Hybridization Between Crocodylus Acutus and Crocodylus Moreletii In the Yucatan Peninsula: I. Evidence From Mitochondrial DNA and Morphology

JOURNAL OF EXPERIMENTAL ZOOLOGY 309A:661–673 (2008) A Journal of Integrative Biology Hybridization Between Crocodylus acutus and Crocodylus moreletii in the Yucatan Peninsula: I. Evidence From Mitochondrial DNA and Morphology JOSÉ ROGELIO CEDEÑO-VÁZQUEZ1, DAVID RODRIGUEZ2, SOPHIE CALMÉ1, JAMES PERRAN ROSS3, LLEWELLYN D. DENSMORE III2, 4 AND JOHN B. THORBJARNARSON 1 El Colegio de la Frontera Sur, Unidad Chetumal, Chetumal, Quintana Roo, Mexico 2 Department of Biological Sciences, Texas Tech University, Lubbock, Texas 3 Department of Wildlife Ecology and Conservation, University of Florida, Gainesville, Florida 4 Wildlife Conservation Society, Gainesville, Florida ABSTRACT The American crocodile (Crocodylus acutus) and the Morelet’s crocodile (C. moreletii) are broadly sympatric in Belize and Mexico. The presence of morphologically anomalous individuals in the overlapping range area suggests possible hybridization between these species. Analysis of 477 base pairs of the mitochondrial tRNAPro-tRNAPhe-Dloop region revealed the presence of pure C. acutus (N 5 43) and C. moreletii (N 5 56), as well as a high proportion of interspecific hybrids (N 5 17, 14.6%) in the Yucatan Peninsula, Mexico. Although all individuals could be assigned to one species or other based on phenotypic characters, some had been characterized as potential hybrids in the field by anomalous scale counts. The hybridization zone lies along the area of sympatry between C. acutus and C. moreletii investigated in this study, but extends further inland if hybrid localities from Belize are included. Hybridization in the Yucatan Peninsula is bidirectional, which indicates considerably more genetic contact between these species than previously recognized, and is probably more detrimental to the genetic integrity of smaller C. acutus populations. A more intensive study of the pattern of hybridization is warranted and supports continued classification of C. acutus as a critically threatened species in the Yucatan Peninsula. r 2008 Wiley-Liss, Inc. J. Exp. Zool. 309A:661–673, 2008. How to cite this article: Cedeño-Vázquez JR, Rodriguez D, Calmé S, Ross JP, Densmore III LD, Thorbjarnarson JB. 2008. Hybridization between Crocodylus acutus and Crocodylus moreletii in the Yucatan Peninsula: I. evidence from mitochondrial DNA and morphology. J. Exp. Zool. 309A:661–673. Effective programs for conserving endangered species require the identification of unambiguous management units that reflect evolutionarily important lineages (Avise, 2004) or specific evolutionarily significant units (ESUs) (Waples, ’95), and the elucidation of threats affecting those units. Crocodilians represent unique evolutionary lineages that are valued ecologically as keystone members of the faunal community (Hekkala, 2004). The crocodile specialist group has emphasized the need for information on population status and population genetic studies of threatened crocodilian species (Ross, ’98) like the r 2008 WILEY-LISS, INC. American crocodile (Crocodylus acutus) and Morelet’s crocodile (C. moreletii). The American crocodile occurs on the Atlantic and Pacific coasts from Mexico to northern South Grant sponsors: Consejo Nacional de Ciencia y Tecnologı́a (CONACYT Fellowship No. 192178); WWF-Education for Nature Program (Russell E. Train Fellowship, Grant Agreement No. RM37); Texas Tech University Graduate School. Correspondence to: J. Rogelio Cedeño Vázquez, El Colegio de la Frontera Sur, Av. Centenario Km 5.5, 77014 Chetumal, Q. Roo, Mexico. E-mail: rogeliocv@mexico.com,jcedeno@ecosur.mx Received 13 July 2007; Revised 12 May 2008; Accepted 17 May 2008 Published online 14 July 2008 in Wiley InterScience (www. interscience.wiley.com). DOI: 10.1002/jez.473 662 CEDEÑO-VÁZQUEZ ET AL. America, as well as in Cuba, Jamaica, Hispaniola (Haiti), and the southern tip of Florida, USA (Thorbjarnarson, ’89). Morelet’s crocodile occurs in the Atlantic and Caribbean lowlands of Mexico, Guatemala, and Belize (Ross, ’98). In the Yucatan Peninsula C. moreletii primarily occurs in fresh water habitats, whereas C. acutus is restricted to coastal mainland habitats and offshore islands (Platt and Thorbjarnarson, 2000a,b; Cedeño-Vázquez et al., 2006). However, both species are broadly sympatric in brackish-saline mangrove swamps in Mexico (Smith and Smith, ’77; CedeñoVázquez et al., 2006; Villegas, 2006) and Belize (Meerman, ’92; Platt and Thorbjarnarson, 2000a,b). Extensive hunting pressures from the 1930s–1960s led to drastic population decline in both species (Casas-Andreu and Guzmán-Arroyo, ’70; Charnock-Wilson, ’70; Ross, ’98). However, over the last 25 years with the cessation of most illegal skin hunting, populations of both species have entered a period of recovery (Ross, ’98). As a result, during the 1980s both species have been moved on the IUCN Red List (IUCN, 2007) from endangered to vulnerable (C. acutus) and species at lower risk, but still conservation dependent (C. moreletii). Both species still remain listed in Appendix I of CITES (2007). Accurate species identification in the field is necessary in biodiversity studies, conservation planning, and wildlife management (Sutherland, ’96). C. acutus and C. moreletii are morphologically similar and sometimes difficult to distinguish in the field, presenting problems for researchers conducting population surveys in areas where these species are sympatric. Platt and Rainwater (2005) presented a review of the morphological characters useful for distinguishing C. moreletii and C. acutus and stated that the best criterion for separating the two species in the field is the subcaudal scalation. Caudal irregularities in the proximal half of the tail may be present in both species; although, in C. acutus no more than three are generally present, and consist of one to three scales confined to the lateral surface (Fig. 1A). In C. moreletii caudal irregularities are more pronounced and are always found on, but not limited to, the ventral surface (Fig. 1B) (King and Brazaitis, ’71; Brazaitis, ’73; Ross and Ross, ’74). These irregularities consist of either a single scale or two to many scales arranged laterally. C. moreletii may also exhibit irregular scale groups on the lateral surface of the tail similar to those occurring in C. acutus, but these are always accompanied by ventral irregularities (Ross and Ross, ’74). Recent studies on the conservation status of both species in sympatric areas of Belize (Platt and Thorbjarnarson, 2000a,b) and Mexico (CedeñoVázquez et al., 2006) have used diagnostic characters described by Platt and Rainwater (2005) to identify captured individuals. In these two studies the presence of several anomalous individuals suggest possible hybridization between C. acutus and C. moreletii (Hekkala, 2004; Villegas, 2005; Cedeño-Vázquez et al., 2006), which has long been postulated (Ross and Ross, ’74; Ross and Mayer, ’83) based on the observation of crocodiles with morphological characteristics typical of both species (Schmidt, ’24; Powell, ’72; Abercrombie et al., ’80; Platt and Thorbjarnarson, ’97; Sigler, ’98). Fig. 1. Side and ventral views of caudal scalation in the proximal end of tail of Crocodylus acutus (A), and C. moreletii (B). Note the symmetrical appearance in C. acutus and the irregular shaped scale groups in C. moreletii. C. acutus specimen (RC132) captured on Bacalar Chico (see Appendix), a coastal mangrove wetland (Photo by Alejandro Franco). C. moreletii specimen (RC063) captured in Cobá Lake (see Appendix), an inland freshwater body (Photos by Pierre Charruau). J. Exp. Zool. 663 HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII Until the recent past, morphological data were considered sufficient to designate ESUs (e.g. Masters and Bragg, 2000), but when species hybridize these characters may become less useful as plasticity increases (Puorto et al., 2001). Molecular genetic tools have revolutionized the understanding of patterns of gene flow, hybridization, and introgression among taxonomic units. The recent development and use of molecular markers such as microsatellites from nuclear DNA, and mitochondrial DNA (mtDNA) has made identification of interspecific hybrids possible. Mitochondrial DNA is an especially useful portion of the genome because it is maternally inherited, and thus reveals patterns of female philopatry and population differentiation more quickly than nuclear DNA (Avise, 2004). Different portions of the mtDNA genome can be used for comparison at different hierarchical levels, because of mutational rate differences along the molecule (Brown, ’83; Parker et al., ’98). Most studies using mtDNA data sets have focused on phylogenetic questions, although numerous others have been centered on population structure of many vertebrates (e.g. Bowen et al., ’92; Baker et al., ’93; Ball et al., ’98) including crocodiles (Glenn et al., 2002). In addition, mitochondrial markers have been useful in the study of interspecific hybridization and introgression as they permit the identification of the maternal parental species in each cross (Karl et al., ’95; Barber et al., 2003; Seminoff et al., 2003; Hekkala, 2004; James et al., 2004; Ray et al., 2004; Lara-Ruiz et al., 2006). The purpose of this study is to identify genetically pure individuals of C. acutus and C. moreletii using mtDNA haplotypes and morphology and to demarcate the hybrid zone in the Yucatan Peninsula. This research will provide genetic tools to assist with crocodile management and conservation programs in this region. MATERIALS AND METHODS Sampling We conducted fieldwork following standard collection methods for crocodilians reported by Bayliss (’87) and King et al. (’94). Samples were collected from 2002 to 2005 as part of a continuing study on C. acutus and C. moreletii, in the state of Quintana Roo, Mexico. Sampling locations and habitats ranged from inland bodies of water to coastal and island areas. Additional samples from the states of Yucatan, Campeche, Veracruz, and Tamaulipas were also included. Sample sizes for each location or survey zone are indicated in Table 1. Crocodiles were spotted at night and captured by hand or with a noose. Species assignment was based on morphological characters outlined by Platt and Rainwater (2005). Individuals with anomalous characters were assigned to their own category, and the species that they most closely resembled was also noted. After recording standard measurements of total length, snout vent length, and scale characters, animals were marked TABLE 1. Haplotype distribution for mitochondrial tRNAPro-tRNAPhe-Dloop region sequences in Crocodylus acutus (N 5 51: CaA–C), and C. moreletii (N 5 64: CmA–D) Sample location Haplotype CaA CaB CaC CmA CmB CmC CmD CrH BCBR Cam ChB ChL (9) (3) (4) (10) 9 – – – – – – – – – – – 1 2 – – – – 1 – 3 – – – – – – – 10 – – – CL LN NE NL OL Oas Pro RH RLBR SKBR Tam Ver XP YBR (6) (1) (3) (7) (3) (4) (1) (10) (15) (20) (3) (2) (12) (3) Total – – – – 6 – – – – – – – 1 – – – – – – – 3 – – – 1 1 4 – – – – 1 – – 1 – 2 – – – – 1 – – 3 – – – – – – 1 – – – – – – – – 10 – – – 9 – – 6 – – – – 1 10 1 1 7 – – – – – – 2 – – 1 – – – – 1 1 – – – 1 4 4 – 3 – – – – – 3 – – – – – 21 16 14 11 50 2 1 1 CrH 5 Crocodylus rhombifer sequence. Sample sizes for each location or survey zone are indicated in parentheses: BCBR 5 Banco Chinchorro Biosphere Reserve, Cam 5 Campeche (Champotón and Chumpán rivers), ChB 5 Chetumal Bay, ChL 5 Chichancanab Lake, CL 5 Cobá Lake, LN 5 Laguna Negra, NE 5 Nueva España pond, NL 5 Nichupté Lake, OL 5 Ocom Lake, Oas 5 Oasis pond, Pro 5 Progreso, RH 5 Rı́o Hondo, RLBR 5 Rı́a Lagartos Biosphere Reserve (Rı́a Lagartos and Chipepté swamps), SKBR 5 Sian Ka’an Biosphere Reserve, Tam 5 Tamaulipas, Ver 5 Veracruz, XP 5 Xcalak Peninsula (Rı́o Huach, Santa Julia, Cementerio, and Bacalar Chico swamps), YBR 5 Yum Balam Reserve. J. Exp. Zool. 664 CEDEÑO-VÁZQUEZ ET AL. by clipping tail scutes, following a numbered code (Platt and Thorbjarnarson, ’97) used for markrecapture programs. Tail scutes from each marked animal were individually stored in 95% ethanol at 201C for DNA analysis. Laboratory procedures and data analysis Total genomic DNA was extracted from skin clips of 52 C. acutus and 64 C. moreletii individuals using the PUREGENE isolation kit (Gentra Systems, Minneapolis, MN). Extracted DNA was visualized on a Gel Logic 100 imaging system (Eastman Kodak Co., Rochester, NY) by staining 1.5% agarose gels with ethidium bromide. Partial sequences from the mitochondrial tRNAPro-tRNAPhe-Dloop region were used as molecular markers. Specifically, we sequenced an eight bp spacer, the complete tRNAPro gene (68 bp), a 10 bp spacer and the complete tRNAPhe gene (70 bp). Within the Dloop we sequenced domain I completely (112 bp) and domain II partially (209 bp) (Ray and Densmore, 2002). To amplify and sequence approximately 500 base pairs from the DNA samples we used primers L15459 (50 AGGAAAAGCGCTGGCCTTGTAA 30 ) (Glenn et al., 2002) and CR2HA (GGGGCCACT AAAAAACTGGGGGGA) modified from Ray and Densmore (2002). Thermal cycling conditions for PCR began with an initial denaturation step at 951C for 2 min followed by 33 cycles at 951C for 30 sec, 581C for 1 min and 721C for 45 sec. A final extension step was done at 721C for 7 min. Excess primers and remaining reagents were removed from final PCR fragments using the QIAGEN PCR purification kit (Qiagen Inc., Valencia, CA), and then cycle-sequenced using Big Dye v. 3.1 (Applied Biosystems Foster City, CA) following the manufacturer’s guidelines. Sequences were analyzed on an ABI 3100 Avant automated sequencer. Sequencher 3.1 (Gene Codes, Ann Arbor, MI) was used to edit and align chromatograms in the generation of bidirectionally verified sequences. Clustal X (Thompson et al., ’97) and Mega v. 3.1 (Kumar et al., 2004) were used to align edited sequences alongside C. rhombifer (accession number AF542539; FitzSimmons et al., 2002), C. porosus (accession number DQ273698), and C. niloticus (accession number AJ810452; Janke et al., 2005) sequences, available in GenBank NCBI (National Resource for Molecular Biology Information, http://www.ncbi.nlm.nih.gov/Genbank/). Data analyses consisted of identification of diagnostic species-specific mtDNA haplotypes and assessment J. Exp. Zool. of their distribution in purported hybrid individuals. We geographically mapped species and haplotype distributions, as well as hybrid zones using GPS coordinate data. A neighbor-joining distance-based tree bootstrapped with 1,000 replicates was generated in PAUP 4.0 (Swofford, 2002) using 477 bp alignments of mtDNA haplotypes. RESULTS Analysis of 477 bp from the tRNAPro-tRNAPheDloop region in comparison with individual morphological assignments revealed the presence of pure populations of C. acutus (N 5 43) and C. moreletii (N 5 56), as well as a high proportion of interspecific hybrids (N 5 16, 14%; Table 2). The numbers of haplotypes was very low in the populations of both species (Table 1, Fig. 2). Only three haplotypes were present in C. acutus, and four in C. moreletii, including individuals from the states of Veracruz and Tamaulipas (Fig. 3). The three C. acutus haplotypes and two of the four C. moreletii haplotypes (those present in the sympatric zone in the study area) were present in hybrid crocodiles (see Appendix); thus, indicating that hybridization is bidirectional, and occurs more or less in the same proportion in each direction. Among morphologically C. acutus individuals (N 5 52), eight crocodiles carried C. moreletii haplotypes (3CmA, 5CmB; see Appendix), and one individual (sample RC51) carried a C. rhombifer haplotype (CrH). Eight of 64 individuals morphologically identified as C. moreletii had C. acutus haplotypes (4 CaA, 1 CaB, 3 CaC; see Appendix). All haplotypes were deposited in GeneBank under the accession numbers EU499907–EU499909 (C. acutus), EU499911–EU499914 (C. moreletii), and EU499910 (C. rhombifer). All sampled individuals could be assigned to either C. acutus or C. moreletii based on their general appearance and morphological characters; although, some crocodiles had been characterized as potential hybrids in the field by the presence of anomalous scale counts (see footnotes in Table 2). More than half (53%) of detected hybrids exhibited normal phenotypes (see notes in Table 2), and were captured in their typical habitat according to their morphological assignment. For instance, C. acutus phenotypic hybrids RC133, RC137, and RC134 were captured in saline to hypersaline water (41–82 parts per thousand). On the contrary, C. moreletii phenotypic hybrids RC021, RC024, RC105, and RC168 were found in 665 HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII TABLE 2. Identification of diagnostic sites within the 477 bp fragment of the mitochondrial tRNAPro-tRNAPhe-Dloop region used for hybrid detection Samples Position of nucleotide change (32 bp) N 5 116 4 6 7 8 0 8 3 1 6 0 1 6 1 1 6 4 1 7 5 1 9 3 1 9 7 1 9 9 2 0 0 2 0 1 2 0 6 2 0 7 2 0 8 2 0 9 2 1 1 2 1 2 2 1 3 2 1 4 2 1 5 2 1 6 2 1 7 2 1 8 2 1 9 2 2 0 2 5 1 2 5 5 2 7 5 3 3 6 C. acutus N 5 28 N 5 15 RC0061 RC0102 RC0112 RC0211 RC0241 RC1051 RC1681 RC2092 A T A T G G G T T T C G A C A G A T A T A T G T A C C A T T T T



C


























































































































































































































































































C. moreletii N 5 56 RC0143 RC0164 RC1085 RC1153 RC1336 RC1346 RC1376 RC2113 G C G C A A A C C C A A C A G A T A T A T G T A C T A C C C C C































































































































































































































































C. rhombifer AF542539 – – – – – A G C C C C A A C A G A T A T A T G T A C C A T C T T RC516 A C G T A


























C. acutus sequences (N 5 43); C. moreletii sequences (N 5 56); C. rhombifer sequence (AF542539). Samples RC 5 hybrids (N 5 17) based on haplotype assignments (see Appendix). Superscripts 1–6 assigned to each hybrid indicate the species they mostly resembled and the observed caudal scalation pattern. 1 Phenotypically normal C. moreletii, numerous irregular subcaudal scale groups present. 2 General appearance of C. moreletii, but irregular subcaudal scale groups very reduced in number. 3 Phenotypically normal C. acutus, but exhibiting one irregular scale confined to lateral surface of tail. 4 General appearance of C. acutus, but two irregular subcaudal scale groups present, as well as three and four irregular scale groups on the lateral surfaces of tail. 5 Phenotypically normal C. acutus, but exhibiting two irregular scale groups on each lateral surface of tail. 6 Phenotypically normal C. acutus, no subcaudal scale groups. freshwater. The hybridization zone between C. acutus and C. moreletii in the Yucatan Peninsula lies along the American crocodile mainland range sampled in this study (Fig. 4). Surprisingly, we detected for the first time in the Mexican Caribbean the presence of an interspecific hybrid between a female C. rhombifer (endemic to Cuba) and a male C. acutus (RC51; Fig. 2) with C. acutus phenotype (see notes in Table 2, and Appendix). DISCUSSION In this study we identified a significant proportion of hybrids between C. acutus and C. moreletii. Regarding the occurrence of C. rhombifer haplo- type in our study area, we do not know if the interspecific mating event took place in situ or in Cuba (the later implies that the hybrid animal came to the Yucatan), because there is no data on the frequency of hybrids in Cuba or gene flow between C. acutus from Cuba and Mexico (see Weaver et al., 2008). Hybridization within the genus Crocodylus has been identified among several species, mostly in captivity (FitzSimmons et al., 2002). It is not known whether such hybridization events in the wild are common or rare, what contributes to them, or the geographic limits of the phenomenon (Hekkala, 2004). Previous genetic evidence of hybridization in wild populations of C. acutus and C. moreletii has only J. Exp. Zool. 666 CEDEÑO-VÁZQUEZ ET AL. Fig. 2. Neighbor-joining tree produced from a 477 bp alignment of unique tRNAPro-tRNAPhe-Dloop region haplotypes. Species groups are indicated by bars and haplotypes are labeled for each clade. Geographic locations of each haplotype are shown in Table 1 and Figure 3. Numbers at nodes indicate bootstrap values above 50% (1,000 replicates). Haplotypes were compared with available sequences of C. porosus, C. rhombifer, and C. niloticus. been reported by Ray et al. (2004) and Hekkala (2004) in Belize. The presence of hybrids in Belize is the result of crosses between male C. moreletii and female C. acutus according to mitochondrial and nuclear markers; in addition, hybrid individuals are fertile (Hekkala, 2004; Ray et al., 2004). However, hybridization in the Mexican part of the Yucatan Peninsula has occurred bidirectionally, because hybrids with C. moreletii haplotypes were discovered in our study. It is possible that initial hybridizations between the pure parental species were all unidirectional (e.g. female C. acutus  male C. moreletii) and through backcrossing produced hybrids with both C. acutus and C. moreletii haplotypes. This would indicate that some level of hybridization and introgression has always, at least periodically, occurred where the two species are sympatric. This hybridization is also typical of species’ interactions promoted by anthropogenic factors (Rhymer and Simberloff, ’96), such as hunting, incidental capture in fishing nets, translocations, habitat destruction and fragmentation. Understanding whether hybridization is a natural phenomenon or is owing to anthropogenic factors is important in developing conservation strategies (DeSalle and Amato, 2004). Fig. 3. Map of C. acutus (black triangles), and C. moreletii (white dots) haplotypes. Pie charts (circular 5 C. moreletii; hexagon–shaped 5 C. acutus) indicate haplotype frequency in each sampling locality or geographic region. J. Exp. Zool. HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII Fig. 4. Map of hybrid locations, triangles and circles correspond to C. acutus and C. moreletii haplotypes, respectively. Locations in Belize indicate where hybrids were found by Ray et al. (2004). Individuals with species-specific mtDNA genetic markers that contradict morphological assignments suggest that introgression is occurring in Mexico, as observed in Belize (Hekkala, 2004; Ray et al., 2004). Morphological identities based on subcaudal scale arrangements are diagnostic characters for identifying each species (Platt and Rainwater, 2005), but reliable species identification in hybrid zones is complicated by cryptic hybrids. In this study, likewise in Ray et al. (2004), several hybrid individuals did not exhibit anomalous morphological characters, which could be explained by backcrossing between the initial hybrids and parental species. This could erase most of the phenotypic characters passed from the ancestor while allowing the haplotype to remain intact through maternal transmission (Ray et al., 2004). In these cases the use of bi-parentally inherited markers and model-based analyses may help estimate the proportion of admixture in an individual or classify the type of hybrid (see Rodriguez et al., 2008). The hybridization zone between C. acutus and C. moreletii in this study lies throughout the range of the former species, but is extended further inland into both Mexico and Belize if hybrid 667 localities from Ray et al. (2004; Fig. 4) and all individuals of admixed ancestry reported by Rodriguez et al. (2008) are included. For the most part, detected hybrids were located in coastal areas; therefore, the greatest management concern may be introgression by C. moreletii into the C. acutus populations as stated by Ray et al. (2004). The high frequency of C. acutus and C. moreletii hybrids in the sympatric zone on the Yucatan Peninsula (Hekkala, 2004; Ray et al., 2004; this study) suggests that hybridization in the wild is more common than previously expected (Arnold, ’97), as also observed in some species of marine turtles (James et al., 2004; Lara-Ruiz et al., 2006). Species-specific breeding mechanisms and a subsequent breakdown in these mechanisms that in turn allow hybridization are most likely related to behavior, breeding seasons, and geography. Hybridization is frequently unidirectional (Wirtz, ’99) because hybrids arise from mating between males of a larger species and females of the smaller species, because large females rarely choose small males (Grant and Grant ’97). Even though C. acutus can reach a total length of 6 m versus 3.5 m in C. moreletii (Ross and Magnusson ’89), we still observed two-way hybridization. We hypothesize that the absence or low density of conspecific breeding males (especially C. acutus) during the courtship period in sympatric areas may drive breeding females to choose males of the other species for mating. Crocodilians display elaborate courtship behaviors (Garrick and Lang, ’77; Lang, ’87; Magnusson et al., ’89; Vliet, ’89, 2001); and many observers believe that these behaviors involve elements of female choice based on the size and vigor of the male suitor, and may also assist in species recognition. Many crocodilians also have precise seasonal coordination of breeding and nesting. In Cuba, the breeding season of sympatric C. acutus and C. rhombifer are asynchronous and may serve to limit the amount and direction of hybridization (Ramos et al., ’94). In the Yucatan Peninsula, C. acutus nests from April to July (Platt et al., 2004; P. Charruau, unpublished data) and C. moreletii from June to September (J.R. Cedeño-Vázquez, personal observation), from which we infer somewhat offset breeding seasons for these species. Crocodilians also display different nesting modes and a degree of site fidelity for nesting sites. Morelet’s crocodiles make mound nests that tend to be widely distributed in freshwater wetlands; whereas, American crocodiles dig hole nests in J. Exp. Zool. 668 CEDEÑO-VÁZQUEZ ET AL. localized sandy locations near the coast where they congregate after undertaking seasonal movements of sometimes several km (Alonso-Tabet and Rodriguez-Soberón, ’98). In addition to these factors, natural disasters such as hurricanes and coastal development along the sandy beaches ideal for C. acutus nesting may have displaced recurrently or permanently breeding C. acutus females to the mainland; thus, favoring mating with C. moreletii males earlier to the onset of the C. moreletii female breeding condition (Hekkala, 2004). Conservation implications There are several critical conservation issues that must be considered in light of our findings and those of previous studies (Hekkala, 2004; Ray et al., 2004). We conclude that hybridization between C. acutus and C. moreletii is occurring along the entire sympatric zone in the Yucatan Peninsula. Hybridization occurs in two directions, and hence indicates considerably more genetic contact between these species than was previously recognized (Hekkala, 2004; Ray et al., 2004). Nevertheless, according to mitochondrial sequences (Ray et al., 2004) and microsatellite analysis (Rodriguez et al., 2008), pairwise genetic distances return two distinct species groups. Taken together these data suggest that C. moreletii and C. acutus are separate and distinct ESUs. C. moreletii has been considered one of the least endangered crocodilians currently listed in Appendix I of CITES (Platt and Thorbjarnarson, 2000a; Ray et al., 2004); however, because hybridization is occurring, it may be that genetically pure C. moreletii in the eastern Yucatan Peninsula are rarer than previously assumed. Following this concern, Ray et al. (2004) suggested that the species should not be removed from Appendix I until the degree of interspecific genetic contact has been accurately assessed. Our results support this statement for populations found in the eastern Yucatan Peninsula. Given the rarity of C. acutus in the Yucatan, for which encounter rates are much lower than those for C. moreletii (Platt and Thorbjarnarson, 2000a,b; Cedeño-Vázquez et al., 2006), conservation efforts should be directed toward this species. The invasion by C. moreletii into coastal areas (Platt and Thorbjarnarson, 2000b; Villegas, 2006) occupied by C. acutus and the resulting hybridization is of greatest concern. An additional potential threat to pure populations is presented by the J. Exp. Zool. occurrence of C. rhombifer haplotype in Mexico (see Table 1 and Appendix, Weaver et al., 2008), which may result in additional genetic dilution of C. acutus. Conservation of wild crocodilian populations will require genetic identification of pure populations (Stafford et al., 2003) and subsequent efforts to vigorously protect and manage these populations (Ray et al., 2004). More information is required about interspecific behavioral interactions between sympatric species of crocodilians (Lang, ’87). Further studies on habitat availability and breeding strategies are also needed to aid in identifying ecological mechanisms responsible for hybridization. For many years, commercial crocodile farms have been involved in captive breeding programs, which now have produced several generations of hybrid crocodiles. This approach has been used because there appears to be neither decreased hybrid fitness nor evidence of hybrid dysgenesis in the progeny of hybrid animals. Regarding skin quality and size, hybrids between C. porosus and C siamensis grow fast, reach large sizes, and are vigorous (J. Thorbjarnarson, personal observation). In this study, all hybrids between C. moreletii and C. acutus with C. moreletii haplotypes were found in estuarine environments (Fig. 4), which may suggest that increased salt tolerance is being imparted to these hybrids. Measures of growth rate, number of hatchlings, and survival rate in conjunction with genetic identification can possibly elucidate these effects. Nursery areas for hatchling C. acutus are further threatened by anthropogenic usage and alteration of estuarine environments near coastal developments (Hekkala, 2004). The recent documentation of ongoing hybridization, along with previous data on the loss of nesting and nursery habitat in addition to already low population densities of C. acutus in coastal zones (Platt and Thorbjarnarson, 2000b; Cedeño-Vázquez et al., 2006) all together suggest that a more intensive study of hybridization is warranted. These threats support the continued classification of C. acutus as an endangered species in the Yucatan Peninsula. ACKNOWLEDGMENTS J. R. C. V. thanks Consejo Nacional de Ciencia y Tecnologı́a (CONACYT) and the WWF-Education for Nature Program for providing doctoral fellowships (CONACYT fellowship No. 192178; WWF Russell E. Train Fellowship grant agreement No. RM37); El Colegio de la Frontera Sur for the HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII facilities in their graduate schools; and Texas Tech University; Oscar Moreno and his laboratory staff at Centro de Investigación Cientı́fica de Yucatán (CICY) for training and advice for processing part of the samples for this research; the personnel from the Secretarı́a de Marina (Sector Naval Chetumal), and all the volunteers who participated during fieldwork. D. R. thanks Robert Bradley for the use of equipment, Dnate Baxter, and John Hanson for assistance with laboratory work, and Michael Forstner for assistance with data analyses. Pierre Charruau, Yadira Gómez, 669 Paulina Bustamante, Jerónimo Domı́nguez, Pablo Beutelspacher, and Felipe Be provided complementary tissue samples from the states of Quintana Roo, Yucatán, Campeche, Veracruz, and Tamaulipas. We thank Mathew Shirley and two anonymous reviewers for their helpful suggestions and comments to previous versions of this manuscript. This research was developed under the sampling permit SGPA/DGVS/08539 and CITES exporting certificate MX 31441 (NRA: CFSTB2300411) issued by Secretarı́a de Medio Ambiente y Recursos Naturales (SEMARNAT). APPENDIX Sample numbers (ID), including morphological assignment (Morph), mitochondrial (mtDNA) assignment (Haplotype), total length (TL) in cm, sex, species status assignments, locations, and GPS coordinate data. C.a. 5 C. acutus, C.m. 5 C. moreletii, CrH 5 C. rhombifer haplotype. The acronyms in parentheses following location name, correspond to those represented in Figure 3. ID Morph Haplotype RC006 RC008 RC010 RC011 RC013 RC014 RC015 RC016 RC021 RC022 RC023 RC024 RC027 RC033 RC034 RC039 RC040 RC042 RC046 RC047 RC048 RC049 RC051 RC052 RC054 RC056 RC057 RC058 RC059 RC061 RC062 RC063 RC066 RC067 RC069 RC070 RC073 C.m. C.a. C.m. C.m. C.a. C.a. C.m. C.a. C.m. C.a. C.a. C.m. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. CaA CaA CaA CaA CaA CmA CmA CmA CaC CaC CaC CaC CaA CaA CaA CaA CaA CaA CaA CaA CaA CaB CrH CaC CaC CaC CaA CaC CmB CmB CmB CmB CmB CmB CmB CmB CmB TL 108.5 176.5 145.0 172.5 82.0 124.0 220.0 87.0 – 233.0 183.0 24.0 172.0 200.0 193.0 188.0 116.6 183.8 152.0 134.3 135.9 191.0 158.0 176.0 85.7 99.0 114.0 286.0 235.0 72.0 79.5 106.5 193.0 104.5 200.0 150.0 135.0 Sex Assignment Location Latitude ~ ~ # # ~ # # ~ – – – – # # # ~ # # # # # ~ ~ ~ ~ # ~ # # # # # ~ # # # # Hybrid C. acutus Hybrid Hybrid C. acutus Hybrid C. moreletii Hybrid Hybrid C. acutus C. acutus Hybrid C. acutus C. acutus C. acutus C. acutus C. acutus C. acutus C. acutus C. acutus C. acutus C. acutus Hybrid C. acutus C. acutus C. acutus C. acutus C. acutus C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii Rı́a Lagartos (RLBR) Chipepté (RLBR) Rı́a Lagartos (RLBR) Rı́a Lagartos (RLBR) Rı́a Lagartos (RLBR) Chipepté (RLBR) Rı́a Lagartos (RLBR) Chipepté (RLBR) Yum Balam (YBR) Yum Balam (YBR) Yum Balam (YBR) Chetumal Bay (ChB) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Cayo Centro (BCBR) Nichupté Lake (NL) Nichupté Lake (NL) Nichupté Lake (NL) Nichupté Lake (NL) Nichupté Lake (NL) Nichupté Lake (NL) Nichupté Lake (NL) Cobá Lake (CL) Cobá Lake (CL) Cobá Lake (CL) Cobá Lake (CL) Cobá Lake (CL) Cobá Lake (CL) Rı́o Hondo (RH) Rı́o Hondo (RH) Chichancanab Lake (ChL) 21.5949000 21.4839700 21.5871300 21.5871300 21.5871300 21.4857700 21.5932400 21.4899600 21.3997500 21.4371667 21.4831333 18.8723560 18.5737849 18.5737849 18.5737849 18.5737849 18.5737849 18.5737849 18.5737849 18.5737849 18.5737849 21.1347842 21.1323417 21.1225090 21.1112540 21.1121400 21.1323410 21.1409517 20.4910960 20.4876700 20.4876700 20.4876700 20.4876700 20.4876700 17.9200405 17.9318944 19.8901370 Longitude 88.08060000 87.48397000 88.04649000 88.04649000 88.04649000 87.55162000 88.05617000 87.55124000 87.17165000 87.18550000 87.18585000 88.07397560 87.32103370 87.32103370 87.32103370 87.32103370 87.32103370 87.32103370 87.32103370 87.32103370 87.32103370 86.75067290 86.75485660 86.75378000 86.76154000 86.76345000 86.75486000 86.78063420 87.73569000 87.72755000 87.72755000 87.72755000 87.72755000 87.72755000 88.85584470 88.85203240 88.76832000 J. Exp. Zool. 670 CEDEÑO-VÁZQUEZ ET AL. ID Morph Haplotype RC074 RC075 RC077 RC078 RC079 RC080 RC083 RC085 RC087 RC091 RC093 RC102 RC103 RC105 RC106 RC107 RC108 RC109 RC110 RC111 RC112 RC113 RC114 RC115 RC116 RC117 RC122 RC129 RC130 RC132 RC133 RC134 RC135 RC136 RC137 RC138 RC139 RC140 RC141 RC142 RC149 RC150 RC151 RC156 RC159 RC160 RC165 RC166 RC167 RC168 RC171 RC172 RC173 RC174 RC175 RC176 RC177 RC179 C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.m. C.a. C.a. C.m. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.a. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. CmB CmB CmB CmB CmB CmB CmB CmB CmB CmB CmA CmB CmB CaC CaB CaB CmB CaB CaB CaB CaB CmB CaB CmB CmB CaB CaA CaB CaB CaB CmB CmB CaC CaC CmB CaB CaB CaC CaC CaA CmB CmB CmB CmB CmB CmB CmB CmB CmB CaB CmB CmB CmB CmB CmB CmB CmB CmB J. Exp. Zool. TL 158.0 95.0 110.0 103.0 124.0 175.0 127.0 152.0 129.0 70.0 46.5 124.0 98.0 163.0 279.0 87.0 180.0 165.0 213.0 132.0 137.5 167.0 197.0 101.0 99.0 153.0 188.0 81.5 196.0 154.0 141.0 124.3 118.0 167.0 95.5 177.5 100.0 257.0 134.0 170.0 – – – 80.0 231.0 73.6 126.0 145.0 93.0 178.5 109.0 164.0 133.0 153.0 115.0 193.0 111.3 188.0 Sex Assignment Location Latitude ~ ~ ~ # ~ # ~ ~ # – ~ # ~ ~ # ~ ~ # ~ ~ ~ # ~ # # # # ~ # # # # # # # # # # ~ # ~ # # ~ # # ~ # ~ # ~ # ~ # # # # # C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii Hybrid C. acutus C. acutus Hybrid C. acutus C. acutus C. acutus C. acutus C. moreletii C. acutus Hybrid C. moreletii C. acutus C. acutus C. acutus C. acutus C. acutus Hybrid Hybrid C. acutus C. acutus Hybrid C. acutus C. acutus C. acutus C. acutus C. acutus C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii Hybrid C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Chichancanab Lake (ChL) Muyil (SKBR) Muyil (SKBR) Chunyaxché (SKBR) Ocom Lake (OL) Ocom Lake (OL) Ocom Lake (OL) Boca Paila (SKBR) Boca Paila (SKBR) Boca Paila (SKBR) Playón (SKBR) Punta Allen (SKBR) Punta Allen (SKBR) Punta Allen (SKBR) Vigı́a Grande (SKBR) Vigı́a Grande (SKBR) Vigı́a Grande (SKBR) Vigı́a Grande (SKBR) Vigı́a Grande (SKBR) Chipepté (RLBR) Canal Monjas (SKBR) Bacalar Chico (XP) Bacalar Chico (XP) Santa Julia (XP) Santa Julia (XP) Bacalar Chico (XP) Bacalar Chico (XP) Rı́o Huach (XP) Cementerio (XP) Bacalar Chico (XP) Bacalar Chico (XP) Cementerio (XP) Santa Julia (XP) Nueva España (NE) Nueva España (NE) Nueva España (NE) Chetumal Bay (ChB) Chetumal Bay (ChB) Chetumal Bay (ChB) Oasis (Oas) Oasis (Oas) Oasis (Oas) Oasis (Oas) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) Rı́o Hondo (RH) 19.8974630 19.9008080 19.9052810 19.9197860 19.9305985 19.9485438 19.7819021 19.7817666 20.0642800 20.0706350 20.0706347 19.4617080 19.4617089 19.4680370 20.0316660 20.0420800 20.0420800 19.8235860 19.8012240 19.7905750 19.7767260 19.6275460 19.6196170 19.6190910 19.6156120 19.6156120 21.4760300 20.1118580 18.2071530 18.2110580 18.3563880 18.3485130 18.2085290 18.1807100 18.4304995 18.2504790 18.1882550 18.1954840 18.2547700 18.3485130 18.2480800 18.2480800 18.2480800 18.8723560 18.8687040 18.7536580 18.8502430 18.8502430 18.8502430 18.8502430 17.9345110 17.9548150 17.9773300 17.9806540 17.9936450 18.0641140 18.1970580 18.4124830 Longitude 88.76835000 88.76968400 88.76973000 88.77087400 88.76908270 88.75950010 88.73735450 88.73549210 87.59682000 87.60659000 87.60658960 88.09537500 88.09537610 88.07990000 87.49448400 87.50614000 87.50614000 87.49397000 87.48248000 87.47657000 87.47851600 87.67380000 87.68181000 87.68013000 87.68008000 87.68008000 87.53765000 87.52167500 87.85234000 87.84251000 87.80526000 87.81280500 87.84812000 87.85636000 87.77189280 87.84663400 87.86063000 87.85293000 87.84693000 87.81280500 89.05089000 89.05089000 89.05089000 88.07397560 88.05047600 88.19215000 87.81175000 87.81175000 87.81175000 87.81175000 88.84854000 88.80893000 88.78564500 88.78480500 88.78488000 88.71874000 88.66950000 88.53040000 HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII ID Morph Haplotype RC182 RC184 RC185 RC192 RC196 RC197 RC198 RC199 RC201 RC202 RC205 RC206 RC208 RC209 RC210 RC211 RC212 RC213 RC214 RC215 RC217 C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.m. C.a. C.a. C.m. C.m. C.m. C.a. C.a. C.a. C.m. C.m. C.a. C.m. CmC CmB CmC CmA CmA CmD CmA CmB CmB CaB CaC CmB CmA CaA CaA CmA CaA CmA CmA CaA CmB TL 32.8 75.0 50.0 33.7 189.0 80.1 199.0 197.0 90.2 250.0 – 134.0 150.0 145.0 64.3 157.3 146.0 223.5 187.0 – 145.0 Sex Assignment Location Latitude # # # – # ~ # ~ ~ ~ – ~ ~ ~ # # ~ # # # ~ C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. moreletii C. acutus C. acutus C. moreletii C. moreletii Hybrid C. acutus Hybrid C. acutus C. moreletii C. moreletii C. acutus C. moreletii Champotón river (Cam) Chumpán river (Cam) Chumpán river (Cam) Delicias (Tam) Rı́o Corona (Tam) Xicotencatl (Tam) Bahı́a Cochinos (Ver) Catemaco lake (Ver) Laguna Negra (LN) Canal Monjas (SKBR) Boca Paila (SKBR) Pulticup (SKBR) Progreso (Pro) Rı́a Lagartos (RLBR) Chipepté (RLBR) Chipepté (RLBR) Chipepté (RLBR) Rı́a Lagartos (RLBR) Rı́a Lagartos (RLBR) Canal Pinos (SKBR) Chichancanab Lake (ChL) 19.3050610 18.1536420 18.3322222 23.9333333 23.9397000 22.9825000 20.8480910 18.4017900 18.7678816 20.0330520 20.0408650 19.1316667 21.2800000 21.6036500 21.4842400 21.4806812 21.4779010 21.5915100 21.5955800 20.1913280 19.7819021 LITERATURE CITED Abercrombie CL, Davidson D, Hope CA, Scott DE. 1980. Status of Morelet’s crocodile (Crocodylus moreletii) in Belize. Biol Conserv 17:103–113. Alonso-Tabet M, Rodriguez-Soberón R. 1998. Observations on nesting behavior of Crocodylus acutus. Crocodile Spec Group Newsl 17:11–13. Arnold ML. 1997. Natural hybridization and evolution. Oxford series in ecology and evolution. New York, NY: Oxford University Press. Avise JC. 2004. Molecular markers, natural history, and evolution, 2nd edition. Sunderland, MA: Sinauer Assoc Inc. Baker CS, Perry A, Bannister JL, Weinrich MT, Abernethy RB, Calambokidis J, Lien J, Lambertsen RH, Ramirez JU, Vasquez O, Clapham PJ, Alling A, O’Brien SJ, Palumbi SR. 1993. Abundant mitochondrial DNA variation and worldwide population structure in humpback whales. Proc Natl Acad Sci USA 90:8239–8243. Ball Jr RM, Freeman S, Jam FC, Bermingham E, Avise JC. 1998. Phylogeographic population structure of red-winged blackbirds assessed by mitochondrial DNA. Proc Natl Acad Sci USA 85:1558–1562. Barber RC, Fontaine CT, Flanagan JP, Louis Jr EE. 2003. Natural hybridization between a Kemp’s Ridley (Lepidochelys kempii) and Loggerhead sea turtle (Caretta caretta) confirmed by molecular analysis. Chelonian Conserv Biol 4:701–704. Bayliss P. 1987. Survey methods and monitoring within crocodile management programmes. In: Webb GJW, Manolis SC, Whitehead PJ, editors. Wildlife management: crocodiles and alligators. Sydney, Australia: Surrey Beaty and Sons Pty Ltd. p 157–175. Bowen BW, Meylan AB, Ross JP, Limpus CJ, Balazs GH, Avise JC. 1992. Global population structure and natural history of the green turtle (Chelonia mydas) in terms of matriarchal phylogeny. Evolution 46:865–881. 671 Longitude 90.68945600 91.50290200 91.51305560 98.43333330 98.95718800 98.78888889 97.24460100 95.06617200 88.48374290 87.49356000 87.50149500 87.56500000 89.65000000 88.13467000 87.53606000 87.53723420 87.54473000 88.05455000 88.06915000 87.50891300 88.73735450 Brazaitis P. 1973. The identification of living crocodilians. Zoologica 58:59–88. Brown WM. 1983. Evolution of animal mitochondrial DNA. In: Nei M, Koehn RK, editors. Evolution of genes and proteins. Sunderland, MA: Sinauer Assoc Inc. p 62–88. Casas-Andreu G, Guzmán-Arroyo M. 1970. Estado actual de las investigaciones sobre cocodrilos mexicanos. Instituto Nacional de Investigaciones Biol Pesq, Serie Divulgación. Boletı́n 3:1–50. Cedeño-Vázquez JR, Ross JP, Calmé S. 2006. Population status and distribution of Crocodylus acutus and C. moreletii in southeastern Quintana Roo, Mexico. Herpetol Nat Hist 10:17–29. Charnock-Wilson J. 1970. Manatees and crocodiles. Oryx 10: 236–238. CITES. 2007. Appendices I, II and III. Valid from 13 September 2007. Available via DIALOG. http://www.cites. org/eng/app/e-appendices.pdf. Cited November 27, 2007. DeSalle R, Amato G. 2004. The expansion of conservation genetics. Nature 5:702–712. FitzSimmons N, Buchan N, Lam JC, Polet PV, Hung G, Thang TT, Quoc N, Gratten J. 2002. Identification of purebred Crocodylus siamensis for reintroduction in Vietnam. J Exp Zool 294:373–381. Garrick L, Lang JW. 1977. Social signals and behavior of adult alligators and crocodiles. Am Zool 17:225–239. Glenn TC, Staton JL, Vu AT, Davis LM, Alvarado-Bremer JR, Rhodes WE, Brisbin Jr IL, Sawyer RH. 2002. Low mitochondrial DNA variation among American alligators and a novel non-coding region in crocodilians. J Exp Zool 294:312–324. Grant PR, Grant BR. 1997. Mating patterns of Darwin’s finch hybrids determined by song and morphology. Biol J Linnean Soc 60:317–343. Hekkala ER. 2004. Conservation genetics at the species boundary: case studies from African and Caribbean croco- J. Exp. Zool. 672 CEDEÑO-VÁZQUEZ ET AL. diles (Genus: Crocodylus). Dissertation, Columbia University, New York. IUCN. 2007. 2007 IUCN Red List of Threatened Species. Available via DIALOG. http:// www.iucnredlist.org. Cited November 27, 2007. James MC, Martin K, Dutton PH. 2004. Hybridization between a green turtle, Chelonia mydas, and loggerhead turtle, Caretta caretta, and the first record of a green turtle in Atlantic Canada. Can Field-Nat 118:579–582. Janke A, Gullberg A, Hughes S, Aggarwal RK, Arnason U. 2005. Mitogenomic analyses place the gharial (Gavialis gangeticus) on the crocodile tree and provide pre-K/T divergence times for most crocodilians. J Mol Evol 61:620–626. Karl SA, Bowen BW, Avise JC. 1995. Hybridization among the ancient mariners: characterization of marine turtle hybrids with molecular genetic assays. J Hered 86: 262–268. King WF, Brazaitis P. 1971. Species identification of commercial crocodilian skins. Zoologica 56:15–70. King WF, Hutton J, Manolis C, Miller J, Jelden D, McNamara K, Rodrı́guez M, Ross JP, Saalfeld K, Velasco A, Webb GJW, Woodward A. 1994. Guidelines on monitoring crocodilian populations. In: Proceedings of the 2nd. Regional Meeting (Eastern Asia, Oceania and Australasia) of the Crocodile Specialist Group, Species Survival Commission/IUCN, Australia. p 1–3. Kumar S, Tamura K, Nei M. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5:150–163. Lang JW. 1987. Crocodilian behaviour: implications for management. In: Webb GJW, Manolis SC, Whitehead PJ, editors. Wildlife management: crocodiles and alligators. Sydney, Australia: Surrey Beatty and Sons Pty Ltd. p 273–294. Lara-Ruiz P, López GG, Santos FR, Soares LS. 2006. Extensive hybridization in hawksbill turtles (Eretmochelys imbricata) nesting in Brazil revealed by mtDNA analyses. Conserv Genet 7:773–781. Magnusson WE, Vliet KA, Pooley AC, Whitaker R. 1989. Reproduction. In: Ross, CA, editor. Crocodiles and alligators. New York, NY: Facts on File Inc. p 118–135. Masters JC, Bragg NP. 2000. Morphological correlates of speciation in bush babies. Int J Primatol 21:793–813. Meerman JC. 1992. The status of crocodiles in the eastern Corozal district. Occas Pap Belize Nat Hist Soc 1:1–5. Parker PT, Snow AA, Schug MD, Booton GC, Fuerst PA. 1998. What molecules can tell us about populations: choosing and using a molecular marker. Ecology 79:361–382. Platt SG, Rainwater TR. 2005. A review of morphological character useful for distinguishing Morelet’s crocodile (Crocodylus moreletii) and American crocodile (Crocodylus acutus) with an emphasis on populations in the coastal zone of Belize. Bull Chic Herpetol Soc 40:25–29. Platt SG, Thorbjarnarson JB. 1997. Status and life history of the American Crocodile in Belize. Belize Coastal Zone Management Project BZE/92/G31. Report to United Nations Development Program, Global Environmental Facility, Belize City, Belize. Platt SG, Thorbjarnarson JB. 2000a. Population status and conservation of Morelet’s crocodile, Crocodylus moreletii, in northern Belize. Biol Conserv 96:21–29. Platt SG, Thorbjarnarson JB. 2000b. Status and conservation of the American crocodile, Crocodylus acutus, in Belize. Biol Conserv 96:13–20. J. Exp. Zool. Platt SG, Rainwater TR, Nichols S. 2004. A recent population assessment of the American crocodile (Crocodylus acutus) in Turneffe Atoll, Belize. Herpetol Bull 89:26–32. Powell J. 1972. The Morelet’s crocodile: an unknown quantity. Anim Kingdom 1972:21–26. Puorto G, Salomão MG, Theakston RDG, Thorpe RS, Warrell DA, Wüster W. 2001. Combining mitochondrial DNA sequences and morphological data to infer species boundaries: phylogeography of lanceheaded pit vipers in the Brazilian Atlantic forest, and the status of Bothrops pradoi (Squamata: Serpentes: Viperidae). J Evol Biol 14:527–538. Ramos R, de Buffrenil V, Ross JP. 1994. Current status of the Cuban crocodile, Crocodylus rhombifer, in the wild. In: Crocodiles, Proceedings of the 12th Working Meeting of the Crocodile Specialist Group, IUCN—The World Conservation Union. Gland, Switzerland. p 113–140. Ray DA, Densmore LD. 2002. The crocodilian mitochondrial control region: general structure, conserved sequences and evolutionary implications. J Exp Zool 294:334–345. Ray DA, Dever JA, Platt SG, Rainwater TR, Finger AG, McMurry ST, Batzer MA, Barr B, Stafford PJ, McKnight J, Densmore LD. 2004. Low levels of nucleotide diversity in Crocodylus moreletii and evidence of hybridization with C. acutus. Conserv Genet 5:449–462. Rhymer JM, Simberloff D. 1996. Extinction by hybridization and introgression. Annu Rev Ecol Syst 27:83–109. Rodriguez D, Cedeño-Vázquez JR, Forstner MRJ, Densmore III LD. 2008. Hybridization between Crocodylus acutus and Crocodylus moreletii in the Yucatan Peninsula: II. Evidence from microsatellites. J Exp Zool 309A:674–686. Ross JP. 1998. Crocodiles. Status survey and conservation action plan, 2nd edition. IUCN/SSC Crocodile Specialist Group Publ.,Oxford: Oxford Press. Ross CA, Magnusson WE. 1989. Living crocodilians. In: Ross CA, editor. Crocodiles and alligators. New York, NY: Facts on File, Inc. p 58–73. Ross FD, Mayer GC. 1983. On the dorsal armor of the Crocodilia. In: Rhodin AGJ, Miyata K, editors. Advances in herpetology and evolutionary biology: essays in honor of Ernest E. Williams. Cambridge, MA: Museum Comp Zool. p 305–331. Ross CA, Ross FD. 1974. Caudal scalation of central American Crocodylus. Proc Biol Soc Wash 87:231–234. Schmidt KP. 1924. Notes on central American crocodiles. Fieldiana 12:79–92. Seminoff JA, Karl SA, Schwartz T, Resendiz A. 2003. Hybridization of the green turtle (Chelonia mydas) and hawksbill turtle (Eretmochelys imbricata) in the Pacific Ocean: indication of an absence of gender bias in the directionality of crosses. Bull Marine Sci 73:643–652. Sigler L. 1998. A Crocodylus acutus with the appearance of a C. moreletii. Crocodile Spec Group Newsl 173:9–11. Smith HM, Smith RB. 1977. Synopsis of the herpetofauna of Mexico. Guide to the Mexican amphisbaenians and crocodilians. Vol. 5, North Bennington, VT: John Johnson Natural History Books. Stafford PJ, McMurry ST, Rainwater TR, Ray DA, Densmore LD, Barr B. 2003. Morelet’s crocodile (Crocodylus moreletii) in the Macal River watershed, Maya Mountains, Belize. Herpetol Bull 85:15–23. Sutherland WJ. 1996. The twenty commonest censusing sins. In: Sutherland WJ, editor. Ecological census techniques: HYBRIDIZATION BETWEEN C. ACUTUS AND C. MORELETII a handbook. Cambridge: Cambridge University Press. p 317–318. Swofford DL. 2002. PAUP: phylogenetic analysis using parsimony (and other methods). Beta version 4.0. Sunderland, MA: Sinauer Assoc Inc. Thompson J, Gibson T, Plewniak F, Jeanmougin F, DJ. 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882. Thorbjarnarson JB. 1989. Ecology of the American crocodile (Crocodylus acutus). In: Hall PM, editor. Crocodiles. Their ecology, management, and conservation. Gland, Switzerland: IUCN—The World Conservation Union. p 228–258. Villegas A. 2005. Phenotypic characteristics of Crocodylus acutus and C. moreletii in south Quintana Roo. Crocodile Spec Group Newsl 24:8–9. Villegas A. 2006. Record of Morelet’s crocodile in coastal lagoons in south Quintana Roo. Crocodile Spec Group Newsl 25:8–9. Vliet KA. 1989. Social displays of the American alligator (Alligator mississippiensis). Am Zool 29:1019–1031. 673 Vliet KA. 2001. Courtship behaviour of American alligators (Alligator mississippiensis). In: Grigg GC, Seebacher F, Franklin CE, editors. Crocodilian biology and evolution. Chipping Norton: Surrey Beatty and Sons Pty Ltd. p 383–408. Waples RS. 1995. Evolutionarily significant units and the conservation of biological diversity under the Endangered Species Act. In: Nielsen JL, editor. Evolution and aquatic ecosystem: defining unique units in population conservation. American fisheries society symposium. Vol. 17. p 8–27. Weaver JP, Rodriguez D, Venegas-Anaya M, Cedeño-Vázquez JR, Forstner MRJ, Densmore III LD. 2008. Genetic characterization of captive Cuban crocodiles (Crocodylus rhombifer) and evidence of hybridization with the American crocodile (Crocodylus acutus). J Exp Zool 309A:649–660. Wirtz P. 1999. Mother species–father species: unidirectional hybridization in animals with female choice. Anim Behav 58:1–12. J. Exp. Zool.