Mutations for Gaucher disease confer high susceptibility to Parkinson disease

ORIGINAL CONTRIBUTION Mutations for Gaucher Disease Confer High Susceptibility to Parkinson Disease Jun Mitsui, MD; Ikuko Mizuta, MD, PhD; Atsushi Toyoda, PhD; Ryo Ashida, BS; Yuji Takahashi, MD, PhD; Jun Goto, MD, PhD; Yoko Fukuda, PhD; Hidetoshi Date, PhD; Atsushi Iwata, MD, PhD; Mitsutoshi Yamamoto, MD, PhD; Nobutaka Hattori, MD, PhD; Miho Murata, MD, PhD; Tatsushi Toda, MD, PhD; Shoji Tsuji, MD, PhD Participants: Five hundred thirty-four patients with PD, 34 families in which multiple patients with PD are present, and 544 control subjects. ease, 11 nonsynonymous variants not associated with Gaucher disease, and 5 synonymous variants. Fifty patients with PD (9.4%) had 1 of the 11 pathogenic variants in the heterozygous state, whereas only 2 controls (0.37%) had such variants (odds ratio, 28.0). Among the pathogenic variants, R120W and L444P/RecNciI were highly prevalent, and each showed a significant association with PD. Furthermore, other rare pathogenic variants were found in 13 patients with PD but not in the controls, further confirming the role of these rare variants in the susceptibility to PD. Patients with PD carrying pathogenic variants were significantly younger than those not carrying them. In addition, concordance of PD states and pathogenic variants was observed in 8 multiplex families with PD. Main Outcome Measures: Disease status and GBA Conclusion: Heterozygous pathogenic variants in GBA Background: Increased frequency of pathogenic vari- ants in GBA, the causative gene for Gaucher disease, has been suggested to be associated with Parkinson disease (PD). Objectives: To conduct comprehensive resequencing of GBA to identify all sequence variants and to investigate the association of these variants with PD. Design: Case-control study. Setting: Multicenter university-based study. variations. Results: Comprehensive resequencing of GBA in 534 pa- tients with PD and 544 controls revealed 27 sequence variants: 11 pathogenic variants associated with Gaucher dis- Author Affiliations: Departments of Neurology, University of Tokyo Graduate School of Medicine (Drs Mitsui, Takahashi, Goto, Fukuda, Date, Iwata, and Tsuji), Juntendo University School of Medicine (Dr Hattori), and Musashi Hospital, National Center of Neurology and Psychiatry (Dr Murata), Tokyo, and Kagawa Prefectural Central Hospital, Takamatsu (Dr Yamamoto); Division of Clinical Genetics, Department of Medical Genetics, Osaka University Graduate School of Medicine, Suita, Osaka (Drs Mizuta and Toda and Mr Ashida); and Comparative Genomics Laboratory, National Institute of Genetics, Shizuoka (Dr Toyoda), Japan. Dr Murata is now with the National Center of Neurology and Psychiatry, Tokyo. confer a high risk for sporadic PD, even for familial clustering, and are associated with significantly earlier age at onset of disease. Arch Neurol. 2009;66(5):571-576 P ARKINSON DISEASE (PD), characterized by tremor, rigidity, bradykinesia, and postural instability, is the second most common neurodegenerative disease after Alzheimer disease, with usual onset in late adulthood, that is, after age 50 years. The prevalence See also pages 555 and 578 of PD is estimated to be 0.3% in the general population and 1% in individuals older than 60 years.1 Although SNCA, LRRK2, UCHL-1, PARK2, PINK1, and DJ-1 have been identified as the causative genes for familial PD,2 patients with PD with pathogenic mutations in these genes are rare. Most cases of PD are sporadic and the etiologies poorly understood. A populationbased study coupled with genealogic information demonstrated that the estimated risk ratio for PD in siblings of patients with (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 571 PD was significantly high (!s=6.7), which suggests that genetic factors substantially contribute to the development of sporadic PD.3 To elucidate susceptibility genes for sporadic PD, numerous case-control association studies using the analyses of single nucleotide polymorphisms have been conducted under the common disease–common variants hypothesis; however, only a few consistent findings have been observed. 4 Recently, polymorphisms of SNCA, a major component of Lewy bodies, a pathologic hallmark of PD, have been reported to be associated with sporadic PD (odds ratio [OR], 1.4-2.0).5,6 Several articles have suggested the association of sporadic PD with heterozygous variants in the glucocerebrosidase gene (GBA) (OMIM 606463) encoding the enzyme that is deficient in patients with Gaucher disease, an autosomal recessive lysosomal storage disease. Although GBA WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. Table 1. Demographic Data for Study Participants Tier 1 Variable Age at sampling, mean (SD), y Age at onset of PD, mean (SD), y Sex, male to female ratio Tier 2 Patients With PD (n=61) Control Subjects (n = 47) Patients With PD (n = 473) Control Subjects (n = 497) 66.8 (8.2) 58.3 (9.9) 1.44 58.4 (11.8) NA 1.76 65.2 (9.9) 58.2 (10.7) 1.08 43.4 (16.4) NA 1.12 Abbreviations: NA, not applicable; PD, Parkinson disease. Table 2. Primers for PCR and Sequence Analysis Primer PCR Exons 1-5 Exons 5-7 Exons 8-11 Sequence Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11 Forward Reverse CCTAAAGTTGTCACCCATAC GACCTCAAATGATATACCTG TGTGTGCAAGGTCCAGGATCAG AGCAGACCTACCCTACAGTTT AGTTTGGGAGCCAGTCATTT ACCACCTAGAGGGGAAAGTG TAGTGGATCCTCTATCCTTC AAAGGCAGCTAAGCCCTGCC AGTCTCTCCTAGCAGATGTG AAATGGTGTCAGTGATCACC GCAAGTGATAAGCAGAGTCC AATGGCTGAACCGGATGCAC TCAAGTGATCCACCTGCCTC TGTGTGCAAGGTCCAGGATCAG ACCCTTACCTACACTCTCTG GGGTGACTTCTTAGATGAGG GGAAGTGGGCTGAAGACAGC AAATTCCAGTGCCAGGATTC GCTACCAAAGGACTATGAGG TCCATGGTGATCACTGACAC GCAGAGTGAGATTCTGCCTC CAAGCAGACCTACCCTACAG AAGTGGAACTAGGTTGAGGG AGTTTGGGAGCCAGTCATTT GCTTCTGTCAGTCTTTGGTG GTGATGTAAGCCATCCGATG AGCTGAGAGTGTGATCCTGC TTAGTCACAGACAGCGTGT Abbreviation: PCR, polymerase chain reaction. variants associated with Gaucher disease are diverse and each carrier frequency is rare, most of the previous studies analyzed only specific variants7-16 and sample sizes were small.17-21 Therefore, ORs assessed for the GBA variants have been highly variable in the subsequent studies, making the medical implications of GBA variants associated with PD inconclusive. We conducted extensive resequencing analysis of GBA in patients with PD and in control subjects and found that GBA variants that are pathogenic for Gaucher disease confer high susceptibility to sporadic PD and, furthermore, familial clustering of PD. provided by the Japanese Parkinson Disease Susceptibility Gene Consortium. The diagnosis of PD was based on diagnostic criteria for PD.22 This study was approved by the institutional review boards of the participating institutions. GENOMIC DNA AND AMPLIFICATION OF GBA Genomic DNA was extracted from peripheral blood leukocytes using standard procedures. Three primer pairs were designed to selectively amplify GBA but not its pseudogene, as previously described (Table 2).23 RESEQUENCING OF TIER 1 METHODS SUBJECTS We conducted a resequencing of GBA in patients with PD and control subjects using a microarray-based, high-throughput resequencing system (first tier). As an independent data set, resequencing of GBA was conducted on large-scale samples (second tier) using direct nucleotide sequence analysis. The first tier comprised 61 unrelated patients with PD at the University of Tokyo Hospital and 47 controls provided by the Japan Multiple System Atrophy Research Consortium. The second tier comprised 473 unrelated patients with PD and 497 controls provided by the Japanese Parkinson Disease Susceptibility Gene Consortium (Table 1). In addition, 34 families in which multiple patients with PD are present (hereafter referred to as “multiplex families”) independent of participants in tiers 1 and 2, having more than 1 patient with PD in the second degree, were Resequencing of GBA was conducted using newly designed resequencing microarrays TKYPD02 and TKYPD03, both of which were composed of tiled sequences of all 11 exons of GBA and the flanking 12 base pairs of the splicing junctions.24 The analysis was conducted according to the manufacturer’s instructions (Affymetrix Inc, Santa Clara, California). All variants were further confirmed at direct nucleotide sequence analysis using a genetic analyzer (ABI PRISM 3100; Applied Biosystems Inc, Foster City, California). RESEQUENCING OF TIER 2 The polymerase chain reaction products were subjected to direct nucleotide sequence analysis for the coding sequences and the flanking splice sites of GBA using DNA analyzers (ABI3730xl; Applied Biosystems Inc). The primers for sequence analysis are given in Table 2. (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 572 WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. Table 3. Frequencies of the Pathogenic GBA Variants in Patients With PD and Control Subjects Variants Patients With PD (n=534) Control Subjects (n = 544) P Value a OR (95% CI) 15 1 4 1 1 1 2 8 14 1 2 50 (9.4) 0 0 0 0 0 0 0 0 2 0 0 2 (0.37) ".001 NA .06 NA NA NA .25 .004 .002 NA .25 6.9# 10−14 NA NA NA NA NA NA NA NA 7.3 (1.7-66.4) NA NA 28.0 (7.3-238.3) R120W R131C N188S R120W-N188R-V191G-S196P-F213I G193W F213I R329C L444P L444P-A456P-V460V (RecNciI) A456P-V460V R496C Total (%) Abbreviations: CI, confidence interval; NA, not applicable; OR, odds ratio; PD, Parkinson disease. a Fisher exact test. STATISTICAL ANALYSIS Standard statistical methods were used to test the difference in carrier frequency (Fisher exact test), to compute ORs and corresponding 95% confidence intervals, and to compare mean age at onset of PD (t test). For a meta-analysis, a pooled OR was calculated using a fixed-effects model (Mantel-Haenszel method). P".05 was considered statistically significant. Data were analyzed using commercially available statistical software (StatsDirect version 2.6.5; StatsDirect Ltd, Cheshire, England). RESULTS Resequencing of tier 1 (61 patients with PD and 47 controls) revealed that 6 patients with PD carried the variants (1 R120W, 1 R329C, 3 RecNciI, and 1 R496C) that are pathogenic for Gaucher disease, whereas none of these variants were present in the controls. Given this result, we further expanded the comprehensive resequencing analysis to tier 2 (473 patients with PD and 497 controls) and identified 44 patients with PD carrying the variants that have been reported to be pathogenic for Gaucher disease, whereas these variants were present in only 2 controls. Pathogenic variants were either single-base substitutions (R120W, R131C, N188S, G193W, F213I, R329C, L444P, and R496C) or complex multiple substitutions (R120W-N188R-V191G-S196P-F213I, L444P-A456PV460V, and A456P-V460V). The precise structures of the complex alleles were confirmed at nucleotide sequence analysis of the subcloned mutant alleles. Among the complex mutant alleles, L444P-A456P-V460V is a RecNciI allele, a recombination allele that consists of 3 singlebase substitutions of the pseudogene origin in exon 10.25 In summary, we found that 50 of 534 patients with PD (9.4%) had these pathogenic variants in the heterozygous state, whereas only 2 of 544 controls (0.37%) had such variants in the heterozygous state (OR [95% confidence interval] for patients with PD compared with controls, 28.0 [7.3-238.3], which was highly significant (P=6.9#10−14) (Table 3). When individual variants were analyzed, the frequency of the R120W, L444P, and RecNciI carriers was significantly higher in patients with PD than in controls (P " .001, .004, and .002, respectively). In addition, we identified 11 nonsynonymous variants and 5 synonymous variants in tiers 1 and 2, and none of these has been shown to be causative for Gaucher disease. When these variants were analyzed individually and in combination, the frequency of patients with PD was not significantly different from that of the controls (Table 4). We analyzed the clinical manifestations in the 50 patients with PD carrying pathogenic variants in GBA. The age at disease onset in the patients with PD who were carriers of such variants was significantly younger than in those who were not carriers (Table 5). Detailed clinical data were available for 49 of 50 patients with PD carrying pathogenic variants. Forty-one of 49 patients with PD (83.7%) showed good responsiveness to antiparkinsonian drug treatment. Iodine 123–labeled metaiodobenzylguanidine cardiac scintigraphy26 was carried out in 33 patients with PD, revealing that 29 of 33 patients with PD (87.9%) had reduced cardiac uptake, consistent with a diagnosis of PD. In the 49 patients with PD, 13 (26.5%) manifested overt dementia (clinical dementia rating27 $1) and 17 (34.7%) developed visual hallucinations during the course of the disease (mean [SD] interval between onset of PD and evaluation of dementia or visual hallucinations, 9.1 [4.1] and 7.9 [5.0] years, respectively). N-isopropyl-p-[ 123 I]iodoamphetamine single-photon emission computed tomography was performed in 15 patients with PD, of whom 8 had dementia. All 8 patients with dementia exhibited hypoperfusion in the occipital areas. In the 7 patients without dementia, 5 exhibited hypoperfusion in the occipital areas and 2 had normal findings. Detailed inquiry into the family history of the 50 patients with PD carrying pathogenic variants in GBA revealed that 11 patients (22.0%) had parents or siblings with PD. Genomic DNA was available for 3 affected siblings. All 3 affected siblings had the same GBA variants (2 R120W and 1 RecNciI) as did their probands. Given the concordant GBA variants in the 3 affected siblings, we analyzed probands of an additional 34 multiplex families independent of those in tiers 1 and 2 with more than 1 patient (parent or sibling) with PD. We found that 5 (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 573 WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. Table 4. Frequency of Nonpathogenic GBA Variants in Patients With PD and Control Subjects Variant Patients With PD (n=534) Control Subjects (n = 544) 77 1 0 0 1 4 1 1 0 1 1 0 1 2 11 4 90 15 66 b I(-20)V L(-15)F L67Q V121V D153N R163Q P299T G307S T334I L336L G344G F347L R359L V460V K466K I489V Nonsynonymous Synonymous 0 1 1 0 7 0 0 1 0 0 1 0 1 8 3 79 10 P Value a OR (95% CI) .28 NA NA NA NA .55 NA NA NA NA NA NA NA .62 .50 .72 .32 .32 1.2 (0.84-1.8) NA NA NA NA 0.58 (0.12-2.3) NA NA NA NA NA NA NA 2.0 (0.11-120.7) 1.4 (0.51-4.1) 1.4 (0.23-9.3) 1.2 (0.85-1.7) 1.5 (0.64-3.9) Abbreviations: CI, confidence interval; NA, not applicable; OR, odds ratio; PD, Parkinson disease. test. had I(−20)V in the homozygous state. a Fisher exact b One subject Table 5. Age at Onset of PD in Carriers and Noncarriers of the Pathogenic GBA Variants Variable Carriers of pathogenic GBA variants Carriers of R120W Carriers of L444P/RecNciI Noncarriers of pathogenic GBA variants A B C D E /w No. of Patients Age at Onset of PD, Mean (SD) P Value a 50 52.5 (7.4) ".001 15 22 484 51.8 (8.2) 52.6 (6.9) 58.8 (10.7) 0W 12 R .01 .007 NA /w W 20 R1 I/w i I/w ci c cN ecN R /w W 20 R1 /w /w W W 20 120 R R1 Re F w w P/ P/ 44 444 L /w W 20 L4 R1 G /w H I Abbreviations: NA, not applicable; PD, Parkinson disease. a t Test. of 34 probands (14.7%) had pathogenic variants in GBA (1 each, R120W, N188S, IVS6%1g&a, L444P, and RecNciI), and all 5 affected relatives also concordantly had the same GBA variants as did their probands. The splice junction mutation IVS6%1g&a is a novel variant that has not been reported even in patients with Gaucher disease; however, it is likely the pathogenic variant because it would affect splicing of intron 6. In total, 8 multiplex families with patients with PD concordantly carrying the pathogenic variants were identified (Figure). We compared the distributions of pathogenic variants in GBA in the 534 Japanese patients with PD (50 alleles) with those of the mutations that have been previously described in the 50 Japanese patients with Gaucher disease (100 alleles).28 R120W was present in 30% of the pathogenic variants in the patients with PD, whereas it was not described in patients with Gaucher disease. F213I was the second most common mutation in patients with Gaucher disease (14%), but it was present in only 2% of the pathogenic variants in patients with PD. In contrast, the frequency of L444P and RecNciI was comparable in the 2 groups, and these were the most common variants. I/w I/w ci ci cN ecN R Re /w w/w S 88 N1 /w w S/ 88 N1 g a> +1 6 VS I g a> +1 6 VS Figure. Pedigree charts for 8 families in which multiple patients with Parkinson disease are present. Squares indicate males; large circles, females; slash, deceased; solid square or large circle, affected individual; and small dot, individual with genomic DNA. COMMENT Multiple rare GBA variants that are responsible for Gaucher disease confer high risk for PD on the basis of the extensive resequencing of GBA of large data sets of Japanese patients with PD and controls. The combined carrier frequency of the pathogenic variants was as high as 9.4% in patients with PD and highly significantly more frequent than in controls (0.37%) with a markedly high OR (95% confidence interval) for patients with PD compared with controls (28.0 [7.3-238.3]). The frequency of nonneuronopathic and neuronopathic Gaucher disease in Japan is estimated to be 1 in 500 000 and 1 in 1 200 000 live births, respectively,29 which is in accord with the frequency of pathogenic variants in the controls (2 carriers per 544 individuals) in this study. (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 574 WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. Among the pathogenic variants identified in the patients with PD, R120W and L444P/RecNciI were highly prevalent. The identification of multiple rare variants that are pathogenic for Gaucher disease was achieved only by extensive resequencing of large data sets, as clearly demonstrated in the present study. For these pathogenic variants except R120W and L444P/RecNciI, the frequency of the individual variants was low in patients with PD, and the association with PD should be confirmed in much larger association studies. However, we observed these various rare pathogenic variants in 13 patients with PD, whereas such variants were not observed in the controls. These findings further strengthen the role of these rare GBA variants in susceptibility to PD as well. In contrast to the present findings, previous association studies demonstrated substantially variable ORs. In the studies that demonstrated a significant association of GBA variants with PD,7,11,13-17,20,21 N370S is the variant accounting for most of the significant association. N370S is highly prevalent in the Jewish population, with a carrier frequency of 4% to 6%,7,8,16,20 and that significant association of N370S with PD has not been demonstrated in other ethnic populations. In contrast to N370S, L444P/RecNciI has been found regardless of ethnic background. When previous studies that analyzed L444P/ RecNciI7,9-21 and the present study were subjected to metaanalysis (4181 patients with PD and 9587 controls), a high pooled OR (95% confidence interval) of 6.8 (4.011.8) for L444P/RecNciI was obtained without evidence of significant heterogeneity (Cochran Q=7.3; P=.88), further confirming the role of GBA variants in PD. However, previous studies with small sample sizes failed to detect controls carrying L444P/RecNciI,9,11,14,15,17-21 although L444P/RecNciI was detected in patients with PD. Thus, it is crucially important to determine the frequency of the GBA variants in the controls for accurate evaluation of ORs conferred by rare variants, necessitating the analysis of large data sets with at least several hundred patients and controls. Furthermore, there seems to be a bias in the distribution of sequence variants in GBA associated with PD compared with that observed in Gaucher disease. In most of the previous studies,7-16 however, only specific variants considered common in patients with Gaucher disease have been analyzed, which may have led to the underestimation of mutant GBA carrier frequency. Clinically, patients with PD with heterozygous pathogenic variants in GBA were significantly younger at disease onset than those without such variants, which confirms findings of previous studies.7,11,12,16,20 To further determine the exact effects of heterozygous GBA variants on PD phenotypes, extensive clinical and epidemiologic analyses should be conducted in large cohorts. In the present study, we identified 8 multiplex families with patients with PD concordantly having heterozygous pathogenic variants in GBA. Given the markedly high ORs caused by heterozygous pathogenic variants in GBA, it is conceivable that such variants underlie not only sporadic PD but also familial PD. The roles of the pathogenic variants in the pathogenesis of PD still needed to be elucidated. Gain of toxic functions of mutant glucocerebrosidase proteins indepen- dent of enzyme activities might be involved in the pathogenesis. However, all variants associated with PD are pathogenic variants for Gaucher disease, which raises the possibility that decrease in glucocerebrosidase activities has a role in the pathogenesis of PD. Identification of the splice junction mutation IVS6%1g&a in the present study may further support this notion. We should emphasize a paradigm shift from the common disease–common variants hypothesis to the common disease–multiple rare variants hypothesis in our search for disease susceptibility genes in sporadic PD, which may be applicable to studies of other diseases. The multiple rare variants can be identified only by extensive resequencing and are difficult to detect in association studies using common single nucleotide polymorphisms. Such multiple rare variants confer strong genetic risks, as demonstrated in the present study, which is also in striking contrast to the low ORs of those identified in genomewide association studies using common single nucleotide polymorphisms. Our results strongly emphasize the importance of conducting a comprehensive resequencing analysis of disease susceptibility genes in detecting even the rarest variants. In conclusion, we have established GBA as a robust and relatively prevalent genetic risk factor for sporadic PD. Further studies of the biological implications of mutant glucocerebrosidase in the pathophysiologic processes of PD are expected to provide new avenues for developing therapeutic measures for PD. Accepted for Publication: September 3, 2008. Correspondence: Shoji Tsuji, MD, PhD, Department of Neurology, University of Tokyo Graduate School of Medicine, 7-3-1 Hongo, Bunkyo-Ku, Tokyo 113-8655, Japan (tsuji@m.u-tokyo.ac.jp) or Tatsushi Toda, MD, PhD, Division of Clinical Genetics, Department of Medical Genetics, Osaka University, Graduate School of Medicine, 2-2-B9 Yamadaoka, Suita, Osaka 565-8071, Japan (toda@clgene.med.osaka-u.ac.jp). Author Contributions: Dr Mitsui had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Drs Mitsui and Mitzuta contributed equally to the study. Study concept and design: Mitsui, Mizuta, Takahashi, Goto, Date, Iwata, Toda, and Tsuji. Acquisition of data: Mitsui, Mizuta, Toyoda, Ashida, Takahashi, Goto, Yamamoto, Hattori, Murata, Toda, and Tsuji. Analysis and interpretation of data: Mitsui, Mizuta, Takahashi, Goto, Fukuda, Toda, and Tsuji. Drafting of the manuscript: Mitsui, Mizuta, Toyoda, Takahashi, Goto, Toda, and Tsuji. Critical revision of the manuscript for important intellectual content: Ashida, Takahashi, Goto, Fukuda, Date, Iwata, Yamamoto, Hattori, Murata, and Tsuji. Statistical analysis: Mitsui, Mizuta, and Fukuda. Obtained funding: Tsuji. Administrative, technical, and material support: Toyoda, Takahashi, Goto, Date, Yamamoto, Hattori, Murata, and Tsuji. Study supervision: Goto, Iwata, Toda, and Tsuji. Financial Disclosure: None reported. Funding/Support:This study was supported by KAKENHI (Grant-in-Aid for Scientific Research) on Priority Areas (Dr Tsuji), Applied Genomics (Dr Tsuji), the 21st Century COE Program “Center for Integrated Brain Medical (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 575 WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. Science” (Dr Tsuji), and Scientific Research (A) from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Dr Tsuji), by a Grant-in-Aid from the Research Committee of Ataxic Diseases and the Research Committee of CNS Degenerative Diseases of the Research on Measures for Intractable Diseases from the Ministry of Health, Labour, and Welfare of Japan (Dr Toda), and by grants from the Core Research for Evolutional Science and Technology of the Japan Science and Technology Agency and the Takeda Science Foundation (Dr Tsuji). Additional Contributions: The technical staff of the Sequencing Technology Team at RIKEN Genomic Sciences Center provided assistance; Hiroyuki Tomiyama, MD, PhD, and Taku Hatano, MD, PhD, collected the clinical information for the patients with Parkinson disease; and Yuko Nakabayashi, BS, provided technical help. REFERENCES 13. 14. 15. 16. 17. 18. 19. 20. 1. de Lau LM, Breteler MM. Epidemiology of Parkinson’s disease. Lancet Neurol. 2006;5(6):525-535. 2. Farrer MJ. Genetics of Parkinson disease: paradigm shifts and future prospects. Nat Rev Genet. 2006;7(4):306-318. 3. Sveinbjörnsdottir S, Hicks AA, Jonsson T, et al. Familial aggregation of Parkinson’s disease in Iceland. N Engl J Med. 2000;343(24):1765-1770. 4. Warner TT, Schapira AH. Genetic and environmental factors in the cause of Parkinson’s disease. Ann Neurol. 2003;53(suppl 3):S16-S25. 5. Mizuta I, Satake W, Nakabayashi Y, et al. Multiple candidate gene analysis identifies alpha-synuclein as a susceptibility gene for sporadic Parkinson’s disease. Hum Mol Genet. 2006;15(7):1151-1158. 6. Maraganore DM, de Andrade M, Elbaz A, et al; Genetic Epidemiology of Parkinson’s Disease (GEO-PD) Consortium. Collaborative analysis of alpha-synuclein gene promoter variability and Parkinson disease. JAMA. 2006;296(6):661670. 7. Aharon-Peretz J, Rosenbaum H, Gershoni-Baruch R. Mutations in the glucocerebrosidase gene and Parkinson’s disease in Ashkenazi Jews. N Engl J Med. 2004; 351(19):1972-1977. 8. Clark LN, Nicolai A, Afridi S, et al. Pilot association study of the betaglucocerebrosidase N370S allele and Parkinson’s disease in subjects of Jewish ethnicity. Mov Disord. 2005;20(1):100-103. 9. Sato C, Morgan A, Lang AE, et al. Analysis of the glucocerebrosidase gene in Parkinson’s disease. Mov Disord. 2005;20(3):367-370. 10. Toft M, Pielsticker L, Ross OA, Aasly JO, Farrer MJ. Glucocerebrosidase gene mutations and Parkinson disease in the Norwegian population. Neurology. 2006; 66(3):415-417. 11. Tan EK, Tong J, Fook-Chong S, et al. Glucocerebrosidase mutations and risk of Parkinson disease in Chinese patients. Arch Neurol. 2007;64(7):1056-1058. 12. Wu YR, Chen CM, Chao CY, et al. Glucocerebrosidase gene mutation is a risk 21. 22. 23. 24. 25. 26. 27. 28. 29. factor for early onset of Parkinson disease among Taiwanese. J Neurol Neurosurg Psychiatry. 2007;78(9):977-979. De Marco EV, Annesi G, Tarantino P, et al. Glucocerebrosidase gene mutations are associated with Parkinson’s disease in southern Italy. Mov Disord. 2008; 23(3):460-463. Spitz M, Rozenberg R, Pereira LdaV, Reis Barbosa E. Association between Parkinson’s disease and glucocerebrosidase mutations in Brazil. Parkinsonism Relat Disord. 2008;14(1):58-62. Mata IF, Samii A, Schneer SH, et al. Glucocerebrosidase gene mutations: a risk factor for Lewy body disorders. Arch Neurol. 2008;65(3):379-382. Gan-Or Z, Giladi N, Rozovski U, et al. Genotype-phenotype correlations between GBA mutations and Parkinson disease risk and onset. Neurology. 2008;70 (24):2277-2283. Lwin A, Orvisky E, Goker-Alpan O, LaMarca ME, Sidransky E. Glucocerebrosidase mutations in subjects with parkinsonism. Mol Genet Metab. 2004;81(1): 70-73. Eblan MJ, Nguyen J, Ziegler SG, et al. Glucocerebrosidase mutations are also found in subjects with early-onset parkinsonism from Venezuela. Mov Disord. 2006;21(2):282-283. Ziegler SG, Eblan MJ, Gutti U, et al. Glucocerebrosidase mutations in Chinese subjects from Taiwan with sporadic Parkinson disease. Mol Genet Metab. 2007; 91(2):195-200. Clark LN, Ross BM, Wang Y, et al. Mutations in the glucocerebrosidase gene are associated with early-onset Parkinson disease. Neurology. 2007;69(12):12701277. Bras J, Paisan-Ruiz C, Guerreiro R, et al. Complete screening for glucocerebrosidase mutations in Parkinson disease patients from Portugal [published online ahead of print December 19, 2007] Neurobiol Aging. doi:10.1016/j.neurobiolaging .2007.11.016. Bower JH, Maraganore DM, McDonnell SK, Rocca WA. Incidence and distribution of parkinsonism in Olmsted County, Minnesota, 1976-1990. Neurology. 1999; 52(6):1214-1220. Koprivica V, Stone DL, Park JK, et al. Analysis and classification of 304 mutant alleles in patients with type 1 and type 3 Gaucher disease. Am J Hum Genet. 2000; 66(6):1777-1786. Takahashi Y, Seki N, Ishiura H, et al. Development of a high-throughput microarraybased resequencing system for neurological disorders and its application to molecular genetics of amyotrophic lateral sclerosis. Arch Neurol. 2008;65(10): 1326-1332. Latham T, Grabowski GA, Theophilus BD, Smith FI. Complex alleles of the acid beta-glucosidase gene in Gaucher disease. Am J Hum Genet. 1990;47(1):7986. Orimo S, Ozawa E, Nakade S, Sugimoto T, Mizusawa H. (123)I-metaiodobenzylguanidine myocardial scintigraphy in Parkinson’s disease. J Neurol Neurosurg Psychiatry. 1999;67(2):189-194. Hughes CP, Berg L, Danziger WL, Coben LA, Martin RL. A new clinical scale for the staging of dementia. Br J Psychiatry. 1982;140:566-572. Eto Y, Ida H. Clinical and molecular characteristics of Japanese Gaucher disease. Neurochem Res. 1999;24(2):207-211. Ida H, Rennert OM, Kawame H, Maekawa K, Eto Y. Mutation prevalence among 47 unrelated Japanese patients with Gaucher disease: identification of four novel mutations. J Inherit Metab Dis. 1997;20(1):67-73. Announcement Visit www.archneurol.com. You can send an e-mail to a friend that includes a link to an article and a note if you wish. Links will go to short versions of articles whenever possible. (REPRINTED) ARCH NEUROL / VOL 66 (NO. 5), MAY 2009 576 WWW.ARCHNEUROL.COM Downloaded from www.archneurol.com at University of Washington, on May 13, 2009 ©2009 American Medical Association. All rights reserved. View publication stats