Biochemical and Molecular Alterations Associated with Depression Induced in Rats Fahmy Gad Elsaid Biology Department, Faculty of Science, King Khalid University, PO Box 10347, Abha 61321, Saudi Arabia Tel: +966-53-906-036 E-mail: elsaidfg@gmail.com Tel:+2-011-400-200-49 E-mail: fahmygad@mans.edu.eg Zoology Department, Faculty of Science, Mansoura University, Mansoura, Egypt. Khalid M. Alzailaie Biology Department, Faculty of Science, King Khalid University, PO Box 10347, Abha 61321, Saudi Arabia Tel: +966-54-537-4224 E-mail: alzailaie@gmail.com Ali A. Shati Biology Department, Faculty of Science, King Khalid University, PO Box 10347, Abha 61321, Saudi Arabia Tel: +966-55-575-9031 E-mail: shati100@yahoo.com Abstract Forced swimming test (FST) is considered an animal model of depression. Sprague dawely rats were divided into 4 groups (five/group); Control group; Depression group: rats were daily exposed to FST for 10 min for 15 days; Depression& rosemary group: rats were daily exposed to FST for 10 min and orally administered with rosemary extract at 200 mg/kg b. wt. for 15 days; Depression& green coffee group: rats were daily exposed to FST for 10 min and orally administered with green coffee extract at 600 mg/kg for 15 days. There was a decrease in the acetylcholinesterase (AchE) activity in rats exposed to FST. Additionally, there was an imbalance of oxidants/antioxidants level in brain of depressed rats. Molecular study showed the expression of AchE gene was low but the expression of P53, Bcl-2 (B cell lymphoma 2) and interleukins (IL-4& IL-12) genes was high in the brain of depression group. Both aqueous rosemary and green coffee extracts have antidepressant effect delivered not only from their potentiality in preventing the neurodegenerative effect of depression as expressed by the changes in the expression of P53, Bcl-2, IL-4& IL-12 genes and in acetylcholinesterase activity and its gene expression but also they have remarkable antioxidant properties. Keywords: Depression, forced swimming test, antioxidants, gene expression, green coffee, rosemary. 1. Introduction: Depression is a common disorder with high lifetime rates. Forced swimming test (FST) is considered an animal model of depression and it has been used to induce a depressive-like behavior to screen antidepressant effect of drugs and to determine depressive-like behavior in animals after exposure to other stressors (Lucki, 1997; Takeda et al., 2006). FST represents a stressing situation, being capable of inducing a state of lower mood, reflected in the immobility induced in animals. The suggested mechanism by which stress causes its effects is via the hypothalamic–pituitary–adrenal axis and/or via the sympathoadrenomedullary system (Carrasco and Van de Kar, 2003). Some studies have shown that oxidative stress may play an important role in the pathophysiology of neuropsychiatric disorder (Ozcan et al., 2004). In brain, when free radicals are produced in excess or the enzymatic and non-enzymatic antioxidant defense systems are inefficient, some chain reactions causing oxidative damage to lipids, proteins and DNA are activated and neurons are injured or even dead (Niebroj-Dobosz et al., 2004). Depressive status has been associated to oxidative stress in the brain (Hayley et al., 2005; Pedrearez et al., 2011). Experimental induced depression-like behavior in rats is accompanied by brain oxidative stress (Kubera et al., 2011). Hydrogen peroxide (H 2O2) is a major mediator of oxidative stress (Satoh et al., 1996), and amyloid  protein plays a critical role in the development and progression of Alzheimer disease via the generation of reactive oxygen species such as H2O2 (Milton, 2004). H2O2 in turn is involved in the production of highly reactive hydroxyl radicals via Fenton’s reaction, which promotes apoptosis (Vianello et al., 1990).Free radicals can be evaluated indirectly by determination of the activities of some antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidease (GSH-Px) and the levels of the products of lipid peroxidation such as malondialdehyde (MDA) (Kuloglu et al., 2002; Ozcan et al., 2004; Shati et al., 2011). The antioxidant enzymes act as key regulators of intracellular reactive oxygen species may be capable of modulating synaptic plasticity (Watson and Arnold, 2002). SOD is expressed in brain neurons and has been shown to be involved in neurodegeneration (Hayashi et al., 2005). However, antidepressant treatment enhances SOD activity and decreases nitric oxide production in patients with depression (Herken et al., 2007). Another study showed that lowered GSH-Px activity in depression (Maes et al., 2011). De Souza et al., (2006) reported that FST decreases total GSH contents. Also chronic mild stress induced depression in the rodent, lowered concentrations of brain GSH content (Gutteridge and Halliwell, 1994) and lowered brain cortex GSH-Px activity in male Wistar rats (Eren et al., 2007a) are recorded. Beside it is accompanied by increased lipid peroxidation in the cerebellum and the striatum (Lucca et al., 2009a). De Souza et al., (2006) found that restraint and swimming stress increases the levels of thiobarbituric acid reactive substance (TBARS). Moreover, there is evidence that oxidative damage to lipids, including lipid peroxidation, and proteins are important factors in the pathophysiology of neurodegenerative disorders (Greilberger et al., 2008). However, different pathways are involved in neurodegeneration: free radicals and lipid peroxidation products may cause decreased neuronal viability and diminished expression of neurofilaments (Haorah et al., 2008) which are factors causing cell necrosis (Vanlangenakker et al., 2008). It is well known that the cholinergic system is involved in the regulation of several central nerve system functions. The modulation of cholinergic activities is presently the most accepted and recognized therapeutic marker for development of cognitive enhancers (Orhan et al., 2008) and to prevent from some lifestyle disease like stress and depression. Acetylcholinesterase (AchE) is one of the most biological catalysts that play a key role in cholinergic neurotransmission by rapidly hydrolyzing the neurotransmitter Acetylcholine at cholinergic synapses and neuromuscular junctions (Soreq and Seidman, 2001). Also, it was demonstrated to be affected by stressful situations in animal model (Nijholt et al., 2004). However, the biological role of AchE is not limited to cholinergic transmission. It has been implicated in several non-cholinergic actions including cell proliferation, neurite outgrowth (Mazzanti et al., 2009), cell adhesion, hematopoiesis and tumorigenesis (Zhu et al., 2007). Oxidative stress exerts toxic effects on cells and is potent in inducing apoptosis (Andoh et al., 2002).Overproduction of ROS in SOD antisense-transfected cells was reported to increase proapoptotic proteins Bad and Bax and to decrease antiapoptotic proteins Bcl-2 and Bcl-xL by regulating their phosphorylation and ubiquitination (Li et al., 2004). However, Xu et al., (2003) found that the expression of some antioxidant enzymes such as SOD presented a more complex pattern, differed from the expression of Bcl-2. Moreover, in pressure-overloaded mice hearts, Tsukamoto et al., (2006) demonstrated that the levels of proapoptotic proteins (p53 and Bax) increased 2 weeks and further intensified 4 weeks after thoracic aortic constriction despite unchanged levels of mRNA, suggesting that the reduced protein degradation due to the deactivated proteasome contributes to the increased levels of the proapoptotic proteins. On the other hand, antiapoptotic proteins (Bcl-2 and Bcl-XL) decreased 4 weeks after thoracic aortic constriction, which exacerbated the imbalance of apoptosis-regulatory proteins (an elevation of proapoptotic/ antiapoptotic protein ratio). Also Cho et al., (2009) showed that H2O2-induced apoptosis is accompanied by changes in apoptosis-related factors such as the Bcl-2 family of regulatory proteins. The intracellular concentration of the antiapoptotic protein Bcl-2 acts as a molecular indicator that influences whether a cell lives or dies (Cheng et al., 2007). Emotional stressors induce inflammatory reactions with an increased production of pro-inflammatory cytokines (Maes, 1998). Stress and depression are able to alter cytokine expression and action in the brain (Goujon et al., 1995). Cytokines most probably influence energy balance through interactions with appetite-regulating pathways (Wong and Pinkney, 2004). Thus, Yu et al., (2003) found depression to be associated with a polymorphism of the interleukin-1 (IL-1) gene. Bull et al., (2009) found an association between IL-6 polymorphism and reduced risk of depressive symptoms. Most antidepressants also induce adaptive changes in central monoaminergic neurotransmission, which itself might modulate central actions of cytokines (Linthorst and Reul, 1999). 1.1 Natural products Because the mechanism of stress-induced depression is quite complex, many currently available synthetic chemical antidepressants have low rates of response and remission and even severe adverse-effects (Sarko, 2000). Accordingly, it is necessary to search for and develop more effective antidepressants with lower adverse-effect such as natural product extracts. 1.1.1 Rosemary Numerous studies reported that Rosmarinus officinalis L., (family Lomiaceae, Labiatae) has several medicinal use such as anti-inflammatory (Altinier et al., 2007), antinociceptive (Takaki et al., 2008), antiulcerogenic (Dias et al., 2000), hepatoprotective (Amin and Hamza, 2005), diuretic (Haloui et al., 2000), antithrombotic (Yamamoto et al., 2005), neuroprotective and antiaging (Adams et al., 2007), antidiabetic (Bakirel et al., 2008), and antioxidant (Bakirel et al., 2008). In folk medicine, this plant is known for memory improving and treating cognitive decline. It is also used as sedative and relaxant, against headaches, epilepsy, and depression (Heinrich et al., 2006). As well, rosmarinic acid has been demonstrated to have antidepressive effects in the FST in mice (Takeda et al., 2002). More recently, it has been shown that R. officinalis produces a specific antidepressant-like effect in animal experiment (Heinrich et al., 2006; Machado et al., 2009). 1.1.2. Green coffee Coffea arabica L., (family Rubiaceae) has many therapeutic uses and acts as fashion drink in the world wide. Coffee, as a rich source of caffeine, has been reported to have an effect on neurodegenerative disorders such as Parkinson’s disease (Ascherio et al., 2003). Chlorogenic acids (CGA) are phenolic compounds formed by the esterification of cinnamic acids, such as caffeic, ferulic, and p-coumaric acids, with (-)-quinic acid. A series of health benefits have been associated with the consumption of CGA in the last few years, such as reduction of the relative risk of cardiovascular disease, diabetes type II, and Alzheimer disease (Salazar-Martinez et al., 2004; Ranheim and Halvorsen, 2005). Green (or raw) coffee is a major source of CGA in nature (5–12g/100g (Farah and Donangelo, 2006). Many studies demonstrated that the consumption of green coffee extracts produced antihypertensive effect in rats and humans (Kozuma et al., 2005), improvement in human vasoreactivity (Ochiai et al., 2004), inhibitory effect on fat accumulation and body weight in mice and humans (Shimoda et al., 2006; Dellalibera et al., 2006) and modulation of glucose metabolism in humans (Blum et al., 2007). Also aqueous green coffee extract ameliorates the disturbances in the most antioxidant enzymes such as SOD, CAT and GSH-Px also it has antitumor effect (Shati et al., 2011). Because the mechanism of depression is quite complex, many currently available synthetic chemical antidepressants have low rates of response and diminution and even severe adverse-effects (Sarko, 2000). Accordingly, it is necessary to search for more effective antidepressants with lower adverse-effect such as natural product extracts (rosemary and green coffee extracts) especially on the biochemical and molecular changes associated with the depression in rats’ brain induced by FST. 2. Material and methods 2.1. Animal grouping In the experiment, we used adult albino Sprague Dawely male rats (200-250g). Animals were obtained from animal house at Faculty of Science, King Khalid University, Abha, Saudi Arabia. The local committee approved the design of the experiments and the protocol conforms to the guidelines of the National Institutes of Health (NIH). All measures were taken to minimize the number of rats used and their suffering. Animals were kept in vivarium, housed in polycarbonate cages, five rats per cage, at a constant room temperature of 23±1°C with a 12-h light/ dark cycle (light on from 7:00AM till 7:00PM). Standard rat chow diet and water were available ad libitum. Animals were divided into four groups (five/group); Control group: rats were daily received only normal saline solution orally administered by gavage tube; Depression group: rats were daily exposed to FST for 10 min for 15 days; Depression& rosemary group: rats were daily exposed to FST for 10 min and orally administered with rosemary extract at 200 mg/kg b. wt. for 15 days; Depression& green coffee group: rats were daily exposed to FST for 10 min and orally administered with green coffee extract at 600 mg/kg b. wt for 15 days. At the end of the experimental period rats were sacrificed by decapitation then sera and brain tissues were collected from each group. The brain tissues that used in biochemical analysis were immediately homogenized in a phosphate buffer solution pH 7.4 and centrifuged at 4°C. The supernatant and brain tissues that used in the molecular study were stored at -80°C until used. 2.2. Animal models for stress-induced depression induced by FST: In these experiments, the FST was done by immersing rats individually in a 60×50×40 cm (L×W×H) filled with water (23–25 °C) from which it could not escape out for 10 min for 15 days and this could represent a serious injury that could cause behavioral depression. The rats initially swam energetically but gradually became immobile; floating in the water with minimum movements of paws and legs to keep their head above the water level, the method with little modifications according to (Lucki, 1997). Considering that rats in deeper water exhibit more swimming so antidepressants are magnified when rats are tested in deeper water (Detke and Lucki, 1996), so we selected the depth of 40 cm. The water deep was enough that rats were unable to touch the bottom of the aquarium. 2.3. Natural Products Extraction: Commercial rosemary and green coffee were obtained from a local supermarket in Abha, KSA. The fresh and dried plant materials of rosemary and fresh powder of green coffee seeds were immersed individually in distilled water (250 mg/ml) for 24 hours, filtered and freshly prepared every three days and stored at -20°C until used. The extract of each were freshly prepared every three days and orally administered at 200 and 600 mg/kg b. wt. once a day for rosemary and green coffee respectively. 2.4. Enzymatic assay: 2.4.1.Total antioxidant capacity: Determination of the antioxidant capacity was performed by the reaction of antioxidants in the sample with a defined amount of exogenously provide hydrogen peroxide (H2O2).The antioxidants in the sample will eliminate a certain amount of the provided hydrogen peroxide. The residual H 2O2 is determined colorimetrically by an enzymatic reaction which involves the conversion of 3, 5, dichloro–2–hydroxyl benzensulphonate to a colored product (Koracevic et al., 2001 ). 2.4.2. Superoxide dismutase activity: This assay relied on the ability of the enzyme to inhibit the phenazine methosulphate-mediated reduction of nitroblue tetrazolium dye (Nishikimi et al., 1972). 2.4.3. Catalase activity: It reacted with a known quantity of H2O2. The reaction was stopped after exactly one minute with CAT inhibitor. In the presence of peroxidase, the remaining H2O2 reacted with 3,5-Dichloro-2-hydroxybenzene sulfonic acid and 4-aminophenazone to form a chromophore with a color intensity inversely proportional to the amount of CAT in the original sample, each 1unit =1μmol of H 2O2 degraded for a minute, using a molar extinction coefficient of 43.6M −1 cm−1 (Aebi, 1984). 2.4.4. GSH-Px activity: The activity was measured by the method described by (Ellman, 1959). Briefly, the reaction mixture contained 0.2ml of 0.4M phosphate buffer (pH 7.0), 0.1ml of 10mM sodium azide, 0.2ml of brain homogenate (homogenate on 0.4M phosphate buffer, pH 7.0), and 0.2ml glutathione, 0.1 of 0.2mM H 2O2. The reaction content was incubated at 37°C for 10min. The reaction was arrested by adding 0.4ml of 10% TCA and then centrifuged. Supernatant was assayed for glutathione content by using Ellman’s reagent. The molar extinction coefficient for NADPH is 6220mM -1 cm-1 at 340nm. 2.4.5. GSH-Red activity: GSH-Red catalyzed the reduction of oxidized glutathione (GSSG) to reduced glutathione (GSH). GSH-Red is essential for the glutathione redox cycle that maintains adequate levels of reduced cellular GSH. According to the method of Goldberg and Spooner (1983), GSH-Red catalyzed the reduction of the oxidized glutathione (GSSG) in the presence of NADPH that oxidized into NADPH+. The decrease in absorbance was measured at 340nm. 2.4.6. GSH content: GSH served as an antioxidant, reacting with free radicals and organic peroxides, in amino acid transport, and as a substrate for the GSH-Px and glutathione-S-transferase in the detoxification of organic peroxide and metabolism of xenobiotics, respectively. A tissue was homogenized in 10 ml cold buffer (50mM potassium phosphate, pH 7.5, 1mM EDTA) per gram tissue. Centrifuge at 100,000 x g for 15min at 4°C was performed. The supernatant was transferred into a new sterile tube for assay and the rest of the samples stored at - 80°C for further work. The method based on the reduction of 5,5` dithiobis (2-nitrobenzoic acid) (DTNB) with GSH to produce a yellow compound. The reduced chromogen directly proportional to GSH concentration and its absorbance can be measured at 405nm (Beutler et al., 1963). 2.4.7. Lipid peroxidation level: The thiobarbituric acid reactive substances (TBARS) as malon-dialdehyde were estimated by the method of Ohkawa et al., (1979). Briefly, to 0.2ml of brain homogenate, 0.2ml of 40% sodium dodecyle sulphate, 1.5ml of 20% acetic acid (prepared in 0.27M of HCl) and 1.5ml of 0.5% thiobarbituric acid were mixed together. The mixture was heated for 60min at 95°C in a water bath to give a pink color. The mixture was then centrifuged at 3500 rpm for 10min. Finally absorbance of the supernatant layer was read spectrophoto-metrically at 532nm, the molar extinction coefficient factor equal 1.56 x105 M-1cm-1. 2.4.8. Hydrogen peroxide level: Its concentration was measured according to the method of Aebi (1984). The principle of this method based on that, in the presence of peroxidase, H2O2 reacts with 3,5-dichloro-2-hydroxy benzene sulfonic acid (DHBS) and 4-aminophenazone (AAP) to form a chromophore. The absorbance was read spectrophoto-metrically at 510nm. 2.4.9. Total protein content: In the presence of an alkaline cupric sulfate, the protein produced a violet color, the intensity of which is proportional to their concentration (Gornal et al., 1949). The absorbance was read at 550nm. 2.4.10. Acetylcholinesterase activity (AchE): This assay depended on the ability of the enzyme to produce a thiocholine and form a complex with dithio-bis-nitrobenzoate (Weber, 1966). The mean absorbance change was determined per 30 sec at 405 nm. 2.5. Statistical analysis of biochemical data: The biochemical data recorded were expressed as mean±SD and statistical and correlation analyses were undertaken using the One-way ANOVA followed by a post-hoc LSD (Least Significant Difference) test. A P value < 0.05 was statistically significant. A Statistical analysis was performed with the Statistical Package for the Social Sciences for Windows (SPSS, version 10.0, Chicago, IL, USA). 2.6. Extraction of total RNA from brain tissue homogenates: Total RNA was isolated from brain homogenates using RNeasy Mini Kit according to manufacturer's instructions (QIAGEN, Germany). About 100 µl of each homogenate was subjected to RNA extraction and the resultant RNA was dissolved in DEPC-treated water, quantified spectrophotometrically and analyzed on 1.2% agarose gel. RNAs inhibitors were added to the samples during the RNA extraction process. 2.7. Real time PCR and gene expression: 2.7.1. For DNA neurotransmitter gene (AchE): The extracted RNA from different groups was subjected to examine the expression level of AchE gene using specific primer in the presence of glyceraldehyde-3-phosphate dehydrogenase as a housekeeping gene. The Real time reaction consists of 12.5μl of 2X Quantitech SYBR® Green RT Mix (Fermentaz, USA), 2μl of the extracted RNA (50ng/μl), 1μl of 25pM/μl forward (F) primer, 1μl of 25pM/μl reverse (R) primer (Table 1), 9.5μl of RNAase free water for a total of 25μl. Samples were spun before loading in the rotor’s wells. The real time PCR program was performed as follows: initial denaturation at 95°C for 10 min.; 40 cycles of 95°C for 15 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec. Data acquisition performed during the extension step. This reaction was performed using Rotor-Gene 6000 system (QIAGEN, USA). 2.7.2 For DNA proapoptic and antiapoptic genes (P53 and Bcl2): The extracted RNA was subjected to Real Time PCR reaction to examine the expression p53 and Bcl2 genes in depression, depression& rosemary and depression& green coffee using specific primers in the presence of glyceraldehyde-3-phosphate dehydrogenase (GPDH) as a housekeeping gene. The Real time reaction consists of 12.5μl of 2X Quantitech SYBR® Green RT Mix (Fermentaz, USA), 2μl of the extracted RNA (50ng/μl), 1μl of 25pM/μl forward (F) primer, 1μl of 25pM/μl reverse (R) primer (Table 1), 9.5μl of RNAase free water for a total of 25μl. Samples were spun before loading in the rotor’s wells. The real time PCR program was performed as follows: initial denaturation at 95 °C for 10 min.; 40 cycles of 64°C for 15 sec for P53, annealing at 63°C for 30 sec for Bcl2 and extension at 72°C for 30 sec. Data acquisition performed during the extension step. This reaction was performed using Rotor-Gene 6000 system (QIAGEN, USA). 2.7.3 For cytokine genes (interleukins (IL)-4& 12): Real Time PCR was performed using specific primers for two of cytokines genes, IL-4 and IL-12. The reaction was performed on the total RNA extracted from the brain of all experimental groups. The PCR reaction constituents and conditions were similar to the above genes except that the annealing temperature was 60°C for IL-4 gene and 65°C for IL-12 gene. 2.8. Molecular data analysis: Real-time PCR data of all samples were analyzed with appropriate bioinformatics and statistical program for the estimation of the relative expression of genes using real-time PCR and the result normalized to its housekeeping gene (reference gene). The Comparative quantitation of data was statistically evaluated, interpreted and analyzed using Rotor-Gene-6000 version 1.7. Table (1): Primers nucleotides sequence used in this study: 3. Results Table (2): Brain antioxidants and oxidative stress in different groups of rats: The depressed group in table (2), showed very high significant decrease (P<0.001) in the brain antioxidant enzymes activities when compared with control group. Also the decrease (P<0.001) in total antioxidant capacity and GSH content was registered in depressed group. The oxidative stress was estimated as increment in TBARS and H 2O2 in the depressed group. The aqueous extracts of rosemary and green coffee ameliorate the antioxidants status as they increase the antioxidant enzymes and also decrease the TBARS and H2O2 in the depression& rosemary and depression& green coffee groups when compared with depressed group. Table (3): Acetylcholinesterase activity in different groups of rats: As in table (3), there was a significant decrease (P<0.001) in the activity of the acetylcholinesterase in sera and brain tissues of the depressed group when compared with the control ones. Both depressed& rosemary and depressed& green coffee groups have the ability to ameliorate the decrease of AchE activity when compared with the depressed group Fig (1): The ratio of target genes expression in brain of different groups of rats The real time PCR results (fig.1) showed that the expression of AchE gene was decreased in brain of depressed group when compared with the control one. But the expression of the AchE gene was increased in depressed& rosemary and depressed& green coffee treated groups when compared with the depressed group. Moreover the expression of P53, Bcl2 and IL 4& 12 genes was increased in brain of depressed group when compared with the control one. Also the extracts of rosemary and green coffee ameliorate the increase of these genes in depressed& rosemary and depressed& green coffee treated groups when compared with the depressed group. 4. Discussion The forced swimming test is the most common animal model of depression used for investigating the antidepressant effect of drugs and other natural products. The animal experiments show that physical and psychological stress-induced depression are accompanied by lowered antioxidant levels and increased oxidative stress as a result of damage to fatty acids and proteins (Cho et al., 2009; Kubera et al., 2011). The brain is especially susceptible to such damage due to the large amount of lipids that compose its architecture.Lipid peroxidation targets the polyunsaturated fatty acids in the brain, thus, decreasing the membrane integrity. The decrease in membrane stability is especially important because the membrane contains receptor proteins and ion channel entities. Along with its own deleterious effects, lipid peroxidation is also responsible for the inhibition of lipid repair enzymes such as lysophosphatidylcholine acyltransferase and fatty acyl CoA synthase (Schaller and Graf, 2004). Since neurons in the brain are strongly depend on aerobic respiration (consumes approximately 20% of the available oxygen), these neurons become much more vulnerable to oxidative stress. Oxidative stress has been related with depressive status (Maes, 2008).It was reviewed that depression is associated with neurodegeneration and a reduced neurogenesis in the brain (Koo and Duman, 2008; Maes et al., 2009). The brain also contains high levels of lipids while possessing low amounts of antioxidants, thus further increasing its susceptibility to damage as the result of ROS and oxidative stress (Saeed et al., 2007). Along with their role in effecting the transcription of various proteins, ROS generated by reperfusion can itself cause direct cellular stress. So, the increase in TBARS and H 2O2 levels in the brain as in table (1) may be inducing the neurodegeneration of the brain (Lucca et al., 2009a) after exposing to depression induced by FST. This may be due to some chain reactions causing oxidative damage to lipids, proteins and DNA are activated and neuron are injured or even dead (Niebroj-Dobosz et al., 2004). Moreover, H2O2 is converted to the hydroxyl radical and lipid peroxide are produced can have extensive implications in neurons and neuronal signaling. The increase in the oxidative stress was accompanied by the decrease in the antioxidants enzymes such as CAT, SOD, GSH-Px, GSH-Red and GST activity (Kuloglu et al., 2002) and in the contents of brain GSH in depression group. On the other word the total antioxidant capacity was decreased by depression. Moreover some studies have shown that oxidative stress may play an important role in the pathophysiology of neuropsychiatric disorders (Kuloglu et al., 2002; Ozcan et al., 2004). Overt neuron injury or death especially in hippocampus has been hypothesized to play a role in depression (Lee et al., 2002; Hayley et al., 2005). On the other hand the antioxidant properties of green coffee and rosemary play a vital role in restoring the balance of the antioxidants/oxidative stress induced by the FST in the brain of rats. As mentioned previously that phenolic compounds that are present in the green coffee such as chlorogenic acid play a role in restoring the memory and may prevent Alzheimer disease (Ranheim and Halvorsen, 2005). Also the rosamrinic acid in rosemary extract plays a role antidepressive agent in FST (Takeda et al., 2002) that leads to imbalance between antioxidants and oxidative stress in rats’ brain. It could be due to their antioxidant properties of both green coffee and rosemary extracts as shown in table (1) as restoring the balance between the brain antioxidants and the oxidative stress status. Stress during different ages has implications for the extent of depression and psychotic disorders in stressful events lead to the release of glucocorticoids and corticotropic-releasing hormones from neurons which in turn leads to the regression of synapses (Bennet, 2008) as result of increment of oxidants as in table (2) and this may be explain the decrease in the activity of AchE in both serum and brain tissue simultaneously with the lowering in expression of brain AchE gene in depression group (table 3). Also, it was verified to be affected by stressful situations in animal study (Nijholt et al., 2004). Depression induced the loss of synapses primarily in the hippocampus and changes in depressive behavior (Hajszan et al., 2008). The management of the acetylcholine esterase both in sera and brain tissues of depression rats after administration of green coffee and rosemary extracts proves that they have a role in neurotransmission so they may be good antideperssive agents. Apoptosis is a programmed cell death where the cell expends energy towards its own end. It is controlled by a complex interconnection of proteins such as P53 and is often triggered by oxidative stress and the release of cytochrome c from the mitochondria (Cho et al., 2009). The increased level of ROS is involved in generating the signal that causes change the permeability of the mitochondrial membrane, and, thus, the release of cytochrome c into the cytosol. Once this occurs, the initiation of the cascade of caspases occurs (Matson, 2000). Activation of caspases will eventually lead to the death of the cell and other surrounding cells. H2O2-induced apoptosis is accompanied by changes in apoptosis-related factors such as the Bcl-2 family of regulatory proteins (Cho et al., 2009). However, ROS such as H2O2 act not only as cellular messengers capable of causing oxidative damage to macromolecules, but also as signaling molecules that activate protein kinase cascades (Petersen et al., 2007). So, high expression of P53 and Bcl2 genes may be to the deficit of P53and Bcl2 proteins, which have antiappoptic action, in the brain cells due to their oxidation by the increase of the free radicals level. So the high expression of these genes may be to provide the cells with these proteins to countenance the neurodegenration induced by oxidative stress in the depression rats. It was found that splenocytes and thymocytes undergo apoptosis with aging in rats and the apoptosis was associated with enhanced expression of P53, Bax, and caspase-3 (Kapasi and Singhal, 1999). Moreover, it was also demonstrated that there are differential expressions of Bcl-2 family proteins and caspase family proteins during aging in rat brain (Shimohama et al., 2001). Given the fact that the most prominent mood stabilizers, lithium and valproate upregulate anti-apoptotic proteins like Bcl-2 (Chen et al., 1999) and suppress proapoptotic proteins, P53 and Bax (Chen and Chuang, 1999). The aquatic extracts of green coffee and rosemary may protect against depression through preventing of apoptosis or depression-induced molecular changes in the brain. The antioxidant properties of green coffee and rosemary may explain this progression. The exposure to chronic mild stress in mice produces cognitive impairment accompanied by increased proinflammatory cytokines and enhanced cell damage (Li et al., 2008). Stress and depression are capable to alter cytokine expression and action in the brain (Goujon et al., 1995). Most antidepressants also encourage adaptive changes in central monoaminergic neurotrans-mission, which itself might amend immune reactivity (Deleplanque and Neveu, 1995) and central actions of cytokines (Linthorst and Reul, 1999). Stress-induced depressive-like behavior is associated with increase in interleukin 1-β (IL-1β), tumor necrosis factor-α (TNF-α), IL-6, nuclear factor κB, cyclooxygenase-2, expression of Toll-like receptors and lipid peroxidation in animals (Kubera et al., 2011). Proinflammatory cytokines such as IL-1, IL-6 and TNF-α above being responsible for the local inflammatory response also coordinate the physiological and behavioral components of the systemic acute phase response to infection (Liaudet et al., 2002). Interestingly, some parts of sickness behavior resemble the symptoms of major depressive disorder and increased circulating levels of cytokines have indeed been found in several studies on depression (Raison et al., 2006). Our data suggest an association between depression and cytokines as shown in fig (1) by inducing the expression of IL-4 and -12 genes. The inflamm-atory response, as the increase of IL4 and 12 genes expression, results in decreased blood brain barrier function (Liaudet et al., 2002), increased cerebral edema, and cell death (Lakhan et al., 2004).The anti-inflammatory action of green coffee and rosemary may be interpreted due to their ability to change the expression of the IL4 and 12 genes in depression rats administered by their extracts as in fig (1). 4. Conclusion Forced swimming test may be use as an experimental model for depression. The induced depression causes imbalance in the oxidants and antioxidant system in the brain of rats. Moreover, the changes in the brain neuronal signaling of depressed rats as reflected by the changes in the activity of acetylcholine esterase and their expression of AchE gene. Apoptosis and neurodegenerative of brain is associated with depression, this is investigated by the changes in the gene expression of P53, and Bcl-2 genes. Also depression is associated with inflammation as discussed by the increase of expression of IL4 & 12 genes. The administration of aqueous extract of green coffee and rosemary showed high ameliorative action in managing the biochemical and molecular changes accompanied by depression. As they have anti-apoptic, anti-inflammatory and antioxidant action it may be recommended as antidepressant agents. References Adams M, Gmunder F, Hamburger M. (2007). Plants traditionally used in age related brain disorders –a survey of ethnobotanical literature. Journal of Ethnopharmacology 113: 363–381. Aebi, H. (1974). Catalase. In. Bergmeyer, H.U. (Ed.), Methods of Enzymatic Analysis. Academic Press, New York, pp. 673-677. Altinier G, Sosa S, Aquino RP, Mencherini T, Loggia RD, Tubaro A. (2007). Characterization of topical antiinflammatory compounds in Rosmarinus officinalis L. J. Agric. Food Chem. 55:1718–1723. Amin A, Hamza AA. (2005). Hepatoprotectiveeffectsof Hibiscus, Rosmarinus and Salvia on azathioprine-inducedtoxicityinrats. Life Sci. 77:266–278. Andoh T, Chock PB, Chiueh CC. (2002).The roles of thioredoxin in protection against oxidative stress-induced apoptosis in SH-SY5Y cells, J. Biol. Chem. 277: 9655–9660. Ascherio A, Chen H, Schwarzschild MA, Zhang SM, Colditz GA, Speizer FE. (2003). Caffeine, postmenopausal estrogen, and risk of Parkinson’s disease. Neurol. 60:790–795. Bakirel T, Bakirel U, Keles OU, Ülgen SG, Yardibi H. (2008). In vivo assessment of antidiabetic and antioxidant activities of rosemary (Rosmarinus officinalis) in alloxan-diabetic rabbits. J. Ethnopharmacol.116: 64–73. Bennet AMR. (2008). Stress and anxiety in schizophrenia and depression: glucocorticoids, corticotropin-releasing hormone and synapse regression. Aust. NZJ Psychiatry, 42,12: 995-1002. Bradford MM. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein– dye binding. Anal. Biochem. 72:248–254. Bull SJ, Huezo-Diaz P, Binder EB, Cubells JF, Ranjith G, Maddock C, et al. (2009). Functional polymorphisms in the interleukin-6 and serotonin transporter genes, and depression and fatigue induced by interferon-alpha and ribavirin treatment. Mol. Psychiatry.14: 1095–1104. Carrasco GA, VandeKar LD. (2003).Neuroendocrine pharmacology of stress. Eur. J. Pharmacol. 463:235–272. Chen F, Madsen TM, Wegener G, Nyengaard JR. (2009). Repeated electroconvulsive seizures increase the total number of synapses in adult male rat hippocampus. Eur Neuropsychopharmacol. 19,5: 329–338. Chen RW, Chuang DM. (1999). Long term lithium treatment suppresses p53 and Bax expression but increases Bcl-2 expression: a prominent role in neuroprotection against excitotoxicity. J. Biol. Chem. 274: 6039–6042. Chen SJ, Kao CL, Chang YL, Yen CJ, Shui JW, Chien CS, et al. (2007). Antidepressant administration modulates neural stem cell survival and serotoninergic differentiation through bcl-2. Curr. Neurovasc. Res. 4, 1:19–29. Cheng XR, Zhang L, Hu JJ, Sun L, Du GH. (2007). Neuroprotective effects of tetramethyl-pyrazine on hydrogen peroxide-induced apoptosis in pc12 cells. Cell. Biol. Int. 31: 438–443. Cho D-H, Tomohiro Nakamura T, Fang J, Cieplak P, Godzik A, Gu Z, Lipton SA. (2009). S-Nitrosylation of Drp1 Mediates β-Amyloid-Related Mitochondrial Fission and Neuronal Injury. Science 324 (5923): 102-105 . de Souza FG, Rodrigues MD, Tufik S, Nobrega JN, D'Almeida V. (2006). Acute stressor-selective effects on homocysteine metabolism and oxidative stress parameters in female rats. Pharmacol. Biochem. Behav. 85, 2:400–407. Deleplanque B, Neveu PJ. (1995). Immunological effects of neuropsychiatric substances. In M. Guenounou (Ed.), Forum on Immunomodulators (pp. 287–302). Paris: John Libbey Eurotext. Detke MJ, Lucki I. (1996). Detection of serotonergic and noradrenergic antidepressants in the rat forced swimming test: the effects of water depth. Behav. Brain Res. 73:43–46. Dias PC, Foglio MA, Possenti A, DeCarvalho JE (2000). Antiulcerogenicactivity of crude hydroalcoholic extracts of Rosmarinus officinalis L. J. Ethnopharmacol. 69: 57–62. Ellman GL. (1959). Tissue sulfhydryl groups. Archives of biochemistry and biophysics. 82,1: 70-77. Eren I, Naziroglu M, Demirdas A. (2007). Protective effects of lamotrigine, aripiprazole and escitalopram on depression-induced oxidative stress in rat brain. Neurochem. Res. 32, 1188–1195. Farah A, Donangelo CM. (2006). Phenolic compounds in coffee. Brazilian J. Plant Physiol. 18, 23–36. Goldberg DM, Spooner RJ. (1983). In Methods of Enzymatic Analysis ( Bergmeyen, H.V. Ed. ) 3rd ed. Vol. 3, pp 258-265, Verlog Chemie, Deerfield beach, FI . Beutler E, Duron O, Kelly BM. (1963). Improved method for the determination of blood glutathione. J. Lab. Clin. Med. 61:882–888, Gornal AC, Bardawill CJ, David MM. (1949). J. Biol. Chem. 177: 751. Goujon E, Parnet P, Laye S, Combe C, Kelley KW, Dantzer R.(1995). Stress Down regulates Lipopolysaccharide-Induced Expression of Proinflammatory Cytokines in the Spleen, Pituitary, and Brain of Mice. Brain Behavior Immunity. 9, 4: 292-303. Goujon E, Parnet P, Laye S, Combe C, Kelley KW, Dantzer R. (1995). Stress Down regulates Lipopolysaccharide-Induced Expression of Proinflammatory Cytokines in the Spleen, Pituitary, and Brain of Mice. Brain, Behavior, and Immunity, 9, 4:292-303. Greilberger J, Koidl C, Greilberger M, Lamprecht M, Schroecksnadel K, Leblhuber F, et al. (2008). Malondialdehyde, carbonyl proteins and albumin-disulphide as useful oxidative markers in mild cognitive impairment and Alzheimer's disease. Free Radic. Res. 42,7: 633–638. Gutteridge JMC, Halliwell B. (1994). Antioxidants in Nutrition, Health and Disease. Oxford: Oxford University Press. Takeda H, Tsuji M, Yamada T, Masuya J, Matsushita K, Tahara M, Iimori M, Matsumiya T. (2006). Caffeic acid attenuates the decrease in cortical BDNF mRNA expression induced by exposure to forced swimming stress in mice. Eur. J. Pharmacol. 534: 115–121. Hajszan T, MacLusky NJ, Leranth C (2008). Role of androgens and the androgen receptor in remodeling of spine synapses in limbic brain areas. Horm. Behav. 53:638–646. Haloui M, Louedec L, Michel JB, Lyoussi B (2000). Experimentaldiureticeffectsof Rosmarinus officinalis and Centaurium erythraea. J. Ethnopharmacol. 71: 465–472. Haorah J, Ramirez SH, Floreani N, Gorantla S, Morsey B, Persidsky Y. (2008). Mechanism of alcohol-induced oxidative stress and neuronal injury. Free Radic. Biol. Med. 45, 11: 1542–1550. Hayashi M, Araki S, Kohyama J, Shioda K, Fukatsu R.(2005). Oxidative nucleotide damage and superoxide dismutase expression in the brains of xeroderma pigmentosum group A and Cockayne syndrome. Brain Dev. 27, 1:34–38. Hayley S, Poulter MO, Merali Z, Anisman H. (2005). The pathogenesis of clinical depression: stressor- and cytokine-induced alterations of neuroplasticity. Neurosci. 135:659–678. Heinrich M, Kufer J, Leonti M, Pardo-de-Santayana M. (2006). Ethnobotany and ethnopharma-cology-interdisciplinary-links with the historical sciences. J. Ethnopharmacol. 107: 157–160. Herken H, Gurel A, Selek S, Armutcu F, Ozen ME, Bulut M, Kap O, Yumru M, Savas HA, Akyol O. (2007). Adenosine deaminase, nitric oxide, superoxide dismutase, and xanthine oxidase in patients with major depression: impact of antidepressant treatment. Arch. Med. Res. 38: 247–252. Kapasi AA, Singhal PC. (1999).Aging splenocyte and thymocyte apoptosis is associated with enhanced expression of p53, bax, and caspase-3. Mol. Cell Biol. Res. Commun. 1: 78–81. khawa H, Ohishi N, Yagi K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 95: 351–358. Koo JW, Duman RS. (2008). IL-1beta is an essential mediator of the antineurogenic and anhedonic effects of stress. Proc Natl Acad Sci USA.105:751–756. Koracevic D, Koracevic G. et al. (2001). Method for the measurement of antioxidant activity in human fluids. J. clinic. Pathol. 54, 5: 356. Kozuma K, Tsuchiya S, Kohori J, Hase T, Tokimitsu I. (2005). Antihypertensive Effect of Green Coffee Bean Extract on Mildly Hypertensive Subjects. Hypertension Res. 28: 711–718. Kubera M, Obuchowicz E, Goehler L, Brzeszcz J, Maes M (2011). In Animal Models, Psychosocial Stress-Induced (Neuro) Inflammation, Apoptosis and Reduced Neurogenesis Are Associated to the Onset of Depression. Prog. Neuropsychopharmacol .Biol. sychiatry. 35, 3:744-759. Kuloglu M, Atmaca M, Tezcan E, Gecici O, Tunckol H, Ustundag B. (2002). Antioxidant enzyme activities and malondialdehyde levels in patients with obsessive–compulsive disorder. Neuropsychobiol. 46: 27–32. Lee KW, Lee HJ, Kang KS, Lee C Y. (2002). Preventive effects of vitamin C on carcinogenesis. Lancet, 359,9301: 172. Lee MD, Kennett GA, Dourish CT, Clifton PG. (2002). 5-HT1B receptors modulate components of satiety in the rat: behavioural and pharmacological analyses of the selective serotonin1B agonist CP- 94,253. Psychopharmacol. 164: 49– 60. Li D, Ueta E, Kimura T, Yamamoto T, Osaki T. (2004). Reactive oxygen species (ROS) control the expression of Bcl-2 family proteins by regulating their phosphorylation and ubiquitination, Cancer Sci. 95: 644–650. Liaudet L, Murthy KG, Mabley J, Pacher P, Soriano F, Salzman A, Szabo C. (2002). Comparison of Inflammation, Organ Damage, and Oxidant Stress Induced by Salmonella enterica Serovar Muenchen Flagellin and Serovar Enteritidis Lipopolysaccharide. Infec.Immunity. 70,1: 192–198. Linthorst ACE, Reul JMHM. (1999). Inflammation and brain function under basal conditions and during long-term elevation of brain corticotropin- releasing hormone levels. Adv. Exp. Med. Biol., 461: 129–152. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. (1951). Protein measurement with folin phenol reagent. J. Biol. Chem. 193:265–275. Lucca G, Comim C M, Valvassori S S, Reus G Z, Vuolo F, Petronilho F, Dal-Pizzol F, Gavioli E C, Quevedo J. (2009a). Effects of Chronic Mild Stress on the Oxidative Parameters in the Rat Brain. Neurochem. Int. 54, 5-6:358-362. Lucki I. (1997). The forced swimming test as a model for core and component behavioral effects of antidepressant drugs. Behav. Pharmacol. 8: 523–532. Ozcan ME, Gulec M, Ozerol E, Polat R, Akyol O. (2004). Antioxidant enzyme activities and oxidative stress in affective disorders. Int. Clin. Psychopharmacol. 19:89–95. Machado DG, Bettio LEB, Cunha MP, Capra JC, Dalmarco JB, Pizzolatti MG, Rodrigues ALS. (2009). Antidepressant-like effect of the extract of Rosmarinus officinalis in mice: involvement of the monoaminergic system. Progress Neuro. Psychopharmacol. Bio. Psychiatry. 33: 642–650. Maes M, Mihaylova I, Kubera M, Uytterhoeven M, Vrydags N, Bosmans E. (2011). Lower whole blood glutathione peroxidase (GPX) activity in depression, but not in myalgic encephalomyelitis / chronic fatigue syndrome: another pathway that may be associated with coronary artery disease and neuroprogression in depression. Neuro Endocrinol Lett.32,2:133-140. Maes M, Yirmyia R, Noraberg J, Brene S, Hibbeln J, et al. (2009). The inflammatory & neurodegenerative (I&ND) hypothesis of depression: leads for future research and new drug developments in depression. Metab Brain Dis. 24:27–53. Maes M. (2008). The cytokine hypothesis of depression: inflammation, oxidative & nitrosative stress (IO&NS) and leaky gut as new targets for adjunctive treatments in depression. Neuro. Endocrinol. Lett. 29: 287–291. Mattson MP. (2000). Apoptosis in neurodegenerative disorders. Nat. Rev. Mol. Cell Biol. 1: 120–129. Mazzanti CM, Spanevello R, Ahmed M, Pereira LB, Gonc JF, Corrêa M, Schmatz R, Stefanello N, Leal DBR, Mazzanti A, Ramos AT, Martins TB, Danesi CC, Grac DL, Morsch VM, Schetinger MRC. (2009). Pre-treatment with ebselen and vitamin E modulate acetylcholinesterase activity: interaction with demyelinating agents. Inter. J. Develop. Neurosci. 27: 73–80. Milton NG. (2004). Role of hydrogen peroxide in the aetiology of Alzheimer’s disease: implications for treatment. Drugs Aging. 21: 81–100. Niebroj-Dobosz I, Dziewulska D, Kwiecinski H. (2004). Oxidative damage to proteins in the spinal cord in amyotrophic lateral sclerosis (ALS). Fol Neuropa; 42:151–156. Nijholt I, Farchi N, Kye M, Sklan EH, Shoham S, Verbeure B, Owen D, Hochner B, Spiess J, Soreq H, Blank T. (2004). Stress-induced alternative splicing of acetylcholinesterase results in enhanced fear memory and long-term potentiation. Mole. Psychiatry. 9: 174–183. Nishikimi M, Appaji Rao N. et al. (1972). "The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen." Biochemical and Biophysical Res. Communications. 46, 2: 849-854. Ohkawa, H, Ohishi N., et al. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem.95, 2: 351-358. Orhan I, Aslan S, Kartal MS¸ Bas HKC. (2008). Inhibitory effect of Turkish Rosmarinus officinalis L. onacetylcholinesterase and butylcholinesterase enzymes. Food Chem. 108: 663–668. Ozcan ME, Gulec M, Ozerol E, Polat R, Akyol O. (2004).Antioxidant enzyme activities and oxidative stress in affective disorders. Int. Clin. Psychopharmacol.19:89–95. Paglia DE, Valentine WN. (1967). Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 70, 1: 158–169. Pedreanez A, Arcaya JL, Carrizo E, Mosquera J. (2006). Forced swimming test increases superoxide anion positive cells and angiotensin II positive cells in the cerebrum and cerebellum of the rat. Brain Res. Bull. 71(1–3):18–22. Pedreañez A, Luis Arcaya J, Carrizo E, Rincón J, Viera N, Peña C, Vargas R, Mosquera J. (2011). Experimental depression induces renal oxidative stress in rats. Physiol. Behavior 104: 1002–1009. Petersen RB, Nunomura A, Lee HG, Casadesus G, Perry G, Smith MA, Zhu X. (2007). Signal transduction cascades associated with oxidative stress in Alzheimer’s disease, J. Alzheimers Dis. 11: 143–152. Raison CL, Capuron L, Miller AH. (2006). Cytokines sing the blues: inflammation and the pathogenesis of depression. Trends Immunol. 27: 24–31. Ranheim T, Halvorsen B. (2005). Coffee consumption and human health – beneficial or detrimental? Mechanisms for effects of coffee consumption on different risk factors for cardiovascular disease and type 2 diabetes mellitus. Mole. Nutr. Food Res. 49, 3: 274–284. Saeed SA, Shad KF, Saleem T, Javed F, Khan MU. (2007). Some new prospects in the understanding of the molecular basis of the pathogenesis of stroke. Exper. Brain Res. 182, 1: 1–10. Sarko J. (2000). Antidepressants, old and new. A review of their adverse effects and toxicity in overdose. Emerg. Med. Clin. North Am. 18: 637–654. Satoh T, Sakai N, Enokido Y, Uchiyama Y, Hatanaka H. (1996). Free radicalindependent protection by nerve growth factor and Bcl-2 of PC12 cells from hydrogen peroxide-triggered apoptosis, J. Biochem. 120: 540–546. Schaller B, Graf R. (2004). Cerebral ischemia and reperfusion: the pathophysiologic concept as a basis for clinical therapy, J. Cerebral Blood Flow Metabol. 24, 4: 351–371. Shati A, Elsaid FG, Hafez EE. (2011). Biochemical and molecular aspects of aluminium chloride-induced neurotoxicity in mice and the protective role of Crocus sativus L. extraction and honey syrup. Neurosci.175: 66-74. Shimoda H, Seki E, Aitani M. (2006). Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain mice. BMC Complement Altern. Med. 6: 9–17. Shimohama S, Tanino H, Fujimoto S. (2001). Differential expression of rat brain caspase family proteins during development and aging. Biochem. Biophys. Res. Commun. 289: 1063–1066. Soreq H, Seidman S. (2001). Acetylcholinesterase new roles for and old actor. Nature Reviews Neurosci. 2: 294–302. Takaki I, Bersani ALE, Vendruscolo A, Sartoretto SM, Diniz SP, Bersani ACA, Cuman RKN. (2008). Anti-inflammatoryandantinociceptiveeffectsof Rosmarinus officinalis L. essential oil in experimental animal models. J. Med. Food 11:741–746. Takeda E, Terao J, Nakaya Y, Miyamoto K, Baba Y, Chuman H., et al. (2004). Stress control and human nutrition. J. Med. Invest. 51:139–1145. Takeda H, Tsuji M, Inazu M, Egashira T, Matsumiya T. (2002). Rosmarinic acid and caffeic acid produce antidepressive-like effect in the forced swimming test in mice. European J. Pharmacol. 449: 261–267. Takeda H, Tsuji M, Inazu M, Egashira T, Matsumiya T. (2002). Rosmarinic acid and caffeic acid produce antidepressive-like effect in the forced swimming test in mice. Eur. J. Pharmacol. 449:261–267. Tsukamoto O, Minamino T, Okada K, Shintani Y,Takashima S, Kato H, Liao Y, Okazaki H, Asai M, Hirata A, Fujita M, Asano Y, Yamazaki S, Asanuma H, Hori M, Kitakaze M. (2006). Depression of proteasome activities during the progression of cardiac dysfunction in pressure-overloaded heart of mice. Biochemical and Biophysical Research Communications 340: 1125–1133. Vanlangenakker N, Vanden Berghe T, Krysko DV, Festjens N, Vandenabeele P. (2008). Molecular mechanisms and pathophysiology of necrotic cell death. Curr. Mol. Med. 3:207–220. Vianello A, Zancani M, Macri F. (1990). Hydrogen peroxide formation and iron ion oxidoreduction linked to NADH oxidation in radish plasmalemma vesicles, Biochim. Biophys. Acta. 1023: 19–24. Weber H. (1966). Serum cholinesterase concentration. Deutsch Med. Wschr. 91:1927-1932. Wong S, Pinkney J. (2004). Role of Cytokines in Regulating Feeding Behaviour. Current Drug Targets. 5, 3: 251-263. Xu H, Steven RJ, Li XM. (2003). Dose-related effects of chronic antidepressants on neuroprotective proteins BDNF, Bcl-2 and Cu/Zn-SOD in rat hippocampus, Neuropsycho-pharmacol. 28: 53–62. Yamamoto J, Yamada K, Naemura A, Yamashita T, Arai R. (2005).Testing various herbs for antithrombotic effect. Nutrition. 21: 580–587. Yu YW, Chen TJ, Hong CJ, Chen HM, Tsai SJ. (2003). Association study of the interleukin-1 beta (C-511T) genetic polymorphism with major depressive disorder, associated symptomatology, and antidepressant response. Neuropsychopharmacol. 28: 1182–1185. Zhu H, Gao W, Jiang H, Wu J, Shi YF, Zhang XJ. (2007). Calcineurin mediates acetylcholinesterase expression during calcium ionophore A23187-induced HeLa cell apoptosis. Biochemica. et Biophysica. Acta. 1773: 593–602. Notes Tables: Table (1): Primers nucleotides sequence used in this study: Primer name Primer sequence from 5`-`3 Annealing temp. AchE R –CCACCGATCCTCTGGACGAG P53 F- AGGGATACTATTCAGCCCGAGGTG 64°C Bcl2 F-ATGTGTGTGGAGAGCGTCAACC 63°C F- CGCTCCTGCTTGCTATAGTG R-ACTGCCACTCCTTGCCCCATTC R-TGAGCAGAGTCTTCAGAGACAGCC 60°C IL-4 F-CTATTAATGGGTCTCACCTCCCAACT 60°C R-CATAATCGTCTTTAGCCTTTCCAAG IL-12 F-CAGCCTTGCAGAAAAGAGAGC 65°C R-CCAGTAAGGCCAGGCAACAT GPDH (Housekeeping gene) F-ATTGACCACTACCTGGGCAA 60-65°C R-GAGATACACTTCAACACTTTGACCT GPDH: Glyceraldehyde-3-phosphate dehydrogenase. Results: Table (2): Brain antioxidants and oxidative stress in different groups of rats: Groups Parameters Total Antioxidant Capacity(U/ protein) Catalase (U/mg protein) SOD(U/mg protein) GSH-Px(U/mg protein) GSH-Reductase (U/ mg protein) GSH-S-Transferase (U/ mg protein) GSH(U/ mg protein) TBARS (n mole/g tissue) H2O2 (mM/g tissue) T. Protein (mg/g tissue) mg Control Depression Depression & Rosemary Depression & green Coffee 0.58±0.09 0.35±0.07*** 0.40±0.07** 0.41±0.07** 4.0±0.42 46.2±6.8 4.0±0.49 47.3±4.6 5.6±0.49 3.65±0.49 140.9±15.0 0.92±0.25 8.4±0.75 3.0±0.36*** 33.7±5.3** 2.8±0.45*** 33.5±3.5*** 2.9±0.26*** 2.4±0.33*** 248.9±22.5*** 2.3±0.17*** 4.4±0.84*** 3.6±0.27b 40.7±5.5a 3.3±0.29** 36.4±4.0*** 3.7±0.22***b 3.02±0.28*a 178.5±11.4**c 1.39±0.46*c 5.6±0.57***a 3.9±0.27c 46.9±3.9c 3.9±0.4c 46.7±5.2c 4.4±0.53***c 3.5±0.58c 155.5±20.9c 0.95±0.17c 6.7±0.77**c All groups were compared with the control group p<0.05 *, p<0.01**, p<0.001*** Depression& Rosemary and Depression& Green coffee groups were compared with depression group, p<0.05 a, p<0.01 b, p<0.001 c Table (3): Acetylcholinesterase activity in different groups of rats: Groups Parameters Serum acetylcholinesterase(U/dl) Brain acetylcholinesterase (U/g tissue) Control 602.2±14.3 1314.8±11.2 Depression 336.4±12.3*** 773.6±13.7*** All groups were compared with the control group p<0.001*** Depression & Rosemary 457.2±13.1***c 845±16.1***c Depression & green Coffee 428.2±4.8***c 999.6±14.6***c Depression& Rosemary and Depression& Green coffee groups were compared with depression group, p<0.001 c Fig (1): The ratio of target genes expression in brain of different groups of rats