Root Rot Disease

Wilt/root rot diseases are a major chickpea production
constraint in Ethiopia causing yield losses by reducing
the number of plants. To determine the current status of
disease incidence and distribution, surveys were conducted
in the 2013/2014 and 2014/2015 cropping seasons in major
chickpea growing zones of Ethiopia. Despite recent efforts in
dissemination of improved varieties, low to high incidence
of 0.0–83.4, 0.0–27.6, 1.3–19.8 and 0.0–16.3% and 1.0–81.9,
0.0–25.5, 3.0–13.9 and 1.0–21.5% in East Gojjam, Southwest
Shewa, North Shewa and West Shewa in 2013/2014
and 2014/2015, respectively. Therefore, integrated pest
management strategies should be developed and availed to
farmers.

Soil mycobiota play an important function in agricultural economy of a nation. The current study was made to have the knowledge about soilborne fungi associated with lupine crop in healthy and infested soils. Fungal species and their population in the soil vary depending on many factors such as type of soil, vegetation, temperature, pH, organic matter, moisture content, aggregate size, predation, and agricultural management factors such as tillage, cover cropping, root exudates, fertilizer and crop rotation. All together these factors affected directly or indirectly soil mycobiota, especially the soilborne pathogenic ones. Thirty one fungal species belong to nineteen genera has been isolated from healthy and infested soils. The diversity as well as the count has been, to some extent, differed from healthy to infested soil. By comparison of the species lists of the fungal flora of healthy and infested soils it was evident that soil fungi behave differently toward soil status, while some species isolated only from healthy soil e.g. Achaetomium, Chaetomium, Cladosporium, Epicoccum, Geotrichum, Gliocladium and Mucor, some isolated from both healthy and infested soil e.g. Alternaria, Aspergillus, Emericella, Fusarium Penicillium and Trichoderma, still others isolated only from infested soil e.g. Absidia, Acremonium and Paecilomyces. Regarding the role of soil mycobiota for controlling lupine root rot caused by Plectosporium tabacinum in dual culture, the obtained data clearly show that some isolates were strong antagonist, others were moderate and some were weak.

The present investigation was carried out to study the effect of seed treatments of lupine plants (cv.Giza 2) with chemical inducers Bion (5mM), salicylic acid (5mM) and saccharin (3mM) as well as Paenibacillus polymyxa and Trichoderma harzi-anum as biotic inducers on the infection with Rhi-zoctonia solani and Fusarium oxysporum f. sp. lupini under greenhouse and field conditions. Under greenhouse condition (Agricultural Research Centre, Giza) all treatments significantly reduced the percentages of pre-and post-emergence damping-off compared with the untreated control, the highest percentage of survived plants was achieved 92% by Bion and T. harzi-anum as well as fungicide Rizolex-T followed by salicylic acid and P. polymyxa as 88%. On the other hand, all treatments decrease significantly the incidence and severity of wilt, also increased the percentage of survived plants compared with untreated control. Under field conditions at Giza and Ismailia Agricultural Research Stations (Giza and Ismailia governorates) during winter season 2016-2017, all the treatments decreased the percentage of pre-and post-emergence damping-off as well as the percentage of wilted plants and increased the percentage of survived plants compared with untreated control in two locations. At Giza research station , the highest percentages of survived plants were recorded with Rizolex-T followed by Bion, P. polymyxa, and salicylic acid. While at Ismailia, the highest percentage of survived plants were recorded with Rizolex-T followed by Bion, P. poly-myxa, T. harzianum, and salicylic acid. Meantime, these treatments improved growth parameters i.e. plant height, number of pods/plant, the weight of seeds /plant and the weight of one hundred seed. The higher increase in seed yield (ton /feddan) was obtained with Rizolex-T and Bion treatments followed by Salicylic acid, P. polymyxa, and T. har-zianum at two locations. Activities of peroxidase (PO), polyphenol oxi-dase (PPO) enzymes and phenol content were determined. Bion treatment showed the highest increase in PO and PPO activity, and total phenols followed by salicylic acid and P. polymyxa treatments in the presence of R. solani or F. ox-ysporum. f. sp. lupini.

District Turbat, Balochistan, Pakistan is famous for its stingy and delicious dates. Recently, date palm trees have been badly affected by different plant pathogens which significantly reducing yield and farmers facing heavy losses annually. During a survey of different date palm cultivation in District Turbat and surrounding areas, fruit, root and soil samples were collected. Five fungi viz., Aspergillus niger, A. flavus, Penicillium sp. Cladosporium sp. and Rhizopus sp. were isolated from fruits. Among these fungi, A. niger was dominant and isolated from all the samples. The fungus causes fruit rot disease in different date palm varieties resulting in heavy losses annually. Fungi isolated from root samples included Fusarium solani, F. oxysporum. Drechslera elisii, D. hawaiiensis, Humicola sp., Blastomyces sp., Acremonium sp., Alternaria sp., Phytophthora sp., Aspergillus niger, A. flavus and Penicillium sp. F. solani was the dominant fungus and causes sudden decline syndrome (wilt disease) in Date palm trees. The level of occurrence of this fungus was significantly high in root samples of Gokna and Kungun varieties as compared to other varieties. F. solani, A. niger A. flavus, and A. terreus were isolated from soil at higher percentage as compared to some other fungi such as Drechslera hawaiiensis, Humicola sp., F. oxysporum, Macrophomina phaseolina, Acremonium sp., Alternaria sp., Penicillium sp. and Rhizopus sp.

The root-rot causing fungus Heterobasidion annosum can attack both spruce and pine trees and is the economically most damaging pathogen in northern European forestry. We have monitored the H. annosum S-type (fairly recently named H. parviporum) colonization rate and expression of host chitinases and other host transcripts in Norway spruce material with differing resistances using quatitative realtime PCR. Transcript levels of three chitinases, representing classes I, II and IV, were monitored. Ramets of two 33-year- ...

Green manure incorporation is important for restoration of soil quality, particularly buildup of organic matter and supply of nutrients to plants. However, undecomposed plant residues reduce crop establishment and plant stand. Therefore, there is need to determine suitable time for green manure incorporation before planting. The effect of time after incorporation of lablab green manure on soilborne pathogens and bean crop establishment was evaluated by incorporating 12t/ha of lablab green manure at planting and at 7, 14, and 28 days before planting. Soil samples were collected before and after incorporation of green manure at planting, and at two, four and six weeks after planting. Data was collected on crop emergence, plant stand, yield, incidence and severity of root rot, and population of root rot pathogens. Incorporation of lablab residues 28 days before planting resulted in 21% improvement in germination, with corresponding reduction in root rot incidence and severity of 8% and...

Since chickpea (Cicer arietinum) root rot caused by Neocosmospora
vasinfecta is widespread in Khushab, Jhang and
Layyah, three regions of the Pujab province (Ali et al., 2011),
a study was conducted to assess the virulence and genetic
diversity of a number of fungal isolates which, upon isolation
on chickpea seed meal agar, yielded white cottony colonies
within 7-10 days at 25°C. Virulence assays of seven such isolates
were carried out in pots in a glasshouse and a growthroom
using the susceptible genotypes JG62 and Aug424, as
described by Sharma et al. (2005) and Infantino et al. (2006),
All tested isolates were virulent on both genotypes with variable
reaction from least to highly aggressive. Four out of five
isolates from Khushab and the only isolate from Layyah were
aggressive. For genetic diversity analysis, eight RAPD and
nine URP markers (Kang et al., 2002) were used. Analysis
showed that the seven N. vasinfecta isolates fall into three
distinct clades, with URP markers allowing a better definition
of genetic variability than RAPD. Virulence and genetic
diversity tests proved that the seven isolates fall into three
distinct groups. Cluster analysis was performed based on
the un-weighted pair group method with arithmetic means
(UPGMA) using the Genstat software (10th Edition). No
overlap between genetic and virulence groups was detected,
nor a correlation was found between these two variables
and the geographical origin of the isolates. This preliminary
study will form the basis for a comprehensive future work on
more isolates and may lead to identify N. vasinfecta-resistant
genotypes, potentially forming part of an efficient strategy
to manage chickpea root rot.

Fusarium oxysporum, a ubiquitous soilborne pathogen, causes devastating vascular wilt in more than 100 plant species and ranks 5th among the top 10 fungal plant pathogens. It has emerged as a human pathogen, too, causing infections in immune-compromised patients. Therefore, it is important to gain insight into the molecular processes involved in the pathogenesis of this transkingdom pathogen. A complex network comprising interconnected and overlapping signal pathways-mitogen-activated protein kinase signaling pathways, Ras proteins, G-protein signaling components and their downstream pathways, components of the velvet (LaeA/VeA/VelB) complex, and cAMP pathways-is involved in perceiving the host. This network regulates the expression of various pathogenicity genes. However, plants have evolved an elaborate protection system to combat this attack. They, too, possess intricate mechanisms at the molecular level which, once triggered by pathogen attack, transduce signals to activate defense response. This review focuses on understanding and presenting a wholistic picture of the molecular mechanisms of F. oxysporum-host interactions in plant immunity.

Some algal filtrates namely Sargassum, Fucus and Nostoc spp., and chemical inducers namely Dipotassium Phosphate (K2
HPo4
), Salicylic
acid and Ascorbic acid to investigate their effect on the control of faba bean root-rot caused by Rhizocptina solani, Fusarium solani and
Fusarium oxysporum in the laboratory and green house using the faba bean (Giza3 Mohassan). Results of in vitro studies showed that algal
filtrates or chemical inducers significantly inhibited the mycelial growth of the pathogen, when compared to the untreated control. Under
greenhouse conditions, all isolated fungi proved to be pathogenic and caused pre- and post emergence damping-off. Considerable increases
in activity of oxidative reductive enzymes (peroxidase and polyphenol oxidase) and chitinase enzyme were recorded in plants grown from
treated faba bean seeds.

Seeds of mung bean (Vigna radiata (L.) Wilczek and groundnut (Arachis hypogaea L.) were treated with ultra violet (UV-C) radiation for 0, 5, 10, 15, 20, 30 and 60 minutes for the estimation of growth parameters and root infecting fungi like Macrophomina phaseolina (Tassi) Goid, Rhizoctonia solani Kühn and Fusarium spp. It was observed that both crop plants showed increment in shoot weight, shoot length, root length and root weight, leaf area and number of nodules when seeds of groundnut and mung bean were treated with UV-C for 10, 15, 30 and 60 minutes period. UV-C exposure for 0-60 minutes showed reduction in root infecting fungi whereas 15, 20 and 30 minutes exposure with UV-C gave significant result in increment of total chlorophyll and carbohydrate contents.

Salinity is one of the predisposing factors to plant disease and increase the severity of the plant disease. An experiment was
conducted to determine the effect the different levels of NaCl salinity on growth of Cotton (Gossypium hirsutum L.)
varieties (CIM-598, CIM-599, CIM-602, CIM-573 and CIM-554) and its root rot pathogens. These varieties of Cotton were
grown under different salinity levels @ 0, 30, 60, 90, 120 and 150mM NaCl (corresponding to 1.91, 5.72, 9.54, 13.43,
16.43, and 20.98 dS.m-1
). The salinity reduced the root and shoot growth significantly. Root weight was the most limiting
growth parameter. On the basis of 50% reduction of root weight, the in hand cotton varieties were found to follow following
salt tolerance order,
CIM-598 > CIM-602 > CIM-554 > CIM-573 > CIM – 599
(166.6) (142.4) (132.5) (119.1) (94.4)…mM NaCl
The results of 3-way ANOVA showed that salinity treatment (P < 0.008, F = 3.21) and fungal type (P < 0.001,
F = 238.47) significantly affected the colonization of root rot fungi while all varieties of cotton behaved more or
less similarly and didn’t differ significantly (p < 0.364, F = 1.086) in colonization. The interactions amongst the
three factors were highly significant indicating the fact that the intensity of colonization was an interactive
function of salinity varietal specificity and nature of the root rot fungi. There was somewhat irregular trend of
decline of colonization with salinity. However, maximum colonization was apparent in control and 30 mM
NaCl treatment and minimum in 120 mM NaCl salinity. There was no significant difference in varietal response
to fungal colonization (39.92- 45.91%). Fusarium sp. had, however, relatively higher colonization (64.98%). M.
phaseolina had the moderate (48.18%) and R. solani, the least (15.38%) colonization.

This study was carried out to evaluate the efficiency of Saccharomyces cerevisiae; Kluyveromyces marxianus; Pseudomonas
fluorescens; Bacillus subtilis and Biokont against Phytophthora nicotianae the causal agent of okra damping off. The
pathogenic fungus was isolated from infected seedling and identified on the basis of cultural and molecular characteristics.
The pathogenecity of the isolate was determined on okra seedling. The antagonistic activity of biocontrol agents against P.
nicotianae was tested on cultural medium by dual culture test. The more effective concentration of biocontrol agents was
determine by mixing different concentrations from those agents with cultural medium and inoculated the medium with the
pathogenic fungus. The efficiency of biocontrol agents in controlling seedling death was evaluated by adding the effective
concentration of the agent into poting soil, then contaminated with the pathogenic fungus and sown with okra seeds. The
results showed that all the biocontrol agents inhibited the fungal growth on cultural medium by 69; 65; 67 and 59% for each
of S. cerevisiae; K. marxianus; P. fluorescens and B. subtilis respectively. The inhibition percentage was found to be 100%
when the biocontrol agents were mixed with the medium at 7 x 105; 3 x 106 and 7 x 106 colony forming units/ml for K.
marxianus ; P. fluorescens and B. subtilis and at 0.1; 0.3; 0.5 g/L of S. cerevisiae powder. All the biocontrol agents have
reduced seedling death 0.0; 0.0; 0.0; 6.7; 6.7; 6.7; 6.7; 13.3% with Biokont; S. cerevisiae; K. marxianus and P. fluorescens
before and after emergence respectively compared with 33.3 and 40% in control, while the seedling death attained to 13.3
and 20% in soil treated with B. subtilis before and after emergence respectively.

Damping-off and root-rot are some of the most important diseases attack soybean (Glycine max (L.) Merr.) in Egypt. The effect of biocides, i.e. Bio-Cure-F, Plant guard, and Rhizo-N, and essential oils of eucalyptus, thyme, and lemongrass oils, as well as the fungicide Vitavax-200, were evaluated in vitro, greenhouse and under field conditions during the two successive growing seasons, 2018 and 2019 to control damping-off and root-rot diseases of soybean. All the tested biocides and essential oils used significantly inhibited the linear growth of the tested pathogenic fungi, i.e., Fusarium moniliforme, Fusarium solani and Rhizoctonia solani compared with the control. Under greenhouse and field conditions in both growing seasons, obtained results indicated that all the tested biocides and essential oils significantly reduced the percentages of soybean damping-off and root-rot severity furthermore improved photosynthetic pigments content, growth parameters, and seed yield. Vitavax-200 and Plant guard gave the highest values of reduction in this respect, followed by Rhizo-N, lemongrass oil, Bio-Cure-F, thyme oil, and eucalyptus oil respectively. Besides, the quality parameters of soybean seeds showed a favorable elevation in total oil content, on the contrary, there was a general decrease in the seeds protein content. However, the correlations between seeds oil and protein contents were negatively correlated. It could be concluded in biocides and essential oils examined can be recommended for biocontrol of soybean damping-off and root-rot diseases.

Okra, Abelmoschus esculentus L., is a popular vegetable grown in Iraq. Three pathogens have been identified as causal agents of damping-off of okra in Iraq:
Pythium spp., Rhizoctonia solani, and Fusarium solani (1). In California and Brazil, Phytophthora nicotianae has also been reported as a pathogen of okra (2). P.
nicotianae can cause significant damage when soils are cool to warm (20 to 30°C) and wet. Damping-off is now considered one of the most important and
destructive diseases of okra in Iraq with disease incidence reaching 50 to 75% in some fields. In March and April 2012, symptoms of damping-off were observed
in two okra fields of ~0.75 and 1.50 ha located north and south of Baghdad, Iraq, respectively. The symptoms included dark brown lesions that coalesced,
girdling the stem at the base, and causing seedling collapse within a few days. Symptomatic tissues were surface-sterilized in 1% NaOCl for 1 min and plated on
potato dextrose agar (PDA). Emerging fungal colonies were transferred to new plates of PDA and incubated at 25°C. P. nicotianae was identified by
morphological and molecular techniques. Spherical, bipapillate sporangia had a mean length of 48 μm, mean width of 40 μm, and 1.0 to 1.4:1.0 ratio of length to
breadth with 40-μm-long chlamydospores. Oospores and antheridia were not observed when two isolates were grown on PDA or in water. Swelling and radiating
hyphae developed in water culture. No hyphal growth was observed on PDA when the culture was incubated at 35°C. These morphological and cultural
characteristics were similar to those reported by van Breda de Haan (4) concerning P. nicotianae. The identification of two isolates was confirmed by sequencing
the internal transcribed spacer (ITS) region of rDNA using forward and reverse primers (ITS1: I1, TCCGTAGGTGAACCTGCGG; and ITS4: I4,
TCCTCCGCTTATTGATATGC, respectively) at the BCCM/LMG Microbiology Collection Laboratory for Microbiology, University of Ghent, Belgium (MUCL
54380). The ITS rDNA consensus sequence for the two isolates showed 99% identity with the ITS sequences of known P. nicotianae isolates, and was deposited
in GenBank. Pathogenicity tests of one of the isolates of P. nicotianae were performed on okra seedlings of a local cultivar grown in a 1:1 mixture of sterile soil
and peat moss in pots (each 5 cm tall × 10 cm wide). The soil peat mix in each pot was infested with a half PDA plate of fungal growth (7 days old), from which
the mycelium and agar were homogenized and added to the soil. A half PDA plate without P. nicotianae was added to potting mix for the non-inoculated
treatment. Ten okra seeds were sown in each pot and three pots were used for each treatment. Plants were irrigated as needed with sterilized water, and
maintained in a greenhouse at 25 ± 2°C with 100% relative humidity for 48 h by covering the pots with polyethylene bag. Thereafter, the bags were removed and
the pots kept in the greenhouse at ambient relative humidity (approximately 50%) for 5 days. Inoculated plants showed seed decay and damping-off after 7 days,
whereas control plants remained healthy. The pathogen reisolate d from inoculated seedling had the same morphological and molecular (ITS rDNA) characteristics

Salinity is one of the predisposing factors to plant disease and increase the severity of the plant disease. An experiment was conducted to determine the effect the different levels of NaCl salinity on growth of Cotton (Gossypium hirsutum L.) varieties (CIM-598, CIM-599, CIM-602, CIM-573 and CIM-554) and its root rot pathogens. These varieties of Cotton were grown under different salinity levels @ 0, 30, 60, 90, 120 and 150mM NaCl (corresponding to 1.91, 5.72, 9.54, 13.43, 16.43, and 20.98 dS.m -1 ). The salinity reduced the root and shoot growth significantly. Root weight was the most limiting growth parameter. On the basis of 50% reduction of root weight, the in hand cotton varieties were found to follow following salt tolerance order, CIM-598 &gt; CIM-602 &gt; CIM-554 &gt; CIM-573 &gt; CIM – 599 (166.6) (142.4) (132.5) (119.1) (94.4)…mM NaCl The results of 3-way ANOVA showed that salinity treatment (P &lt; 0.008, F = 3.21) and fungal type (P &lt; 0.001, F = 238.47) significantly ...

Damping-off and root-rot are important diseases attacking chickpea (Cicer arietinum L.) in Egypt. The effect of biofumigation, using mustard (Brassica juncea) and canola (Brassica napus) seed meals were evaluated to control damping-off and root-rot diseases of chickpea in vitro and in vivo (under greenhouse and field conditions trials) conducted in Sers-Ellian Agricultural Research Station, Menoufia governorate, Egypt, in 2016/2017 and 2017/2018. Both mustard and canola seed meals significantly decreased the linear growth of the tested pathogenic fungi, i.e., Fusarium oxysporum, Sclerotinia sclerotiorum and Rhizoctonia solani, this decrease was more important with the increasing of concentration when compared with the control. The fungicidal effect of mustard and canola seed meals against the tested fungi was demonstrated under greenhouse and field conditions. Obtained results indicated that mustard and canola seed meals significantly reduced the percentages of damping-off severity furthermore improved growth parameters, i.e., plant height, pods number per plant and 100-seed weight. Mustard seed meal recorded the highest values of reduction in this respect as well as, significantly increased nodulation status of rhizobium (Mesorhizobium ciceri) i.e., number of nodules, nodules fresh and dry weights on chickpea roots in pots and field experiments. Mustard seed meal was superior. It could be concluded, that applying of such biofumigation procedure in the control of chickpea damping-off and root rot diseases on the field scale may offer a practical complement environmentally safe measure to control soil-borne pathogens, and may be combined in an integrated diseases management regime.