, or RnBP gene
expression during the follicular growth or between the
dominant and the subordinate follicle (data not shown).
The mRNA encoding RAS proteins was further assessed
after the intrafollicular injection of fulvestrant to induce
atresia. The authors have previously confirmed that the
intrafollicular injection of fulvestrant (100 µM) decreased
Figure 4. Expression of renin–angiotensin system-related
genes in granulosa cells 12 or 24 h after intrafollicular selective
oestrogen receptor antagonist (fulvestrant) treatment.
Granulosa cells were recovered from (black bar) saline- and
(open bar) fulvestrant-treated follicles 12 h (n = 3/group) and
24 h (n = 4/group) after intrafollicular injection (mean ± SEM).
Asterisk (*) indicates statistical difference between groups
(p ≤ 0.05).
ACE: angiotensin-converting enzyme, RnBP: renin-binding protein.
CYP19A1 gene expression and induced follicular atresia
from 12 h after treatment. The ACE and (P)RR (at 12 and
24 h) and the RnBP (at 12 h after intrafollicular injection)
mRNA expression in granulosa cells did not differ between
fulvestrant- and saline-treated follicles. However, RnBP
mRNA expression was upregulated in fulvestrant-treated
follicles at 24 h after intrafollicular injection (figure 4;
p < 0.05).
Discussion
The authors used a well-established experimental model
proposed by Rivera et al.35 and found that the concentration of AngII in the follicular fluid of the dominant follicle
increased at the expected time of follicular deviation.
Downloaded from jra.sagepub.com by guest on July 27, 2016
480
Journal of the Renin-Angiotensin-Aldosterone System 12(4)
There is evidence that AngII is involved in the mechanism
of follicular deviation in cattle. Recently, it was found that
AngII is required for dominance and the follicle development when FSH levels are low during the cow follicular
wave after follicular deviation.36 It is well known that the
concentration of AngII in follicular fluid increases after
LH surge in the bovine;37 however, AngII concentration
had not been measured during the follicular wave development in mammals.
The expression of genes codifying for ACE, (P)RR, and
RnBP was upregulated in the second largest follicle during
and after follicular divergence. Berisha et al.8 observed
an upregulation of ACE gene in the highest steroidogenic
follicles (with a diameter greater than 12 mm) in ovarian
follicles from an abattoir. However, Daud et al.9 observed
low ACE levels in pre-ovulatory follicles and suggested a
role for ACE in follicular atresia. Moreover, in the ovariectomised rats, the replacement of oestrogen reduced the
ACE activity in the aorta and the kidney tissue and plasma.38
These results together suggest that oestrogen secretion by a
dominant follicle can suppress ACE expression in a dominant follicle. ACE mRNA upregulation in subordinate follicles may be a consequence of low oestradiol levels, as
previously suggested.38 The fact that ACE inhibits the accumulation of nitric oxide,39 a factor involved in the prevention of follicular cell apoptosis40 and the stimulation of
bovine granulosa cell oestradiol secretion,41 suggests that
ACE can be involved in follicular atresia.38 In contrast,
kinins induced nitric oxide synthesis39,42 and ACE is a
major kininase that inactivates kinins.43 Therefore, one cannot rule out a possible interaction between these two systems to promote follicular atresia in cattle.
The authors observed that the ACE gene is upregulated
but did not result in a concomitant increase of AngII levels
in the follicular fluid of the second largest follicle. Captopril,
an ACE inhibitor, did not inhibit the hCG-induced ovulation
in the rabbit perfused ovaries.9 In contrast, treatment with
saralasin, an AT1 and AT2 blocker, is able to inhibit ovulation and oocyte maturation in rabbits10 and cattle.11,12 There
are some possible reasons for the discrepant results between
captopril and saralasin, which may also explain the upregulation of ACE without increasing AngII. For example, ACE
inhibitors have other effects, including the prevention of
the hydrolysis of bradykinin15,16 and the clearance of Ang1(1–7).17 Alternative enzymes have been demonstrated to be
able to cleave AngI into AngII, such as members of plasminogen activator family,44 cathepsin D, and chymase,13
giving rise to the possibility of an alternative pathway to
produce AngII in ovarian follicular cells. The perfusion of
the isolated rabbit ovaries with IGF-1, an important local
factor that controls follicular dominance, increases the follicular growth and the intrafollicular plasminogen activator
activity.45 Moreover, the same authors stimulated in vitro
both follicular growth and the intrafollicular AngII content
using streptokinase, an exogenous PA.
The present results provide, to the authors’ knowledge,
the first direct evidence of differential regulation of local
RAS components during follicular deviation in the bovine
ovary. However, the hypothesis that (P)RR is regulating the
AngII production in the ovarian follicle during the follicular deviation was not confirmed. The regulatory pattern of
AngII was different from that observed for (P)RR in the
dominant follicle. Many factors may account for these differences. One is that the (P)RR system seems to have at
least two different functions. One is angiotensin independent, that (P)RR induces an intracellular signal and a downstream effect. Another is an angiotensin-dependent function
related to the increased catalytic activity of receptor-bound
(pro)renin.46 Oestradiol seems to affect negatively renin
activity in the follicular fluid38 and a high prorenin-like
activity was observed in the atretic follicles.47 Renin and
ACE were demonstrated in the granulosa and the thecal
cells of antral follicles in cattle,6 which may explain the
presence of AngII but not the differential regulatory pattern
of AngII in a dominant follicle. Therefore, on the basis of
the actual knowledge, one cannot speculate about the biological function of the upregulation of (P)RR mRNA in the
subordinate follicles.
Renin-binding protein is a protein that binds to renin and
inhibits its activity. It can be found as a complex with renin
called high molecular weight renin48 and as a single protein.49 In the present study, RnBP was highly expressed in
the subordinated follicle and it increased expression during
follicular deviation. This result was further confirmed when
the authors assessed RnBP mRNA expression in in vivoderived follicles 24 h after the intrafollicular treatment with
the selective oestrogen receptor antagonist, fulvestrant. In
rat, the tissue distribution of RnBP mRNA was similar to
that of renin mRNA and was highly expressed in the ovary.50
Moreover, the same authors suggested a regulation of RnBP
gene expression by oestradiol, and the intravenous injection
of the RnBP into rats resulted in a rapid and strong inhibition of plasma renin activity that persisted for at least 2 h.
However, knockout of the gene encoding for this protein in
mice did not show any effect on RAS activity or blood pressure.51 Therefore, more studies are necessary to understand
the role of RnBP in the control of ovarian renin activity and
AngII production.
The authors have presented here a regulatory pattern of
AngII and mRNA expression of local RAS enzymes
throughout the follicular wave development in cattle. AngII
concentration increased in the dominant follicle during and
after the follicular deviation, which supports the recent
finding that AngII is required for the follicular development
when the levels of FSH decrease during deviation. Using an
in vivo model, it was found that the expression of ACE,
RnBP, and (P)RR mRNA is upregulated in the second largest follicle during and after the follicular deviation and that
intrafollicular injection of the oestradiol receptor antagonist
upregulates RnBP mRNA expression, suggesting an
Downloaded from jra.sagepub.com by guest on July 27, 2016
481
Ferreira et al.
interaction between oestradiol and the RAS system in
bovine follicle. In conclusion, the findings support the
hypothesis that a local RAS is present in the ovary regulating follicular dominance in cattle.
Acknowledgments
The authors would like to thank Fazenda do Leão, Dr José Manoel
Ferreira, and Dr Vinicius de Oliveira for providing the animals
and facilities.
Funding
This study was supported by the Brazilian Council of Scientific
and Technological Development (CNPq, grant number
502074/2008-6).
Conflict of interest statement
None declared.
References
1. Peach MJ. Renin–angiotensin system: biochemistry and
mechanisms of action. Physiol Rev 1977; 57: 313–370.
2. Phillips MI and Sumners C. Angiotensin II in central nervous
system physiology. Regul Pept 1998; 78: 1–11.
3. Kim S and Iwao H. Molecular and cellular mechanisms of
angiotensin II-mediated cardiovascular and renal diseases.
Pharmacol Rev 2000; 52: 11–34.
4. Husain A, Bumpus FM, Silva PD and Speth RC. Localization
of angiotensin II receptors in ovarian follicles and the identification of angiotensin II in rat ovaries. Proc Natl Acad Sci
USA 1987; 84: 2489–2493.
5. Yoshimura Y, Koyama N, Karube M, et al. Gonadotropin
stimulates ovarian renin–angiotensin system in the rabbit.
J Clin Invest 1994; 93: 180–187.
6. Schauser KH, Nielsen AH, Winther H, Dantzer V and
Poulsen K. Localization of the renin–angiotensin system in
the bovine ovary: cyclic variation of the angiotensin II receptor expression. Biol Reprod 2001; 65: 1672–1680.
7. Kobayashi S, Berisha B, Amselgruber WM, Schams D and
Miyamoto A. Production and localisation of angiotensin
II in the bovine early corpus luteum: a possible interaction
with luteal angiogenic factors and prostaglandin F2 alpha.
J Endocrinol 2001; 170: 369–380.
8. Berisha B, Schams D and Miyamoto A. The mRNA expression of angiotensin and endothelin system members in
bovine ovarian follicles during final follicular growth.
J Reprod Devel 2002; 48: 573–582.
9. Daud AI, Bumpus FM and Husain A. Characterization of
angiotensin I-converting enzyme (ACE)-containing follicles in the rat ovary during the estrous cycle and effects of
ACE inhibitor on ovulation. Endocrinology 1990; 126:
2927–2935.
10. Yoshimura Y, Karube M, Koyama N, Shiokawa S, Nanno T
and Nakamura Y. Angiotensin II directly induces follicle rupture and oocyte maturation in the rabbit. FEBS Lett 1992;
307: 305–308.
11. Ferreira R, Oliveira JF, Fernandes R, Moraes JF and
Gonçalves PB. The role of angiotensin II in the early stages
of bovine ovulation. Reproduction 2007; 134: 713–719.
12. Barreta MH, Oliveira JFC, Ferreira R, et al. Evidence that
the effect of angiotensin II on bovine oocyte nuclear maturation is mediated by prostaglandins E2 and F2α. Reproduction
2008; 136: 733–740.
13. Paul M, Poyan Mehr A and Kreutz R. Physiology of local
renin–angiotensin systems. Physiol Rev 2006; 86: 747–803.
14. Sihn G, Rousselle A, Vilianovitch L, Burckle C and Bader
M. Physiology of the (pro)renin receptor: Wnt of change?
Kidney Int 2010; 78: 246–256.
15. Gainer JV, Morrow JD, Loveland A, King DJ and Brown
NJ. Effect of bradykinin-receptor blockade on the response
to angiotensin-converting-enzyme inhibitor in normotensive and hypertensive subjects. N Engl J Med 1998; 339:
1285–1292.
16. Campbell DJ. The kallikrein–kinin system in humans. Clin
Exp Pharmacol Physiol 2001; 28: 1060–1065.
17. Yamada K, Iyer SN, Chappell MC, Ganten D and Ferrario
CM. Converting enzyme determines plasma clearance of
angiotensin-(1-7). Hypertension 1998; 32: 496–502.
18. Do YS, Shinagawa T, Tam H, Inagami T and Hsueh WA.
Characterization of pure human renal renin. Evidence for a
subunit structure. J Biol Chem 1987; 262: 1037–1043.
19. Sealey JE, White RP, Laragh JH and Rubin AL. Plasma
prorenin and renin in anephric patients. Circ Res 1977; 41:
17–21.
20. Nguyen G, Delarue F, Burckle C, Bouzhir L, Giller T and
Sraer JD. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J Clin
Invest 2002; 109: 1417–1427.
21. Suzuki F, Hayakawa M, Nakagawa T, et al. Human prorenin
has ‘gate and handle’ regions for its non-proteolytic activation. J Biol Chem 2003; 278: 22217–22222.
22. Nabi AH, Kageshima A, Uddin MN, Nakagawa T, Park EY
and Suzuki F. Binding properties of rat prorenin and renin
to the recombinant rat renin/prorenin receptor prepared by
a baculovirus expression system. Int J Mol Med 2006; 18:
483–488.
23. Batenburg WW, Krop M, Garrelds IM, et al. Prorenin is the
endogenous agonist of the (pro)renin receptor. Binding kinetics of renin and prorenin in rat vascular smooth muscle cells
overexpressing the human (pro)renin receptor. J Hypertens
2007; 25: 2441–2453.
24. Kaneshiro Y, Ichihara A, Sakoda M, et al. Slowly progressive, angiotensin II-independent glomerulosclerosis in
human (pro)renin receptor-transgenic rats. J Am Soc Nephrol
2007; 18: 1789–1795.
25. Takahashi S, Inoue H and Miyake Y. The human gene for
renin-binding protein. J Biol Chem 1992; 267: 13007–13013.
Downloaded from jra.sagepub.com by guest on July 27, 2016
482
Journal of the Renin-Angiotensin-Aldosterone System 12(4)
26. Savio JD, Keenan L, Boland MP and Roche JF. Pattern of
growth of dominant follicles during the oestrous cycle of
heifers. J Reprod Fertil 1988; 83: 663–671.
27. Ginther OJ, Kastelic JP and Knopf L. Composition and
characteristics of follicular waves during the bovine estrous
cycle. Anim Reprod Sci 1989; 20: 187–200.
28. Evans ACO and Fortune JE. Selection of the dominant follicle in cattle occurs in the absence of differences in the
expression of messenger ribonucleic acid for gonadotropin
receptors. Endocrinology 1997; 138: 2963–2971.
29. Kot K, Gibbons JR and Ginther OJ. A technique for intrafollicular injection in cattle: Effects of hCG. Theriogenology
1995; 44: 41–50.
30. Jaiswal RS, Singh J and Adams GP. Developmental pattern
of small antral follicles in the bovine ovary. Biol Reprod
2004; 71: 1244–1251.
31. Rivera GM and Fortune JE. Development of codominant follicles in cattle is associated with a follicle-stimulating hormone-dependent insulin-like growth factor binding protein-4
protease. Biol Reprod 2001; 65: 112–118.
32. Buratini J Jr, Teixeira AB, Costa IB, et al. Expression of
fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and -4, in bovine
antral follicles. Reproduction 2005; 130: 343–350.
33. Costa APR, Fagundes-Moura CR, Pereira VM, et al.
Angiotensin-(1–7): a novel peptide in the ovary. Endocrinology
2003; 144: 1942–1948.
34. Livak KJ and Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the
2-[Delta][Delta]CT Method. Methods 2001; 25: 402–408.
35. Rivera GM, Chandrasekher YA, Evans AC, Giudice LC and
Fortune JE. A potential role for insulin-like growth factor
binding protein-4 proteolysis in the establishment of ovarian
follicular dominance in cattle. Biol Reprod 2001; 65: 102–111.
36. Ferreira R, Gasperin B, Bohrer RC, et al. The Role of
Angiotensin II in Bovine Follicular Growth. 41th Annual
Meeting of the Society for the Study of Reproduction. 714
ed. 41th Annual Meeting of the Society for the Study of
Reproduction: Society for the Study of Reproduction, 2008,
p 240–241.
37. Acosta TJ, Ozawa T, Kobayashi S, et al. Periovulatory
changes in the local release of vasoactive peptides, prostaglandin F2α, and steroid hormones from bovine mature follicles in vivo. Biol Reprod 2000; 63: 1253–1261.
38. Brosnihan KB, Senanayake PS, Li P and Ferrario CM.
Bi-directional actions of estrogen on the renin–angiotensin
system. Braz J Med Biol Res 1999; 32: 373–381.
39. Zhang X, Xie YW, Nasjletti A, Xu X, Wolin MS and Hintze
TH. ACE inhibitors promote nitric oxide accumulation to
modulate myocardial oxygen consumption. Circulation
1997; 95: 176–182.
40. Dineva JD, Vangelov IM, Nikolov GG, Konakchieva R and
Ivanova MD. Nitric oxide stimulates the production of atrial
natriuretic peptide and progesterone by human granulosa
luteinized cells with an antiapoptotic effect. Endocr Regul
2008; 42: 45–51.
41. Faes MR, Caldas-Bussiere MC, Viana KS, Dias BL, Costa FR
and Escocard RM. Nitric oxide regulates steroid synthesis
by bovine antral granulosa cells in a chemically defined
medium. Anim Reprod Sci 2009; 110: 222–236.
42. Kuhr F, Lowry J, Zhang Y, Brovkovych V and Skidgel RA.
Differential regulation of inducible and endothelial nitric
oxide synthase by kinin B1 and B2 receptors. Neuropeptides
2010; 44: 145–154.
43. Kuoppala A, Lindstedt KA, Saarinen J, Kovanen PT and
Kokkonen JO. Inactivation of bradykinin by angiotensinconverting enzyme and by carboxypeptidase N in human
plasma. Am J Physiol Heart Circ Physiol 2000; 278:
H1069–1074.
44. Peterson MC, Morioka N, Zhu C, Ryan JW and LeMaire WJ.
Angiotensin-converting enzyme inhibitors have no effect
on ovulation and ovarian steroidogenesis in the perfused rat
ovary. Reprod Toxicol 1993; 7: 131–135.
45. Yoshimura Y, Aoki N, Sueoka K, et al. Interactions between
insulin-like growth factor-I (IGF-I) and the renin–angiotensin
system in follicular growth and ovulation. J Clin Invest 1996;
98: 308–316.
46. Nguyen G and Danser AH. Prorenin and (pro)renin receptor: a review of available data from in vitro studies and
experimental models in rodents. Exp Physiol 2008; 93:
557–563.
47. Schultze D, Brunswig B and Mukhopadhyay AK. Renin
and prorenin-like activities in bovine ovarian follicles.
Endocrinology 1989; 124: 1389–1398.
48. Takahashi S, Ohsawa T, Miura R and Miyake Y. Purification
of high molecular weight (HMW) renin from porcine kidney and direct evidence that the HMW renin is a complex of
renin with renin binding protein (RnBP). J Biochem 1983;
93: 265–274.
49. Takahashi S, Ohsawa T, Miura R and Miyake Y. Purification
and characterization of renin binding protein (RnBP) from
porcine kidney. J Biochem 1983; 93: 1583–1594.
50. Tada M, Takahashi S, Miyano M and Miyake Y. Tissuespecific regulation of renin-binding protein gene expression
in rats. J Biochem 1992; 112: 175–182.
51. Schmitz C, Gotthardt M, Hinderlich S, et al. Normal blood
pressure and plasma renin activity in mice lacking the reninbinding protein, a cellular renin inhibitor. J Biol Chem 2000;
275: 15357–15362.
52. Luo W and Wiltbank MC. Distinct regulation by steroids of
messenger RNAs for FSHR and CYP19A1 in bovine granulosa cells. Biol Reprod 2006; 75: 217–225.
Downloaded from jra.sagepub.com by guest on July 27, 2016