This art icle was downloaded by: [ I ngent a Cont ent Dist ribut ion ( Publishing Technology) ] On: 07 Oct ober 2014, At : 04: 01 Publisher: Taylor & Francis I nform a Lt d Regist ered in England and Wales Regist ered Num ber: 1072954 Regist ered office: Mort im er House, 37- 41 Mort im er St reet , London W1T 3JH, UK Avian Pathology Publicat ion det ails, including inst ruct ions f or aut hors and subscript ion inf ormat ion: ht t p: / / www. t andf online. com/ loi/ cavp20 Characterization of infectious laryngotracheitis virus isolates from the US by polymerase chain reaction and restriction fragment length polymorphism of multiple genome regions Ivomar Oldoni a & Maricarmen García a a Poult ry Diagnost ic and Research Cent er, Depart ment of Populat ion Healt h , College of Vet erinary Medicine, At hensThe Universit y of Georgia , 953 College St at ion Road, At hens, GA, 30602, USA Published online: 02 May 2007. To cite this article: Ivomar Oldoni & Maricarmen García (2007) Charact erizat ion of inf ect ious laryngot racheit is virus isolat es f rom t he US by polymerase chain react ion and rest rict ion f ragment lengt h polymorphism of mult iple genome regions, Avian Pat hology, 36: 2, 167-176, DOI: 10. 1080/ 03079450701216654 To link to this article: ht t p: / / dx. doi. org/ 10. 1080/ 03079450701216654 PLEASE SCROLL DOWN FOR ARTI CLE Taylor & Francis m akes every effort t o ensure t he accuracy of all t he inform at ion ( t he “ Cont ent ” ) cont ained in t he publicat ions on our plat form . However, Taylor & Francis, our agent s, and our licensors m ake no represent at ions or warrant ies what soever as t o t he accuracy, com plet eness, or suit abilit y for any purpose of t he Cont ent . Any opinions and views expressed in t his publicat ion are t he opinions and views of t he aut hors, and are not t he views of or endorsed by Taylor & Francis. The accuracy of t he Cont ent should not be relied upon and should be independent ly verified wit h prim ary sources of inform at ion. Taylor and Francis shall not be liable for any losses, act ions, claim s, proceedings, dem ands, cost s, expenses, dam ages, and ot her liabilit ies what soever or howsoever caused arising direct ly or indirect ly in connect ion wit h, in relat ion t o or arising out of t he use of t he Cont ent . This art icle m ay be used for research, t eaching, and privat e st udy purposes. Any subst ant ial or syst em at ic reproduct ion, redist ribut ion, reselling, loan, sub- licensing, syst em at ic supply, or dist ribut ion in any form t o anyone is expressly forbidden. Term s & Condit ions of access and use can be found at ht t p: / / www.t andfonline.com / page/ t erm s- and- condit ions Avian Pathology (April 2007) 36(2), 167  176 Characterization of infectious laryngotracheitis virus isolates from the United States by polymerase chain reaction and restriction fragment length polymorphism of multiple genome regions Ivomar Oldoni and Maricarmen Garcı́a* Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Poultry Diagnostic and Research Center, Department of Population Health, College of Veterinary Medicine, Athens, 953 College Station Road, The University of Georgia, Athens, GA 30602, USA Infectious laryngotracheitis (ILT) is an acute viral respiratory disease, primarily of chickens. Economic losses attributable to ILT affect many poultry-producing areas throughout the United States (US) and the world. Despite efforts to control the disease by vaccination, prolonged epidemics of ILT remain a threat to the poultry industry. Earlier epidemiological and molecular evidence indicated that outbreaks in the US are caused by vaccine-related strains. In this study, polymerase chain reaction and restriction fragment polymorphism (PCR-RFLP) of four genome regions was utilized to characterize 25 isolates from commercial poultry and backyard flocks from the US. Combinations of PCR-RFLP patterns classified the ILT virus isolates into nine groups. Backyard flock isolates were categorized in three separate groups. The ILT virus US Department of Agriculture (USDA) reference strain and the tissue culture origin (TCO) vaccine strain were categorized into two separate groups. Twenty-two isolates from commercial poultry were categorized into four groups: one group, of six isolates, showed patterns identical to the chicken embryo origin (CEO) vaccines; a second group, of nine isolates, differed in only one pattern from the CEO vaccines; a third group, of two isolates, differed in only one pattern from the TCO vaccine; a fourth group, of five isolates, differed in six and nine patterns from the CEO and TCO vaccines, respectively. Results obtained from this study clearly demonstrated that most of the commercial poultry isolates (17 of 22 isolates) were closely related to the vaccine strains. However, isolates different to the vaccine strains were also identified in commercial poultry. Introduction Infectious laryngotracheitis (ILT) is a highly contagious, acute respiratory disease of chickens of worldwide distribution that affects growth and egg production and leads to significant economic losses during periodic outbreaks of the diseases (Guy & Bagust, 2003). The causative agent is infectious laryngotracheitis virus (ILTV) or Gallid herpesvirus I, a member of the Herpesviridae family, Alphaherpesvirinae subfamily (Roizman, 1996). Vaccination with live-attenuated vaccines has been the principal tool used to control the spread of the disease (Guy & Bagust, 2003). Traditionally in the US, two types of live-attenuated vaccines have been widely utilized; the vaccines attenuated by multiple passages in embryonated eggs *chicken embryo origin (CEO) (Samberg et al. 1971); and the vaccine generated by multiple passages in tissues culture *tissue culture origin (TCO) (Gelenczei & Marty, 1965). There are currently several CEO vaccines and one TCO vaccine commercially available. Several CEO vaccines are labelled for administration by water and spray in addition to the preferred eyedrop method. The TCO vaccine is labelled for eyedrop administration only. Most recently, a fowlpox-vector ILT vaccine (FP-LT) has been com- mercially available for administration only by wing webstab inoculation at about 8 weeks of age (Davison et al ., 2006). Vaccination programs vary widely in the US between states and between different companies within a state. Commercial layers, layer breeders, and broiler breeders are usually vaccinated twice with CEO and/or TCO vaccines. Broilers are vaccinated only in case of outbreaks with the CEO vaccines. The increased frequency of outbreaks in broilers has been associated with denser poultry populations, mixing of different type of birds (breeders, leghorns, and broilers) in the same geographical area, shorter down times, and lax biosecurity. It is believed that most of the outbreaks in the US are caused by CEO vaccine isolates that persist in longlived bird operations and spill-over broiler populations (Davison et al ., 2005). Earlier experimental evidence demonstrated that live attenuated vaccine strains, particularly the CEO vaccines, could easily revert to virulence after bird-to-bird passage (Guy et al ., 1991), or after reactivation from latency (Hughes et al ., 1991). Once vaccine strains have been introduced in the field, the identification of ILTV strains is difficult because of the antigenic and genomic homogeneity of the vaccines *To whom correspondence should be addressed. Tel: 1 706 542 5656. Fax: 1 706 542 5630. E-mail: mcgarcia@uga.edu ISSN 0307-9457 (print)/ISSN 1465-3338 (online)/07/20167-10 # 2007 Houghton Trust Ltd DOI: 10.1080/03079450701216654 Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 168 I. Oldoni and M. Garcı́a and field viruses (Guy & Bagust, 2003). Initial attempts to differentiate among ILTV strains in the US were achieved by restriction fragment length polymorphism (RFLP) analysis of the viral genome (Leib et al ., 1986; Guy et al ., 1989; Andreasen et al ., 1990; Keller et al ., 1992; Keeler et al ., 1993). These studies provided the first evidence indicating that US ILTV field isolates were closely related to the CEO vaccine strains. However, routine use of RFLP analysis of the viral genome was limited due to the difficulties in obtaining high yields of pure viral DNA. With the advent of the polymerase chain reaction (PCR), RFLP of PCR products (PCRRFLP) has greatly facilitated the differentiation of ILTV strains. PCR-RFLP analysis of single and multiple viral genes and genome regions has permitted the differentiation of ILTV isolates from different parts of the world (Chang et al ., 1997; Clavijo & Nagy, 1997; Graham et al ., 2000; Han & Kim, 2001, 2003; Kirkpatrick et al ., 2006; Creelan et al ., 2006; Ojkic et al ., 2006). Analysis of the ICP4 gene by PCR-RFLP was utilized to differentiate vaccine strains from field isolates in Taiwan (Chang et al ., 1997), Northern Ireland (Graham et al ., 2000), and to detect concurrent infections of ‘‘wild type’’ and vaccine strain in the United Kingdom (UK) (Creelan et al ., 2006). Analysis of multiple genome regions by PCR-RFLP was utilized to gain a more precise identification of geographically and historical distinct Australian ILTV isolates (Kirkpatrick et al ., 2006). Sequencing analysis of multiple viral genes has also been utilized to differentiate ILTV isolates. Sequencing of the thymidine kinase (TK) and glycoprotein G (gG) genes allowed the differentiation of vaccine strains and field isolates from Korea (Han & Kim, 2001), while sequencing analysis of the gG and UL47 genes allowed the differentiation of outbreak related isolates from Canada (Ojkic et al ., 2006). Isolates from the US has been identified as viral subpopulations derived from the CEO vaccines by PCRRFLP analysis of the glycoprotein E (gE) (Garcı́a & Riblet, 2001). However, PCR-RFLP analysis of the gE gene by itself lacks the discriminatory potential to accurately differentiate among closely related vaccines and field isolates (Kirkpatrick et al ., 2006). Moreover viral genome regions of genetic diversity have not been clearly identified for US ILTV isolates. The objective of the present study was to utilize multiple PCR-RFLP assays to identify regions of diversity and to genetically categorize ILTV isolates from the US. To accomplish this objective, 22 field isolates from commercial poultry and three isolates from backyard flocks collected from diverse poultry production regions of the US were analysed by PCR-RFLP of four viral genome regions. Material and Methods Strains, isolates and viral propagation. Seven ILTV vaccine strains were used in this study: six CEO vaccines *Biotrach (Intervert Inc., Millsboro, Delaware, USA), Broilertrake-M (American Scientific Laboratories, Inc., Millsboro, Delaware, USA), BioTrach (TrioBio Laboratories, State College, Pennsylvania, USA), Trachivax (Schering-Plough Animal Health, Kenilworth, New Jersey, USA), LaryngoVac (Fort Dodge Animal Health, Fort Dodge, Iowa, USA), and Fowl Laryngotracheitis Vaccine (Lohmann, Animal Health, Winslow, Maine, USA) *and the TCO vaccine LT-IVAX (Schering-Plough Animal Health). A total of 25 field isolates collected between 1988 and 2005 from nine states were analysed in this study; 22 isolates were obtained from commercial poultry and three isolates from backyard flocks (Table 1). Of the 22 commercial poultry isolates, 19 were recovered from Table 1. Infectious laryngotracheitis virus field isolates used for PCR-RFLP Isolatea Species Age (days) Vaccination 25/H/88/BCY 24/H/91/BCY 9/C/97BR 10/C/97/BR 6/B/99/BR 7/B/99/BR 8/B/99/BR 23/H/01/BBR 12/D/02/BCY 13/E/03/BBR 14/E/03/BBR 15/E/03/BR 16/F/05/BR 26/I/03/BR 1/A/04/BR 2/A/04/BR 3/A/04/BR 4/A/04/BR 5/A/04/BR 11/C/05/BR 17/F/05/BR 18/F/05/BR 19/F/05/BR 21/G/05/BR 22/G/05/BR Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Peafowl Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken Chicken 28 to 56 183 to 548 56 53 Unknown Unknown Unknown 392 Unknown 441 Unknown 35 55 40 Unknown Unknown 35 Unknown Unknown 42 Unknown 55 60 42 42 Non-vaccinated Non-vaccinated Non-vaccinated CEO Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated TCO TCO Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated TCO Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated Non-vaccinated a Sample number/state/year of isolation/bird type; States of isolation are indicate by letters (A to I). Each sample with same letter is originated in the same state; bird type: from commercial poultry broiler (BR), from broiler breeder (BBR), or from backyard flock (BCY). broiler and three from broiler breeder flocks. Isolates were identified by the sample number, followed by a letter (each letter represents a different state of origin, A to I), year of isolation, and type of bird the isolate was collected from. All viruses were isolated from the upper respiratory tract of birds and propagated as previously described (Garcia & Riblet, 2001). Briefly, ILTV isolates were propagated in the chorioallantoic membrane (CAM) of 9-day-old to 11-day-old specific pathogen free chicken embryonated eggs. Embryos were incubated for 5 days at 378C and monitored daily. After incubation, the CAMs were examined for the presence of plaques characteristic of ILTV replication. Isolated plaques were minced in 100 ml phosphate-buffered saline, and freeze/thawed three times. Single plaques were utilized for DNA extraction and were maintained as the viral stock at 808C. The US Department of Agriculture (USDA) ILTV reference strain (ATCC #N-71851) was propagated in chicken embryo kidney (CEK) cells prepared as previously described (Tripathy, 1998), and infected cultures were maintained at 808C for DNA extraction. Virus isolation from experimentally vaccinated birds was performed in chicken kidney cells from adult birds (Hughes & Jones, 1988). Vaccination experiments. Twenty-six leghorn-type specific pathogen free chickens were divided into two groups of 13 birds and placed in two isolation units with filtered air and positive pressure, and were fed a standard diet and water ad libitum . At 4 weeks of age, one group of 13 birds was vaccinated with the CEO vaccine Trachivax (Schering-Plough Animal Health), and the remaining 13 birds were vaccinated with the TCO vaccine LT-IVAX (Schering-Plough Animal Health). Both vaccines were diluted as recommended by the manufacturer and applied via eye drop. All birds were vaccinated in the left eye. Ten days post vaccination all the vaccinated birds were euthanized and the trachea, including the larynx, was collected from each bird. The trachea was cut longitudinally and the epithelium was scraped. Each larynx trachea scraping was re-suspended in 2 ml phosphate-buffered saline with sterile phosphate-buffered saline solution containing 2% antibiotic antimy- Characterization of ILTV from the US 169 cotic solution (Invitrogen, Carlsbad, California, USA) and 2% calf serum. The tracheal scrapings were first tested for the presence of viral DNA using a quantitative real-time PCR method previously described by Callison et al . (2007). Only those samples with more than 105 viral genome copies were further tested for virus isolation and for multiple PCR-RFLP analysis. Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Extraction of viral DNA. DNA from field isolates was extracted from individual CAM plaques, while DNA from the commercial vaccines was extracted directly from vaccine preparations, or from infected chicken embryo kidney supernatants using the QIAamp DNA Mini Kit (Qiagen, Valencia, California, USA) according to the manufacturer’s recommendations. The DNA was diluted in 50 ml elution buffer and stored at 208C. Primers and PCR. Some of the primers utilized in this study were selected from previously published work and others were designed using the ILTV genome sequence (GenBank accession number U28832) with Primer Select software (DNASTAR, Madison, Wisconsin, USA) (Table 2). All amplifications were performed using high-fidelity Platinum Taq DNA polymerase (Invitrogen). Each amplification reaction was performed in a 50 ml volume, containing 200 mM dNTPs, 2 mM MgSO4, 250 mM each primer, 1 U Taq polymerase, 5 ml buffer, and 5 ml template DNA. All amplification reactions used an initial denaturing step at 948C for 1 min, followed by 35 amplification cycles of 948C for 1 min, with annealing temperatures ranging from 54 to 608C (Table 2), for 30 sec (gM/UL9), 45 sec (ORF B-TK, ICP4, TK and gD/ gI/gE), or 1 min (UL47gG and UL0/UL-1). Extension was performed at 688C with extension times that varied accordingly to the size of the target region amplified (UL0/UL-1, TK and UL47/gG for 3 min; gM/ UL9 for 2 min; ICP4, gD/gI/gE and ORF B-TK for 7 min), and a final extension at 688C for 7 min (UL0/UL-1, TK, UL47/gG and gM/UL9) or 10 min (ICP4, gD/gI/gE and ORF B-TK). The PCR products were separated by electrophoresis in 1% agarose gels, stained with ethidium bromide, and exposed to ultraviolet light for visualization. RFLP analysis. A total of 36 restriction endonucleases (REs) were initially selected for RFLP analysis of PCR products from representative ILTV strains (Table 2). Digestion of the ICP4 gene with REs HinP1 I, Hae III, Msp I (Chang et al ., 1997), the ORF-BTK with Fok I (Kirkpatrick et al ., 2006), and the TK gene with Hae III and Msp I (Chang et al ., 1997) were performed as previously described. Digestion of the UL47/gG genome region was performed using REs Afl II, Nla IV, and Fsp I. These enzymes target single nucleotide polymorphisms (SNPs) previously described by Ojkic et al. (2006) found in Canadian isolates. The remaining REs utilized in the study were selected based on the USDA strain (GenBank accession number U28832) restriction sites using the MapDraw software (DNASTAR) (Table 2). Amplification products (10 ml) were digested separately with 10 U RE (New England Biolabs, Beverly, Massachusetts, USA) at adequate temperature for 3 h. After digestion, DNA fragments were separated in 15% polyacrylamide mini gels of 10 8 cm2 or 1010.5 cm2. Fragments were visualized by silver staining using the DNA Silver Stain Kit (Amersham Pharmacia Biotech, Piscataway, New Jersey, USA) following the manufacturer’s recommendations. Gels were analysed under a light box and pattern differences were classified for each enzyme. Once the different patterns were identified, the absence or presence of a given fragment in the RFLP pattern were assigned 0 or 1, respectively; these data were imported into Free Tree software for cluster analysis (Pavlicek et al ., 1999). Similarity coefficients were calculated using the method of Nei & Li (1979). An unrooted dendrogram was constructed using the unweighted pair group method and statistical support for the dendrogram was obtained by bootstrapping using 500 resamplings. Results Selection of genome regions and restriction endonucleases. Of the initial seven genome regions and 36 REs tested, four genome regions and 10 REs were selected for their ability to differentiate among representative US ILTV strains and isolates. The selected genome regions were: ORFB-TK digested with RE BstF5 I; ICP4 digested with Table 2. Primers and genome regions utilized in PCR-RFLP analysis Target genome regions Primer name Sequence (5?to 3?) Expected product size (bp) Annealing temperature for PCR (8C) Restriction endonucleases ORFB-TK Fa ORFB-TK R ORF B-TKa TCTGCGATCTTCGCAGTGGTCAG TGACGAGGAGAGCGAACTTTAATCC 4675 58 BstF5 I, Fok I, Mly I, Xmn I ICP4 Fb ICP4b AACCTGTAGAGACAGTACCGTGACCC 4980 57 Hae III, HinP1 I, Msp I, Alw I, Ava I 2931 58 MspI, BstUI NlaIV, Af l II, FspI, AluI, HaeIII, Hinf I, TspRI 1424 58 MwoI, RsaI, HpyCH4III, MspI, Hinf I 1924 60 Msp I, Fok I, Hae III, ScrF I, Alu I, Nla III 4784 54 BccI, BsmFI, BsmAI, MlyI, HpyCH4III, HinfI 2237 58 Hae III, Msp I ICP4 R CCATTACTACGTGACCTACATTGAGCC c c UL47/gG UL47gG F TCTTGAATGACCTTGCCCCAT UL47gG R gM F ACTCTCGGGTGGCTACTGCTG c c gM/UL9 GCTGAGATCGCATCCGTACA gM R CTTCTAGCAGCCACTGGCTC c UL0 UL-1 F c UL0/UL-1 UL0 UL-1 R gDIE F c GACGGACCTGATTTATAGACTGACAA c gD/gI/gE gDIE R TK forwardb TK reverse a TGCCAGGTATATCGACACTTGAAC TCTCCGGAACCTTACTGTCTTTT GCACGCGCCCATACTCA TKb CTGGGCTAAATCATCCAAGACATCA GCTCTCTCGAGTAAGAATGAGTACA Genome regions previously amplified by Kirkpatrick et al. (2006). Genome regions previously amplified by Chang et al. (1997). c Genome regions amplified in this study. b 170 I. Oldoni and M. Garcı́a Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 REs Hae III and HinP1 I (Chang et al ., 1997), Alw I and Ava I; UL47/gG digested with REs Msp I, Afl II, Nla IV, Fsp I and Hae III; and the gM/UL9 region digested with RE Mwo I. The UL0/UL-1, gD/E/I and TK genome regions did not show RFLP pattern differences with any of the REs tested (data not shown). PCR amplification of ORFB-TK, gM/UL9, ICP4 and UL47/Gg. With the exception of the ICP4 amplification products obtained for the USDA strain and the TCO vaccine, all amplification reactions produced the expected PCR product size (Table 2). The USDA strain and the TCO vaccine produced two ICP4 amplification products, one of the expected size (4980 base pairs [bp]) and a larger fragment of approximately 5800 bp (data not shown). The presence of two amplification products may reflect size differences between the two ICP4 gene copies present in the genomes of the USDA and TCO strains. Further sequence analysis of both ICP4 PCR products will prove or refute this conjecture. RFLP patterns for the ICP4 region. Digestion of the ICP4 genome region of the US isolates with Hae III and Hinp1 I generated different patterns as previously described by Chang et al. (1997) and Kirkpatrick et al. (2006). However, no pattern differences were observed between the US isolates when digested with the Msp I enzyme as previously reported for isolates from Taiwan (Chang et al., 1997), Northern Ireland (Graham et al., 2000), and the UK (Creelan et al ., 2006). Digestion of the ICP4 region with Hae III generated seven different patterns (Figure 1a and Table 3). Pattern A corresponds to the USDA strain, patterns B0 and B were both characteristic of the TCO vaccine obtained directly from vaccine vial or from experimentally vaccinated birds, respectively. As pattern A, pattern B0 has an additional 500 bp fragment while pattern B lacks this fragment. Both patterns B0 and B have an additional fragment of approximately 80 bp. Patterns C to F also lack a 500 bp fragment present in patterns A and B0. Patterns C to F lack a 170 bp fragment present in patterns A and B, while patterns D and E show unique 360 and 330 bp fragments, respectively. Pattern B was characteristic of 17 commercial poultry isolates, the TCO and CEO vaccine strains. Pattern C was characteristic of five commercial poultry isolates. Patterns D, E and F were characteristic of the three backyard flock isolates (Table 3). Restriction endonuclease digestion of the ICP4 region with the HinP1 I enzyme generated four different patterns (Figure 1b and Table 3). Pattern A was characteristic of the USDA strain, the TCO vaccine, and two commercial poultry isolates. As compared with pattern A, pattern B lacks the 150 and 350 bp fragments and has a fragment of approximately 500 bp. Pattern B was characteristic of 20 commercial poultry isolates and of the CEO vaccines. Pattern C lacks a 110 bp fragment and has a fragment of approximately 400 bp. Pattern C was characteristic of the two backyard flock isolates. Pattern D has an additional fragment of approximately 400 bp and was characteristic of one backyard flock isolate. Restriction endonuclease digestion of the ICP4 region with the Alw I enzyme generated three different patterns (Figure 1c and Table 3). Pattern A was characteristic of the USDA strain and the TCO vaccine. As compared with pattern A, pattern B lacks a 1200 bp and has an additional band of approximately 800 bp. Figure 1. Polyacrylamide gel electrophoresis of DNA fragments generated by restriction endonuclease digestion of ICP4 genome region with enzyme HaeIII (1a), HinP1I (1b), AlwI (1c) and AvaI (1d). Letters indicate different patterns as compared with the USDA reference strain. Additional bands are indicated by arrows and missing bands are indicated by stars in comparison with the reference strain. Patterns B0 and B are expected from ICP4 of TCO-like strains digested by HaeIII, by lack of stability of the site that generates the 500 bp fragment. Pattern B was characteristic of two commercial poultry isolates and three backyard flock isolates. Pattern C lacks a 1200 bp fragment and has a fragment of approximately 600 bp. Pattern C was characteristic of CEO vaccine strains and 20 commercial poultry isolates. Restriction endonuclease digestion of the ICP4 region with the Ava I enzyme generated two different patterns (Figure 1d and Table 3). Pattern A was characteristic of the USDA strain, the TCO vaccine, two commercial poultry isolates and one backyard flock isolate. As compared with pattern A, pattern B lacks a 750 bp and has an additional band of approximately 2000 bp. Pattern B was characteristic of the CEO vaccines, 20 commercial poultry isolates and two backyard flock isolates. RFLP patterns for the ORFB-TK and gM/UL9 regions. RE digestion of the ORFB-TK region with the BstU I enzyme produced identical patterns for all the US ILTV strains and isolates tested (data not shown); however, digestion with the BstF51 enzyme produced two different patterns (Figure 2a and Table 3). Pattern A consisted of fragment sizes of approximately 2422, 931, 513, 352, Characterization of ILTV from the US 171 Table 3. Comparison of patterns generated by PCR-RFLP of selected regions from different ILTV isolates and strains Genome region ORFB-TK gM/UL9 Isolate ID/strain Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 USDA BstF 5I Mwo I A A ICP4 UL47/gG Hae III HinP 1I Alw I Ava I Afl II Nla IV Fsp I HaeIII Msp I Pattern combination Group A A A A A A A A A AAAAAAAAAAA I TCO vaccine A A B A A A A A A A A AABAAAAAAAA II 13/E/03/BBR 14/E/03/BBR A A A A B B A A B B A A A A A A A A A A A A AABABAAAAAA AABABAAAAAA III III CEO vaccine 1 CEO vaccine 2 CEO vaccine 3 CEO vaccine 4 CEO vaccine 5 CEO vaccine 6 9/C/97BR 10/C/97/BR 11/C/05/BR 23/H/01/BBR 21/G/05/BR 22/G/05/BR A A A A A A A A A A A A B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B C C C C C C C C C C C C B B B B B B B B B B B B A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA ABBBCBAAAAA IV IV IV IV IV IV IV IV IV IV IV IV 15/E/03/BR 16/F/05/BR 17/F/05/BR 18/F/05/BR 6/B/99/BR 19/F/05/BR 7/B/99/BR 8/B/99/BR 26/I/03/BR A A A A A A A A A A A A A A A A A A B B B B B B B B B B B B B B B B B B C C C C C C C C C B B B B B B B B B A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA AABBCBAAAAA V V V V V V V V V 1/A/04/BR 2/A/04/BR 3/A/04/BR 4/A/04/BR 5/A/04/BR A A A A A C C C C C C C C C C B B B B B C C C C C B B B B B B B B B B B B B B B B B B B B A A A A A B B B B B ACCBCBBBBAB ACCBCBBBBAB ACCBCBBBBAB ACCBCBBBBAB ACCBCBBBBAB VI VI VI VI VI 12/D/02/BCK B A D C B A B C B C A BADCBABCBCA VII 24/H/91/BCK B A E D B B B B B B A BAEDBBBBBBA VIII 25/H/88/BCK B A F C B B B C B B A BAFCBBBCBBA IX 232, 156 and 65 bp. This pattern was characteristic of the USDA strain, the vaccine strains (TCO and CEO), and all the commercial poultry isolates. Pattern B lacks the 930 bp fragment and has a 400 bp fragment. Pattern B was characteristic of the three backyard flock isolates. RE digestion of the gM/UL9 region with the Mwo I enzyme generated three different patterns (Figure 2b and Table 3). Pattern A consisted of fragment sizes of approximately 429, 312, 180, 107, 97, 86, 71, 61 and 48 bp. This pattern was characteristic of the USDA strain, the TCO vaccine, 11 commercial poultry isolates, and three backyard flock isolates. Pattern B lacks the 71 and 61 bp fragments and has a 130 bp fragment. This pattern was characteristic of the CEO vaccines and six commercial poultry isolates. Pattern C lacks the 86 bp fragment and has a 55 bp fragment. Pattern C is characteristic of five commercial poultry isolates. RFLP patterns for the UL47/gG region. Restriction endonuclease digestion of the UL47/gG region with the Afl II enzyme produced two patterns (Figure 2c and Table 3). Pattern A consisted of fragment sizes of 1675 and 1257 bp. This pattern was characteristic of the USDA strain, the vaccine strains (TCO and CEO), and 17 commercial poultry isolates. Pattern B produced a single fragment of 2932 bp, indicating the lack of this site in five commercial poultry isolates and the backyard flock isolates. Digestion with the Nla IV enzyme produced three patterns (Figure 2d and Table 3). Pattern A consisted of 12 fragments of 710, 500, 437, 280, 197, 174/ 170, 151, 93, 79 and 65/63 bp. This pattern was characteristic of the USDA strain, the vaccine strains (TCO and CEO), and 17 commercial poultry isolates. Pattern B lacks the 197 and 79 bp fragments, producing a 276 bp fragment that cannot be visualized in the gel because it migrates together with the 280 bp fragment. This pattern is characteristic of five commercial poultry isolates and one backyard flock isolate. Pattern C lacks the 437 bp fragment and has a fragment of approximately 350 bp. Pattern C is characteristic of two backyard flock isolates. Digestion with Fsp I enzyme produced two patterns (Figure 2e and Table 3). Pattern A consisted of four fragments, 835, 826, 646 and 624 bp; however, the fragments of 646 and 624 bp were not separated on the 15% polyacrylamide gel, allowing the visualization of only three bands. This pattern was Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 172 I. Oldoni and M. Garcı́a Figure 2. Polyacrylamide gel electrophoresis of DNA fragments generated by restriction endonuclease digestion. 2a: ORF B-TK digested with enzyme BstF5I; 2b: gM/UL9 digested with enzyme MwoI; 2c: UL47/gG digested with enzyme AflII; 2d: UL47/gG digested with enzyme NlaIV; 2e: UL47/gG digested with enzyme FspI; 2f: UL47/gG digested with enzyme HaeIII; 2g: UL47/gG digested with enzyme MspI. Letters indicate different patterns as compared with the USDA reference strain. Additional bands are indicated by arrows and missing bands are indicated by stars in comparison with the reference strain. characteristic of the USDA strain, the vaccine strains (CEO and TCO), and 17 commercial poultry isolates. Pattern B lacks the 835 and 826 bp fragments and has a 1700 bp fragment. This pattern was characteristic of five commercial poultry isolates and three backyard flock isolates. Digestion of the UL47/gG region with Hae III enzyme produced three patterns (Figure 2f and Table 3). Pattern A consisted of 11 fragments 1051, 377, 285, 276, 221, 190, 181, 159, 84 and 49/41 bp. This pattern was characteristic of the USDA strain, the vaccine strains (CEO and TCO) and 22 commercial poultry isolates. Pattern B lacks the 1051 bp fragment and shows two fragments of approximately 650 and 400 bp. This pattern is characteristic of two backyard flock isolates. Pattern C lacks the 1051 bp fragment and shows 650, 400 and 70 bp fragments. This pattern was characteristic of one backyard flock isolate. Digestion with Msp I enzyme produced two patterns (Figure 2g and Table 3). Pattern A consisted of 13 fragments of 563, 363/352, 330, 280, 263, 228,128, 98, 84, 69, 54 and 45 bp. This pattern was characteristic of the USDA strain, the vaccine strains (CEO and TCO), 17 commercial poultry isolates, and three backyard flock isolates. Pattern B lacks the 69 and 45 bp fragments and has a fragment of approximately 114 bp. This pattern is characteristic of five commercial poultry isolates. Stability of PCR-RFLP. The stability of the PCR-RFLP patterns was evaluated for five CEO and six TCO viruses recovered from birds 10 days post vaccination. The PCR-RFLP patterns obtained for the five CEO vaccine viruses, recovered from experimentally vaccinated birds, were identical to the patterns obtained from the DNA extracted directly from the vaccine vial (data not shown). For the TCO vaccine, 10 of the 11 PCR-RFLP patterns generated for the six viruses recovered from experimentally vaccinated birds were identical to patterns generated for the TCO vaccine preparation. However, PCR-RFLP pattern for the ICP4 region digested with the Hae III enzyme for the TCO vaccine preparation showed an additional 500 bp fragment (Figure 1a, pattern B0). This 500 bp fragment was not detected in viruses retrieved from birds 10 days post vaccination with the TCO vaccine. This ICP4/Hae III pattern was designated B (Figure 1a). Multiple PCR-RFLP analysis. Analysis of combined RFLP patterns generated a total of nine groups (Table 3). The USDA strain and the TCO vaccine differed in Characterization of ILTV from the US 173 Group II (TCO vaccine) Group I (USDA reference strain) 100 Group III 32 Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Group VI 52 78 Group VII 98 Group VIII 51 76 Group IX Group IV (CEO vaccines) 92 Group V 0.1 Figure 3. Dendogram based on cluster analysis of PCR-RFLP pattern combination of nine groups of ILTV isolates and strains. Similarity coefficients were calculated according the method of Nei & Li (1978). The branch lengths represent the genetic distance between the groups, and numbers on the branches are bootstrap values as a percentage at internal nodes (500 resampling). Group I, USDA vaccine strain; Group II, TCO vaccine strain; Group III, two commercial poultry isolates; Group IV, CEO vaccine strains and six commercial poultry isolates; Group V, nine commercial poultry isolates; Group VI, Five commercial poultry isolates; Groups VII, VIII and IX, three backyard flock isolates. only one pattern and were categorized as groups I and II. Two ILTV isolates from commercial breeders had 10 identical PCR-RFLP patterns to commercial TCO vaccine RFLP patterns, and were categorized into group III. Six ILTV isolates from commercial poultry had identical PCR-RFLP patterns to the commercial CEO vaccines, differed in five patterns from the USDA strain and in four patterns from the TCO vaccine, and were categorized as group IV. Nine ILTV isolates had 10 identical patterns to CEO vaccines. These isolates differed in only one pattern from the CEO vaccines and shared this pattern with the USDA strain and the TCO vaccine, and were identified as group V. Five isolates from commercial poultry shared two patterns with the USDA strain and the TCO vaccine, five patterns with the CEO vaccines, four patterns with the one backyard flock isolate, and had three unique patterns; these isolates were categorized as group VI. Backyard flock isolates differed in at least seven patterns when compared with the USDA strain and the vaccine strains (CEO and TCO), and were categorized separately as groups VII, VIII and IX. Cluster analyses of ILTV PCR-RFLP groups. The nine groups generated by combining RFLP patterns were segregated in three main clusters as determined by cluster and bootstrapping analysis (Figure 3). The first cluster was composed of group I (USDA reference strain), group II (TCO vaccine) and group III (two commercial poultry isolates). The second cluster was composed of closely related group IV (CEO vaccines and commercial poultry isolates) and group V (commercial poultry isolates). A third cluster was composed of group VI from commercial poultry and groups VII, VIII and IX from a backyard flock. Bootstrapping analysis demonstrated that group VI isolates from commercial poultry were more closely related to groups VII, VIII 174 I. Oldoni and M. Garcı́a and IX from backyard flocks than to other commercial poultry isolates and vaccine strains. Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Discussion This study presents the genetic characterization of ILTV isolates collected between 1988 and 2005 from different regions of dense poultry production in the US. Twenty-two isolates were collected from commercial poultry and three isolates from backyard flocks. The 11 PCR-RFLP pattern combinations generated by the digestion of four genome regions with 10 REs categorized the US isolates in nine groups (Table 3). ILTV isolates from commercial poultry were categorized into four groups (III, IV, V and VI), and the backyard flock isolates were categorized into three separated groups (groups VII, VIII and IX). The stability of the 11 PCRRFLP patterns was tested for the vaccine strains after replication in chickens. The PCR-RFLP patterns for one CEO vaccine were shown to be stable after vaccine strain replication in chickens. For the TCO vaccine 10 of the 11 patterns were shown to be stable after vaccine strain replication in chickens. However, the ICP4/Hae III digestion pattern of the TCO vaccine (pattern B0, Figure 1a) was characterized by an additional 500 bp fragment that was not detected after the TCO vaccine strain replicated in chickens (pattern B, Figure 1a), indicating that this site is not stable and cannot be considered a marker to identify TCO-related strains. Previous studies using PCR-RFLP of the ICP4 gene had demonstrated the importance of this genome region to differentiate vaccine strains from ILTV isolates from Taiwan with REs Msp I and Hae III (Chang et al ., 1997), from Northern Ireland with Hae III and Msp I (Graham et al ., 2000), from the United Kingdom with Msp I (Creelan et al ., 2006), from Australia (Kirkpatrick et al ., 2006) and from Canada (Ojkic et al ., 2006) with Hae III. As in other countries, the PCR-RFLP analysis of the ICP4 was valuable to separate ILTV isolates from the US. In this analysis digestion of the ICP4 region with Hae III, HinP1 I, and Alw I allowed the differentiation of vaccine strains from commercial poultry and backyard flock isolates. A partial sequence of the ICP4 region, corresponding to nucleotide positions 2039 to 2950 of the ICP4 gene (accession number L32139), was analysed for all 25 isolates (data not shown). This region of the ICP4 gene was selected for sequencing analysis because it enclosed two Alw I sites that have proven informative by PCR-RFLP analysis (Table 3). However, sequence analysis of this fragment did not allow the differentiation of vaccine strains from field isolates (groups III and VI) as PCR-RFLP analysis of the complete ICP4 region did. Therefore sequence analysis of the complete ICP4 region is needed to identify all the informative ICP4 SNPs found among US isolates. Analysis of Australian isolates showed that PCRRFLP analysis of the ORF B-TK genome region with Fok I allowed the differentiation of ILTV vaccine strains from outbreak isolates (Kirkpatrick et al ., 2006); nevertheless, analysis of the ORF B-TK genome region of US isolates with Fok I did not discriminate between vaccine strains, commercial poultry, and backyard flock isolates (data not shown). Digestion of the ORF B-TK region with BstF5 I allowed the differentiation of backyard flock isolates from commercial poultry isolates and vaccine strains utilized in the US. Earlier reports indicated that the TK gene was valuable to differentiate field isolates from vaccine strains utilized in Korea (Han & Kim, 2001), and Australia (Kirkpatrick et al ., 2006); however, PCR-RFLP analysis of the TK gene with REs Hae III and Msp I did not differentiate between vaccine strains and commercial poultry isolates from the US (data not shown). Differentiation of ‘‘wild type’’ from vaccinal type isolates from the UK was possible by PCRRFLP of a 222 bp ICP4 gene fragment digested with the Msp I enzyme (Creelan et al ., 2006). Digestion of the complete ICP4 region (4980 bp) with the Msp I enzyme did not differentiate between US ILTV isolates from commercial poultry and backyard flocks. Consequently, PCR-RFLP assays need to be tailored for each country in order to precisely characterize the ILTV isolates circulating in a particular region at different time points. PCR-RFLP analysis of the UL47/gG region with enzymes Afl II, Fsp I and Nla IV produced different patterns among commercial poultry isolates (group VI) and backyard flock isolates (groups VII, VIII and IX). The construction of an ILTV gG deletion mutant provided evidence indicating that gG may contribute to the viral virulence (Devlin et al ., 2006). Therefore, SNPs of the gG gene among US isolates become relevant as they may influence viral virulence. Genetic diversity was also detected in the gM/UL9 region where a SNP in the gM recognized by the Mwo I enzyme separated commercial poultry isolates (group V) from the CEO vaccines. PCR-RFLP analysis of multiple genome regions was required to precisely differentiate among closely related US ILTV isolates. PCR-RFLP pattern combinations categorized the 22 commercial poultry isolates in four distinct groups. Six of the 22 isolates showed PCRRFLP patterns identical to the CEO vaccine (group IV); one of these isolates was recovered from a CEO vaccinated broiler flock. Another nine isolates differed in only one pattern from the CEO vaccine (group V). Isolates from groups IV and V identified as closely related to the CEO vaccine strains were collected from seven of the nine states represented in this study, indicating that these types of isolates are the most prevalent in ILT outbreaks in the US. These findings confirm previous reports that isolates closely related to the vaccine strains are involved in outbreaks of the disease in different regions of the US (Guy et al ., 1989; Andreasen et al ., 1990; Keller et al ., 1992; Keeler et al ., 1993). Whether the origin of these isolates is vaccine strains that lost attenuation and consequently persist in the field is not completely understood. To confirm that the isolates categorize in groups III, IV, and V are derived from vaccine strains, complete genome sequencing of representative isolates and vaccine strains will be necessary. Although most of the commercial poultry isolates were closely related to the commercial vaccines, five commercial poultry isolates (group VI) differed in six and nine patterns when compared with the CEO and TCO vaccine strains, respectively. All five isolates were recovered during the same outbreak of the disease in 2004. These isolates share similar patterns with the backyard flock isolate 24/H/91/BCK and Canadian wild-type isolates (Ojkic et al ., 2006). Overall, using multiple PCR-RFLP analysis of four genome regions digested with 10 REs revealed genetic diversity of the ICP4, gM/UL9, and gG/UL47 genome regions of US isolates from commercial poultry and backyard flocks. PCR-RFLP analysis of gM/UL9 with Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Characterization of ILTV from the US 175 Mwo I and the ICP4 region with Hae III and Alw I was sufficient to differentiate vaccine strains, commercial poultry and backyard flock isolates in nine genetic groups. PCR-RFLP analysis of the UL47-gG region further confirmed that backyard flock isolates (groups VII, VIII and IX) and commercial poultry isolates from group VI were genetically different to the vaccine strains and the remaining commercial poultry isolates from the US. In this study it was confirmed that most of the US ILTV isolates from commercial poultry were similar to, or closely related to, the commercial vaccine strains; in particular, to the CEO vaccines. This result was not unexpected; previous ILTV genotyping studies from Northern Ireland (Graham et al ., 2000) and Taiwan (Chang et al ., 1997) concluded that vaccine viruses, once established in the field, displace wild-type virus and are responsible for many of the outbreaks. In the US the intermittent use of CEO vaccines in regions of diverse poultry populations, combined with lax biosecurity, has permitted the emergence of vaccine-related viruses that are well adapted to linger in the field, and incite outbreaks when introduced into naı̈ve broiler flocks. Although the PCR-RFLP categories generated in this study may be modified when more intense sequencing analysis of these isolates is performed, this report identifies genome regions of genetic diversity among US ILTV isolates, presents the first comprehensive genotyping characterization of a diverse group of isolates from the US, and provides the framework for further sequencing analysis. In addition to sequencing analysis, future work will incorporate pathotyping studies of representative isolates from the different PCR-RFLP groups identified in this study. Acknowledgement This study was supported by the US Poultry & Egg Association. References Andreasen, J.R., Jr., Glisson, J.R. & Villegas, P. (1990). Differentiation of vaccine strains and Georgia field isolates of infectious laryngotracheitis virus by their restriction endonuclease fragment patterns. Avian Diseases , 34 , 646 656. Callison, S.A., Riblet, S.M., Oldoni, I., Sun, S., Zavala, G., Williams, S., Ressurreccion, R., Spackman, E. & Garcı́a, M. (2007). Development and validation of a real-time Taqman† PCR assay for the detection and quantification of infectious laryngotracheitis virus in poultry. Journal of Virological Methods, 139 , 31 38. Chang, P.C., Lee, Y.L., Shien, J.H. & Shieh, H.K. (1997). Rapid differentiation of vaccine strains and field isolates of infectious laryngotracheitis virus by restriction fragment length polymorphism of PCR products. Journal of Virological Methods, 66 , 179 186. Clavijo, A. & Nagy, E. (1997). Differentiation of infectious laryngotracheitis virus strains by polymerase chain reaction. Avian Diseases, 41 , 241 246. Creelan, J.L., Calvert, V.M., Graham, D.A. & McCullough, S.J. (2006). Rapid detection and characterization from field cases of infectious laryngotracheitis virus by real-time polymerase chain reaction and restriction fragment length polymorphism. Avian Pathology, 5 (2), 173 179. Davidson, S., Gingerich, E.N., Casavant, S. & Eckroade, R.J. (2006). Evaluation of the efficacy of a live fowlpox-vectored infectious laryngotracheitis/avian encephalomyelitis vaccine against ILT viral challenge. Avian Diseases , 50 , 50 54. Davison, S., Dufour-Zavala, L., Garcia, M., Ghori, H., Hoerr, F., Hopkins, B., Smith, J. & Waldrip, D. (2005). Vaccinal laryngotracheitis *overview in the United States. In Proceedings of the 109th Annual Meeting of the United States Animal Health Association (p. 580). Hershey, PA, USA. Devlin, J.M., Browning, G.F., Hartley, C.A., Kirkpatrick, N.C., Mahmoudian, A., Noormohammadi, A.H. & Gilkerson, J.R. (2006). Glycoprotein G is a virulence factor in infectious laryngotracheitis virus. Journal General of Virology, 87 (10), 2839 2847. Garcia, M. & Riblet, S.M. (2001). Characterization of infectious laryngotracheitis virus isolates: demonstration of viral subpopulations within vaccine preparations. Avian Diseases , 45 , 558 566. Gelenczei, E.F. & Marty, E.W. (1965). Strain stability and immunologic characteristics of a tissue-culture-modified infectious laryngotracheitis virus. Avian Diseases, 14 , 44 56. Graham, D.A., McLaren, I.E., Calvert, V., Torrens, D. & Meehan, B.M. (2000). RFLP analysis of recent Northern Ireland isolates of infectious laryngotracheitis virus: comparison with vaccine virus and field isolates from England, Scotland and the Republic of Ireland. Avian Pathology, 29 , 57 62. Guy, J.S. & Bagust, T.J. (2003). Laringotracheitis. In Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald & D.E. Swayne (Eds.), Diseases of Poultry, 11th edn (pp. 121 134). Ames, IA: Iowa State Press. Guy, J.S., Barnes, H.J., Munger, L.L. & Rose, L. (1989). Restriction endonuclease analysis of infectious laryngotracheitis viruses: comparison of modified-live vaccine viruses and North Carolina field isolates. Avian Diseases, 33 , 316 323. Guy, J.S., Barnes, H.J. & Smith, L. (1991). Increased virulence of modified-live infectious laryngotracheitis vaccine virus following bird-to-bird passage. Avian Diseases , 35 , 348 355. Han, M.G. & Kim, S.J. (2001). Analysis of Korean strains of infectious laryngotracheitis virus by nucleotide sequences and restriction fragment length polymorphism. Veterinary Microbiology, 4 , 321 331. Han, M.G. & Kim, S.J. (2003). Efficacy of live virus vaccines against infectious laryngotracheitis assessed by polymerase chain reactionrestriction fragment length polymorphism. Avian Diseases, 47 , 261 271. Hughes, C.S. & Jones, R.C. (1988). Comparison of cultural methods for primary isolation of infectious laryngotracheitis virus from field materials. Avian Pathology, 17 , 295 303. Hughes, C.S., Williams, R.A., Gaskell, R.M., Jordan, F.T., Bradbury, J.M., Bennett, M. & Jones, R.C. (1991). Latency and reactivation of infectious laryngotracheitis vaccine virus. Archives of Virology, 121 , 213 218. Keeler, C.L. Jr, Hazel, J.W., Hastings, J.E. & Rosenberger, J.K. (1993). Restriction endonuclease analysis of Delmarva field isolates of infectious laryngotracheitis virus. Avian Diseases, 37 , 418 426. Keller, L.H., Benson, C.E., Davison, S. & Eckroade, R.J. (1992). Differences among restriction endonuclease DNA fingerprints of Pennsylvania field isolates, vaccine strains, and challenge strains of infectious laryngotracheitis virus. Avian Diseases, 36 , 575 581. Kirkpartick, N.C., Mahmoudian, A., O’Rourke, D. & Noormohammadi, A.H. (2006). Differentiation of infectious laryngotracheitis virus isoaltes by restriction fragment length polymorphic analysis of polymerase chain reaction products amplified from multiple genes. Avian Diseases, 50 , 28 34. Leib, D.A., Bradbury, J.M., Gaskell, R.M., Hughes, C.S. & Jones, R.C. (1986). Restriction endonuclease patterns of some European and American isolates of avian infectious laryngotracheitis virus. Avian Diseases , 30 , 835 837. Nei, M. & Li, W.H. (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences of the United States of America , 76 (10), 5269 5273. Ojkic, D., Swinton, J., Vallieres, M., Martin, E., Shapiro, J., Sanei, B. & Binnington, B. (2006). Characterization of field isolates of infectious laryngotracheitis virus from Ontario. Avian Pathology, 35 (4), 286 292. Pavlicek, A., Hrda, S. & Flegr, J. (1999). Free-Tree *freeware program for construction of phylogenetic trees on the basis of distance data and bootstrap/jackknife analysis of the tree robustness. Application 176 I. Oldoni and M. Garcı́a Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 in the RAPD analysis of genus Frenkelia. Folia Biologica , 45 (3), 97 99. Roizman, B. (1996). Herpesviridae. In B. N. Fields, D.M. Knipe & P.M. Howley (Eds.), Virology, 3rd edn (pp. 22212230). Philadelphia, PA: Lippincott-Raven. Samberg, Y., Cuperstein, E., Bendheim, U. & Aronovici, I. (1971). The development of a vaccine against avian infectious laryngotracheitis. IV. Immunization of chickens with a modified laryngotracheitis vaccine in the drinking water. Avian Diseases, 15 , 413 417. Tripathy, D.N. (1998). Infectious laryngotracheitis. In D.E. Swayne, J.R. Glisson, M.W. Jackwood, J.E. Pearson & W.M. Reed (Eds.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 4th edn (pp. 111 115). Kennett Square, PA: American Association of Avian Pathologists. Avian Pathology (April 2007) 36(2), 1
2 Non-English Abstracts Characterization of infectious laryngotracheitis virus isolates from the United States by polymerase chain reaction and restriction fragment length polymorphism of multiple genome regions Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Ivomar Oldoni and Maricarmen Garcı́a* Poultry Diagnostic and Research Center, Department of Population Health, College of Veterinary Medicine, Athens, 953 College Station Road, The University of Georgia, Athens, GA 30602, USA Caractérisation de souches du virus de la laryngotrachéite infectieuse aviaire (VLTI) isolées aux USA par la réaction de polymérisation en chaı̂ne et le polymorphisme de taille des fragments de restriction (PCR-RFLP) de régions génomiques multiples La laryngotrachéite infectieuse aviaire (LTI) est une maladie virale aiguë principalement de la poule. Des pertes économiques attribuables à la LTI affectent de nombreuses régions avicoles aux USA et dans le monde. Malgré les efforts pour maı̂triser la maladie par la vaccination, des épidémies prolongées de LTI restent une menace pour l’industrie avicole. Des mises en évidence épidémiologiques et moléculaires antérieures ont montré que des cas, aux USA, étaient dus à des souches en liaison avec les vaccins. Dans cette étude, la réaction de polymérisation en chaı̂ne et le polymorphisme de taille des fragments de restriction (PCR-RFLP) de quatre régions génomiques ont été utilisés pour caractériser 25 souches isolées aux USA dans des élevages fermiers et industriels. Les combinaisons des profils de PCR-RFLP ont permis de classer les isolats de virus de la laryngotrachéite infectieuse aviaire (VLTI) en neuf groupes. Les souches isolées dans les élevages fermiers ont été classées en trois groupes. La souche de référence américaine de VLTI et la souche vaccinale dont l’origine est une culture de tissu (TCO) ont été classées en deux groupes séparés. Vingt-deux souches isolées d’élevages commerciaux ont été classées en quatre groupes: un groupe de six isolats qui ont montré des profils identiques aux vaccins dont l’origine est l’embryon de poulet (CEO); un second groupe de neuf isolats qui ont présenté une seule différence de profil par rapport aux vaccins CEO; un troisième groupe de deux isolats qui ont présenté une seule différence de profil par rapport aux vaccins TCO; un quatrième groupe de cinq isolats qui ont présenté respectivement six et neuf différences par rapport aux vaccins CEO et TCO. Les résultats obtenus à partir de cette étude démontrent clairement que la plupart des souches isolées dans les élevages industriels (17 sur 22 souches) étaient très proches des souches vaccinales CEO. Cependant, certains isolats différents des souches vaccinales ont également été identifiés dans les élevages industriels. Charakterisierung von Isolaten des infektiösen Laryngotracheitisvirus (ILTV) aus den Vereinigten Staaten mittels Polymerasekettenreaktion und Restriktionsfragmentlängenpolymorphismus (PCR-RFLP) mehrerer Genomregionen Die infektiöse Laryngotracheitis (ILT) ist eine akute virale Respirationserkrankung vorwiegend bei Hühnern. Viele Geflügelhaltungen weltweit sind von wirtschaftlichen Verlusten durch ILT betroffen. Trotz der Anstrengungen die Krankheit durch Vakzination zu bekämpfen, bleibt die ILT durch anhaltende Epidemien eine Bedrohung für die Geflügelindustrie. Vorhergehende epidemiologische und molekulare Nachweise belegen, dass die Ausbrüche in den USA durch Impfstoff-verwandte Stämme verursacht worden sind. In dieser Studie wurden die Polymerasekettenreaktion und der Restriktionsfragmentlängenpolymorphismus (PCR-RFLP) von vier Genomregionen zur Charakterisierung von 25 Isolaten aus kommerziellen und Hinterhofgeflügelhaltungen in den USA angewendet. Durch Zusammenstellung der PCR-RFLP-Muster konnten die ILTV-Isolate in neun Gruppen klassifiziert werden. Die Isolate aus den Hinterhofherden wurden in drei separate Gruppen eingeteilt. Der ILTV-USDV-Referenzstamm und der originale Gewebekultur (TCO)-Vakzinestamm wurden zwei verschiedenen Gruppen zugeordnet. Die 22 Isolate aus kommerziellen Hühnern wurden in vier Gruppen klassifiziert: eine Gruppe aus sechs Isolaten hatte identische Muster mit den originalen Hühnerembryo (CEO)-Vakzinen; die zweite Gruppe mit neun *To whom correspondence should be addressed. Tel: 1 706 542 5656. Fax: 1 706 542 5630. E-mail: mcgarcia@uga.edu ISSN 0307-9457 (print)/ISSN 1465-3338 (online)//20001-02 # 2007 Houghton Trust Ltd DOI: 10.1080/03079450701216654 2 I. Oldoni and M. Garcı́a Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 04:01 07 October 2014 Isolaten unterschied sich nur in einem Muster von den CEO-Vakzinen; eine dritte Gruppe mit zwei Isolaten zeigte in nur einem Muster Unterschiede zur TCO-Vakzine; eine vierte Gruppe mit fünf Isolaten differierte in sechs bzw. neun Mustern von den CEO- und TCO-Vakzinen. Die Ergebnisse aus dieser Studie zeigen deutlich, dass die meisten Isolate (17 von 22) aus kommerziellen Hühnern mit den CEO-Vakzinestämmen eng verwandt waren. Es wurden jedoch auch in diesen Haltungen Isolate, die sich von den Vakzinestämmen unterschieden, nachgewiesen. Caracterización de aislamientos de virus de laringotraqueı́tis infecciosa (ILTV) de Estados Unidos mediante reacción en cadena de la polimerasa y polimorfismo de la longitud de los fragmentos de restricción (PCR-RFLP) de múltiples regiones del genoma. La laringotraqueı́tis infecciosa (ILT) es una enfermedad vı́rica aguda que afecta principalmente a pollos. Muchas áreas de producción avı́cola en todo Estados Unidos y en todo el mundo sufren pérdidas económicas atribuibles a ILT. A pesar de los esfuerzos realizados para el control de la enfermedad a través de vacunación, epidemias prolongadas de ILT continúan suponiendo una amenaza para la industria avı́cola. Estudios epidemiológicos y moleculares previos indicaron que los brotes en US estaban causados por virus relacionados con cepas vacunales. En este estudio, se utilizó la reacción en cadena de la polimerasa y polimorfismo de la longitud de los fragmentos de restricción (PCR-RFLP) de cuatro regiones del genoma para caracterizar 25 aislamientos procedentes de lotes de aves comerciales y familiares de US. Las combinaciones de patrones de PCR-RFLP clasificaron los virus de laringotraqueı́tis infecciosa (ILTV) en nueve grupos. Los aislamientos procedentes de lotes familiares se organizaron en tres grupos separados. La cepa de ILTV de referencia de USDA y la cepa vacunal derivada de cultivo tisular (TCO) se clasificaron en dos grupos separados. Veintidós aislamientos de aves comerciales se clasificaron en cuatro grupos: un grupo de seis aislamientos, mostró patrones idénticos a las vacunas derivadas de embriones de pollo (CEO); un segundo grupo de nueve aislamientos tan sólo se diferenció de las vacunas CEO por una banda; un tercer grupo formado por dos aislamientos se diferenció de las vacunas TCO por una banda; un cuarto grupo formado por cinco aislamientos se diferenció de las vacunas CEO y TCO por seis y nueve bandas respectivamente. Los resultados obtenidos en este estudio demostraron claramente que la mayorı́a de los aislamientos de aves comerciales (17 de 22 aislamientos) estaban relacionados estrechamente con las cepas vacunales CEO. Sin embargo, también se identificaron aislamientos distintos a las cepas vacunales en aves comerciales.