Euphytica (2011) 178:247–259 DOI 10.1007/s10681-010-0309-6 Genetic variability of seed-quality traits in gamma-induced mutants of sunflower (Helianthus annuus L.) under water-stressed condition P. Haddadi • B. Yazdi-samadi • M. Berger M. R. Naghavi • A. Calmon • A. Sarrafi • Received: 9 August 2010 / Accepted: 11 November 2010 / Published online: 27 November 2010 Ó Springer Science+Business Media B.V. 2010 Abstract Sunflower is one of the major annual world crops grown for edible oil and its meal is a potential source of protein for human consumption. It contains tocopherol that decreases potential risk of chronic diseases in human. The objectives of the current research are to assess the genetic variability and to identify AFLP markers and candidate genes associated with seed-quality traits under well-irrigated and water-stressed conditions in gammainduced mutants of sunflower. Two mutant lines, M8-826-2-1 and M8-39-2-1, with significant increased level of oleic acid were identified that can be used in breeding programs for quality increase high oxidative stability and heart-healthy properties. P. Haddadi Laboratoire des Interactions Plantes Micro-organismes, UMR CNRS-INRA 2594/441, Chemin de Borde-Rouge Auzeville, BP 52627, 31326 Castanet Tolosan, France The significant increased level of tocopherol in mutant lines, M8-862-1N1 and M8-641-2-1, is justified by observed polymorphism for tocopherol pathway-related gene; MCT. The most important marker for total tocopherol content is E33M50_16 which explains 33.9% of phenotypic variance. One of the most important candidate genes involving fatty acid biosynthesis, FAD2 (FAD2-1), is linked to oleic and linoleic acids content and explained more than 53% of phenotypic variance. Common markers associated with different seed-quality traits in well-irrigated and water-stressed conditions could be used for markerassisted selection (MAS) in both conditions. Other markers, which are specific for one condition whereas linked to different traits or specific for a trait, could be useful for a given water treatment. Keywords Seed-quality traits
Gamma-induced mutants
AFLP markers
Candidate genes
Sunflower P. Haddadi
B. Yazdi-samadi
M. R. Naghavi Agronomy and Plant Breeding Department, Faculty of Agriculture, University of Tehran, Karaj, Iran P. Haddadi
A. Sarrafi (&) Laboratoire de Symbiose et Pathologie des Plantes, SP2, IFR 40, INP-ENSAT, 18 Chemin de Borde Rouge, BP 32607, 31326 Castanet Tolosan, France e-mail: sarrafi@ensat.fr M. Berger
A. Calmon UMR 1054 INRA/EIP - Laboratoire d’Agrophysiologie, Ecole d’Ingénieurs de Purpan. 75, Voie du TOEC, BP 57611, 31076 Toulouse Cedex 3, France Introduction Sunflower seed oil contains saturated and unsaturated fatty acids, as the lipid part of the oil, as well as tocopherol conferring antioxidant properties to the non-lipid part of oil. Fatty acids with 18 carbons are either saturated (C18:0; stearic acid) or unsaturated 123 248 (C18:1; oleic acid and C18:2; linoleic acid) (Dorrell and Vick 1997; Pérez-Vich et al. 2002). Among C18 fatty acids, oleic acid is more important because of higher oxidative stability, more resistance to heating and heart-healthy properties (Smith et al. 2007). Tocopherol belongs to the Vitamin E class of lipid soluble antioxidants that are essential for human nutrition. The function of tocopherol in human and animal systems is generally related to the level of a-tocopherol activity. Alpha-tocopherol has a maximum vitamin E activity (Kamal-Eldin and Appelqvist 1996). Among oil seed crops sunflower grains mainly contain a tocopherol, which accounts for more than 95% of the total tocopherols (Marwede et al. 2005). In sunflower seed oil, total tocopherol content represents the sum of a, b, c, and d tocopherol (Ayerdi Gotor et al. 2007). In sunflower, gamma-irradiation has been used for inducing genetic variability for different characters such as osmotic-related traits (Poormohammad Kiani 2007), resistance to Phoma macdonaldii (Abou Al Fadil et al. 2004), germination traits (Alejo-James et al. 2004), morphological traits (Nabipour et al. 2004) and organogenesis (Rachid Al-Chaarani et al. 2004). Mutagenesis has been successfully used for developing variation in the fatty acid profile of sunflower and some mutants with altered fatty acid content have been developed (Osorio et al. 1995; Fernández-Martı́nez et al. 1997; Cantisán et al. 2000; Lacombe and Berville 2001; Pérez-Vich et al. 2004; Schuppert et al. 2006). High palmitic acid mutants; 275HP, CAS-5 and CAS-12 (Fernández-Martı́nez et al. 1997), and the high stearic acid line, CAS-3, as well as two lines with midstearic acid content, CAS-4 and CAS-8, were obtained (Osorio et al. 1995). Developing midstearic acid sunflower lines (CAS-19, es1es1Es2Es2, and CAS-20, Es1Es1es2es2) from a high stearic acid mutant is also reported (Pérez-Vich et al. 2004). The genetic studies of CAS-3, CAS-4 and CAS-8 revealed that total stearic acid increased as a result of reduced conversion rate of stearic to oleic acid while conversion rate of palmitic to stearic was not changed (Cantisán et al. 2000). Enzymatic actives for stearoyl-ACP desaturase and acyl-ACP thioesterase in above-mentioned high stearic acid mutant showed that stearoyl-ACP desaturase activity was reduced whereas acyl-ACP thioesterase activity was increased (Cantisán et al. 2000). Prevenets, high oleic acid mutants, have been so far developed by 123 Euphytica (2011) 178:247–259 chemical mutagenesis (dimethyl-sulfate) (Soldatov 1976). In genotypes with high oleic acid content, in addition to 5.7 kb an extra 7.9 kb EcoRI restriction fragment (EcoRI-D12HOS) was observed in comparison with genotypes with normal oleic acid content. A novel HindIII restriction fragment of more than 15 kb (HindIII-D12HOS) instead of 8 kb was also reported (Lacombe and Berville 2001). Co-segregation of FAD2-1 with Ol in high-oleic sunflower mutant was also reported (Schuppert et al. 2006). Three loci, Tph1 (m), Tph2 (g) and d, can control the level of a tocopherol in sunflower seed (Hass et al. 2006; Tang et al. 2006; Vera-Ruiz et al. 2006). The amount of b tocopherol is increased by d locus in mutant inbred lines (m m) whereas the level of c tocopherol is enhanced by g locus in mutant inbred lines (g g) as a result of knockout of c tocopherol methyl transferase (Hass et al. 2006). 2-Methyl-6-phytyl-1,4-benzoquinone/2-methyl-6-solanyl-1,4-benzoquinone methyltransferase (MPBQ/MSBQ-MT) paralogs from sunflower (MT1 and MT2) were isolated and sequenced (Tang et al. 2006). INDEL markers were developed for MT1 and MT2 and the MT1 Locus was mapped to linkage group 1 (Tang et al. 2006). In this research the genetic variation of seed-quality traits such as total tocopherol, protein, oil and fatty acids contents, as well as polymorphism for AFLP markers and some candidate genes (CGs) in gamma-induced mutants of sunflower under well-irrigated and waterstressed conditions are studied. Materials and methods Plant materials and experimental conditions The sunflower restorer inbred line ‘AS613’ has been produced in our laboratory from a cross between two genotypes (‘ENSAT-125’ and ‘ENSAT-704’) through a single-seed descent (SSD) programme (Sarrafi et al. 2000). The seeds of ‘AS613’ were exposed to gamma rays at the Atomic Energy Center (Cadarache, France) with a dose of 75 Grays. Mutants population have been developed through modified SSD method (Sarrafi et al. 2000). Regarding to morpho-physiological studies, among a population of about 2000 gamma-induced mutants of sunflower, 23 M8 mutants were selected for quantitative analysis. Two experiments were undertaken in randomized Euphytica (2011) 178:247–259 complete block design (water treatment as main plot) with three replications at Tehran University-Iran2007. Seeds of mutants and original line (AS613) were sown in the field under well-irrigated and waterstressed conditions. Each genotype per replication consisted of one row, 4 m long, 50 cm between rows and 25 cm between plants in rows. The distance between replications of well-irrigated and waterstressed treatments was 7 m. The so-called ‘wellirrigated’ condition plots were irrigated once a week, whereas for the second condition (water-stressed), water deficit was started 45 days after sowing at the stage near flower bud formation and continued up to maturity. 249 Solvent extraction of lipids The extraction of the total oil content was performed by hexane (n-hexane, Prolabo/Subra, Toulouse, France) extraction using an accelerated solvent extractor apparatus (ASE 200, Dionex, France) with an isopropanol/hexane mixture (5:95 v/v) during 20 min. Then, the solvent was removed from the extracts under low-pressure evaporation (Rotavapor, Bioblock Scientific HS 40 HUBER, Heildorph, Germany). Lipid extracts were weighed and tocopherol content was analyzed. Tocopherol determination Trait measurements Seed-quality traits Near infrared reflectance (NIR) spectroscopy, has been successfully used as an alternative technique to classical methods to determine multiple parameters of seed quality traits in sunflower, such as proteins, oil content, fatty acid compositions (Pérez-Vich et al. 1998; Velasco and Becker 1998; Biskupek-Korell and Moschner, 2007; Ebrahimi et al. 2008, 2009). Seed protein content (SPC), seed oil content (SOC), palmitic acid content (PAC), stearic acid content (SAC), oleic acid content (OAC) and linoleic acid content (LAC) were measured in mutants and original line (AS613) in each replication for both conditions by the FOSS NIRSystems 6500. Twenty grams of sunflower seeds per genotype per condition per replication were ground in a Knifetec 1095 Sample Mill (1975, Foss Tecator, Höganäs, Sweden) three times for 10 s each. A FOSS NIR Systems 6500 spectrophotometer (Foss Analytical, Denmark) was used to collect spectra from the ground sunflower seeds using a small round cup with a quartz window. The reflectance (R) of each sample was measured as log of 1/R from 400 to 2500 nm at 2 nm intervals. Pre-measurements for total tocopherol content (TTC) were carried out by both FOSS NIRSystems 6500 and reference method (HPLC, ISO 9936, 1997) for core collection (44 samples). Total oil content was extracted and TTC was thus determined using the following subsections. Total tocopherol was achieved using a high-performance liquid chromatography (HPLC) (SpectraPhysics, Thermo Separation Products, USA) with a normal-phase LiChrosorb Si60 column, 250 cm 9 4 mm 9 5 lm (CIL, Cluzeau, France) (ISO 9936, 1997). The mobile phase was a mixture of hexane/ isopropanol (99.7:0.3 v/v) at 1 ml/min flow rate. One gram of oil sample was diluted in 25 ml of hexane and 20 ll was injected into the HPLC. Detection was performed with fluorescence detector (excitation wavelength = 298 nm and emission wavelength = 344 nm: Waters 2475 multi k). Total tocopherol content was calculated as the sum of a, b, c, and d-tocopherol contents and expressed in mg kg-1 oil. A modified partial least-squares regression (MPLS) model, after 4 outlier elimination passes (WINISI 1.02—Infrasoft International LLC) was used. The performance of our NIRS model, for the estimation of tocopherols was determined by the following parameters: the standard error of calibration (SEC), the coefficient of determination in calibration (RSQ), the standard error of cross-validation (SECV), the coefficient of determination of cross-validation (1 - VR) and the standard error of prediction (SEP). We have obtained a high significant correlation between the HPLC analysis and the NIRS predictions for TTC (R2 = 0.76) indicating the NIRS method can be used to determine total tocopherol content. Then, TTC was measured in mutants and original line (AS613) in each replication for both conditions by the FOSS NIRSystems 6500. 123 250 Euphytica (2011) 178:247–259 Molecular analysis The genomic DNA of original and mutant lines were isolated according to the method of extraction and purification presented by Porebski et al. (1997) and DNA quantification was performed by picogreen. The AFLP procedure is previously described by Darvishzadeh et al. (2008). Different MseI/EcoRI primer combinations were used for AFLP genotyping (Table 1). Polymorphism of some important candidate genes; tocopherol pathway-related, phosphoglyceride transfer-related, enzymatic antioxidant-related, drought-responsive and fatty acid biosynthesis-related genes were studied. Reactions catalyzed by proteins of the tocopherol and fatty acid pathways are illustrated in Figs. 1 and 2, respectively. Respective sequence data for candidate genes coding for these proteins were obtained from The Arabidopsis Information Resource, TAIR, (www.arabidopsis.org). In order to seek the helianthus homolog sequences to the Arabidopsis genes, we used the Compositae EST assembly clusters, available at the Helianthus-devoted bioinformatics portal Heliagene (www.heliagene.org). Table 1 Seventeen AFLP primer combinations and their polymorphic markers used for genotyping sunflower mutants and their original line (AS613) Primer combinations Number of polymorphic markers E40M59(EAGC 9 MCTA) 9 E40E50(EAGC 9 MCAT) E38M62(EACT 9 MCTT) 9 8 E37M50(EACG 9 MCAT) 27 E37M62(EACG 9 MCTT) 9 E37M48(EACG 9 MCAC) 8 E33M50(EAAG 9 MCAT) 16 E33M49(EAAG 9 MCAG) 15 E33M59(EAAG 9 MCTA) 15 E33M47(EAAG 9 MCAA) 13 E33M60(EAAG 9 MCTC) 11 E33M62(EAAG 9 MCTT) 10 E33M48(EAAG 9 MCAC) 9 E33M61(EAAG 9 MCTG) 8 E31M50(EAAA 9 MCAT) 13 E31M62(EAAA 9 MCTT) 10 E31M48(EAAA 9 MCAC) Total 123 10 200 The Helianthus EST clusters presenting the reciprocal blast with the highest score and lowest E value with regarding to the original Arabidopsis genes were chosen for our studies. All Primers were designed by MATLAB. Four various primer combinations per each candidate gene were tested on agarose gel. Primers used for PCR are summarized in Table 2. The PCR program was: 4 min at 94°C followed by 35 cycles; 30 s at 94°C, 30 s at 55°C, 1 min at 72°C and at last, 5 min at 72°C. Statistical analysis The data were analyzed using SPSS. The association between AFLP markers and candidate genes with the quantitative traits was estimated through stepwise multiple regression analysis, where each quantitative trait was considered as a dependent variable while AFLP markers and candidate genes were treated as an independent variable. To select independent variables for the regression equation, F-values with 0.045 and 0.099 probabilities were used to enter and remove, respectively. Multiple regression analysis has been used to identify molecular markers associated with morphological and yield traits in some crops (Virk et al. 1996; Vijayan et al. 2006). Results Phenotypic variation Results of analysis of variance show significant genotypic effect (Mutants) for seed-quality (Table 3) trait under well-irrigated and water-stressed conditions. The effect of water treatment is not significant for unsaturated fatty acid content (oleic and linoleic acid) whereas it is significant for TTC, SPC, SOC and saturated fatty acid content (Table 3). Characteristics of sunflower M8 mutant lines in both conditions for seed-quality traits are also summarized in Table 3. Regarding the range of mutant lines, variation for all studied traits was observed and some mutants presented significant higher values compared with the original line. Molecular analysis Seventeen AFLP primer combinations and their polymorphic markers used for genotyping mutants 2-C-methyl-D-erythritol 4-phosphate Arogenic acid MCT Tyrosine AS613 Shikimate pathway M8-641-2-1 251 M8-862-1N1 Euphytica (2011) 178:247–259 1600 bp 1200 bp 2-C-methyl-D-erythritol 4 (Cytidine 5’-phospho) p-hydroxyphenylpyruvate Isoprenoid Homogentisic acid Phytyl pyrophospate Homogenitisate phytyltransferase (VTE2) -tocopherol VTE4 -tocopherol M8-381-1-1 2, 3-Dimethyl-5-phytyl-1, 4- benzoquinol M8-641-2-1 2-Methyl-6-phytyl-1,4-benzoquinol (MPBQ) 2000 bp -tocopherol -tocopherol methyl-transferase (VTE4) -tocopherol Fig. 1 Tocopherol biosynthetic pathway; ‘2-C-methyl-D-erythritol 4-phosphate’ is converted into ‘2-C-methyl-D-erythritol 4 (Cytidine 50 -phospho)’ by 2-C-methyl-D-erythritol 4-phosphate cytidyl transferase (MCT).‘2-Methyl-6-phytyl-1,4-benzoquinol’ (MPBQ) is formed after the condensation of homogentisic acid (HGA) and phytyl pyrophosphate (PDP) by homogenitisate phytyltransferase (VTE2). a-tocopherol can be generated by methylation of c-tocopherol via c-tocopherol methyl- transferase (VTE4) (D’Harlingue and Camara 1985). b-tocopherol is formed from d-tocopherol by methylation of the 5 position by VTE4 (Norris et al. 2004).The studied candidate genes are also highlighted in bold. Gel electrophoretic separation of candidate gene–PCR products from original line (AS613) and some mutants are presented with the corresponding metabolic pathway and their original line (AS613). The number of polymorphic markers varied from 8 to 27 for different primer combinations (Darvishzadeh et al. 2008). Polymorphisms are also observed for the studied candidate genes for original line (AS 613) and some mutants (Fig. 3). The results of marker identification for different traits under well-irrigated and waterstressed conditions are summarized in Table 4. Results revealed that the number of AFLP marker and candidate gene (CG) associated with seed-quality traits ranged from 4 to 6 depending on trait and conditions. The percentage of phenotypic variance (R2) explained by each marker or candidate gene associated with the traits ranged from 4.4% to 53.3%. The most important marker for TTC is E33M50_16 and explained 33.9% of phenotypic variance. One of the most important candidate genes involving tocopherol pathway (Fig. 1), homogenitisate phytyltransferase (VTE2), is linked to TTC (Table 4). The E31M50_12 marker correlated with SPC is identified in well-irrigated condition and explained 35% of phenotypic variance. The largest amount of 123 252 Euphytica (2011) 178:247–259 FACII AS 613 M8-52-1-1 Palmitic acid (16:0) 2000 bp Stearoyl ACP desaturase – PC 19 500 bp Triacylglycerols M8-826-2-1 stearoyl-ACP desaturase Oleic acid (18:1) M8-39-2-1 FatB- PC 22 acyl-ACP thioesterase AS 613 Stearic acid (18:0) 1500 bp FAD2-1– PC 18 900 bp FAD2 FAD2-2 – PC 17 500 bp FAD2-3 – PC 14 linoleic acid (18:2) FAD2-3 – PC 15 600 bp Fig. 2 Simplified fatty acid biosynthetic pathway. Stearic acid is formed from palmitic acid by FACII, which lengthens palmitic acid (16:0) by two carbon atoms to produce stearic acid (18:0) (Pleite et al. 2006). Stearic acid can be either desaturated by D9-desaturase (stearoyl-ACP desaturase) which catalyses the first desaturation of stearic acid (18:0) to oleic acid (18:1) or hydrolyzed by acyl-ACP thioesterase (Heppard et al. 1996; Lacombe and Berville 2001; Vega et al. 2004). Finally, linoleic acid is formed from oleic acid by D12desaturase (oleoyl-PC desaturase; FAD2), which catalyses the second desaturation of oleic acid (18:1) to linoleic acid (18:2) (Garcés and Mancha 1991). The studied candidate genes are also highlighted in bold. Gelelectrophoretic separation of candidate gene–PCR products from original line and mutants are presented with the corresponding metabolic pathway. PC primer combination phenotypic variance (R2) explained by E37M50_10 for SOC is 35.3%. Under water-stressed condition, association between SEC14 and SOC is observed. Among 11 identified markers for PAC in both conditions, E37M50_20 is most important with R2 = 28.6%. Under well-irrigated condition, the correlation between POD and PAC is also observed. Two common markers; E33M59_6 and E31M50_5, are detected for SAC. One of the most important candidate genes involving fatty acid biosynthesis (Fig. 2), FAD2 (FAD2-1), is linked to OAC and LAC and explains more than 53% of phenotypic variance (Table 4). traits. Mutant line, M8-862-1N1, presents significant increased level of tocopherol (403.78 mg kg-1oil compared with 314.3 mg kg-1oil in original line AS613; Table 3). Mutant lines, M8-826-2-1 and M8-392-1, with significant increased level of oleic acid (70.3 mg 100 mg -1oil in M8-826-2-1 mutant compared with 29.2 mg 100 mg-1oil in original line AS613; Table 3) are developed by gamma rays with a dose of 75 Grays in our research. These mutants can be used in breeding programs because of high oxidative stability and heart-healthy properties. Molecular genetic studies have been carried out in the aforementioned population through AFLP markers and candidate genes (CGs). The results of marker identification show that some AFLP markers and candidate genes are associated with several traits and some others are specific for only one trait (Table 4). Among all studied candidate genes involving tocopherol biosynthetic pathway, polymorphisms were observed for VTE4, VTE2 and MCT genes among some mutants and original line (Fig. 1). Endrigkeit et al. (2009) reported that in rape seed genotypes, Discussion The large genetic variability observed among mutant lines for the studied traits revealed that the efficiency of gamma-irradiation for inducing genetic variation in sunflower for seed-quality traits. Some mutants have advantages over the original line ‘AS613’ for different 123 Target gene Accession AGI-Arabidobsis Homologue with Heliagene cluster Primer pair combination Sequence of primer (50 –30 ) Forward Reverse Tocopherol pathway-related genes VTE4 AT1G64970.1 HuCL02246C001 1 ATCCGTATGATTGAACAAGC ATGTGCTCTCCACTCTCCATTG 2 GTTTGGTCAATGGAGAGTG ATCCTTCAATCATTAGTGGC VTE2 AT2G18950.1 HuCL02840C003 3 TGCCACAAGAGCAAATCGCTTC TTTGGGCACTCTTCATAAG MCT AT2G02500.1 HuCL00002C009 4 CAAAGTCTTCACCACAAATG ACCTCATCCCATCTTCTTCC Euphytica (2011) 178:247–259 Table 2 Primers used for PCR Phosphoglyceride transfer-related genes PGT Cytosolic AT1G75170.1 AT3G24840.1 HuCL10527C001 HuCL09897C001 5 6 TATGTCCATCTTTCGGCGTC ATGATAACCGTGTGGATAGC ATGGTGTCTTTAGCGGTTC ATGCTAAACTGGAGGAAAGC SEC14 AT2G21540.2 HuCL00667C001 7 CAAGGAAGGATTTCACCGTG AAGGCGGTTGATGCTTTACG Enzymatic antioxidant-related genes POD AT1G14540.1 HuCL03143C001 8 GACTTGGAAGAAGAGATTCAC ATTGTCAGCATACTCGGTC CAT AT1G20620.1 HuCL00001C054 9 AAACTACCCTGAGTGGAAG AATGAATCGTTCTTGCCTG GST AT1G02930.1 HuCL00790C003 10 AAAGAGCACAAGAGTCCTG ACTTATTTGAGTGGGCAAC Drou AT5G26990.1 HuCL02051C001 11 TTGTTGAGGAGGGAACTAAG GTCATCACCAAGAATCGTCG SPL2 AT5G43270.1 HuCL10252C001 12 ATTTGATGGGAAGAAGCGG CATTGTGGTCAGAAAGCCTC Dehydrin AT3G50980.1 HuCL00053C009 13 AAGTTCTCCAAACCGACGAG ACAACCACAGTGAAACCAC Drought-responsive genes Fatty acid biosynthesis-related genes FAD2a FAD2-3 _ AY802998.1 14 GCCTTATTCTACATTCTGCTC ATCCCATAGTCTCGGTCTAC HuCL07925C001 15 GCCTTATTCTACATTCTGCTC AATCGCCTTTGTTGCTTCC FAD2-2 _ AY802993.1 16 GGTCTGTCATCCGTTCATTC GCGAATCGGTCATAATACC FAD2-1 _ HuCL00141C001 DQ075691.1 17 18 GGTCTGTCATCCGTTCATTC GAGAAGAGGGAGGTGTGAAG AGTCCCGTCAAACTGATAG GCCATAGCAACACGATAAAG HuCL00406C001 19b GAGAAGAGGGAGGTGTGAAG ACAAAGCCCACAGTGTCGTC HuCL00103C001 20 GACGTTTCAATCAGACCTGT GCATTGTTTGGTAAGTAGGC 21 GCCTACTTACCAAACAATGC TATTTTTGTGTAGGCGGTTT Stearoyl ACP desaturase AT1G08510.1 HuCL03123C002 22 TTACACATTCGGCTTATCG TGGTTGATAAAGGTTCTCGGG 23 TTACACATTCGGCTTATCG GCACATTTCTGGTGTTGAACCG 24 ACTGAGGTGAATGGGAGTAG GCACATTTCTGGTGTTGAACCG 253 123 FatB AT2G43710.1 254 123 Table 2 continued Target gene Accession FatA AGI-Arabidobsis Homologue with Heliagene cluster AT3G25110.1 HuCL04107C001 Primer pair combination Sequence of primer (50 –30 ) Forward Reverse 25 AATAAGACGGCGACTGTTG TTCAATTTCAACCACATCA The candidate genes are: tocopherol methyl-transferase (VTE4), homogenitisate phytyltransferase (VTE2), 2-C-methyl-D-erythritol 4-phosphate cytidyl transferase (MCT), phosphoglyceride transfer (PGT), cytosolic, phosphatidylinositol transporter (SEC14), peroxidase (POD), glutation-s-transferase (GST), catalase (CAT), drought-responsive (Drou, SPL2), dehydrin, FAD2 (FAD2-1, FAD2-2, FAD2-3), stearoyl ACP desaturase and acylACP thioesterase (FatA, FatB) a Sequences of FAD2 used for primer design were obtained from GenBank b Specific primer for high OAC*(Bervillé et al. 2009) Table 3 Characteristics of sunflower M8 mutant lines for seed-quality traits in well-irrigated (WI) and Water-stressed (WS) conditions Trait Mutants WI Mean 314.3 26.8 32.6 5.9 5.8 29.2 59.5 WS 277.5 27.2 32.0 6.5 7.0 28.1 60.6 Some mutant lines Range Effect M8-826-2-1 M8-133-2 M8-186-1 M8-143-2 M8-862-1N1 Ma Wb WI WS WI WS WI WS WI WS WI WS WI WS WI WS WI WS 312.1 27.26 34.8 5.9 6.0 29.1 60.2 274.9 27.9 32.4 6.0 6.8 29.7 59.6 228.9–403.7 22.2–31.0 27.2–42.5 4.6–7.1 5.1–7.4 13.2–65.3 26.0–75.9 134.9–395.4 23.2 –31.1 27.0–39.7 4.8–6.8 5.1–7.3 14.3–68.8 23.0–74.6 292.9 30.0 36.3 4.7* 5.8 70.3* 26.0* 303.1 31.2 35.9 4.8* 6.3 68.8* 23.0* 284 31.0* 27.8 5.5 6.7 29.1 59.3 261.5 30.0* 29.8 6.1 7.3 22.9 65.7 387.4* 22.2 42.5* 7.0** 5.3 13.2* 75.9** 365.1* 27.7 33.8 6.8 6.1 14.3* 74.5** 342.1 30.5 37.3* 6.4 7.4* 35.2 53.9 345.7 30.0 35.7* 6.1 6.8 36.6 52.6 403.7* 24.4 40.7* 6.5 5.2 18.9 70.6 395.5* 23.3 39.2* 6.9 5.2 16.3 72.9 ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** * ** * ** NS NS All significant increasing or decreasing are highlighted in bold Note: TTC total tocopherol content, SPC seed protein content, SOC seed oil content, PAC palmitic acid content, SAC stearic acid content, OAC oleic acid content, LAC linoleic acid content *, ** Significant difference with original line (AS613) at 0.05 and 0.01 probability level, respectively a M mutants effect b W water treatment effect Euphytica (2011) 178:247–259 TTC (mg kg-1 oil) SPC (g 100 g-1 dry matter) SOC (g 100 g-1 dry matter) PAC (mg 100 mg-1 oil) SAC (mg 100 mg-1 oil) OAC (mg 100 mg-1 oil) LAC (mg 100 mg-1 oil) Original line (AS613) Euphytica (2011) 178:247–259 255 Table 4 AFLP markers and candidate genes correlated with seed-quality traits in a population of sunflower mutants and original line (AS613) under well-irrigated and water-stressed conditions Traits TTC SPC SOC PAC Well-irrigated condition OAC LAC Water-stressed condition P-Value Marker R2% 6.8 <0.0001 E40M59_5 30.7 6.7 <0.0001 10.1 \0.0001 E37M50_7 15.7 5.1 <0.0001 5.5 <0.0001 E33M59_7 11.2 3.5 0.003 7.0 5.1 \0.0001 E33M59_2 10.7 3.5 0.002 E37M50_7 5.0 3.0 0.007 7.0 2.6 0.01 E31M50_12 35.0 8.4 \0.0001 E37M50_12 23.0 7.7 \0.0001 E37M50_10 19.0 5.8 <0.0001 E40M59_7 19.2 4.8 <0.0001 E31M48_1 11.2 5.2 \0.0001 E33M61_6 13.8 6.2 <0.0001 E37M62_7 12.1 5.2 \0.0001 E33M49_7 16.0 7.2 \0.0001 E40M59_7 6.1 3.8 <0.0001 E33M47_2 11.3 3.5 0.003 E37M50_10 E31M50_6 35.3 22 7.1 6.3 <0.0001 <0.0001 E33M59_4 E33M47_6 21.3 32.0 6.4 7.7 \0.0001 \0.0001 E38M62_7 12.9 7.3 <0.0001 E37M50_6 14.3 7.4 <0.0001 E38M62_8 10.5 4.4 \0.0001 E33M47_1 10.4 4.9 \0.0001 Marker R% E37M50_9 32.7 E33M50_16 33.9 E40M59_5 10.5 E40M50_7 T- Value VTE2 T- Value P-Value E37M50_10 9.1 4.1 0.001 SEC14 4.9 3.2 0.005 E33M60_8 26.8 6.3 <0.0001 E37M50_20 28.6 10.1 <0.0001 FAD2-1 25.1 6.8 <0.0001 E33M61_5 22.9 7.9 \0.0001 E40M59_6 13.6 3.6 0.002 E40M50_8 17.0 6.0 \0.0001 E33M50_13 6.9 3.5 0.003 E37M50_3 8.5 6.1 \0.0001 E33M59_11 6.0 3.2 0.005 E33M50_8 8.7 3.9 0.001 6.7 2.7 0.01 E33M50_13 28.9 9.6 \0.0001 E33M61_3 37.4 5.5 \0.0001 E33M59_6 27.3 8.8 <0.0001 E33M59_6 21.7 6.0 <0.0001 E31M50_5 14.1 5.2 <0.0001 E31M50_5 14.1 6.0 <0.0001 Drou E33M61_6 12.1 7.5 5.3 3.7 \0.0001 0.002 E37M50_20 E33M60_4 10.2 6.3 4.0 3.3 0.001 0.004 <0.0001 POD SAC 2 FAD2-1 44.3 11.7 \0.0001 FAD2-1 52.8 7.5 E33M60_8 19.4 3.6 0.002 E33M60_8 16.4 3.9 0.001 E33M59_10 8.0 5.4 \0.0001 E33M61_1 7.5 2.8 0.012 E33M59_8 9.0 4.3 \0.0001 E37M50_9 6.2 2.6 0.017 E33M59_11 4.4 3 <0.0001 0.009 FAD2-1 43.7 9.5 \0.0001 FAD2-1 53.3 9.7 E33M60_8 19.3 6.1 <0.0001 E33M60_8 18.2 5.7 <0.0001 E40M59_6 8.6 3.3 0.004 E38M62_6 6.8 4.4 \0.0001 E33M49_13 6.6 4.2 0.001 E33M47_10 7.1 3.9 0.001 TTC total tocopherol content, SPC seed protein content, SOC seed oil content, PAC palmitic acid content, SAC stearic acid content. The candidate genes are: homogenitisate phytyltransferase (VTE2), phosphatidylinositol transporter (SEC14), peroxidase (POD), drought-responsive (Drou). Common markers are also shown as bold face VTE4 was anchored to the end of chromosome A02, where also two QTLs for a-tocopherol content had been identified. Primer combination corresponding to MCT gene (PC 4; Table 2) led to PCR fragment of about 1.2 kb in M8-862-1N1 and M8-641-2-1 Lines and 1.6 kb in AS613 (Fig. 1). The increased level of 123 M8-78-1 M8-653 M8-133-2 M8-352-2-2 M8-381-1-1 AS 613 M8-263-2 M8-186-1 M8-135-2 M8-36-2 M8-338-2-2 M8-16-2 M8-39-2-1 M8-641-2-1 M8-862-1N1 M8-575-1 M8-652-1 M8-826-2-1 M8-143-2 M8-32-1-1 M8--133-1 M8-375-1 M8-52-1-1 Fig. 3 Polymorphisms for candidate gene–PCR products among original line (AS613) and mutants. a phosphatidylinositol transporter (SEC14)-PC7, b catalase (CAT)-PC9, c dehydrin-PC13, d peroxidase (POD)-PC8 and e phosphoglyceride transfer (PGT)-PC5. PC Primer combination Euphytica (2011) 178:247–259 M8-417-1 256 2500 bp 2000 bp 1500 bp a 1000 bp 800 bp b 1000 bp c 1500 bp 1000 bp 800 bp d 2500 bp 2000 bp 1500 bp e tocopherol content in both lines with a truncated MCT gene might be explained by the possible deletion of an inhibitor-binding domain in the promoter region of the gene. The polymorphisms for some Phosphoglyceride transfer-related genes are also observed among mutants and original line (Fig. 3). The level of TTC, SOC, PAC and LAC are significantly increased in M8-186-1 line (Table 3) and polymorphism for phosphatidylinositol transporter (SEC14) is also observed compared with AS613 (Fig. 3). The level of SOC is significantly increased in M8-52-1-1 line (40.2 g 100 g-1 dry matter in M8-52-1-1 mutant compared with 32.6 g 100 g-1 dry matter in original line AS-613) and polymorphism for stearoyl ACP desaturase, phosphatidylinositol transporter (SEC14), CAT, POD and PGT genes is also observed compared with AS613 (Figs. 2, 3). It has been reported that SEC14 domains exist in proteins from plants, yeast and mammals (Saito et al. 2007). Wide range of lipids, phosphatidylglycerol and tocopherols were known as ligands for SEC14 domain-containing proteins (Saito et al. 2007). Some enzymatic antioxidant-related genes such as peroxidase (POD) and catalase (CAT) present polymorphisms in some mutant lines compared with the 123 original line; AS613 (Fig. 3). The association between POD gene, enzymatic antioxidant, and PAC is observed (Table 4). The interdependence between antioxidant and lipid peroxidation has been reported (Semchuk et al. 2009). In plants, the protection of photosynthetic apparatus and polyunsaturated fatty acids from oxidative damage caused by reactive oxygen species (ROS) are the main function of antioxidant (Trebst et al. 2002; Cela et al. 2009; Semchuk et al. 2009). Primer combination corresponding to Dehydrin gene (PC 13; Table 2) led to specific PCR fragment of about 1 kb in M8-417-1, M8-826-2-1, M8-39-2-1 and M8-186-1 Lines (Fig. 3). Dehydrin is a gene of the D-11 subgroup of late-embryogenesis-abundant (LEA) proteins (Dure et al. 1989; Close et al. 1993), associated with drought tolerance in sunflower (Ouvrard et al. 1996; Cellier et al. 1998). In sunflower three FAD2 genes have been isolated whereas from both cotton and soybean two and from Arabidopsis only a single FAD2 genes have been identified (Heppard et al. 1996; Liu et al. 1997; Martı́nez-Rivas et al. 2001). In the present study, sequences of FAD2 used for primer design were obtained from GenBank, closet homologue in Helianthus is indicated as reference. Primer combinations corresponding to FAD2_1 gene (PC 18; Table 2) led to high oleic acid specific amplification Euphytica (2011) 178:247–259 fragments of about 1.5 kb in M8-826-2-1 and M8-392-1 Lines. In contrast, primer combinations corresponding to FAD2_2 and FAD2_3 genes just led to nonspecific bands in mutants and original line (Fig. 2). These results suggest that the high oleic mutation in gamma-induced sunflower population interferes with the mutation in FAD2_1 gene. FAD21 is seed specific and strongly expressed in developing seeds (Martı́nez-Rivas et al. 2001). Co-segregation of FAD2-1 with Ol gene has been shown and it has been also assigned to linkage group 14 in sunflower (Schuppert et al. 2006). The high association between FAD2-1 gene and E33M60_8 with OAC and LAC can be explained by correlation between OA and LA as well as by a specific gene for D12-desaturase (oleoyl-PC desaturase), which catalyses the second desaturation of oleic acid (18:1) to linoleic acid (18:2) (Garcés and Mancha, 1991). High oleic acid mutants can be developed either by the upstream desaturation of stearic acid into oleic acid by D9 desaturase or by the downstream desaturation of oleic acid by D12 desaturase. High significant and negative correlation between OA and LA (Ebrahimi et al. 2008) is justified by opposite coefficient of their common markers (Table 4). This phenomenon poses potential challenges to breeders for simultaneous improvement of both traits. However, independent markers for OA and LA identified in our research (Table 4) provide opportunity for simultaneous improvement of these two traits in sunflower. Two stable markers, E40M59_5 and E37M50_7, for TTC are identified in both conditions (Table 4). The changes in TTC during plant responses to drought stress can be characterized by two phases. In the first phase, increased TTC contribute to avoid oxidative damage by quenching reactive oxygen species (ROS). The second phase occurs when the stress is severe. TTC decreases during the second phase and consequently, lipid peroxidation increases and cell death happens if tocopherol deficiency cannot be compensated by other mechanisms of protection (MunnéBosch 2005). An increase of tocopherol synthesis under moderate stress and a decrease of tocopherol synthesis under severe stress have been reported (Munné-Bosch 2005). Under water-stressed condition, common marker; E37M50_20, for PAC and SAC is detected (Table 4). This can be explained by a specific gene for fatty acid synthetase II (FACII), which lengthens palmitic acid (16:0) by two carbon 257 atoms to produce stearic acid (18:0) (Pleite et al. 2006). Common markers associated with different seed-quality traits in well-irrigated and water-stressed conditions could be used for marker-assisted selection (MAS) in both conditions. Other markers, which are specific for one condition whereas linked to different traits or specific for a trait, could be useful for a given water treatment. Acknowledgments This research was supported by Gundishapur project No. 12267RD. The authors wish to thank the French and Iranian governments for providing fellowship for Ph.D. program of the first author. References Abou Al Fadil T, Dechamp-Guillaume G, Poormohammad Kiani S, Sarrafi A (2004) Genetic variability and heritability for resistance to black stem (Phoma macdonaldii) in sunflower (Helianthus annuus L.). J Genet Breed 58:323–328 Alejo-James A, Jardinaud MF, Maury P, Aliber J, Gentzbittel L, Sarrafi A, Grieu P, Petitprez M (2004) Genetic variation for germination and physiological traits in sunflower mutants induced by gamma rays. J Genet Breed 58:285–294 Ayerdi Gotor A, Farkas E, Berger M, Labalette F, Centis S, Daydé J, Calmon A (2007) Determination of tocopherols and phytosterols in sunflower seeds by NIR spectrometry. Eur J Lipid Sci Technol 109:525–530 Bervillé A, Lacombe S, Veillet S, Granier C, Leger S, Jouve P (2009) Method of selecting sunflower genotypes with high oleic acid content in seed oil. United States Patent Application 20090258346 Biskupek-Korell B, Moschner CR (2007) Near-infrared spectroscopy (NIRS) for quality assurance in breeding, cultivation and marketing of high-oleic sunflowers. Helia 29:73–80 Cantisán S, Martı́nez-Force E, Garcés R (2000) Enzymatic studies of high stearic acid sunflower seed mutants. Plant Physiol Biochem 38:377–382 Cela J, Falk J, Munné-Bosch S (2009) Ethylene signaling may be involved in the regulation of tocopherol biosynthesis in Arabidopsis thaliana. FEBS Lett 583:992–996 Cellier F, Conejero G, Breitler JC, Casse F (1998) Molecular and physiological responses to water deficit in droughttolerant and drought-sensitive lines of sunflower accumulation of dehydrin transcripts correlates with tolerance. Plant Physiol 116:319–328 Close TJ, Fenton RD, Moonan FA (1993) View of plant dehydrins using antibodies specific to the carboxy terminal peptide. Plant Mol Biol 23:279–286 D’Harlingue A, Camara B (1985) Plastid enzymes of terpenoid biosynthesis. Purification and characterization of gammatocopherol methyltransferase from Capsicum chromoplasts. J Biol Chem 260:15200–15203 Darvishzadeh R, Poormohammad Kiani S, Huguet T, Sarrafi A (2008) Genetic variation and identification of molecular 123 258 markers associated with partial resistance to black stem in gamma-irradiation induced mutants in sunflower (Helianthus annuus L.). Can J Plant Pathol 30:106–114 Dorrell DG, Vick BA (1997) Properties and processing of oilseed sunflower. In: Schneiter AA (ed) Sunflower production and technology. Agron Monogr 35:709–746. ASA, CSSA and SSSA, Madison Dure L III, Crouch M, Harada J, Ho T-HD, Mundy J, Quatrano R, Thomas T, Sung ZR (1989) Common amino acid sequence domains among the LEA proteins of higher plants. Plant Mol Biol 12:475–486 Ebrahimi A, Maury P, Berger M, Poormohammad Kiani S, Nabipour A, Shariati F, Grieu P, Sarrafi A (2008) QTL mapping of seed-quality traits in sunflower recombinant inbred lines under different water regimes. Genome 51:599–615 Ebrahimi A, Maury P, Berger M, Calmon A, Grieu P, Sarrafi A (2009) QTL mapping of protein content and seed characteristics under water-stress conditions in sunflower. Genome 52:419–430 Endrigkeit J, Wang X, Cai D, Zhang C, Long Y, Meng J, Jung C (2009) Genetic mapping, cloning, and functional characterization of the BnaX.VTE4 gene encoding a gammatocopherol methyltransferase from oilseed rape. Theor Appl Genet 119:567–575 Fernández-Martı́nez JM, Osorio J, Mancha M, Garcés R (1997) Isolation of high palmitic mutants on high oleic background. Euphytica 97:113–116 Garcés R, Mancha M (1991) In vitro oleate desaturase in developing sunflower seeds. Phytochemistry 30:2127– 2130 Hass CG, Tang S, Leonard S, Traber M, Miller JF, Knapp SJ (2006) Three non-allelic epistatically interacting methyltransferase mutations produce novel tocopherol (vitamin E) profiles in sunflower. Theor Appl Genet 113:767–782 Heppard EP, Kinney AJ, Stecca KL, Miao GH (1996) Developmental and growth temperature regulation of two different microsomal x-6 desaturase genes in soybeans. Plant Physiol 110:311–319 Kamal-Eldin A, Appelqvist LA (1996) The chemistry and antioxidant properties of tocopherols and tocotrienols. Lipids 31:671–701 Lacombe S, Berville A (2001) A dominant mutation for high oleic acid content in sunflower (Helianthus annuus L.) seed oil is genetically linked to a single oleate-desaturase RFLP locus. Mol Breed 8:129–137 Liu Q, Singh SP, Brubaker CL, Sharp PJ, Green AG, Marshall DR (1997) Isolation and characterization of two different microsomal x-6 desaturase genes in cotton (Gossypium hirsutum L.). In: Williams JP, Khan MU, Lem NW (eds) Physiology, biochemistry and molecular biology of plant lipids. Kluwer Academic Publishers, Dordrecht, Netherlands, pp 383–385 Martı́nez-Rivas JM, Sperling P, Lühs W, Heinz E (2001) Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from normal-type and high-oleic varieties of sunflower (Helianthus annuus L.). Mol Breed 8:159–168 Marwede V, Gul MK, Becker HC, Ecke W (2005) Mapping of QTL controlling tocopherol content in winter oilseed rape. Plant Breeding 124:20–26 123 Euphytica (2011) 178:247–259 Munné-Bosch S (2005) The role of alpha-tocopherol in plant stress tolerance. J Plant Physiol 162:743–748 Nabipour A, Yazdi-Samadi B, Sarrafi A (2004) Genetic control of some morphological mutants in sunflower. J Genet Breed 58:157–162 Norris SR, Lincoln K, Abad MS, Eilers R, Hartsuyker KK, Hirschberg J, Karunanandaa B, Moshiri F, Stein J, Valentin HE, Venkatesh TV (2004) Tocopherol biosynthesis related genes and uses thereof. United States Patent 7230165 Osorio J, Fernández-Martı́nez JM, Mancha M, Garcés R (1995) Mutant sunflower with high concentration in saturated fatty acid in the oil. Crop Sci 35:739–742 Ouvrard O, Cellier F, Ferrare K, Tousch D, Lamaze T, Dupuis JM, Casse-Delbart F (1996) Identification and expression of water stress- and abscisic acid-regulated genes in a drought tolerant sunflower genotype. Plant Mol Biol 31:819–829 Pérez-Vich B, Velasco L, Fernández-Martı́nez J (1998) Determination of seed oil content and fatty acid composition in sunflower through the analysis of intact seeds, husked seeds, meal and oil by near-infrared reflectance spectroscopy. JAOCS 75:547–555 Pérez-Vich B, Fernández-Martı́nez JM, Grondona M, Knapp SJ, Berry ST (2002) Stearoyl-ACP and oleoyl-PC desaturase genes cosegregate with quantitative trait loci underlying high stearic and high oleic acid mutant phenotypes in sunflower. Theor Appl Genet 104:338–349 Pérez-Vich B, Muñoz-Ruz J, Fernández-Martı́nez JM (2004) Developing midstearic acid sunflower lines from a high stearic acid mutant. Crop Sci 44:70–75 Pleite R, Martinez-Force E, Garces R (2006) Increase of the stearic acid content in high-oleic sunflower (Helianthus annuus) seeds. J Agric Food Chem 54:9383–9388 Poormohammad Kiani S (2007) Analyse génétique des réponses physiologiques du tournesol (Helianthus annuus L.) soumis à la sécheresse. Ph.D. thesis, Doctorat de l’institut national polytechnique de Toulouse, pp 148–163. http://ethesis.inp-toulouse.fr/archive/00000490/01/poor mohammad_kiani.pdf Porebski S, Bailey L, Baum B (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Rep 15:8–15 Rachid Al-Chaarani G, Gentzbittel L, Barrault G, Lenoble S, Sarrafi A (2004) The effect of gamma rays and genotypes on sunflower organogenesis traits. J Genet Breed 58:73–78 Saito K, Tautz L, Mustelin T (2007) The lipid-binding SEC14 domain. Biochim Biophys Acta 1771:719–726 Sarrafi A, Kayyal H, Rachid Al-Chaarani G, Cantin F, Chaline AS, Durielle AS (2000) Inheritance of organogenesis parameters in cotyledons of sunflower (Helianthus annuus L.). J Genet Breed 54:227–231 Schuppert GF, Tang S, Slabaugh MB, Knapp SJ (2006) The sunflower high-oleic mutant Ol carries variable tandem repeats of FAD2–1, a seed-specific oleoyl-phosphatidyl choline desaturase. Mol Breed 17:241–256 Semchuk NM, Lushchak OV, Falk J, Krupinska K, Lushchak VI (2009) Inactivation of genes, encoding tocopherol biosynthetic pathway enzymes, results in Euphytica (2011) 178:247–259 oxidative stress in outdoor grown Arabidopsis thaliana. Plant Physiol Biochem 47:384–390 Smith SA, King RE, Min DB (2007) Oxidative and thermal stabilities of genetically modified high oleic sunflower oil. Food Chem 102:1208–1213 Soldatov KI (1976) Chemical mutagenesis in sunflower breeding. In: Proceedings of 7th international sunflower conference, Krasnodar, USSR, Vlaardingen, the Netherlands: International sunflower association, pp 352–357 Tang S, Hass CG, Knapp SJ (2006) Ty3/gypsy-like retrotransposon knockout of a 2-methyl-6-phytyl-1, 4-benzoquinone methyltransferase is non-lethal, uncovers a cryptic paralogous mutation, and produces novel tocopherol (vitamin E) profiles in sunflower. Theor Appl Genet 113:783–799 Trebst A, Depka B, Holländer-Czytko H (2002) A specific role for tocopherol and of chemical singlet oxygen quenchers in the maintenance of photosystem II structure and function in Chlamydomonas reinhardtii. FEBS Lett 516:156–160 259 Vega S, del Rio A, Bamberg J, Palta J (2004) Evidence for the up-regulation of stearoyl-ACP (D9) desaturase gene expression during cold acclimation. Am J Potato Res 81:125–135 Velasco L, Becker HC (1998) Estimating the fatty acid composition of the oil in intact-seed rapeseed (Brassica napus L.) by nearinfrared reflectance spectroscopy. Euphytica 101:221–230 Vera-Ruiz E, Velasco L, Leon A, Fernández-Martı́nez J, Pérez-Vich B (2006) Genetic mapping of the Tph1 gene controlling beta-tocopherol accumulation in sunflower seeds. Mol Breed 17:291–296 Vijayan K, Srivatsava PP, Nair CV, Awasthi AK, Tikader A, Sreenivasa B, Urs SR (2006) Molecular characterization and identification of markers associaterd with yield traits in mulberry using ISSR markers. Plant Breed 125:298–301 Virk PS, Ford-Lloyd BV, Jackson MT, Pooni HS, Clemeno TP, Newbury HJ (1996) Predicting quantitative variation within rice germplasm using molecular markers. Heredity 76:296–304 123