© Copyright 2003 by Humana Press Inc. All rights of any nature whatsoever reserved. 1085-9195/03/38/239–249/$20.00 ORIGINAL ARTICLE Hyperoxia Augments Pulmonary Lipofibroblast-to-Myofibroblast Transdifferentiation V. K. Rehan*1 and J. S. Torday1,2 Departments of Pediatrics1 and Obstetrics and Gynecology,2 Harbor-UCLA Medical Center Research and Education Institute, UCLA School of Medicine, Torrance, CA Abstract Bronchopulmonary dysplasia (BPD) remains a major cause of morbidity and mortality in premature infants, and despite many advances, its pathophysiology remains incompletely understood. Exposure of the premature lung to hyperoxia is commonly implicated in its pathogenesis. However, the exact link between hyperoxia and BPD, particularly its role in the generation of myofibroblasts, the signature cell-type for lung fibrosis, is undetermined. There is increasing evidence that lipid interstitial fibroblasts play an important role in injury-repair mechanisms in various organ systems. This study demonstrates that exposure to hyperoxia augments the transdifferentiation of pulmonary lipofibroblasts to myofibroblasts. Fetal rat lung fibroblasts (FRLF) from embryonic (e) (term = e22) 18 and e21 gestation were studied. After initial culture in minimum essential medium (MEM) and 10% fetal bovine serum (FBS) in 21% O2 / 5% CO2 at 37°C, FRLF were maintained in MEM and 10%FBS at 37°C under control (21% O2 / 5% CO2) and under experimental conditions (24-hour exposure to 95% O2 /5% CO2) at passage (P) 1 and 5. At each passage, cells were allowed to attach to 100 cm2 culture dishes and grow in 21% O2 before being subjected to the experimental conditions. Passage 1 and 5 cells were analyzed for the expression of well-characterized lipogenic and myogenic markers based on semiquantitative competitive RT-PCR (for parathyroid hormone–related protein receptor [PTHrPR]), adipose differentiation related protein (ADRP), and α smooth muscle actin (αSMA), triglyceride uptake, and leptin assay. Serial passage and maintenance of cells in 21% O2 resulted in a significant decrease in the expression of the lipogenic markers from P1 to P5, spontaneously. This decrease was greater for e18 than for e21 FRLF. However, exposing cells to 95% O2 augmented the loss of the lipogenic markers and gain of the myogenic marker from P1 to P5 in comparison to cells maintained in 21% O2. These changes were also greater for e18 vs e21 lipofibroblasts. These changes in mRNA expression were accompanied by decreased triglyceride uptake and leptin secretion on exposure to hyperoxia. These results suggest that exposure to hyperoxia (95% O2) augments the transdifferentiation of pulmonary lipofibroblasts to myofibroblasts. Hyperoxia-augmented transdifferentiation was at least partially attenuated by prostaglandin J2 pretreatment. Lipofibroblast-tomyofibroblast transdifferentiation may be an important mechanism for hyperoxic lung injury and may be an important element in the pathophysiology of BPD. In addition, induction of adipogenic transcription factors may not only prevent but, in fact, may reverse the myogenic fibroblast phenotype to the adipogenic fibroblast phenotype. Index Entries: Bronchopulmonary dysplasia; lung development; hyperoxia; pulmonary fibroblasts. *Author to whom all correspondence and reprint requests. Supported in part by American Heart Association grant (no. 0265127Y) to V.K.R. and National Institutes of Health grant (HL 55268) to J.S.T. and V.K.R. E-mail: vrehan@gcrc.rei.edu Cell Biochemistry and Biophysics 239 Volume 38, 2003 240 INTRODUCTION Bronchopulmonary dysplasia (BPD) occurs primarily in premature infants who require supplemental oxygen and ventilatory support (1–5). Despite numerous advances, its pathogenesis remains incompletely understood. Lung injury, abnormal repair, and truncation of alveolarization and vascularization are its cardinal pathologic features (5–8). Although multiple factors, acting additively or synergistically, are known to be important in its causation, exposure to relative hyperoxia (compared to intrauterine oxygen tension) and alveolar stretch are the principal contributing factors. However, the specific underlying mechanism linking hyperoxia to BPD remains poorly defined. In this study, we sought to determine whether exposure to hyperoxia augments the spontaneous in vitro transdifferentiation of pulmonary lipofibroblasts to myofibroblasts, the signature cell-type seen in chronic lung disease (8–13). Lung interstitial fibroblasts play an important role in lung development and repair (14–17). Normal cell–cell communications between primordial interstitial fibroblasts and the developing lung epithelium are essential for normal lung development and repair (18–23). Disruption of the communications between lipofibroblasts and epithelial cells, and/or vice versa, may severely affect lung growth and may play an important role in lung injury/BPD. Recent work has suggested that during specific developmental stages and in response to lung injury, interstitial fibroblasts differentiate along either an adipogenic or a myogenic pathway and can transdifferentiate from one phenotype to the other (24–26). The phenotypic characteristics of interstitial fibroblasts are of central importance in determining the nature of signaling communications between the mesenchyme and the epithelium. In this study, we determined the effects of hyperoxia on characteristic lipogenic markers in the immature (embryonic [e] 18) and developmentally more mature (e21) fetal rat lung lipofibroblasts (FRLF). We tested the hypothe- Cell Biochemistry and Biophysics Rehan and Torday sis that hyperoxia would augment the spontaneous transdifferentiation of interstitial fibroblasts from an adipogenic to a myogenic phenotype, and that this process is developmentally regulated. MATERIAL AND METHODS Reagents Rat leptin antibody assay kit (rat, polyclonal) was acquired from Linco (St. Charles, MO). 3H-triolein was purchased from New England Nuclear, Boston, MA. 2’,7’-dichlorofluorescein diacetate was purchased from Molecular Probes, Inc. (Eugene, OR). ANIMALS Time-mated Sprague-Dawley rats (time e0=day of mating) were obtained from Charles River Breeders (Holister, CA). All experiments were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals. I SOLATION OF FETAL RAT LUNG FIBROBLASTS Three to five time-mated (e18 and e21) Sprague Dawley rat dams were used per preparation, depending on the number of experimental variables to be tested. The fetal lungs were removed into Hanks’ balanced salt solution (HBSS) (37). The HBSS was decanted and 5 vol of 0.05% trypsin were added to the lung preparation. The lungs were dissociated in a 37°C water bath using a Teflon® stirring bar to disrupt the tissue mechanically. Once the tissue was dispersed into a unicellular suspension, the cells were pelleted at 500g for 10 min at room temperature in a 50-mL polystyrene centrifuge tube. The supernatant was decanted and the pellet was resuspended in minimal essential medium (MEM) containing 20% fetal bovine serum (FBS) to yield a mixed cell suspension of approx 3 × 108 cells, as determined by Coulter particle counter (Beckman-Coulter, Hayaleah, FL). The cell suspension was then added to culture flasks (75 cm2) for 30–60 min Volume 38, 2003 Hyperoxia Augments Pulmonary Lipofibroblasts to allow for differential adherence of lung fibroblasts. These cells are greater than 95% pure fibroblasts based upon vimentin-positive staining. C ELL C ULTURE e18 and e21 FRLF were maintained in MEM + 10% FBS 21% (control) or 95% (experimental) O2 / 5% CO2 in sealed modular incubator chambers (Billups-Rothenberg, Del Mar, CA) kept at 37°C in standard incubators. The modules were flushed for 3 min at a flow rate of 10 L/min with either 21% or 95% O2/5% CO2. The modules were then sealed and put into standard cell culture incubators. When confluent, the cells were passaged and allowed to grow in 21% O2 for 24 h. Subsequently, control cells were maintained in 21% O2/5% CO2, and experimental cells in 95% O2/ 5% CO2 in modules, as described previously. This was continued for up to 5 passages. Passage (P) 1 and 5 cells were studied for the expression of the various lipogenic and myogenic markers outlined below. I SOLATION OF TOTAL C ELLULAR R IBONUCLEIC ACID Total cellular ribonucleic acid (RNA) was isolated using previously described methods (28). Cells were lysed directly by vortexing in 0.2-mL lysis solution (2 M guanidinium isothiocyanate, 12.5-mM sodium citrate [pH 7.0], 0.25% sarkosyl, 50-mM 2-mercaptoethanol, and 50% (vol/vol) water-saturated phenol). Chloroformisoamyl alcohol (49:1, vol/vol) was added to each sample and the mixture was vortexed and cooled on ice. After centrifugation at 10,000g for 20 min at 4°C, RNA in the aqueous phase was precipitated in EtOH at –20°C. The RNA was pelleted at 10,000g for 20 min at 4°C. After reextraction in P:IC and ethanol precipitation, samples were resuspended in DEPC-treated water and quantitated by absorbance at 260 nm. R EVERSE TRANSCRIPTION-P OLYMERASE C HAIN R EACTION Reverse transcription-polymerase chain reaction (RT-PCR) probes used included rat Cell Biochemistry and Biophysics 241 parathyroid hormone–related protein receptor (PTHrPR): 5’ TGGACACCAGCATCTACGTCAG and 3’ GACATGGAGTATCCCACGGTGTA; rat adipocyte differentiation– related protein (ADRP): 5’ GAACAAAGGTCCTCATTATGG and 3’ ACAGTGATGAAGCCTGCTC, and rat alpha smooth muscle actin (SMA): 5’ CGCAAATATTCTGTCTGGATCG and 3’ TCACAGTTGTGTGCTAGAGACA. RTPCR was carried out for 2 h at 37°C in 50 mM Tris buffer, pH 8.3 containing 75 mM KCl, 3mM MgCl2, and 10 mM DTT. The total incubation volume was 20 µL, and it contained 0.5 mM each of dNTP, 20 U of RNAsin, 25 pmol of oligo(dt) primer, and 200-U of Moloney murine leukemia virus reverse transcriptase. At the end of the incubation, the reaction was stopped by heating at 90°C for 5 min. PCR amplification was performed in 75 µL final reaction volume, which contained the complementary deoxyribonucleic acid (cDNA) mixtures from various experimental conditions diluted with the reaction buffer 10X) to a final composition of 10 mM Tris buffer, pH 8.3; 50 mM KCl, 1.5 mM MgCl2 and 100 µM dNTPs, 2.5 U Taq polymerase, and 55 pmol of each primer. The amounts of complementary deoxyribonucleic acid (cDNA) were adjusted to equal concentrations as assessed by the PCR of the constitutively expressed gene, GAPDH (rat lung GAPDH). The amount of 18S ribosomal RNA synthesised from each cDNA template was visualized by ethidium bromide–stained agarose gel electrophoresis. The reactions were run according to a standard protocol at 42°C for 75 min and terminated by heating at 95°C for 5 min. Coamplification with 18S cDNA was used as the internal standard. The PCR reaction was terminated by Taq DNA polymerase and allowed to proceed for 30 cycles with an annealing temperature at 50°C. TRIGLYCERIDE U PTAKE Cells were plated on 6-well culture plates and allowed to grow to confluence. Culture medium was replaced with MEM containing 20% adult rat serum mixed with [3H]triolein (5 µCi/mL) that was prepared by first drying the Volume 38, 2003 242 [3H]triolein under a stream of nitrogen, resuspending it in 50 µL of ethanol and then adding the MEM plus serum and vortexing the mixture thoroughly. The plates were then incubated at 37°C under control (21% O2 /5% CO2) and experimental (95% O2/5% CO2) conditions for 4 h. At termination, medium was aspirated, the cells were rinsed 3 times with 1 mL of cold PBS. The cells were scraped from the culture plate with a rubber spatula. The cells suspension in distilled water was disrupted by sonication, and a 100-µL aliquot was taken for DNA determination; lipids in the residual sonicate were extracted by the method of Bligh and Dyer. The neutral lipids were then separated by thin layer chromatography (petroleum ether/diethyl ether/acetic acid, 75:24:1, v/v) and identified using pure lipid standard (Sigma, St. Louis, MO). Silica gel bands corresponding to the triglyceride standard were scraped from the thin layer plate into scintillation vials and counted in a liquid scintillation spectrometer. LEPTIN ASSAY Leptin assay was performed by radioimmunoassay (RIA), according to manufacturer’s instructions, using a commercial kit (Rat leptin RIA, Linco Research Inc., St. Charles, MO). M EASUREMENT OF R EACTIVE OXYGEN S PECIES (2′,7′-DICHLOROFLUORESCEIN DIACETATE ASSAY) The intracellular reactive oxygen species (ROS) levels were measured using a fluorescent dye, 2’,7’-dichlorofluorescein diacetate (DCFH-DA), according to the manufacturer’s protocol (Molecular Probes, Inc, Eugene, OR). DCFH-DA is a nonpolar compound that readily diffuses into cells. Within the cell it is hydrolyzed to a polar derivative, DCFH, thereby being trapped within the cell. In the presence of an oxidant, DCFH is converted to the highly fluorescent 2’,7’-dichlorofluorescein. For assays, 5000 cells were plated per well in 96-well microtiter plates, then exposed to experimental conditions. The cells were subse- Cell Biochemistry and Biophysics Rehan and Torday quently loaded with 10-µM DCFH-DA, and incubated in the dark. At specified times, the microtiter plates were analyzed for fluorescence using a fluorescein filter (485 nm excitation/535 nm absorbance). STATISTICAL ANALYSIS Analysis of variance for multiple comparisons was used to analyze the experimental data. A P value less than 0.05 was considered to indicate significant differences in the expression of lipogenic and myogenic markers by e18 and e21, P1 and P5 FRLF, in response to 21% and 95% O2 exposures. RESULTS Because our previous studies have demonstrated that when developing pulmonary lipofibroblasts are cultured in vitro, they spontaneously transdifferentiate to myofibroblasts (8,12,13), the present series of experiments was designed to elucidate whether exposure to hyperoxia augments this transdifferntiation process, and whether this effect is developmentally dependent. We have focused on the effect of hyperoxic exposure on PTHrPR expression and its downstream targets in interstitial fibroblasts because we previously identified PTHrP to be a key molecule that links the paracrine signaling between developing pulmonary fibroblasts and alveolar type II cells (29). Exposure to hyperoxia (95% O2 for 24 h) at passages 1 and 5 caused significant decreases (p < 0.05, 95% vs 21% O2) in PTHrPR mRNA expression by e18 fibroblasts (Fig. 1). This decrease was more pronounced in P5 fibroblasts (p < 0.05, P5 vs P1). In contrast, e21 fibroblasts were more resistant to the effects of hyperoxia than e18 fibroblasts. Because the downstream effect of PTHrPR on lipid metabolism is mediated by ADRP, we tested the effect of hyperoxic exposure on both ADRP mRNA expression and triglyceride uptake. Exposure to hyperoxia decreased ADRP mRNA expression (Fig. 2) and triglyceride Volume 38, 2003 Hyperoxia Augments Pulmonary Lipofibroblasts Fig. 1. Exposure to hyperoxia (95% O2 for 24 h) caused decrease (*=p < .05 vs 21% O2) in PTHrPR mRNA expression in FRLF at both passages 1 and 5; this effect being more pronounced for cells at passage 5 (#=p < .05 vs P1). Further, the decrease in PTHrPR mRNA expression was greater (&=p < .05) for immature (e18) vs relatively mature (d21) FRLF. 243 enchymal-epithelial-mesenchymal paracrine loop between alveolar type II cells and lipofibroblasts for PTHrP to stimulate surfactant synthesis by type II cells, we next examined the effect of hyperoxia on leptin secretion by lipofibroblasts. Exposure to hyperoxia significantly decreased leptin expression by lipofibroblasts (Fig. 5). Here again, the most prominent decrease was observed in e18 P5 fibroblasts. To study the mechanism of hyperoxia-augmented transdifferentiation of pulmonary lipofibroblasts-to-myofibroblasts, we next studied the generation of ROS by the fibroblasts on exposure to hyperoxia. Based on the DCFH assay, we demonstrated a dose-dependent increase in the ROS contents of both e18 and e21 FRLF (60-min exposure) (Fig. 6). Furthermore, although ROS of e18 FRLF under normoxic conditions was higher than that of e21, there were no differences in their response on exposure to increasing concentrations of oxygen. As evidence that enhanced lipogenic status may ameliorate oxygen-augmented transdifferentiation, the effect of treatment with PGJ2, an agent that is known to enhance the lipogenic status of these fibroblasts, was tested; we determined that 24-h treatment with PGJ2 (30 µM) attenuates the spontaneous decrease in lipogenic, and at least, partially blunts hyperoxia-augmented lipofibroblast-to-myofibroblast transdifferentiation (Fig. 7). DISCUSSION uptake (Fig. 3). These effects were also more pronounced in e18 vs e21 fibroblasts and in P5 vs P1 cells. The decreases in the lipogenic markers (PTHrPR and ADRP mRNA expression and triglyceride uptake), on exposure to hyperoxia, were accompanied by a concomitant increase in alpha smooth muscle actin (αSMA) mRNA expression (Fig. 4). This increase was more pronounced in P5 as compared to P1 cells in both e18 and e21 fibroblasts. Based on our recent demonstration that leptin expression by lipofibroblasts completes the mes- Cell Biochemistry and Biophysics Our data provide the first evidence that exposure to hyperoxia augments lipofibroblast-to-myofibroblast transdifferentiation in FRLF. This process is developmentally dependent because it was more pronounced in relatively immature e18 than the more mature e21 fibroblasts. The underlying mechanisms probably involve intricate signaling pathways, which are the focus of our ongoing studies. Treatment with lipogenic agent, PGJ2, at least partially prevented the lipofibroblast-to-myofibroblast transdifferentiation. Given the critical Volume 38, 2003 244 Rehan and Torday Fig. 2. Exposure to hyperoxia (95% O2 for 24 h) caused decrease (*=p < .05 vs 21% O2) in ADRP mRNA expression in FRLF at both passages 1 and 5; this effect being more pronounced for cells at passage 5 (#=p < .05 vs P1). Further, the decrease in ADRP mRNA expression was greater (&=p < .05) for immature (e18) vs relatively mature (e21) FRLF. Fig. 3. Exposure to hyperoxia (95% O2 for 24 h) caused decrease (*=p < .05 vs 21% O2) in triolein uptake by FRLF at both passages 1 and 5; the decrease in triolein uptake was more pronounced for cells at passage 5 (#=p < .05 vs P1) both spontaneously (in 21% O2) and in response to hyperoxia exposure. Further, the decrease in triolein uptake was greater (&=p < .05) for immature (e18) vs relatively mature (e21) FRLF. Cell Biochemistry and Biophysics Volume 38, 2003 Hyperoxia Augments Pulmonary Lipofibroblasts Fig. 4. Exposure to hyperoxia (95% O2 for 24 h) caused increase (*=p < .05 vs 21% O2) in αSMA mRNA expression in FRLF at passage 5 in both e18 and e21 FRLF; this effect was more pronounced in being more pronounced for cells at passage 5 (#=p < .05 vs P1). importance of lipofibroblasts in maintaining pulmonary epithelial integrity (8,18–23), it is likely that the hyperoxia-enhanced transdifferentiation of lipofibroblasts to a myofibroblasts plays a critical and possibly a central role in the pathogenesis of BPD. During lung development, epithelial-mesenchymal communications mediated by various soluble factors, including growth factors and cytokines, play a key role in normal growth and development, and response to lung injury (8,18–23,29). For instance, differentiating epithelial cells produce PTHrP and express the leptin receptor, and their neighboring differentiating fibroblasts produce leptin and express the PTHrP receptor. This cell-spe- Cell Biochemistry and Biophysics 245 Fig. 5. Exposure to hyperoxia (95% O2 for 24 h) caused decrease (*=p < .05 vs 21% O2) in leptin secretion in FRLF at both passages 1 and 5; the decrease in leptin secretion was more pronounced for cells at passage 5 (#=p < .05 vs P1) both spontaneously (in 21% O2) and in response to hyperoxia exposure. Further, the decrease in leptin secretion was greater (&=p < .05) for immature (e18) vs relatively mature (e21) FRLF. cific paracrine loop requires specific intercellular signal transduction pathways that induce the fibroblast and epithelial phenotypes that maintain alveolar homeostasis (29). Specifically, PTHrP induces primordial fibroblasts to become lipofibroblasts, which promote alveolar homeostasis by providing substrates for surfactant phospholipid synthesis; retinoic acid, which maintains epithelial differentiation; and neutral lipids, which act as anti-oxidants to protect the alveolar acinus against oxygen free radicals (17,27,30). When these pulmonary epithelial-mesenchymal communications are disrupted, e.g., downregulation of PTHrP receptor on exposure to hyperoxia, as we observed, it is likely to disrupt the normal growth and development of alveoli, and Volume 38, 2003 246 Rehan and Torday Fig. 7. Treatment with PGJ2 (30 µM) attenuated (bottom panel) the spontaneous decrease (upper panel) in ADRP mRNA expression up to 72 h in culture. Fig. 6. Dose-dependent increase in ROS content occurred in both e18 and e21 FRLF on exposure to increasing concentrations of oxygen (60-min exposure). Although the ROS content under normoxic conditions was greater in e18 FRLF, there were no differences in ROS content between d18 and d21 FRLF on exposure to increasing oxygen concentrations. * = p < .05 vs 21% O2 control; # = p < .05 vs 30% O2; and & = p < .05 vs e21. impair the normal repair mechanisms. Our data clearly show that downregulation of the PTHrP receptor on hyperoxic exposure leads to the loss of the lipid storage and lipid trafficking functions of lipofibroblasts that are so crucial not only for optimal functioning of fibroblasts but also of the neighboring type II cells. On the contrary, it has been shown that factors that promote fibroblast development may augment mesenchymal-epithelial communications, and Cell Biochemistry and Biophysics may have the potential to stabilize the alveoli and prevent lung injury (8,23,31). PTHrP binding to the PTHrP receptor on the surface of mesenchymal fibroblasts triggers both the protein kinase A and protein kinase C pathways, stimulating the lipogenic phenotype, including lipoprotein lipase, fatty acid synthase, ADRP, and leptin (32–34) expressions. Upon exposure to hyperoxia, we found that downregulation of the PTHrP receptor is associated with down regulation of ADRP, which is a recently identified marker for specialized cells containing lipid droplets (35,36). This novel 50-kDa membrane-associated protein is necessary for sorting and exocytosis of lipid droplets. ADRP is expressed in a variety of adipogenic tissues and cultured cell lines, where it is localized on the surface of neutral lipid storage droplets. ADRP mRNA levels are rapidly and maximally induced on triggering adipocyte differentiation. It has recently been shown that ADRP mRNA and protein are stimulated during pulmonary lipofibroblast differentiation and by treatment with PTHrP (36). Therefore, it not surprising that PTHrP receptor downregulation, on exposure to hyperoxia, was accompanied by decreased ADRP mRNA expression. Furthermore, because ADRP plays an important role in the uptake, storage, and trafficking of neutral lipid for surfactant synthesis in the developing lung, its downregula- Volume 38, 2003 Hyperoxia Augments Pulmonary Lipofibroblasts tion on exposure to hyperoxia suggests not only the loss of the lipogenic characteristics of the lipofibroblast, but also impaired function of the adjacent pulmonary type II cell. The possibility exists that exposure of cultured fibroblasts (which, at P1, are comprised almost entirely of lipofibroblasts, based on lipid and vimentin staining) to hyperoxia is associated with adaptation of clones or subpopulation of fibroblasts (~ myofibroblasts) that continue to divide and maintain a selective advantage. However, clastogenesis is more likely to occur following low-level oxidant exposure rather than in cells exposed to 95% O2 (37). The cellular mechanisms by which hyperoxia augments the observed lipofibroblast-tomyofibroblast transdifferentiation remain to be explored and are currently under investigation. It is likely that the generation of ROS, on exposure to hyperoxia, acts as a second messenger to stimulate protein kinase cascades coupled to the expression of key lipogenic markers (38). A relative lack of antioxidant defenses in e18 compared to e21 lung fibroblasts is likely to be the cause of greater ROS under normoxic conditions, observed by us, in these cells, and likely renders them more susceptible to the damaging effects of ROS (27). However, it is likely that ROS generated on exposure to 95% O2 overwhelms the antioxidant defense mechanisms of fibroblasts at both developmental stages studied, and increased predisposition of e18 fibroblasts to transdifferentiation is likely to be due to an unidentified mechanism rather than entirely due to the amount of ROS generated. Our findings confirm and support our recent observations that metabolic enzymes affecting ribonucleic acid synthesis and lipogenesis from glucose by these fibroblasts show maturation-dependent sensitivity to hyperoxia, and may play a key role in the transdifferentiation of lung fibroblasts to myofibroblasts in the pathogenesis of BPD (13). Experimental evidence for the plasticity of the lipofibroblastic and myofibroblastic phenotypes largely comes from studies of the role of stellate cells in liver fibrosis and from the transcriptional control of adipogenesis (39–41). Cell Biochemistry and Biophysics 247 When rat stellate cells are cultured in vitro, they rapidly lose their neutral lipid stores, acquire characteristics of proliferating myofibroblast-like cells (42), and increase secretion of collagen, mainly type I, but also types III and VI (43,44). This transdifferentiation process can be altered by treatment with specific agents such as peroxisome proliferator-activated receptor γ, which inhibits the expression of α-SMA and other myogenic markers (45,46) by transdifferentiating stellate cells in culture. There is evidence to suggest that myofibroblasts are not terminally differentiated (47), and that specific transcriptional agonists can induce their re-differentiation into their parent fibroblast phenotype (45,46). Treatment with PGJ2 can partially prevent the hyperoxia-enhanced transdifferentiation of lipofibroblasts to myofibroblasts, suggesting that treatment with either PGJ2 or similar agents can prevent this process and may retard, inhibit, prevent, or even reverse fibrosis. We have recently shown that lipofibroblast differentiation to myofibroblasts can be rescued by PTHrP early in the course of lipofibroblast-tomyofibroblast conversion (8). However, once these cells lose their ability to express the PTHrPR, they can no longer be rescued by PTHrP. The data presented here, and our previous studies showing metabolic enzymatic changes in response to hyperoxia (13), suggest significant metabolic adaptations in conjunction with the essential molecular alterations in the developing FRLF. The mechanism by which hyperoxia induces transdifferentiation of the lipofibroblastic phenotype to a myofibroblastic phenotype remains unknown. Better understanding of this process will allow design of new preventive strategies that would potentially reduce, prevent, or reverse the fibrotic response during hyperoxia-induced pulmonary injury. REFERENCES 1. Stevenson, D. K., Wright, L. L., Lemons, J. A., et al. (1998) Very low birth weight outcomes of the National Institute of Child Health and Human Development Neonatal Research Network Volume 38, 2003 248 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. January 1993 through December 1994. Am. J. Obstet. Gynecol. 179, 1632–1639. Warner, B. B., Stuart, R. A., Papes, R. A., and Wispe, J. R. (1998) Functional and pathological effects of prolonged hyperoxia in neonatal mice. Am. J. Physiol. 275, L110–L117. Saugstad, O. D. (2001) Chronic lung disease: oxygen dogma revisited. Acta Paediatr. 90,113–115. Fardy, C. H. and Silverman, M. (1995) Antioxidants in neonatal lung disease. Arch. Dis. Child. Fetal. 73, F112–F117. Coalson, J. J., Winter, V., and deLemos, R. A. (1995) Decreased alveolarization in baboon survivors with bronchopulmonary dysplasia. Am. J. Respir. Crit. Care Med. 152, 640–646. Jobe, A. J. (1999) The new BPD: An arrest of lung development. Pediatr. Res. 46, 641–643. Husain, N. A., Siddiqui, N. H., and Stocker, J. R. (1998) Pathology of arrested acinar development in postsurfactant bronchopulmonary dysplasia. Hum. Pathol. 29, 710–717. Torday, J. S., Torres, E., and Rehan, V. K. (2003) The role of fibroblast transdifferentiation in lung epithelial cell proliferation, differentiation and repair. Pediatr. Pathol. Mol. Med., 22, 189–207. Phan, S. H., Zhang, K., Zhang, H. Y., and Gharaee-Kermani, M. (1999) The myofibroblast as an inflammatory cell in pulmonary fibrosis. Curr. Top. Pathol. 93, 173–182. Gauldie, J., Sime, P. J., Xing, Z., Marr, B., and Tremblay, G. M. (1997) Transforming growth factor-beta gene transfer to the lung induces myofibroblast presence and pulmonary fibrosis. Curr. Top. Pathol. 93, 35–45. Toti, P., Buonocore, G., Tanganelli, P., et al. (1997) Bronchopulmonary dysplasia of the premature baby: an immunohistochemical study. Pediatr. Pulmonol. 24, 22–28. Rehan, V. K., Ling, W., Feng, S., Rehan, Y. H., and Torday, J. S. (2001) Hyperoxia augments pulmonary transdifferentiation to myofibroblasts. Baltimore, Academy of Pediatric Societies, A1716. Boros, L. G., Torday, J. S., Lee, W.-N., and Rehan, V. K. (2002) Metabolic characterization of oxygen triggered transdifferentiation in immature rat fetal lung fibroblast. Mol. Genet. Metab. 77, 230–236. Martinet, Y., Menard, O., Vaillant, P., Vignaud, J. M., and Martinet, N. (1996) Cytokines in human lung fibrosis. Arch. Toxicol. Suppl. 18, 127–139. Dooley, S., Delvoux, B., Lahme, B., MangasserStephan, K., and Gressner, A. M. (2000) Cell Biochemistry and Biophysics Rehan and Torday 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. Modulation of transforming growth factor beta response and signaling during transdifferentiation of rat hepatic stellate cells to myofibroblasts. Hepatology 31, 1094–1096. Shimizu, E., Kobayashi, Y., Oki, Y., Kawasaki, T., Yoshimi, T., Nakamura, H. (1999) OPC-13013, a cyclic nucleotide phosphodiesterase type III, inhibitor, inhibits cell proliferation and transdifferentiation of cultured rat hepatic stellate cells. Life Sci. 64, 2081–2088. McGowan, S. E. and Torday, J. S. (1997) The pulmonary lipofibroblast (lipid interstitial cell) and its contributions to alveolar development. Annu. Rev. Physiol. 59, 43–62. Sugahara, K., Mason, R. J., and Shannon, J. M. (1998) Effects of soluble factors and extracellular matrix on DNA synthesis and surfactant gene expression in primary cultures of rat alveolar type II cells. Cell Tissue Res. 291, 295–303. Lebeche, D., Malpel, S., and Cardoso, W. V. (1999) Fibroblast growth factor interactions in the developing lung. Mech. Dev. 86, 125–136. Adamson, I. Y., Young, L., and King, G. M. (1991) Reciprocal epithelial: fibroblast interactions in the control of fetal and adult rat lung cells in culture. Exp. Lung Res. 17, 821–835. Shannon, J. M., Pan, T., Nielsen, L. D., Edeen, K. E., and Mason, R. J. (2001) Lung fibroblasts improve differentiation of rat type II cells in primary culture. Am. J. Respir. Cell Mol. Biol. 24, 235–244. Smith, B. T. and Post, M. (1989) Fibroblast-pneumonocyte factor. Am. J. Physiol. 257, L174–L178. O’Reilly, M. A., Stripp, B. R., and Pryhuber, G. S. (1997) Epithelial-mesenchymal interactions in the alteration of gene expression and morphology following lung injury. Microsc. Res Tech. 38, 473–479. Heath, V. J., Gillespie, D. A., and Crouch, D. H. (2000) Inhibition of the terminal stages of adipocyte differentiation by cMyc. Exp. Cell Res. 254, 91–98. Bruce, M. C., Honaker, C. E., and Cross, R. J. (1999) Lung fibroblasts undergo apoptosis following alveolarization. Am. J. Respir. Cell Mol. Biol. 20, 228–236. Gressner, A. M. (1996) Transdifferentiation of hepatic stellate cells (Ito cells) to myofibroblasts: a key event in hepatic fibrogenesis. Kidney Int. Suppl. 54, S39–S45. Torday, J. S., Torday, D. P., Gutnick, J., and Rehan, V. (2001) Biologic role of fetal lung Volume 38, 2003 Hyperoxia Augments Pulmonary Lipofibroblasts 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. fibroblast triglycerides as antioxidants. Pediatr. Res. 49, 1–7. Chomczynski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal Biochem. 162, 156–159. Torday, J. S. and Rehan, V. K. (2000) Stretchstimulated surfactant phospholipid synthesis is mediated by the coordinated paracrine actions of parathyroid hormone-related protein and leptin. Am. J. Physiol. Lung Cell Mol. Physiol. 283, L130–L135. Torday, J., Hua, J., and Slavin, R. (1995) Metabolism and fate of neutral lipids of fetal lung fibroblast origin. Biochim. Biophys. Acta. 1254, 198–206. Mendelson, C. R. (2000) Endocrinology of the Lung. Humana, Totowa, NJ. Rubin, L. P., Sanchez-Esteban, J., Chinoy, M., Qin, J., and Torday, J. S. Transduction of mechanical signals by parathyroid hormonerelated protein promotes pulmonary alveolar differentiation. J. Appl. Physiol., in press. Rubin, L. P., Kifor, O., Hua, J., Brown, E. M., and Torday, J. S. (1994) Parathyroid hormone (PTH) and PTH-related protein stimulate surfactant phospholipid synthesis in rat fetal lung, apparently by a mesenchymal-epithelial mechanism. Biochim. Biophys. Acta. 1223, 91–100. Rubin, L. P. and Torday, J .S. (2000) Parathyroid hormone-related Protein (PTHrP) biology in fetal lung development, in Endocrinology of the Lung. Humana, Totowa, NJ, pp. 269–297. Londos, C., Brasaemle, D. L., Schultz, C. J., Segrest, J. P., and Kimmel, A. R. (1999) Perilipins, ADRP, and other proteins that associate with intracellular neutral lipid droplets in animal cells. Semin. Cell. Dev. Biol. 10, 51–58. Schultz, C. J., Londos, C., Sun, H., Torres, E., and Torday, J. S. (2002) Role of adipocyte differentiation-related protein in surfactant phospholipid synthesis by type II cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 283, L288–L296. Gille J. J. and Joenje, H. (1992) Cell culture models for oxidative stress: superoxide and hydrogen peroxide versus normobaric oxygen. Mutat. Res. 275, 405–414. Hashimoto, S., Gon, Y., Takeshita, I., Matsumoto, K., Maruoka, S., and Horie, T. Cell Biochemistry and Biophysics 249 39. 40. 41. 42. 43. 44. 45. 46. 47. (2001) Transforming growth factor—β1 induces phenotypic modulation of human lung fibroblasts to myofibroblast through a c-Jun-NH2-terminal kinase-dependent pathway. Am. J. Respir. Crit. Care. 163, 152–157. Gao, J. and Serrero, G. (1999) Adipose differentiation related protein (ADRP) expressed in transfected COS-7 cells selectively stimulates long chain fatty acid uptake. J. Biol. Chem. 274, 16825–16830. Dooley, S., Delvoux, B., Lahme, B., MangasserStephan, K., and Gressner, A. M. (2000) Modulation of transforming growth factor beta response and signaling during transdifferentiation of rat hepatic stellate cells to myofibroblasts. Hepatology 31, 1094–1106. Shimizu, E., Kobayashi, Y., Oki, Y., Kawasaki, T., Yoshimi, T., and Nakamura, H. (1999) OPC13013, a cyclic nucleotide phosphodiesterase type III, inhibitor, inhibits cell proliferation and transdifferentiation of cultured rat hepatic stellate cells. Life Sci. 64, 2081–2088. Potter, J. J., Rennie-Tankersley, L., Anania, F. A., and Mezey, E. (1999) A transient increase in cmycprecedes the transdifferentiation of hepatic stellate cells to myofibroblast-like cells. Liver. 19, 135–144. Weber, K. T. (1997) Fibrosis, a common pathway to organ failure: angiotensin II and tissue repair. Semin. Nephrol. 17, 467–491. Tang, W. W., Van, G. Y., and Qi, M. (1997) Myofibroblast and alpha 1 (III) collagen expression in experimental tubulointerstitial nephritis. Kidney Int. 51, 926–931. Marra, F., Efsen, E., Romanelli, R. G., et al. (2000) Ligands of peroxisome proliferator-activated receptor gamma modulate profibrogenic and proinflammatory actions in hepatic stellate cells. Gastroenterology. 119, 466–478. Galli, A., Crabb, D., Price, D., et al. (2000) Peroxisome proliferator-activated receptor gamma transcriptional regulation is involved in platelet-derived growth factor-induced proliferation of human hepatic stellate cells. Hepatology. 31, 101–108. Heath, V. J., Gillespie, D. A., and Crouch, D. H. (2000) Inhibition of the terminal stages of adipocyte differentiation by cMyc. Exp. Cell. Res. 254,91–98. Volume 38, 2003