Identification, virulence factors characterization, pathogenicity and aggressiveness analysis of Fusarium spp., causing wheat head blight in Iran Nima Khaledi, Parissa Taheri & Mahrokh Falahati Rastegar European Journal of Plant Pathology Published in cooperation with the European Foundation for Plant Pathology ISSN 0929-1873 Volume 147 Number 4 Eur J Plant Pathol (2017) 147:897-918 DOI 10.1007/s10658-016-1059-7 1 23 Your article is protected by copyright and all rights are held exclusively by Koninklijke Nederlandse Planteziektenkundige Vereniging. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”. 1 23 Author's personal copy Eur J Plant Pathol (2017) 147:897–918 DOI 10.1007/s10658-016-1059-7 Identification, virulence factors characterization, pathogenicity and aggressiveness analysis of Fusarium spp., causing wheat head blight in Iran Nima Khaledi & Parissa Taheri & Mahrokh Falahati Rastegar Accepted: 27 September 2016 / Published online: 7 October 2016 # Koninklijke Nederlandse Planteziektenkundige Vereniging 2016 Abstract Fusarium head blight (FHB), mainly caused by Fusarium graminearum species complex (FGSC) and also by other species of this genus, is one of the most destructive cereal diseases with high yield losses and mycotoxin contamination worldwide. The aim of this study was to identify Fusarium species, characterize their virulence factors such as trichothecene genotypes and cell wall degrading enzymes (CWDEs), and also investigate virulence of the isolates obtained from wheat plants with FHB symptoms in Golestan province of Iran. Among 41 isolates tested, 24 were F. graminearum sensu stricto (s.s.), six were F. proliferatum, four were F. culmorum, three isolates belonged to each of F. subglutinans and F. meridionale species and one isolate of F. asiaticum was identified. Among Fusarium isolates, the nivalenol (NIV) genotype could be found more frequently, followed by 3acetyl deoxynivalenol (3-ADON) and 15-acetyl deoxynivalenol (15-ADON) genotypes. Production of trichothecenes in autoclaved rice cultures was analyzed by gas chromatography (GC) and confirmed by GC–MS. The mean levels of NIV, 3-ADON and 15-ADON produced by Fusarium spp. were 824, 665 and 622 μg kg−1, respectively. All Fusarium isolates were capable of producing CWDEs, mainly cellulase and xylanase. Lipase and pectinase activities appeared later and at less quantities. In overall, the isolates FH1 of F. graminearum and FH8 of F. proliferatum showed the maximum activity of N. Khaledi : P. Taheri (*) : M. Falahati Rastegar Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of Mashhad, P.O.Box: 91775-1163, Mashhad, Iran e-mail: p-taheri@um.ac.ir CWDEs, which was correlated with high level of their virulence and aggressiveness on wheat. On the other hand, correlation was observed between the level and type of trichothecene produced by each isolate and its virulence on wheat. Virulence of trichothecene producing isolates was higher than that of non-trichothecene producing isolates. Our results suggested that CWDEs and trichothecenes, as virulence factors, have considerable roles on virulence and aggressiveness of the pathogen. This is the first report on the effect of trichothecenes and CWDEs on virulence and aggressiveness of Fusarium spp. associated with FHB disease in wheat growing regions of Iran. Keywords Fusarium spp . Head blight . Trichothecenes . Cellwalldegradingenzymes . Virulence Introduction Wheat (Triticum aestivum L.) is one of the major cereal crops and a major source of human food worldwide. The genus Fusarium has a global distribution and many species in the genus are phytopathogenic fungi infecting a wide range of crop plants including cereals such as wheat, maize, oat and barley (Boutigny et al. 2011). Fusarium contamination is a major agricultural problem, which significantly reduce grain yield and quality. More importantly, many species in the genus Fusarium produce mycotoxins that inhibit protein synthesis and cause several health problems in humans and animals (Pestka 2010). Author's personal copy 898 The FHB, also called ear blight or scab, is economically one of the most important fungal diseases of wheat (Spanic et al. 2010). In recent years, the crop losses in Iran due to FHB increased significantly (Haratian et al. 2008; Davari et al. 2013). The causal agents of this destructive disease are several Fusarium species, especially F. graminearum species complex (FGSC) and F. culmorum (Boutigny et al. 2014; Jennings et al. 2004; Nicholson et al. 2007). However, the spectrum of Fusarium spp. involved in the disease varies at a local or regional level depending on weather conditions especially during wheat anthesis (Oerke et al. 2010). To date, 16 species have been identified and formally described within the FGSC (Van der Lee et al. 2015). During the infection process, Fusarium spp. are able to produce different mycotoxins such as trichothecenes, zearalenone and fumonisins. Among them, trichothecenes are considered to be the most important ones (Kimura et al. 2007). Trichothecenes are a large group of sesquiterpenoid fungal metabolites, which are demonstrated as virulence factors in wheat-Fusarium interactions (Proctor et al. 1995). Increased trichothecene accumulation is associated with higher level of fungal virulence (Gardiner et al. 2010). Trichothecene biosynthetic gene (Tri) clusters have been characterized in FGSC and F. sporotrichioides (Proctor et al. 2009; Brown et al. 2002). In both species, the cluster consists of 12 genes that are involved in the biosynthesis, regulation or transport of trichothecenes. These genes are: Tri 5 (encoding a terpene synthase); Tri 4, Tri 11 and Tri 13 (encoding cytochrome P450 monooxygenases); Tri 3 and TRI7 (encoding acetyl transferases), Tri 8 (encoding an esterase), Tri 6 and Tri 10 (proposed to be regulatory genes) and Tri 12 (encoding a transporter). They have been classified into four types (A, B, C, and D) based on structural features (Chaudhary et al. 2011). Among type B-trichothecenes, deoxynivalenol (DON), NIV, and their acetylated derivatives 3-ADON, 15-ADON, and 4-acetylnivalenol (4ANIV, syn. fusarenone-X) are those having a significant impact on human and animal health (Pasquali and Migheli 2014). Different trichothecenes have various toxicological properties (Van der Lee et al. 2015). DON is associated with feed refusal, vomiting and suppressed immune functions in consumers, while NIV is more toxic to humans and domestic animals compared to DON (Ryu et al. 1988). Trichothecenes also are potent phytotoxins, Eur J Plant Pathol (2017) 147:897–918 with DON being more phytotoxic than NIV (Desjardins 2006). Only a hydroxyl group at C-4 in NIV distinguishes it from DON. However, these chemotype differences may have important fitness consequences for the fungus, as differences in the pattern of oxygenation and acetylation can alter the bioactivity and toxicity of trichothecenes (Alexander et al. 1998). Three strain-specific profiles of trichothecene chemotypes have been identified within the Btrichothecene lineage of Fusarium: (i) DON and 3acetyldeoxynivalenol (3-ADON chemotype); (ii) DON and 15-acetyldeoxynivalenol (15-ADON chemotype); or (iii) NIV, its acetylated derivatives and low levels of DON (NIV chemotype) (Ward et al. 2002). On the other hand, in some sources the DON chemotype may exists which includes Fusarium species producing 3-ADON and 15-ADON (Pasquali and Migheli 2014; Miller et al. 1991). Substantial geographic variation in Fusarium spp. and trichothecene chemotype diversity have been observed (Miller 2002; Nielsen et al. 2012; Ward et al. 2008; Yli-Mattila et al. 2009). All chemotypes may be present in the same geographical location; however, only one is predominant. In cereals infected with Fusarium, the DON chemotype was found worldwide but presence of other chemotypes is restricted to geographically specific regions (Qiu and Shi 2014). The 3-ADON chemotype is dominant in Russian Far East (Yli-Mattila and Gagkaeva 2010), Norway (Aamot et al. 2015), northern Japan (Suga et al. 2008), Canada (Ward et al. 2008) and northern Europe and has recently been spreading from Finland to the north west of Russia (Talas et al. 2011; Yli-Mattila et al. 2009). While, the 15ADON chemotype is dominant in central and southern Europe (Yli-Mattila et al. 2013), northern China (Ji et al. 2007; Zhang et al. 2007), south Africa (Boutigny et al. 2011), Brazil (Scoz et al. 2009), Argentina (Alvarez et al. 2011; Reynoso et al. 2011), southern Russia (YliMattila et al. 2009) and the mid-west of USA (Gale et al. 2007). In Asia, NIV chemotype is the most commonly found type of trichothecene (Gale et al. 2007; Zhang et al. 2007). Chemotype occurrence seems to be temperature dependent, the 15-ADON chemotype occurs in cooler regions of China, whereas the NIV chemotype occurred in warmer regions (Zhang et al. 2007). There is also evidence for shifts in trichothecene chemotypes of Fusarium. In China, DON strains are displacing NIV strains (Suga et al. 2008; Zhang et al. 2010). In North America, where for many years 15-ADON was the most prevalent chemotype found in wheat (Schmale et al. Author's personal copy Eur J Plant Pathol (2017) 147:897–918 2012), a shift from 15-ADON to 3-ADON occurred in the last decade. In Russian Far East a shift from 15ADON to 3-ADON chemotype has been found (YliMattila and Gagkaeva 2010). The 3-ADON chemotype has been found to grow more quickly and to produce more trichothecenes and conidia than the 15-ADON chemotype (Ward et al. 2008). So far, little is known about trichothecene chemotypes in different regions of Iran. Among the Fusarium isolates, NIV, 3-ADON and 15-ADON chemotypes were detected from different fields of Mazandaran and Golestan provinces in the northern region of Iran (Haratian et al. 2008; Malihipour et al. 2012), while 15-ADON was the only chemotype detected among the isolates collected from fields of Ardabil province in the north west of Iran (Davari et al. 2013; Malihipour et al. 2012). The knowledge of mechanisms involved in virulence of Fusarium spp. on wheat is very limited till now. Fungal pathogens belonging to the genus Fusarium have no specialized structures for penetration into plant cell and enters the host via natural openings (Pritsch et al. 2000), or penetrates the epidermal cell walls directly with short infection-hyphae (Wanyoike et al. 2002). Fusarium spp. are able to penetrate and invade a host with the help of secreted CWDEs. Production of CWDEs also enables the pathogen to penetrate, grow and infect through the plant tissue (Kikot et al. 2009a). Various CWDEs such as cellulase, xylanase, pectinase and lipase could be produced by F. graminearum during infection of wheat spikes (Ortega et al. 2013). On the other hand, once the infection is established, mycotoxins are released and they interfere with the metabolism, physiologic processes and structural integrity of the host cell (Wagacha and Muthomi 2007). Trichothecenes are considered as virulence factors during plant infection (Pasquali and Migheli 2014). In wheat, the mycotoxin appears to be necessary for fungal passage from infected florets into the rachis from where it can further colonize the head (Jansen et al. 2005). Trichothecenes are also associated with the pathogen aggressiveness (Bai et al. 2002; Foroud and Eudes 2009). These mycotoxins are inhibitors of the protein translational apparatus (Pestka 2007) and have elicitorlike activity in stimulating plant defence and cell death (Desmond et al. 2008; Nishiuchi et al. 2006). Studies on a strain of F. graminearum with mutation in the Tri5 gene encoding a DON biosynthetic enzyme revealed that F. graminearum strains unable to produce DON was less aggressive in both wheat and barley (Boddu 899 et al. 2007; Langevin et al. 2004). So, it is suggested that DON and other trichothecenes are involved in virulence by enabling pathogen spread within a spike, but they are not required for initial infection (Bai et al. 2002). In wheat and barley, trichothecene accumulation is associated with aggressiveness of the fungal pathogen (Gardiner et al. 2010). Reduced aggressiveness of NIV chemotype compared to DON chemotypes, may be due to the lower phytotoxicity of NIVon wheat (Eudes et al. 1997). These findings indicate that fitness and aggressiveness of FHB pathogens change with different chemotypes. The main objectives of this study were to: (i) identify and determine the frequencies of Fusarium spp. isolated from wheat plants with FHB symptoms, (ii) investigate trichothecene chemotypes, (iii) evaluate activities of CWDEs such as cellulase, xylanase, pectinase and lipase which are involved in the infection process of FHB pathogens on host plant, and (iv) characterize virulence factors, pathogenicity and aggressiveness of Fusarium spp. and identify possible correlation. So, we mainly described variability of Fusarium spp. isolates associated with wheat head blight under various perspectives, which are directly or indirectly correlated with pathogenicity. Materials and methods Sample collection Forty-one isolates of Fusarium spp. were collected from different wheat grain samples of various wheat cultivars with symptoms such as ear blight and bleached grains on ears in several regions of Golestan province in Iran during the 2014 growing season (Fig. 1). Isolation and morphological identification of Fusarium species For isolation of Fusarium spp., the grains were surface sterilized by immersion in 1 % sodium hypochlorite for 3 min, and then rinsed three times in sterile distilled water. The sterilized samples were placed in water agar as a general medium and a semi-selective medium for Fusarium, i.e., peptone- pentachloronitrobenzene agar (PPA), and incubated at 25 °C in a 12 h light/dark cycle for 10 days. The resulting Fusarium colonies were single-spored and transferred to potato dextrose agar Author's personal copy 900 Eur J Plant Pathol (2017) 147:897–918 Fig. 1 Geographic locations of Fusarium species isolates obtained from wheat-growing regions in the Golestan province of Iran. Sampling was performed of gray areas. ● F. graminearum; ■ F. culmorum; ○ F. proliferatum; □ F. meridionale; ♦ F. subglutinans; × F. asiaticum (PDA), carnation leaf agar (CLA) (Fisher et al. 1982) and spezieller nährstoffarmer agar (SNA) plates for morphological identification (Leslie and Summerell 2006). Fusarium species were identified on the basis of macroscopic characteristics such as pigmentations and growth rates on PDA plates, as well as their microscopic features including size of macroconidia, presence of microconidia and chlamydospores in cultures grown on SNA and CLA (Leslie and Summerell 2006). available DNA extraction kit (Genomic DNA isolation kit IV; DENA Zist Asia, Iran) according to the manufacturer’s instructions. DNA concentration was quantified with a NanoDrop spectrophotometer and the quality was verified by 1 % agarose gel electrophoresis. The DNA samples were diluted using sterilized distilled water with final concentration of 50 ng μL−1 and stored at −20 °C until use. Isolation of fungal genomic DNA Species identification and trichothecene genotype determination by PCR Mycelial plugs (0.5 cm2) were picked up from PDA plates and transferred into bottles containing 100 ml potato dextrose broth (PDB) medium in 250 mL Erlenmeyer flasks, then incubated at 25 °C for 10 days. Mycelial mats were dried between sterile filter papers and ground to a fine powder with liquid nitrogen. Total genomic DNA was extracted with a commercially To confirm the morphological identification of species, conventional PCR was performed using specific primers (Table 1) for molecular identification of seven Fusarium species, which may potentially infect wheat kernels in the investigated area. The PCR reaction was performed in a 25 μl volume, each reaction contained 7.5 μL of sterile water, 12.5 μL of PCR Master Mix (Pars Tous, Author's personal copy Eur J Plant Pathol (2017) 147:897–918 901 Table 1 Primer sequences, product sizes and annealing temperatures used for PCR identification of Fusarium species Species Primer Sequences (5′-3′) Product size (bp) PCR conditions (anneal/extend) Reference F. graminearum Fg16F Fg16R CTCCGGATATGTTGCGTCAA GGTAGGTATCCGACATGGCAA 400–500 60 °C/60s Nicholson et al. (1998); Castañares et al. (2014) F. culmorum OPT18F OPT18R GATGCCAGACCAAGACGAAG GATGCCAGACGCACTAAGAT 472 59 °C/30s Schilling et al. (1996); Williams et al. (2002) F. subglutinans 61-2 F 61-2R GGCCACTCAAGCGGCGAAAG GTCAGACCAGAGCAATGGGC 445 64 °C/60s Möller et al. (1999) F. proliferatum PRO1-F PRO1-R CTTTCCGCCAAGTTTCTTC TGTCAGTAACTCGACGTTGTTG 585 57 °C/50s Iran), 1 μL of 10pM each forward and reverse primers and 3 μL of template DNA. The PCR cycle consisted of an initial denaturation step at 94 °C for 2 min followed by 35 cycles of denaturation (95 °C for 35 s), annealing (times and temperatures for each primer pair listed in Table 1), extension (72 °C for 30 s) and final extension at 72 °C for 7 min. All primers used in this study were purchased from Macrogen (South Korea). For trichothecene genotypes identification, specific primers for DON, NIV, 3-ADON and 15-ADON forms were used (Table 2). Two multiplex PCR assays were used to evaluate trichothecene genotypes in field populations of Fusarium. The DON and NIV genotypes were identified using a multiplex PCR assay to amplify portions of the Tri5, Tri5-Tri6 intergenic, Tri7 and Tri13 genes (Doohan et al. 1999; Li et al. 2005; Waalwijk et al. 2003). The DON, 3-ADON, 15-ADON and NIV genotypes were identified using a multiplex PCR assay to amplify portions of Tri3 and Tri12 (Ward et al. 2002). PCR amplification of Tri5, Tri5-Tri6 intergenic, Tri7 and Tri13 genes were performed as previously described (Doohan et al. 1999; Li et al. 2005; Waalwijk et al. 2003). The PCR amplification of Tri12 and Tri3 consisted of an initial step at 94 °C for 10 min, followed by two cycles of 94 °C for 30 s, 59 °C for 30 s and 72 °C for 30 s. The annealing temperature was stepped down every two cycles to 58, 56, 54, 53, 52 and 51 °C, then Table 2 Primer identification, sequences and expected amplicon sizes for trichothecene mycotoxin chemotypes of Fusarium Primer designation Primer sequence Target gene 3CON (R) 3NA (F) TGGCAAAGACTGGTTCAC GTGCACAGAATATACGAGC Tri3 3D15A (F) ACTGACCCAAGCTGCCATC Amplicon (bp) Trichothecene mycotoxin chemotypes 840 NIV 610 15-ADON Reference Ward et al. (2002) 3D3A (F) CGCATTGGCTAACACATG 243 3-ADON TRI5 (F) TRI5 (R) AGCGACTACAGGCTTCCCTC AAACCATCCAGTTCTCCATCT Tri5 544 Trichothecene producers Doohan et al. (1999) ToxP1 ToxP2 GCCGTGGGGRTAAAAGTCAAA TGACAAGTCCGGTCGCACTAGCA Tri5-Tri6 intergenic 300 360 DON NIV Li et al. (2005) MinusTri7F MinusTri7R TGGATGAATGACTTGAGTTGACA AAAGCCTTCATTCACAGCC Tri7 483 DON Doohan et al. (1999) Tri13F Tri13R TACGTGAAACATTGTTGGC GGTGTCCCAGGATCTGCG Tri13 234 415 DON NIV Waalwijk et al. (2003) 12CON (R) 12NF (F) CATGAGCATGGTGATGTC TCTCCTCGTTGTATCTGG Tri12 840 NIV 12-15 F (F) TACAGCGGTCGCAACTTC 670 15-ADON 12-3 F (F) CTTTGGCAAGCCCGTGCA 410 3-ADON Ward et al. (2002) Author's personal copy 902 50 °C for 21 cycles, with a final extension at 72 °C for 10 min (Schmale et al. 2011). Mycotoxin analyses in laboratory cultures Mycotoxin production of the Fusarium isolates in laboratory cultures was investigated according to Alvarez et al. (2009). Briefly, 25 g of rice (Oryza sativa L.) grains was soaked in 100 ml of sterile distilled water for 6 h. Water was drained and the soaked rice was autoclaved twice. Five milliliters inoculum suspension of 1 × 105 conidia mL−1 from each isolate was added to each flask and incubated at 26 ± 1 °C in darkness for 3 weeks. The rice-fungi mixtures were ground in a mortar and then dispensed in an Erlenmeyer flask with 75 ml of acetonitrile: methanol: water (80:5:15, v/v). Approximately 10 ml of the sample extract was gravity filtered and 5 ml aliquot of the purified extract was transferred into a vial. The solvent was evaporated at 55 °C for 1 h. The analysis was carried out using a fused silica capillary DB-5 column (30 m × 0.25 mm i.d.; film thickness 0.25 μm) for detection and quantification of NIV, DON, 3-ADON and 15-ADON. Nitrogen was both the carrier and auxiliary gas. The injection volume was 1 μl and total running-time was 30 min for each sample. Detection limits were 20 μg kg−1 for DON, 50 μg kg−1 for NIV, 3-ADON and 15-ADON. Mycotoxin production was confirmed using an Agilent 7890A gas chromatograph with mass spectroscopy, which was performed under electron energy conditions of 70 eV as described by Alvarez et al. (2009). Enzymatic analyses According to previous studies on the activity of CWDEs in vitro, most enzyme activities are observed within 10 days after inoculation (Kikot et al. 2009; Ortega et al. 2013). Based on these observations, pectinase and cellulase activity were evaluated in this study within 10 days. The test for each enzyme had three replicates for each isolate and the experiment was repeated two times. Pectinase assay Cultures were performed in 500 mL Erlenmeyers with 250 mL culture medium as previously described (MacMillan and Voughin 1964). Pectinase activity was determined based on the amount of reducing sugar (D- Eur J Plant Pathol (2017) 147:897–918 galacturonic acid) released in culture supernatant. The amount of D-galacturonic acid was determined by dinitrosalicylic acid colorimetric method of Colowich (1995) and absorbance was measured at 540 nm. The unit of enzyme activity was defined as the amount of enzyme that released 1 μ mol of galacturonic acid per minute according to the standard curve. The standard curve was drawn based on the absorbance in different concentrations (μg ml−1) of D-galacturonic acid. Cellulase assay Cultures were performed in 500 mL Erlenmeyers with 250 mL culture medium as described by Abdel-Razik (1970). After inoculation, incubation was carried out under shaking (150 rpm) at 27 °C and darkness for 10 days. Cellulase activity was investigated using the method of Wood and Bhat (1988). The absorbance was measured at 550 nm and the amount of reducing sugar released was calculated from the standard curve of glucose. One unit of cellulase activity was defined as the amount of enzyme that catalyzed 1.0 μ mol of glucose per minute during the hydrolysis reaction. Xylanase assay Cultures were performed in 500 mL Erlenmeyers with 250 mL culture medium as described by Miller (1959). Xylanase activity was investigated using the method of Bailey et al. (1992). Absorbance was read at 540 nm and the amount of reducing sugar released was calculated from the standard curve of glucose. One unit of xylanase activity was defined as the amount of enzyme that liberates 1.0 μ mol of reducing sugars equivalent to xylose per minute under the assay conditions described. Lipase assay Cultures were performed in 500 mL Erlenmeyers with 250 mL culture medium as described by Ortega et al. (2013). Lipase activity was investigated using the method of Ortega et al. (2013). Lipase hydrolytic activity was measured spectrophotometrically at 440 nm with pnitrophenyl palmitate (p-NPP, 1 mM in acetone) as substrate at 37 °C in 50 mM Tris–HCl buffer (pH 7.0). One unit of enzyme activity was defined as the amount of enzyme that releases 1 μ mol of p-NPP per minute under the above mentioned reaction conditions. Author's personal copy Eur J Plant Pathol (2017) 147:897–918 903 Plant materials Virulence analysis on wheat spikes Spring wheat cultivar (cv.) Falat, which is susceptible to FHB (Soltanloo et al. 2011) and obtained from Agricultural Research Center of Khorassan Razavi province in Iran, was used for pathogenicity testes. The seeds were surface sterilized with 1 % sodium hypochlorite for 1 min, rinsed three times with sterile distilled water and incubated for 5 days on a wet sterile filter paper in Petri dishes at 25 °C. Germinated seeds were each sown in the 15 cm-diameter plastic pots filled with potting soil, which had been autoclaved at 121 °C for a minimum of 30 min at 100 kPa (15 psi) on 2 successive days and grown in greenhouse (30 ± 4 °C; 16/8 h light/dark photoperiod). The soil used in this experiment, was a combination of clay, sand and farmyard manure with the ratio of 2:1:1 (v/v/v). Virulence of all isolates on wheat spikes was evaluated using the method described by Yoshida et al. (2007). At the flowering stage (ZGS 64 to 65), 10 mL of spore suspension (1 × 105 conidia mL −1) amended with 0.05 % Tween 20 was sprayed onto the spikes of each plant. The inoculated plants were incubated overnight in greenhouse at 18-25 °C, with 100 % humidity. Then, the plants were placed in a plastic bag for 3 days to maintain high relative humidity. Control plants were only treated with sterile distilled water. Inoculated wheat heads were evaluated after 10 days and the FHB disease severity was estimated. Disease severity was measured as the percentage of infected spikelet(s) within the spike using a 0 to 5 scale (0 = no disease, 1 = to 20 %, 2 = to 40 %, 3 = to 60 %, 4 = to 80 % and 5 = more than 80 % disease severity) (Wan et al. 1997) and the FHB index was calculated as described previously (Amarasinghe et al. 2013). Each test had ten replicates arranged in a completely randomized design, and the experiment was repeated two times. Inoculum preparation Fungal inocula were produced in Mung Bean Broth (MBB) medium using the method described by Zhang et al. (2013). Conidial suspensions were diluted to a final concentration of 1 × 105 conidia mL−1 containing 0.05 % (v/v) Tween 20. Virulence analysis on seedlings Virulence capability of all Fusarium isolates on seedlings was investigated using the method described by Gargouri-Kammoun et al. (2009). At the two- to threeleaf stage (Zadoks’ growth stage (ZGS) 12 to 13), a volume of 250 μl of a spore suspension (1 × 105 conidia mL−1) was placed at the stem base and leaf primordial of each plant. Plants used as controls were inoculated in a similar manner with sterile distilled water. Plants were incubated in the dark at constant 100 % relative humidity and 22 °C for 24 h, and twenty one days after inoculation, each plant was carefully pulled out and washed. Disease severity was graded into five classes based on the proportion of stem discoloration (0 = no discoloration; 1 = 1 to 25 %; 2 = 26 to 50 %; 3 = 51 to 75 %; 4 = more than 75 %; 5 = dead plant) as described by Fernandez and Chen (2005) and the disease index (DI) was calculated as described previously (Taheri and Tarighi 2010). Each test had ten replicates arranged in a completely randomized design, and the experiment was repeated two times. Detached-leaf assay The wheat plants were grown in greenhouse with 12 h photoperiod, RH of 75 %, and a day: night temperature of 18 °C: 12 °C. After 14 days, 4 cm segments from the mid-section of the first leaf were harvested, and placed adaxial surface up on the surface of 0.5 % water agar as described by Browne and Cooke (2004). Leaf segments were inoculated at the center of the adaxial surface with 5 μl inoculum suspension of 1 × 105 conidia mL−1 containing 0.05 % (v/v) Tween 20. Sterile distilled water was applied on the control leaves. Petri dishes were incubated at 25 °C with a 12 h: 12 h light: dark cycle. After 5 days, the length of necrotic lesions was measured. The test included four replicates for each isolate and the experiment was repeated two times. Assessment of aggressiveness Aggressiveness of each isolate of Fusarium spp. on seedlings, wheat spikes, and detached leaves were carried out using the methods described by Malihipour et al. (2012) and Pariaud et al. (2009). Analysis of aggressiveness was done based on determining hours post inoculation (hpi) for disease symptom appearance. Author's personal copy 904 Aggressiveness of all isolates was checked after every 12 h. Statistical analysis All experiments were set up in a completely randomized design. The data were analyzed by one-way analysis of variance (ANOVA) and comparison of means was carried out using the Duncan’s Multiple Range Test at the level of P ≤ 0.05. Statistical analysis was performed with statistical package for the social sciences (SPSS; version 22) software. Results Morphological identification of Fusarium isolates Morphological observations showed that width of macroconidia ranged from 4.0 to 7.0 μm for FGSC (Fig. 2a), 4.0 to 4.6 μm for F. graminearum (Fig. 2b), 4.0 to 4.5 μm for F. asiaticum (Fig. 2c), 3.8 to 4.3 μm Fig. 2 Morphological characters of Fusarium species. macroconidium of FGSC (a), macroconidium of F. graminearum (b), macroconidium of F. asiaticum (c), macroconidium of F. meridionale (d), macroconidium of F. culmorum (e), Eur J Plant Pathol (2017) 147:897–918 for F. meridionale (Fig. 2d), 5.0 to 6.0 μm for F. culmorum (Fig. 2e). Based on morphological characters of conidia, chlamydospores and conidiophores, 41 Fusarium isolates were identified which belonged to four species (Table 3, Fig. 2). The most common species identified were FGSC (68.3 %) and F. proliferatum (14.6 %). Less frequently isolated species included F. culmorum (9.8 %) and F. subglutinans (7.3 %). Molecular identification of Fusarium isolates using species-specific PCR assay The list of PCR primers used to identify Fusarium species is presented in Table 1. The Fg16F/Fg16R primers are not completely specific to F. graminearum sensu stricto, but they gave products of different size (400–500 bp), as described by Nicholson et al. (1998). F. graminearum s.s. gave a product of about 400 bp, while F. asiaticum gave a PCR product of about 550 bp and F. meridionale gave a product of about 500 bp, as described by Castañares et al. (2014). Molecular analysis using Fg16F/Fg16R primers revealed that from 28 macroconidium of F. proliferatum (f), macroconidium of F. subglutinans (g), chlamydospores of FGSC (h), conidiophores of F. proliferatum (i) Author's personal copy Eur J Plant Pathol (2017) 147:897–918 905 Table 3 Morphological characters of Fusarium isolates from different cultivars of wheat (Triticum aestivum L.) Name of the Species Pigmentation Growth Chlamydospore Sporodochium on PDA rate Microconidia Macroconidia Number Apical cell Basal size (μm) of septa cell FGSC F. culmorum vary from white to pale pink to red red F. subglutinans initially white but becomes violet F. proliferatum purple-violet R + Pale orange – 5–7 tapered Fs 24–72 × 4– 7 R + Orange to brown – 3–4 Nfs 37–55 × 4– 7 S –. Tan to orange + 3 rounded and blunt curved Pfs 54–85 × 4– 7 S – Tan to pale orange + 3–5 curved Pf 54–85× 4– 7 FGSC: Fusarium graminearum species complex, R: Rapid, S: Slow, +: Presence, −: Absence, Fs: Foot shape, Nfs: Notched and without a distinct foot shape, Pfs: Relatively poorly developed, Pf: Poorly developed isolates morphologically identified as FGSC, 24 isolates belonged to F. graminearum, three isolates were F. meridionale and one isolates was F. asiaticum. All six isolates morphologically identified as F. proliferatum, were confirmed using PRO1-F/PRO1R primers. All four isolates morphologically identified as F. culmorum were confirmed using OPT18-F470/ OPT18-R470 primers. Also, morphological identification of three isolates belonging to F. subglutinans was confirmed using OPT18-61-2 F/61-2R primers specific for this species. Trichothecene genotype detection by PCR The gene Tri5 encodes Trichodiene synthase, which catalyses the first step in trichothecene biosynthesis. In this study, this gene was detected using the primer set TRI5(F)/TRI5(R), which produces a unique PCR product in size of 544 bp for strains that contain Tri5 gene (Doohan et al. 1999; Covarelli et al. 2014). In overall, results obtained from PCR of the tri5 gene showed amplification of this gene for 78.1 % of trichothecene producing and 21.9 % of non-trichothecene producing isolates. Also, primers for amplification of five genomic regions (Tri3, Tri5-Tri6 intergenic, Tri7, Tri12 and Tri13) involved in trichothecene biosynthesis were used (Table 2). The results obtained from PCR reaction with Tri3, Tri5-Tri6 intergenic, Tri12 and Tri13 showed the presence of NIV genotype in our isolates. Primers used in regions of Tri3, Tri5-Tri6 intergenic, Tri12 and Tri13 produced a fragment of 840, 360, 415 and 840 bp length, respectively. The Tri7 primer pair which was specific for detecting DON produced a fragment of 483 bp length. Primers Tri3 and Tri12 for detecting 3ADON produced fragments of 243 and 410 bp length, respectively, and for detecting 15-ADON produced fragments of 610 and 670 bp length, respectively. The results showed that 25 isolates had the NIV genotype, five classified in 3-ADON genotype, two had 15ADON genotype, and nine were non-trichothecene producing isolates (Table 4). There were negative results with all genotype-specific primers in Table 4. Distribution of genotypes Among different wheat samples of various cultivars in the investigated regions, Galikesh farms showed high distribution of NIV producer isolates. This trichothecene genotype was detected in all sampling regions. Among the isolates, 3-ADON was detected from different fields of Gorgan, Azadshar, Ali Abad, Bandar gaz and Agh Ghala, while 15-ADON was detected from different fields of Gorgan and Agh Ghala in the northern region of Iran. Also we observed isolates, which based on PCR assay results should be able to produce NIV, DON, 3-ADON and/or 15 A-DON simultaneously (Table 4). 906 Table 4 Isolates, origin, species-specific PCR, presence of trichothecene-specific markers detected by TRI-based multiplex PCR assays and trichothecene genotype Isolate code Cultivar Sample site Species-specific PCR Trichothecene genotype PCR assay results Tri5 Tri3 Tri5-Tri6 Tri7 Tri12 Tri13 Tri P 15-ADON 3-ADON NIV DON NIV DON NIV 15-ADON 3-ADON DON NIV FH1 Koohdasht Gorgan F. graminearum NIV + + + + − − − + − + − + FH2 Unknown Gorgan F. graminearum NIV + − − + − − − + − − − − FH3 Unknown Gorgan F. graminearum NIV + − − + − − − + + − − − FH4 Tajan Gorgan F. meridionale 3-ADON + − + − − − − − − − − − Tajan Gorgan F. graminearum 15-ADON + + − − − − − − − − + − Unknown Gorgan F. meridionale NIV + − − − − − − + − + − − FH7 N8720 Gorgan F. subglutinans NIV + − + − − − − + − − − + Tajan Azadshar F. proliferatum NIV + − + + − − − − + − − − Tajan Azadshar F. culmorum NIV + − − + − − − − + − − − FH10 Unknown Azadshar F. graminearum 3-ADON + − − − − − − − − + + − FH11 Tajan Minoodasht F. graminearum − − − − − − − − − − − − − FH12 Tajan Minoodasht F. graminearum NIV + − − + − − − − − − − + FH13 Unknown Minoodasht F. graminearum NIV + − − − − + − + − − − + FH14 Gonbad Minoodasht F. proliferatum − − − − − − − − − − − − − FH15 Tajan Minoodasht F. proliferatum NIV + − − − − + − − − − − + FH16 Koohdasht Ali Abad F. graminearum 3-ADON + − + − − − + − − − − − FH17 Tajan Ali Abad F. graminearum − − − − − − − − − − − − − FH18 Tajan Ali Abad F. graminearum NIV + − + + − − − − − − − − FH19 N8720 Galikesh F. proliferatum − − − − − − − − − − − − − FH20 N8720 Galikesh F. proliferatum NIV + − + + − − − − − − − − FH21 N8720 Galikesh F. proliferatum NIV + − − + − − − − − + − − FH22 Unknown Galikesh F. graminearum NIV + − − − − + − + − − − − F. culmorum FH23 Unknown Galikesh NIV + − − + − − − − − + − + FH24 Tajan Bandar gaz F. graminearum 3-ADON + − − − − − − − − + + − FH25 Unknown Bandar gaz F. graminearum NIV + − − + − − − + − − − + FH26 Gonbad Daland F. graminearum NIV + − − + − − − − − − − + FH27 Koohdasht Daland F. graminearum − − − − − − − − − − − − − FH28 Koohdasht Daland F. asiaticum − − − − − − − − − − − − − Eur J Plant Pathol (2017) 147:897–918 FH8 FH9 Author's personal copy FH5 FH6 Isolate code Cultivar Sample site Species-specific PCR Trichothecene genotype PCR assay results Tri5 Tri3 Tri P Tri5-Tri6 Tri7 Tri12 Tri13 15-ADON 3-ADON NIV DON NIV DON NIV 15-ADON 3-ADON DON NIV Tajan Agh Ghala F. graminearum NIV + − + − − − − + − − − − FH30 Tajan Agh Ghala F. graminearum NIV + + − + − − − + − − − − FH31 Unknown Agh Ghala F. meridionale NIV + − − − − − − + − + − − FH32 Unknown Agh Ghala F. graminearum 3-ADON + − + − − − + − − − + − FH33 Koohdasht Agh Ghala F. graminearum NIV + − − + − − − − − − − + FH34 Koohdasht Agh Ghala F. graminearum 15-ADON + + − − + − − − − − − − FH35 Koohdasht Ismail Abad Unknown Ismail Abad Unknown Ismail Abad Tajan Kordkuy F. subglutinans − − − − − − − − − − − − − F. graminearum − − − − − − − − − − − − − F. culmorum − − − − − − − − − − − − − F. graminearum NIV + − − − − − − − − − − + FH39 Tajan Kordkuy F. culmorum NIV + − − − − − − + − − − + FH40 Unknown Fazel Abad F. subglutinans NIV + + − + − − − − − − − − FH41 Unknown Fazel Abad F. graminearum NIV + − − − − − − + − − − − FH36 FH37 FH38 Author's personal copy FH29 Eur J Plant Pathol (2017) 147:897–918 Table 4 (continued) Tri P: trichothecene producers, +: Presence, −: Absence, 3ADON: 3-acetyldeoxynivalenol + deoxynivalenol, 15ADON, 15-acetyldeoxynivalenol + deoxynivalenol, NIV: nivalenol + acetylated derivatives (Miller et al. 1991; Ward et al. 2002) 907 Author's personal copy 908 Eur J Plant Pathol (2017) 147:897–918 Mycotoxin analysis Virulence and aggressiveness assay Data of trichothecene production by Fusarium isolates on rice medium are shown in Table 5. For FGSC, 53.6 %, 28.6 %, 42.9 % and 21.4 % of the analysed samples contained NIV, DON, 3-ADON and 15ADON, in levels ranging from 437 to 1205 μg kg−1; 269 to 1248 μg kg−1; 178 to 1183 μg kg−1 and 240 to 1155 μg kg−1, respectively. Most of the F. culmorum, F. proliferatum and F. subglutinans isolates were NIV producers (75 %, 66.7 % and 66.7 %), at levels between 700 and 1075 μg kg−1, 260 and 1199 μg kg−1 and 313 to 1202 μg kg−1, respectively (Table 5). Isolates FH1 of F. graminearum and FH8 of F. proliferatum produced NIV, 3-ADON and 15-ADON simultaneously (Table 5). Comparison of the data obtained from inoculation of Fusarium isolates on wheat seedlings, wheat spikes and leaf segments revealed that different isolates tested had various virulence capabilities (Table 6). Based on the results obtained, significant differences in disease index on seedlings, wheat spikes and also leaf lesion length were observed among isolates tested. Pathogenicity tests on seedlings showed that the lowest disease index was observed for the FH11 isolate. The FH1 isolate caused the highest level of disease progress on seedlings with average DI of 63 ± 1.2 (Table 6, Fig. 3a). The results of pathogenicity test on wheat spikes showed that the longest lesions were produced by FH1 isolate with an average DI of 69.3 ± 0.3 (Table 6, Fig. 3b). The shortest lesions were produced by FH11 and FH19 isolates among all Fusarium isolates. FHB index of other isolates ranged from 66.3 ± 1.3 to 12.7 ± 0.3. Leaf assay revealed that the highest lesion length was produced by the FH1 isolate. The lowest lesion length was produced by FH19 and FH28 isolates, respectively. Other isolates tested fell between these with various levels of virulence on wheat leaf segments (Table 6, Fig. 3c). The results of aggressiveness test on seedlings, wheat spikes, and detached-leaves showed earlier development of disease symptoms by FH1 isolate compared to other isolates tested (Table 6). Analysis CWDEs activity Analysis of CWDEs showed that all Fusarium isolates were capable of producing CWDEs. According to the results obtained, for most of the isolates tested the maximum levels of cellulase, xylanase, pectinase and lipase activity were observed at 72, 96, 144 and 192 h post-culturing (hpc) on liquid medium, respectively. Then, the activity decreased gradually with time, until it remained at constant levels at the end of culture time. At the time point in which most of the isolates showed maximum activity for each enzyme, the level of CWDEs activity among isolates varied from 232 to 938 μg ml−1 for cellulase, 589 to 1215 μg ml−1 for xylanase, 3340 to 4695 μg ml−1 for pectinase, and 13 to 28 μg ml−1 for lipase (Table 5). The FH1 and FH8 isolates showed the maximum cellulase activity in vitro among all isolates. The lowest cellulase activity was observed for FH17 and FH36 isolates, respectively. The lowest xylanase activity belonged to FH19 and FH11 isolates, and also maximum xylanase activity with 1215 ± 7.1 and 1187 ± 11.3 μg ml−1, respectively, was observed for FH1 and FH8 isolates. With regard to pectinase, FH8, FH29, FH7 and FH1 isolates showed the maximum cellulase activity. The lowest pectinase activity belonged to FH11, FH19, FH37 and FH28 isolates, respectively. Maximum lipases activity was observed for FH1 and FH8 isolates, respectively and the isolates FH37 and FH11 had the lowest lipase activity (Table 5). Correlation between activity of CWDEs and virulence We compared the activity of CWDEs produced by some of the Fusarium isolates, which caused maximum or minimum level of virulence on wheat leaves, seedlings, or spike (Fig. 4) for finding possible association between CWDEs and virulence. The isolates FH1 and FH8, which showed the highest levels of virulence in three different bioassays on leaf, seedling and spike, had considerably higher levels of enzyme activity at various time points investigated. Whereas, the isolates FH11 of F. graminearum and FH19 of F. proliferatum, which had the lowest virulence capability (on wheat leaf, spike and seedling), revealed the lowest level of CWDEs activity at most of the time points tested (Fig. 4). Author's personal copy Eur J Plant Pathol (2017) 147:897–918 909 Table 5 Mycotoxin production by Fusarium isolates in rice cultures analyzed by GC-MS and maximum of enzyme activity Isolate code Trichothecene production in vitro (μg kg−1) NIV 3-ADON 15-ADON DON Maximum of enzyme activity (μg ml−1) Cellulase 72 hpc Xylanase 96 hpc Pectinase 144 hpc Lipases 192 hpc FH1 910 498 253 ND 938 ± 2.8 a 4620 ± 6.3 a 29 ± 0.9 a FH2 1105 ND ND ND 488 ± 0.4 g 1215 ± 7.1 a 833 ± 8.0 kl 4255 ± 3.8 f 23 ± 0.6 d FH3 1007 243 ND ND 618 ± 21.7 f 950 ± 3.6 efg 4295 ± 5.2 ef 24 ± 0.2 d FH4 ND 501 ND 1248 725 ± 0.8 c 823 ± 4.6 l 3558 ± 16.7 h 20 ± 0.5 fg FH5 ND ND 1001 1000 672 ± 19.6 d 876 ± 5.6 ij 4253 ± 4.6 f 24 ± 0.9 d FH6 499 108 ND ND 633 ± 4.0 ef 890 ± 10.8 hi FH7 1202 308 ND ND 667.8 ± 5.9 d FH8 438 997 240 ND FH9 751 ND 325 FH10 ND 1098 FH11 – – FH12 754 FH13 FH14 FH15 4324 ± 6.8 ef 16 ± 0.2 h 1041 ± 3.8 c 4620 ± 6.3 a 27 ± 0.5 b 930 ± 7.8 a 1187 ± 11.3 a 4695 ± 33.3 a 28 ± 0.5 a ND 770 ± 25.2 bc 1001 ± 5.4 cd 4597 ± 39.1 b 26.8 ± 0.2 b ND 269 630 ± 2.3 ef 820 ± 12.6 l 3553 ± 21.3 h – – 324 ± 8.8 j 620 ± 10.8 pq 3375 ± 21.3 i 13 ± 0.5 i ND ND ND 670 ± 0.4 d 871 ± 13.5 ijk 4259 ± 9.3 f 23 ± 2.5 d 620 ND ND ND 649 ± 0.6 de 843 ± 15.3 jkl 3711 ± 6.5 1 g 23 ± 0.6 d – – – – 452 ± 1.3 h 725 ± 20.0 mno 3519 ± 16.0 h 19 ± 0.1 g 1199 ND ND ND 628 ± 6.2 ef 1008 ± 14.3 cd 4452 ± 35.4 bc 24 ± 0.0 d FH16 ND 1030 ND 1023 599 ± 6.1 f 827 ± 13.5 l 3584 ± 10.4 h 22 ± 0.4 de FH17 – – – – 232 ± 5.0 k 650 ± 4.6 p 3517 ± 14.2 h 19 ± 0.1 g FH18 701 315 ND ND 723 ± 1.0 c 911 ± 1.2 ghi 3726 ± 8.82 g 20 ± 0.0 fg 589 ± 16.4 q 20 ± 0.2 fg FH19 – – – – 378 ± 2.1 i 3367 ± 4.4 i 16 ± 0.3 h FH20 1098 974 ND ND 732 ± 20.8 c 1094 ± 1.3 b 4426 ± 18.2 c 26 ± 0.0 b FH21 260 1089 ND ND 824 ± 7.4 b 1001 ± 7.8 d 4413 ± 41.5 cd 24 ± 0.0 d FH22 1001 ND ND ND 726 ± 3.6 c 4323 ± 47.5 ef 24 ± 0.1 d FH23 806 355 ND ND 649 ± 25.3 de 898 ± 9.2 hi 4354 ± 4.4 ef FH24 ND 279 ND 1077 673 ± 10.2 d 825 ± 5.4 l 3577 ± 45.3 h 22 ± 0.3 de FH25 739 ND ND ND 738 ± 2.0 c 896 ± 5.6 hi 4345 ± 24.7 de 24 ± 1.2 d FH26 437 ND ND ND 686 ± 14.6 d 929 ± 27.8 fgh 4267 ± 22.5 ef 24 ± 0.9 cd FH27 – – – – 497 ± 1.2 g 752 ± 11.9 mn 3577 ± 44.4 h 20 ± 0.1 fg FH28 – – – – 475 ± 0.4 gh 704 ± 17.8 o 3340 ± 3.8 i 16 ± 0.1 h FH29 1230 1183 ND ND 726 ± 3.6 c 1012 ± 0.2 cd FH30 480 ND 1155 ND 678 ± 36.6 d FH31 1211 980 ND ND 712 ± 5.2 c FH32 ND 178 ND 895 611 ± 17.2 f 759 ± 13.4 m 3544 ± 33.3 h 20 ± 0.0 fg FH33 494 ND ND ND 725 ± 0.8 c 828 ± 0.8 l 3508 ± 7.12 h 19 ± 0.5 g FH34 ND ND 293 1000 632 ± 13.8 ef 730 ± 20.5 mno 3511 ± 9.61 h 19 ± 0.2 fg FH35 - – – – 296 ± 18.5 j 706 ± 17.3 o 3510 ± 10.0 h 19 ± 0.3 g FH36 – – – – 254 ± 12.3 k 714 ± 20.5 no 3563 ± 23.9 h FH37 – – – – 249 ± 10.9 k 646 ± 7.7 p 3350 ± 45.1 i FH38 1088 ND ND ND 629 ± 20.9 ef 874 ± 2.1 ig 3568 ± 29.2 h 21 ± 0.5 ef FH39 1075 ND ND ND 725 ± 0.8 c 884 ± 12.1 i 3576 ± 28.4 h 20 ± 0.0 fg FH40 313 ND 1088 ND 725 ± 0.8 c 940 ± 5.7 fg 4287 ± 5.8 ef 24 ± 0.5 d FH41 1205 1180 ND ND 614 ± 5.0 f 958 ± 36.1 ef 4402 ± 54.9 cd 26 ± 0.0 bc 974 ± 2.0 de 961 ± 10.5 ef 1080 ± 8.2 b 24.4 ± 1.6 d 4620 ± 6.3 a 26 ± 0.4 bc 3585 ± 42.5 h 20 ± 0.2 fg 4510 ± 21.8 b 26 ± 0.3 b 20 ± 0.1 fg 12.9 ± 0.4 i ND: not detected, −: without genotype of trichothecene biosynthesis. Average ± standard error, Different letters indicate significant differences according to Duncan analysis using SPSS software (P = 0.05), each experiment was repeated two times with similar results Author's personal copy 910 Eur J Plant Pathol (2017) 147:897–918 Table 6 Virulence and aggressiveness of Fusarium isolates on seedling, wheat spike and leaf segments inoculated Isolate code Virulence and aggressiveness analysis leaf FH1 FH2 FH3 FH4 FH5 FH6 FH7 FH8 FH9 FH10 FH11 FH12 FH13 FH14 FH15 FH16 FH17 FH18 FH19 FH20 FH21 FH22 FH23 FH24 FH25 FH26 FH27 FH28 FH29 FH30 FH31 FH32 FH33 FH34 FH35 FH36 FH37 FH38 FH39 FH40 FH41 seedling spike Virulence (LL, mm) Aggressiveness (hpi) Virulence (DI) Aggressiveness (hpi) Virulence (FHB index) Aggressiveness (hpi) 39 ± 1.1 a 29 ± 1.6 fg 30.5 ± 1.9 efg 18 ± 0.0 i 23.75 ± 0.6 h 29 ± 1 fg 33.25 ± 1.2 cde 37 ± 0.8 ab 31 ± 0.9 ef 19 ± 1.3 i 7.75 ± 0.94 lm 29.25 ± 1.6 fg 29.5 ± 0.5 fg 10.25 ± 0.7 kl 30 ± 0.8 efg 20 ± 0.7 i 11 ± 0.6 kl 29 ± 1 fg 5.75 ± 0.6 m 36.5 ± 0.9 abc 32 ± 1.2 def 29.5 ± 0.6 fg 29 ± 1.1 fg 19.25 ± 0.5 i 28.25 ± 1.0 g 29.75 ± 0.5 fg 15 ± 0.4 j 6.75 ± 1.7 m 34.5 ± 1.5 bcd 29.25 ± 1.2 fg 35.5 ± 1.0 bc 19.75 ± 1.2 i 29 ± 1.2 fg 25 ± 1.1 h 12.5 ± 1.0 j 10 ± 0.4 kl 5.75 ± 0.6 m 30 ± 1.9 efg 28.5 ± 0.5 fg 29.5 ± 1.3 fg 29.75 ± 0.6 fg 12 48 48 72 60 48 36 24 48 72 96 48 48 96 60 72 96 48 108 24 36 48 48 72 60 48 96 108 24 48 24 72 48 72 96 96 108 48 48 48 48 63 ± 1.2 a 32 ± 1.0 hijk 33 ± 0.7 ghij 20 ± 0.6 no 27 ± 0.3 m 35 ± 0.3 efg 37 ± 0.3 cd 40 ± 0.3 b 35 ± 0.3 efg 18 ± 0.6 p 4 ± 0.6 s 31 ± 0.3 jk 31 ± 0.3 jk 10 ± 0.6 q 35 ± 0.3 ef 22 ± 0.9 n 8 ± 0 qr 34 ± 0.6 efgh 9 ± 1.7 qr 39 ± 0.7 bc 36 ± 0.3 de 34 ± 0.3 efghi 34 ± 0.6 ghij 18 ± 0.7 op 33 ± 0.3 ghij 32 ± 0.7 ijk 10 ± 0.6 q 7 ± 0.6 r 38 ± 0.3 bc 35 ± 0.6 ef 39 ± 0.6 bc 21 ± 0.7 n 31 ± 1.0 jk 28 ± 0.6 l 9 ± 0.7 q 9 ± 1.1 qr 9.3 ± 0.6 qr 30 ± 0.6 k 33 ± 0.3 ghij 33 ± 0.7 ghij 33 ± 0.4 ghi 72 168 168 216 216 144 96 72 144 228 264 180 180 240 144 216 240 144 240 84 108 168 180 216 180 180 228 240 96 120 96 216 180 216 240 240 240 180 168 168 168 69.3 ± 0.3 a 29.7 ± 0.3 gh 30 ± 2.3 gh 24.3 ± 2.7 ij 41 ± 1.2 cd 42.3 ± 2.6 cd 42 ± 2.5 cd 52.7 ± 2.8 b 42 ± 0 cd 18.3 ± 4.3 kl 7 ± 2.3 n 21.3 ± 1.3 jk 27.7 ± 0.3 hi 16. ± 0.6 lm 42 ± 0 cd 27 ± 0 hi 16.3 ± 2.4 lm 31 ± 1 fgh 7.3 ± 0.3 n 68.7 ± 0.9 a 43.3 ± 0.3 c 30.7 ± 0.9 fgh 45.3 ± 0.3 c 14.3 ± 0.9 lm 38.3 ± 0.9 de 45.7 ± 0.3 c 13 ± 0.6 m 14.3 ± 0.7 lm 66.3 ± 1.3 a 43.3 ± 0.7 c 45 ± 1.1 c 16 ± 0 lm 36 ± 3 e 29 ± 0.6 hi 12.7 ± 0.3 m 29.3 ± 1.3 h 12.7 ± 0.3 m 34.3 ± 0.3 efg 26.3 ± 0.3 hi 26.3 ± 0.3 hi 35.3 ± 1.2 ef 48 120 120 144 120 72 72 60 84 156 180 168 120 168 72 120 168 120 180 60 72 120 72 168 72 72 168 168 60 72 72 168 120 144 168 144 168 120 144 144 120 hpi: hours post inoculation, LL: Lesion length, DI: Disease index, FHB index: Fusarium head blight index. Average ± standard error, Different letters indicate significant differences according to Duncan analysis using SPSS software (P = 0.05), each experiment was repeated two times with similar results Author's personal copy Eur J Plant Pathol (2017) 147:897–918 911 Fig. 3 Disease symptoms on wheat seedlings (a), spikes (b) and leaf (c) by Fusarium isolates. Control, F. graminearum (FH1) and F. proliferatum (FH8). Arrows marked symptoms disease and necrotic lesions Fig. 4 Analysis activities of CWDEs produced by Fusarium isolates over an incubation maximum period of 240 h. cellulase activity (a), xylanase activity (b), pectinase activity (c) and lipase activity (d). Values are means of 3 replicates. FH8; FH11; FH19; FH29 FH1; FH20; Author's personal copy 912 Discussion In this study, to identify and determine the frequencies of Fusarium spp. causing wheat head blight in northern region of Iran, a total of 41 Fusarium spp. isolates were obtained from infected wheat heads showing disease symptoms such as ear blight and bleached grains and the isolates were characterized using morphological and molecular methods. Morphological identification was confirmed using a set of species-specific primers. This is the first detailed report of trichothecene genotypes in populations of Fusarium spp. collected from the northern region of Iran and quantification of trichothecenes using GC-MS. Also, we evaluated the activities of CWDEs, which are involved in plant-pathogen interactions during FHB infection and investigated the correlation between virulence factors, aggressiveness and virulence capability of Fusarium isolates on seedlings, spikes and leaves of wheat plants. Based on morphological observations, a total of 41 isolates belonging to four Fusarium species were isolated from wheat grain samples. Twenty eight isolates were identified as FGSC, six isolates as F. proliferatum, three isolates as F. subglutinans and one isolate as F. culmorum. The FHB disease was observed in different regions of Golestan province. Gorgan and Agh Ghala showed the highest percentage of infected samples. It is possible that planting the sensitive cultivar Tajan and crop rotation with maize and sorghum are the causes of FHB prevalence in this region (Table 4). The main species associated with FHB disease are F. graminearum, F. culmorum and F. proliferatum, among which F. graminearum and F. proliferatum are known to produce toxins (Karami-Osboo et al. 2010). Davari et al. (2013) reported that 96 % of the isolates recovered from FHB affected wheat in Ardabil province of Iran belong to F. graminearum, which is in accordance with our data. The results of morphological identification were in accordance with the reports of Sarver et al. (2011) and Starkey et al. (2007). F. graminearum formed narrow conidia with 4.0–4.5 μm width, similar to F. asiaticum. But, the width of F. meridionale isolates was less than 4.5 μm. F. graminearum and F. asiaticum did not form beaked conidia in contrast to F. meridionale. Conidia of F. graminearum and F. asiaticum, however, were gradually curved and, in addition, those were most frequently widest above the mid-region. In contrast, conidia of F. meridionale were gradually curved and most Eur J Plant Pathol (2017) 147:897–918 frequently widest at the mid-region (Sarver et al. 2011; Starkey et al. 2007). Species-specific PCR analysis showed that among 41 isolates used in this study, 24 isolates were identified as F. graminearum, six were F. proliferatum, four were F. culmorum, three were F. meridionale, three were F. subglutinans and one isolate of F. asiaticum was identified. The products of DNA amplification corresponded to sizes reported for species-specific PCR products and confirmed the morphological identification (Alkadri et al. 2013; Castañares et al. 2014; Williams et al. 2002). Based on our molecular analysis, morphological identification of all 4 isolates belonging to F. culmorum was confirmed using the OPT18-F470/ OPT18-R470 primers and gave a PCR product of about 472 bp. But according to Schilling et al. (1996), this primer pair does not give a positive signal with all F. culmorum isolates. Results of the present study indicated that F. graminearum s.s. was the most frequently isolated species (58.6 %), confirming other reports on this species as one of the most often isolated Fusarium species from the FGSC not only in Iran (Haratian et al. 2008), but also in many other countries including the United States (Schmale et al. 2011; Alvarez et al. 2011; Prodi et al. 2011). The Tri5 gene encodes trichothecene synthase as the initial product in the trichothecene biochemical pathway (Neissen and Vogel 1997), which could be used for developing a PCR-based assay to detect trichotheceneproducing Fusarium species (Doohan et al. 1999). The results of trichothecene genotype detection revealed 83.4, 66.7, 75, 66.7 and 100 % amplification of the tri5 gene for the isolates belonging to F. graminearum, F. proliferatum, F. culmorum, F. subglutinans and F. meridionale, respectively. The isolate of F. asiaticum did not produce trichothecene. Production of NIV required Tri13 and Tri7 genes that produce the acetylation and oxygenation of the oxygen at C-4 to produce nivalenol and 4-acetyl nivalenol, respectively (Lee et al. 2009). Our results showed that NIV was produced by 60.9 % of the isolates. Whereas, 41.5 % of the isolates produced 3-ADON, 17.1 % 15-ADON, and 17.1 % DON. In most isolates, NIV was found simultaneously with 3-ADON and 15-ADON. Except for 16 isolates, NIV was always produced in larger amounts than the other trichothecenes. Our data are in accordance with observations of Gale et al. (2011), which Author's personal copy Eur J Plant Pathol (2017) 147:897–918 reported that the NIV chemotype was prevalent on wheat in Southern Louisiana. Trichothecene genotype detection of the FGSC population showed that the NIV genotype was the most frequent (57.2 %) followed by 3-ADON (17.9 %) and 15-ADON (7.2 %) genotypes. With regard to F. proliferatum and F. subglutinans the analysis showed only presence of the NIV (66.7 %) and absence of 3ADON and 15-ADON chemotypes. Two isolates of F. culmorum belonged to the NIV genotype. So, investigation of trichothecene chemotypes revealed that the NIV chemotype was the most prevalent in Fusarium isolates obtained from wheat farms of the northern region of Iran, followed by 3-ADON and 15-ADON chemotypes. Similar results were obtained by AbediTizaki and Sabbagh (2013). Also, Haratian et al. (2008) reported that the NIV chemotype was dominant in Mazandaran province in the northern part of Iran. Results similar to our findings were obtained in southern Louisiana (Gale et al. 2011), England and Wales (Jennings et al. 2004), Netherlands (Waalwijk et al. 2003) and South Africa (Sydenham et al. 1989). Observation of a wide variation in trichothecene production in vitro among Fusarium isolates in this study was supported by results reported by other investigators using GC-MS analysis (Alvarez et al. 2009; Covarelli et al. 2014). Wheat and maize in rotation with sorghum are the most important cereal crops in the northern region of Iran. Crop rotation may influence the pathogen population dynamics, especially since it was shown that NIV and DON act as virulence factors on wheat, while only the NIV chemotype is virulent on maize (Maier et al. 2006). Our results showed that in the north of Iran, which is an important region in producing small grain cereal crops such as wheat and rice, FHB-associated F. graminearum isolates produced mostly NIV rather than DON derivatives. This finding is in accordance with observations of Davari et al. (2013), who demonstrated association of the NIV chemotype with local rice production. Other studies have also clearly shown this association between rice production and the prevalence of the NIV chemotype (Umpiérrez-Failache et al. 2013; Qiu and Shi 2014; Van der Lee et al. 2015), which confirmed our data. According to these results, it might be concluded that differences in crop rotations and bordering crops may influence the species and chemotypes found in wheat. 913 In general, NIV chemotypes appeared to be more aggressive than the other chemotypes of F. graminearum. This finding is in agreement with the observations of other researchers (Carter et al. 2002; Cumagun et al. 2004). In addition, Fusarium isolates producing higher level of NIV and 3-ADON chemotypes were more aggressive than other isolates. Similarly, Von der Ohe et al. (2010) demonstratd that the isolates with 3-ADON chemotype were more aggressive than those with 15-ADON. Also, Puri and Zhong (2010) suggested that the 3-ADON isolates were more aggressive and caused higher FHB severity. Evaluating the activities of CWDEs, which are involved in the infection process of FHB pathogens on wheat, was performed in this study. Aggressiveness of Fusarium spp. involves different mechanisms such as production of extracellular enzymes and mycotoxins (Ortega et al. 2013). Hemibiotrophic (F. graminearum) and necrotrophic (F. subglutinans, F. proliferatum and F. culmorum) pathogens often produce different extracellular CWDEs (Stankovic et al. 2007). These enzymes are particularly important for phytopathogenic fungi without specialized penetration structures (Gibson et al. 2011). We focused on detailed investigation of pectinase, cellulase, xylanase and lipase activities in different time points because they are the major CWDEs in Fusarium species (Kikot et al. 2009; Ortega et al. 2013). During 10 days of CWDEs investigation, production rate and time of reaching each enzyme to its maximum activity varied among different isolates. Cellulase was the first in reaching its peak, while the maximum activity of xylanase, lipase and pectinase appeared later and at lower magnitude. Similar results were obtained by Ortega et al. (2013), who reported that lipase activity reached to its maximum activity after longer incubation time compared to other enzymes tested. Comparing CWDEs activities and virulence of the isolates revealed that lipase and pectinase had less effect on virulence compared to cellulase and xylanase. Similar results were reported by Phalip et al. (2005), who analyzed exo-proteome of F. graminearum grown on plant cell wall. The results of our study about virulence of Fusarium isolates on seedlings, wheat spikes and leaf segments showed that all isolates were pathogenic on wheat (cv. Falat) and differences in virulnce capability were found. According to the results reported by other investigators, strong association has been found between the severity of FHB and mycotoxin concentration (Panthi et al. Author's personal copy 914 2014; Hernandez-Nopsa et al. 2014; Wegulo 2012; Burlakoti et al. 2007) as observed in this study. F. graminearum isolates without the ability of producing trichothecenes were unable to cause severe disease on wheat tissues, which was in agreement with the data of Bai et al. (2002). Our results are in accordance with several other studies showing that trichothecenes have a significant role in determining the virulence of Fusarium isolates (Hernandez-Nopsa et al. 2014; Purahong et al. 2013; Umpiérrez-Failache et al. 2013). Since the NIV chemotype is more detrimental for consumers, we have to find a solution to reduce this mycotoxin. The economic and social impact of FHB highlights the necessity of using effective control strategies. Management of FHB to reduce mycotoxin contamination have been developed by utilizing host resistance, use of biological agents, tillage, seed treatment, crop rotation and fungicides application during flowering stage (Brown et al. 2007; Müllenborn et al. 2008; Willyerd et al. 2012; Hollingsworth et al. 2008). Knowledge on Fusarium species and chemotypes, CWDEs and virulence levels could be useful in the production of resistant varieties and other management strategies to reduce destructive effects of FHB disease in small grain cereals, especially in wheat growing areas. Acknowledgments We thank Ferdowsi University of Mashhad, Iran, for financial support of this research with project number 3/31477 approved on 2/07/2014. References Aamot, H. U., Ward, T. J., Brodal, G., Vrålstad, T., Larsen, G. B., Klemsdal, S. S., Elameen, A., Uhlig, S., & Hofgaard, I. S. (2015). Genetic and phenotypic diversity within the Fusarium graminearum species complex in Norway. European Journal of Plant Pathology, 142, 501–519. Abdel-Razik, A. A. (1970). The parasitism of white Sclerotium cepivorum Berk., the incitant of white rot of onion. PhD thesis, Fac Agric, Assiut University, Assiut, Egypt. Abedi-Tizaki, M., & Sabbagh, S. K. (2013). Detection of 3acetyldeoxynivalenol, 15-acetyldeoxynivalenol and nivalenol-chemotypes of Fusarium graminearum from Iran using specific PCR assays. Plant Knowledge Journal, 2(1), 38–42. Alexander, N. J., Hohn, T. M., & McCormick, S. P. (1998). The TRI11 gene of Fusarium sporotrichioides encodes a cytochrome P-450 monooxygenase required for C-15 hydroxylation in trichothecene biosynthesis. Applied and Environmental Microbiology, 64(1), 221–225. Eur J Plant Pathol (2017) 147:897–918 Alkadri, D., Nipoti, P., Döll, K., Karlovsky, P., Prodi, A., & Pisi, A. (2013). Study of fungal colonization of wheat kernels in Syria with a focus on Fusarium species. International Journal of Molecular Sciences, 14(3), 5938–5951. Alvarez, C. A., Azcarate, M. P., & Fernandez Pinto, V. (2009). Toxigenic potential of Fusarium graminearum sensu stricto isolates from wheat in Argentina. International Journal of Food Microbiology, 135(2), 131–135. Alvarez, C. L., Somma, S., Proctor, R. H., Stea, G., Mulè, G., Logrieco, A. F., Fernandez Pinto, V., & Moretti, A. (2011). Genetic diversity in Fusarium graminearum from a major wheat-producing region of Argentina. Toxins, 3(10), 1294– 1309. Amarasinghe, C. C., Tamburic-Ilincic, L., Gilbert, J., Brûlé-Babel, A. L., & Fernando, W. (2013). Evaluation of different fungicides for control of fusarium head blight in wheat inoculated with 3ADON and 15ADON chemotypes of Fusarium graminearum in Canada. Canadian Journal of Plant Pathology, 35(2), 200–208. Bai, G. H., Desjardins, A. E., & Plattner, R. D. (2002). Deoxynivalenol nonproducing Fusarium graminearum causes initial infection, but does not cause disease spread in wheat spikes. Mycopathologia, 153(2), 91–98. Bailey, M. J., Biely, P., & Poutanen, K. (1992). Interlaboratory testingof methods for assay of xylanase activity. Journal of Biotechnology, 23(3), 257–270. Boddu, J., Cho, S., & Muehlbauer, G. J. (2007). Transcriptome analysis of trichothecene-induced gene expression in barley. Molecular Plant-Microbe Interactions Journal, 20(11), 1364–1375. Boutigny, A.-L., Ward, T. J., Van Coller, G. J., Flett, B., Lamprecht, S. C., O’Donnell, K., & Viljoen, A. (2011). Analysis of Fusarium graminearum species complex from wheat, barley and maize in South Africa provides evidence of species-specific differences in host preference. Fungal Genetics and Biology, 48(9), 914–920. Boutigny, A.-L., Ward, T., Ballois, N., Iancu, G., & Ioos, R. (2014). Diversity of the Fusarium graminearum species complex on French cereals. European Journal of Plant Pathology, 138(1), 133–148. Brown, D. W., McCormick, S. P., Alexander, N. J., Proctor, R. H., & Desjardins, A. E. (2002). Inactivation of a cytochrome P450 is a determinant of trichothecene diversity in Fusarium species. Fungal Genetics and Biology, 36, 224–233. Brown, D. W., Butchko, R. A. E., Busman, M., & Proctor, R. H. (2007). The Fusarium verticillioides FUM gene cluster encodes a Zn(II)2Cys6 protein that affects FUM gene expression and fumonisin production. Eukaryotic cell, 6(7), 1210–1218. Browne, R. A., & Cooke, B. M. (2004). Development and evaluation of an in vitro detached leaf assay for pre-screening resistance to Fusarium head blight in wheat. European Journal of Plant Pathology, 110(1), 91–102. Burlakoti, R. R., Estrada, R., Rivera, V. V., Boddeda, A., Secor, G. A., & Adhikari, T. B. (2007). Real-time PCR quantification and mycotoxin production of Fusarium graminearum in wheat inoculated with isolates collected from potato, sugar beet, and wheat. Phytopathology, 97(7), 835–841. Carter, J. P., Rezanoor, H. N., Holden, D., Desjardins, A. E., Plattner, R. D., & Nicholson, P. (2002). Variation in pathogenicity associated with the genetic diversity of Fusarium Author's personal copy Eur J Plant Pathol (2017) 147:897–918 graminearum. European Journal of Plant Pathology, 108(6), 573–583. Castañares, E., Albuquerque, D. R., Dinolfo, M. I., Pinto, V. F., Patriarca, A., & Stenglein, S. A. (2014). Trichothecene genotypes and production profiles of Fusarium graminearum isolates obtained from barley cultivated in Argentina. International Journal of Food Microbiology, 179, 57–63. Chaudhary, P., Shank, R. A., Montina, T., Goettel, J. T., Foroud, N. A., Hazendonk, P., & Eudes, F. (2011). Hydrogen-bonding interactions in T-2 toxin studied using solution and solid-state NMR. Toxins, 3(10), 1310–1331. Colowich, S. P. (1995). Methods in Enzymology. London: Academic Prees INC. Covarelli, L., Beccari, G., Prodi, A., Generotti, S., Etruschi, F., Juan, C., Ferrerc, E., & Mañesc, J. (2014). Fusarium species, chemotype characterization and trichothecene contamination of durum and soft wheat in an area of central Italy. Journal of the Science of Food and Agriculture, 95, 540–551. Cumagun, C. J. R., Bodwen, R. L., Jurgenson, J. E., Leslie, J. F., & Miedaner, T. (2004). Genetic mapping of pathogenicity and aggressiveness of Gibberella zeae (Fusarium graminearum) toward wheat. Phytopathology, 94(5), 520–526. Davari, M., Wei, S. H., Babay-Ahari, A., Arzanlou, M., Waalwijk, C., van der Lee, T. A. J., Zare, R., Gerrits van den Ende, A. H. G., de Hoog, G. S., & van Diepeningen, A. D. (2013). Geographic differences in trichothecene chemotypes of Fusarium graminearum in the Northwest and North of Iran. World Mycotoxin Journal, 6(2), 137–150. Desjardins, A. E. (2006). Fusarium mycotoxins chemistry genetics and biology. St. Paul: American Phytopathological Society Press. Desmond, O. J., Manners, J. M., Stephens, A. E., Maclean, D. J., Schenk, P. M., Gardiner, D. M., Munn, A. L., & Kazan, K. (2008). The Fusarium mycotoxin deoxynivalenol elicits hydrogen peroxide production, programmed cell death and defence responses in wheat. Molecular Plant Pathology, 9(4), 435–445. Doohan, F. M., Weston, G., Rezanoor, H. M., Parry, D. W., & Nicholson, P. (1999). Development and use of a reverse transcription-PCR assay to study expression of Tri5 in vitro and in planta. Applied and Environmental Microbiology, 65(9), 3850–3854. Eudes, F., Collin, J., Rioux, S., & Comeau, A. (1997). The trichothecenes, a major component of wheat scab pathogenesis. Cereal Research Communications, 25, 495–496. Fernandez, M. R., & Chen, Y. (2005). Pathogenicity of Fusarium species on different plant parts of spring wheat under controlled conditions. Plant Disease, 89(2), 164–169. Fisher, N. L., Burgess, L. W., Toussoun, T. A., & Nelson, P. E. (1982). Carnation leaves as a substrate and for preserving Fusarium species. Phytopathology, 72(1), 151–153. Foroud, N. A., & Eudes, F. (2009). Trichothecenes in cereal grains. International Journal of Molecular Sciences, 10(1), 147– 173. Gale, L. R., Ward, T. J., Balmas, V., & Kistler, H. C. (2007). Population subdivision of Fusarium graminearum sensu stricto in the upper Midwestern United States. Phytopathology, 97(11), 1434–1439. Gale, L. R., Harrison, S. A., Ward, T. J., O’Donnel, K., Milus, E. A., Gale, S. W., & Kistler, H. C. (2011). Nivalenol type populations of Fusarium graminearum and F. asiaticum are 915 prevalent wheat in southern Louisiana. Phytopathology, 101(1), 124–134. Gardiner, S. A., Boddu, J., Berthiller, F., Hametner, C., Stupar, R. M., Adam, G., & Muehlbauer, G. J. (2010). Transcriptome analysis of the barley-deoxynivalenol interaction: evidence for a role of glutathione in deoxynivalenol detoxification. Molecular Plant-Microbe Interaction, 23, 962–976. Gargouri-Kammoun, L., Gargouri, S., Rezgui, S., Trifi, M., Bahri, N., & Hajlaoui, M. R. (2009). Pathogenicity and aggressiveness of Fusarium and Microdochium on wheat seedlings under controlled conditions. Tunisian Journal of Plant Protection, 4, 135–144. Gibson, D. M., King, B. C., Hayes, M. L., & Bergstrom, G. C. (2011). Plant pathogens as a source of diverse enzymes for lignocellulose digestion. Current Opinion in Microbiology, 14(3), 264–270. Haratian, M., Sharifnabi, B., Alizadeh, A., & Safaie, N. (2008). PCR analysis of the Tri13 gene to determine the genetic potential of Fusarium graminearum isolates from Iran to produce Nivalenol and Deoxynivalenol. Mycopathologia, 166(2), 109–116. Hernandez-Nopsa, J. F., Wegulo, S. N., Panthi, A., Hallen-Adams, H. E., Harris, S. D., & Baenziger, P. S. (2014). Characterization of Nebraska isolates of Fusarium graminearum causing head blight of wheat. Crop Science, 54(1), 310–317. Hollingsworth, C. R., Motteberg, C. D., Wiersma, J. V., & Atkinson, L. M. (2008). Agronomic and economic responses of spring wheat to management of Fusarium head blight. Plant Disease, 92(9), 1339–1348. Jansen, C., von Wettstein, D., Schafer, W., Kogel, K. H., Felk, A., & Maier, F. J. (2005). Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proceedings of the National Academy of Sciences, 102(46), 16892–16897. Jennings, P., Coates, M. E., Turner, J. A., Chandler, E. A., & Nicholson, P. (2004). Determination of deoxynivalenol and nivalenol chemotypes of Fusarium culmorum isolates from England and Wales by PCR assay. Plant Pathology, 53(2), 182–190. Ji, L., Cao, K., Hu, T., & Wang, S. (2007). Determination of deoxynivalenol and nivalenol chemotypes of Fusarium graminearum isolates from China by PCR assay. Journal of Phytopathology, 155(7–8), 505–512. Karami-Osboo, R., Mirabolfathy, M., & Aliakbari, F. (2010). Natural deoxynivalenol contamination of corn produced in Golestan and Moqan areas in Iran. Journal of Agricultural Science and Technology, 12(2), 233–239. Kikot, G. E., Hours, R. A., & Alconada, T. M. (2009). Contribution of cell wall degrading enzymes to pathogenesis of Fusarium graminearum: a review. Journal of Basic Microbiology, 49(3), 231–241. Kimura, M., Tokai, T., Takahashi-Ando, N., Ohsato, S., & Fujita, M. (2007). Molecular and genetic studies of Fusarium trichothecene biosynthesis: pathways, genes, and evolution. Bioscience, Biotechnology and Biochemistry, 71(9), 2105–2123. Langevin, F., Eudes, F., & Comeau, A. (2004). Effect of trichothecenes produced by Fusarium graminearum during Fusarium head blight development in six cereal species. European Journal of Plant Pathology, 110(7), 735–746. Author's personal copy 916 Lee, J., Chang, I.-Y., Kim, H., Yun, S.-H., Leslie, J. F., & Lee, Y.W. (2009). Genetic diversity and fitness of Fusarium graminearum populations from rice in Korea. Applied and Environmental Microbiology, 75(10), 3289–3295. Leslie, J. F., & Summerell, A. B. (2006). The Fusarium laboratory manual. Ames: Blackwell Publishing Professional. 388 pp. Li, H. P., Wu, A.-B., Zhao, C.-S., Scholten, O., Löffler, H., & Liao, Y. C. (2005). Development of a generic PCR detection of deoxynivalenol- and nivalenol-chemotypes of Fusarium graminearum. FEMS Microbiology Letters, 243(2), 505–511. MacMillan, J. D., & Voughin, R. H. (1964). Purification and properties of a polyglacturonic acid- transeliminase produced by Clastridium multiformentans. Biochemistry, 3, 564–572. Maier, F. J., Miedaner, T., Hadeler, B., Felk, A., Salomon, S., Lemmens, M., Kassner, H., & Schaefer, W. (2006). Involvement of trichothecenes in fusarioses of wheat, barley and maize evaluated by gene disruption of the trichodiene synthase (Tri5) gene in three field isolates of different chemotype and virulence. Molecular Plant Pathology, 7(6), 449–461. Malihipour, A., Gilbert, J., Piercey-Normore, M., & Cloutier, S. (2012). Molecular phylogenetic analysis, trichothecene chemotype patterns, and variation in aggressiveness of Fusarium isolates causing head blight in wheat. Plant Disease, 96(7), 1016–1025. Miller, G. L. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry, 31(3), 426–428. Miller, J. D. (2002). Aspects of the ecology of Fusarium toxins in cereals. Advances in Experimental Medicine and Biology, 504, 19–27. Miller, J. D., Greenhalgh, R., Wang, Y., & Lu, M. (1991). Mycotoxin chemotypes of three Fusarium species. Mycologia, 83, 121–130. Möller, E. M., Chełkowski, J., & Geiger, H. H. (1999). Speciesspecific PCR assays for the fungal pathogens Fusarium moniliforme and Fusarium subglutinans and their application to diagnose maize ear rot disease. Journal of Phytopathology, 147(9), 497–508. Müllenborn, C., Steiner, U., Ludwig, M., & Oerke, E. C. (2008). Effect of fungicides on the complex of Fusarium species and saprophytic fungi colonizing wheat kernels. European Journal of Plant Pathology, 120(2), 157–166. Neissen, M. L., & Vogel, R. F. (1997). A molecular approach to the detection of potential trichothecene producing fungi. In A. Mesterhazy (Ed.), Cereals research communications, Proceedings of the Fifth European Fusarium Seminar, Szeged, Hungary (pp. 245–249). Szeged: Cereals Research Institute. Nicholson, P., Simpson, D. R., Weston, G., Rezanoor, H. N., Lees, A. K., Parry, D. W., & Joyce, D. (1998). Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiology and Molecular Biology of Plants, 53(1), 17–37. Nicholson, P., Gosman, N., Draeger, R., Thomsett, M., Chandler, E., & Steed, A. (2007). In H. T. Buck, J. E. Nisi, & N. Salomon (Eds.), The Fusarium head blight pathosystem; Status and knowledge of its components, in Wheat Production in Stressed Environments (pp. 23–36). Berlin: Springer. Eur J Plant Pathol (2017) 147:897–918 Nielsen, L. K., Jensen, J. D., Rodríguez, A., Jørgensen, L. N., & Justesen, A. F. (2012). TRI12 based quantitative real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. International Journal of Food Microbiology, 157(3), 384–392. Nishiuchi, T., Masuda, D., Nakashita, H., Ichimura, K., Shinozaki, K., Yoshida, S., Kimura, M., Yamaguchi, I., & Yamaguchi, K. (2006). Fusarium phytotoxin trichothecenes have an elicitor-like activity in Arabidopsis thaliana, but the activity differed significantly among their molecular species. Molecular Plant-Microbe Interactions Journal, 19(5), 512– 520. Oerke, E. C., Meier, A., Dehne, H. W., Sulyok, M., Krska, R., & Steiner, U. (2010). Spatial variability of fusarium head blight pathogens and associated mycotoxins in wheat crops. Plant Pathology, 59(4), 671–682. Ortega, L. M., Kikot, G. E., Astoreca, A. L., & Alconada, T. M. (2013). Screening of Fusarium graminearum isolates for enzymes extracellular and deoxynivalenol production. Journal of Mycology, 358140, 1–7. Panthi, A., Hallen-Adams, H., Wegulo, S. N., Nopsa, J. H., & Baenziger, P. S. (2014). Chemotype and aggressiveness of isolates of Fusarium graminearum causing head blight of wheat in Nebraska. Canadian Journal of Plant Pathology, 36(4), 447–455. Pariaud, B., Ravigné, V., Halkett, F., Goyeau, H., Carlier, J., & Lannou, C. (2009). Aggressiveness and its role in the adaptation of plant pathogens. Plant Pathology, 58(3), 409–424. Pasquali, M., & Migheli, Q. (2014). Genetic approaches to chemotype determination in type B-trichothecene producing Fusaria. International Journal of Food Microbiology, 189, 164–182. Pestka, J. J. (2007). Deoxynivalenol: toxicity, mechanisms and animal health risks. Animal Feed Science and Technology, 137(3–4), 283–298. Pestka, J. J. (2010). Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Archives of Toxicology, 84(9), 663–679. Phalip, V., Delande, F., Carapito, C., Goubet, F., Hatsch, D., LeizeWagner, E., Dupree, P., Van Dorsselaer, A., & Jetsch, J.-M. (2005). Diversity of the exoproteome of Fusarium graminearum grown on plant cell wall. Current Genetics, 48(6), 366–379. Pritsch, C., Muehlbauer, G. J., Bushnell, W. R., Somers, D. A., & Vance, C. P. (2000). Fungal development and induction of defense response genes during early infection of wheat spikes by Fusarium graminearum. Molecular Plant-Microbe Interactions Journal, 13(2), 159–169. Proctor, R. H., Hohn, T. M., & McCormick, S. P. (1995). Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Molecular Plant-Microbe Interactions Journal, 8(4), 593–601. Proctor, R. H., McCormick, S. P., Alexander, N. J., & Desjardins, A. E. (2009). Evidence that a secondary metabolic biosynthetic gene cluster has grown by gene relocation during evolution of the filamentous fungus Fusarium. Molecular Microbiology, 74(5), 1128–1142. Prodi, A., Purahong, W., Tonti, S., Salomoni, D., Nipoti, P., Covarelli, L., & Pisi, A. (2011). Difference in chemotype composition of Fusarium graminearum populations isolated Author's personal copy Eur J Plant Pathol (2017) 147:897–918 from durum wheat in adjacent areas separated by the Apennines in Northern-Central Italy. Plant Pathology Journal, 27(4), 354–359. Purahong, W., Nipoti, P., Pisi, A., Lemmens, M., & Prodi, A. (2013). Aggressiveness of different Fusarium graminearum chemotypes within a population from Northern-Central Italy. Mycoscience, 55(1), 63–69. Puri, K. D., & Zhong, S. (2010). The 3ADON population of Fusarium graminearum found in North Dakota is more aggressive and produces a higher level of DON than the prevalent 15ADON population in spring wheat. Phytopathology, 100(10), 1007–1014. Qiu, J., & Shi, J. (2014). Genetic relationships, Carbendazim sensitivity and mycotoxin production of the Fusarium graminearum populations from Maize, Wheat and Rice in Eastern China. Toxins, 6(8), 2291–2309. Reynoso, M. M., Ramirez, M. L., Torres, A. M., & Chulze, S. N. (2011). Trichothecene genotypes and chemotypes in Fusarium graminearum strains isolated from wheat in Argentina. International Journal of Food Microbiology, 145(2), 444–448. Ryu, J. C., Ohtsubo, K., Izumiyama, N., Nakamura, K., Tanaka, T., Yamamura, H., & Ueno, Y. (1988). The acute and chronic toxicities of nivalenol in mice. Fundamental and Applied Toxicology, 11(1), 38–47. Sarver, B. A. J., Ward, T. J., Gale, L. R., Broz, K., Kistler, H. C., Aoki, T., Nicholson, P., Carter, J., & O’Donnell, K. (2011). Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genetics and Biology, 48(12), 1096–1107. Schilling, A. G., Moller, E. M., & Geiger, H. H. (1996). Polymerase chain reaction-based assays for speciesspecific detection of F. culmorum, F. graminearum and F. avenaceum. Phytopathology, 86(5), 515–522. Schmale, D. G., Wood-Jones, A. K., Cowger, C., Bergstrom, G. C., & Arellano, C. (2011). Trichothecene genotypes of Gibberella zeae from winter wheat fields in the eastern USA. Plant Pathology, 60(5), 909–917. Schmale, D. G., Ross, S. D., Fetters, T. L., Tallapragada, P., WoodJones, A. K., & Dingus, B. (2012). Isolates of Fusarium graminearum collected 40–320 meters above ground level cause Fusarium head blight in wheat and produce trichothecene mycotoxins. Aerobiologia, 28(1), 1–11. Scoz, L. B., Astolfi, P., Reartes, D. S., Schmale, D. G., III, Moraes, M. G., & Del Ponte, E. M. (2009). Trichothecene mycotoxin genotypes of Fusarium graminearum sensu stricto and Fusarium meridionale in wheat from southern Brazil. Plant Pathology, 58(2), 344–351. Soltanloo, H., Ghadirzade Khorzoghi, E., Ramezanpour, S. S., & Kalateh Arabi, M. (2011). Genetic analysis of Fusarium head blight resistance in bread wheat. Australasian Plant Pathology, 40(5), 453–460. Spanic, V., Lemmens, M., & Drezner, G. (2010). Morphological and molecular identification of Fusarium species associated with head blight on wheat in East Croatia. European Journal of Plant Pathology, 128(4), 511–516. Stankovic, S., Levic, J., Petrovic, T., Logrieco, A., & Moretti, A. (2007). Pathogenicity and mycotoxin production by Fusarium proliferatum isolated from onion and garlic in Serbia. European Journal of Plant Pathology, 118(2), 165– 172. 917 Starkey, D. E., Ward, T. J., Aoki, T., Gale, L. R., Kistler, H. C., Geiser, D. M., Suga, H., Tόth, B., Varga, J., & O’Donnell, K. (2007). Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology, 44(11), 1191–1204. Suga, H., Karugia, G. W., Ward, T., Gale, L. R., Tomimura, K., Nakajima, T., Miyasaka, A., Koizumi, S., Kageyama, K., & Hyakumachi, M. (2008). Molecular characterization of the Fusarium graminearum species complex in Japan. Phytopathology, 98(2), 159–166. Sydenham, E. W., Thiel, P. G., Marasas, W. F. O., & Nieuwenhuis, J. J. (1989). Occurrence of deoxynivalenol and nivalenol in Fusarium graminearum infected under grade wheat in South Africa. Journal of Agricultural Food and Chemistry, 37(4), 921–926. Taheri, P., & Tarighi, S. (2010). Riboflavin induces resistance in rice against Rhizoctonia solani via jasmonate-mediated priming of phenylpropanoid pathway. Journal of Plant Physiology, 167(3), 201–208. Talas, F., Parzies, H., & Miedaner, T. (2011). Sources of resistance to Fusarium head blight within Syrian durum wheat landraces. Plant Breeding, 130(3), 398–480. Umpiérrez-Failache, M., Garmendia, G., Pereyra, S., RodríguezHaralambides, A., Ward, T. J., & Vero, S. (2013). Regional differences in species composition and toxigenic potential among Fusarium head blight isolates from Uruguay indicate a risk of nivalenol contamination in new wheat production areas. International Journal of Food Microbiology, 166(1), 135–140. Van der Lee, T., Zhang, H., van Diepeningen, A., & Waalwijk, C. (2015). Biogeography of Fusarium graminearum species complex and chemotypes: a review, Food Additives & Contaminants: Part A. Chem Anal Control Expo Risk Assess, 32(4), 453–460. Von der Ohe, C., Gauthier, V., Tamburic-Ilincic, L., Brule-Babel, A., Fernando, W., Clear, R., Ward, T. J., & Miedaner, T. (2010). A comparison of aggressiveness and deoxynivalenol production between Canadian Fusarium graminearum isolates with 3-acetyl and 15-acetyldeoxynivalenol chemotypes in field-grown spring wheat. European Journal of Plant Pathology, 127(3), 407–417. Waalwijk, C., Kastelein, P., de Vries, I., Kerenyi, Z., van der Lee, T., & Hesselink, T. (2003). Major changes in Fusarium spp. in wheat in the Netherlands. European Journal of Plant Pathology, 109(7), 743–754. Wagacha, J. M., & Muthomi, J. W. (2007). Fusarium culmorum: infection process, mechanisms of mycotoxin production and their role in pathogenesis in wheat. Crop Protection, 26(7), 877–885. Wan, Y. F., Yen, C., & Yang, J. L. (1997). Sources of resistance to head scab in Triticum. Euphytica, 94(1), 31–36. Wanyoike, W. M., Kang, Z., & Buchenauer, H. (2002). Importance of cell wall degrading enzymes produced by Fusarium graminearum during infection of wheat head. European Journal of Plant Pathology, 108(8), 803–810. Ward, T. J., Bielawsky, J. P., Kistler, H. C., Sullivan, E., & O’Donnel, K. (2002). Ancestral polymorphism and adaptive evolution in the thricothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proceedings of the National Academy of Sciences, 99(14), 9278–9283. Author's personal copy 918 Ward, T. J., Clear, R. M., Rooney, A. P., O’Donnell, K., Gaba, D., Patrick, S., Starkey, D. E., & Nowicki, T. W. (2008). An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genetics and Biology, 45(4), 473–484. Wegulo, S. N. (2012). Factors influencing deoxynivalenol accumulation in small grain cereals. Toxins, 4(11), 1157–1180. Williams, K. J., Dennis, J. I., Smyl, C., & Wallwork, H. (2002). The application of species-specific assays based on the polymerase chain reaction to analyze Fusarium crown rot of durum wheat. Australasian Plant Pathology, 31(2), 119–129. Willyerd, K. T., Li, C., Madden, L. V., Bradley, C. A., Bergstrom, G. C., Sweets, L. E., McMullen, M., Ransom, J. K., Grybauskas, A., Osborne, L., Wegulo, S. N., Hershman, D. E., Wise, K., Bockus, W. W., Groth, D., Dill-Mackey, R., Milus, R., Esker, P. D., Waxman, K. D., Adee, E. A., Ebelhar, S. E., Young, B. D., & Paul, P. A. (2012). Efficacy and stability of integrating fungicide and cultivar resistance to manage Fusarium head blight and deoxynivalenol in wheat. Plant Disease, 96(7), 957–967. Wood, T. M., & Bhat, M. (1988). Methods for measuring cellulase activities. Methods in Enzymology, 160(1), 87–112. Yli-Mattila, T., & Gagkaeva, T. (2010). Molecular chemotyping of Fusarium gramineaum, F. culmorum and F. cerealis isolates from Finland and Russia. In Y. Gherbawy & K. Voigt (Eds.), Molecular identification of fungi. Germany: Springer Verlag, Berlin. Yli-Mattila, T., Gagkaeva, T., Ward, T. J., Aoki, T., Kistler, H. C., & O’Donnell, K. (2009). A novel Asian clade within the Eur J Plant Pathol (2017) 147:897–918 Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Russian Far East. Mycologia, 101(6), 841–852. Yli-Mattila, T., Rämö, S., Hietaniemi, V., Hussien, T., CarlobosLopez, A. L., & Cumagun, C. J. R. (2013). Molecular quantification and genetic diversity of Toxigenic Fusarium species in northern Europe as compared to those in southern Europe. Microorganisms, 1(1), 162–174. Yoshida, M., Kawada, N., & Nakajima, T. (2007). Effect of infection timing on Fusarium head blight and mycotoxin accumulation in open and closed-flowering barley. Phytopathology, 97(9), 1054–1062. Zhang, J. B., Li, H.-P., Dang, F.-J., Qu, B., Xu, Y.-B., Zhao, C.-S., & Lia, Y.-C. (2007). Determination of the trichothecene mycotoxins chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China. Mycological Research, 111(8), 967–975. Zhang, H., Zhang, Z., van der Lee, T., Chen, W. Q., Xu, J., Xu, J. S., Yang, L., Yu, D., Waalwijk, C., & Feng, C. (2010). Population genetic analyses of Fusarium asiaticum populations from barley suggest a recent shift favoring 3ADON producers in southern China. Phytopathology, 100(4), 328– 336. Zhang, J. B., Wang, J. H., Gong, A. D., Chen, F. F., Song, B., Li, X., Li, H. P., Peng, C. H., & Liao, Y. C. (2013). Natural occurrence of Fusarium Head Blight, mycotoxins and mycotoxin producing isolates of Fusarium in commercial fields of wheat in Hubei. Plant Pathology, 62(1), 92–102.