Location via proxy:   [ UP ]  
[Report a bug]   [Manage cookies]                
Next Article in Journal
Non-Structural Carbohydrate Composition of ‘Hass’ Avocado Fruit Is Affected by Maturity, Storage, and Ripening
Next Article in Special Issue
Effects of ‘Candidatus’ Liberibacter Asiaticus on the Root System of Poncirus trifoliata Hybrids as a Rootstock for ‘Valencia’ Scion
Previous Article in Journal
Comprehensive Evaluation of Texture Quality of ‘Huizao’ (Ziziphus jujuba Mill. Huizao) and Its Response to Climate Factors in Four Main Production Areas of Southern Xinjiang
Previous Article in Special Issue
Whole Genome Characterization of Prunus Necrotic Ringspot Virus and Prune Dwarf Virus Infecting Stone Fruits in Russia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 8
10.3390/horticulturae10080865
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biological Control of Streptomyces Species Causing Common Scabs in Potato Tubers in the Yaqui Valley, Mexico

by
Amelia C. Montoya-Martínez
1,
Roel Alejandro Chávez-Luzanía
1,
Ana Isabel Olguín-Martínez
1,
Abraham Ruíz-Castrejón
1,
Jesús Daniel Moreno-Cárdenas
1,
Fabiola Esquivel-Chávez
1,
Fannie I. Parra-Cota
2 and
Sergio de los Santos-Villalobos
1,*
1
Laboratorio de Biotecnología del Recurso Microbiano, Instituto Tecnológico de Sonora, 5 de Febrero 818 Sur, Col. Centro, Ciudad Obregón 85000, Sonora, Mexico
2
Campo Experimental Norman E. Borlaug-INIFAP, Norman E. Borlaug Km. 12., Ciudad Obregón 85000, Sonora, Mexico
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(8), 865; https://doi.org/10.3390/horticulturae10080865
Submission received: 12 July 2024 / Revised: 8 August 2024 / Accepted: 13 August 2024 / Published: 15 August 2024
(This article belongs to the Special Issue Horticultural Plants Pathology and Advances in Disease Management—2nd Edition)
Browse Figures
Versions Notes

Abstract

:
Potatoes (Solanum tuberosum L.) represent an important food in the country’s gastronomy due to their cost, nutritional contribution, and versatility. However, many plant diseases such as the common scab—caused by Streptomyces species—reduce its yield and quality. This study aims to determine Streptomyces species being the causal agent of common scabs in a commercial potato field in the Yaqui Valley, Mexico, while identifying Bacillus strains as a biological control method to mitigate the impact of this disease under field conditions. Thus, three Streptomyces strains were selected from symptomatic samples, and then they were morphologically and molecularly (through sequencing recA and rpoB genes) identified as Streptomyces caniscabiei. After pathogenicity tests, the three strains were found to be pathogenic to potato tubers. In screening assays to identify biocontrol bacteria, strain TSO2T (Bacillus cabrialesii subsp. tritici) and TE3T_UV25 (Bacillus subtilis) had the best in vitro biocontrol effect against S. caniscabiei. Then, a field experiment (1 ha per treatment), under commercial conditions, was carried out to analyze the effectivity of these biocontrol bacteria to mitigate the common scabs on potato crops. After four months, the inoculation of this bacterial consortium decreased common scab incidence from 31% to 21% and increased the potato yield up to almost 5 tons/ha vs. the un-inoculated treatment. These findings demonstrate the effectiveness of the studied bacterial consortium as a potential biological control strategy to control common scabs of potato caused by Streptomyces caniscabiei, as well as increase the potato yield in the Yaqui Valley, Mexico.

1. Introduction

In Latin America and the Caribbean, potato consumption varies from a staple food in urban homes purchased by local businesses to fast food chains as a complementary food. The average annual per capita consumption of potatoes in this region has increased from 22 to 25 kg/person between the years 1961 and 1963 to 2011 and 2013, respectively, where 14.8 kg/person is consumed in Mexico [1], representing an important food in the country’s gastronomy due to its cost, nutritional contribution, and versatility.
According to the Agri-Food and Fisheries Information Service [2] in 2022, 1,878,976 tons of potatoes were produced in an area of 60,102.28 hectares in Mexico, where Sonora state was the main contributor. This Mexican state allocated 14,825 hectares of this crop, obtaining 533,544.04 tons of potatoes with a value of MXN 4,317,464,280 [2]. Within Sonora, the Yaqui Valley region, known as the birthplace of the green revolution and one of the main agricultural areas of Mexico, has been the site of multiple research projects to improve agricultural productivity, as well as a large potato producer [3,4], with a production of 137,295 tons (25.7% of the total production of the state) [2]. Among the factors to consider for potato production is the biotic stress caused by bacterial diseases, which are of special concern [1,5,6], such as the common scab disease caused by Streptomyces species [1]. This disease affects the surface of the tuber, characterized by causing cosmetic damage in the areas of infection: (i) a layer of superficial scab, (ii) clusters of scab with a concave shape, and (iii) indentations in advanced stages of infection [6]. In addition to the appearance caused by common scab complicating the trade of the product, in advanced stages, the infection covers a large part of the tuber superficially and internally, making the process of removing the necrotic tissue difficult and rendering it useless for consumption [5].
Classical methods for identifying Streptomyces species typically involve phenotypic characterization, but these methods can be limited by the morphological similarities between different Streptomyces species. In contrast, molecular approaches provide an accurate identification, by using amplification and sequencing of specific genes to construct multilocus and phylogenetic analyses [7]. The correct and precise identification of phyopathogens, through molecular analyses, has significantly impacted their control and management, as it can facilitate the development of specific and targeted strategies.
The most reported species causing common scabies in potatoes are the following: Streptomyces scabiei, S. acidiscabies, S. turgidiscabies, S. europaeiscabiei, S. stelliscabiei, S. luridiscabiei, S. puniciscabiei, S. niveiscabiei, S. bottropensis, S. aureofaciens, S. galilaeus, S. caviscabiei, S. reticuliscabiei, S. luridiscabiei, S. niveiscabiei, S. puniciscabiei, and S. cheloniumii [1,5,8]. The control of this bacteria in the field has been addressed using potato varieties resistant to common scabs, crop rotation, reduction in soil pH and irrigation, and, mainly, the use of chemical compounds [6]. These synthetic products, although they may be effective in reducing the incidence of the disease, can be an environmental contaminant, affect human health, or cause an imbalance in the populations of soil micro-organisms, affecting native beneficial species and promoting the proliferation of other phytopathogens [9,10].
Despite these control measures, common scab remains an issue, especially in regions like the Yaqui Valley. There is a critical need to explore alternative sustainable control methods that mitigate the negative impacts of chemical treatments. In recent decades, the use of biological agents to control agriculturally important diseases has gained significance as a sustainable alternative. This approach can reduce the incidence of phytopathogens while preserving soil microbial diversity and ensuring food safety [11,12].
Although several Streptomyces species have been identified as causal agents of common scab in potatoes, there is limited research on the specific species and strains prevalent in commercial potato fields in the Yaqui Valley, Mexico. Furthermore, there is a need to identify effective bacterial biological control agents that can reduce the incidence of pathogenic Streptomyces under field conditions. In this sense, this research aims to determine Streptomyces species that cause common scabs in commercial potato fields in the Yaqui Valley, Mexico, as well as to identify bacterial biological control agents capable of reducing the incidence of pathogenic Streptomyces in potatoes under field conditions.

2. Materials and Methods

2.1. Sampling Sites and Isolation

Sampling was carried out in two commercial fields in the Yaqui Valley, Sonora, Mexico (27°12′1.8″ N, 109°53′21.1992″ W and 27°17′55.1256″ N, 109°51′36.2376″ W), during the potato variety FL2027 growing period in February 2022. During this time, the average temperature was 18.2 °C with a total precipitation of 10.7 mm (https://meteostat.net/es/place/mx/ciudad-obregon?s=76253&t=2022-02-01/2022-02-28; accessed on 2 August 2024); and soils in the Yaqui Valley have been reported to have a pH of around 8.8 [3].
Symptomatic plants were collected and the tubers were examined for lesions typical of common scabs; then, they were transferred to a moist chamber until they were transferred to the Microbial Resource Biotechnology laboratory (www.itson.mx/LBRM, accessed on 2 August 2024) and stored at 4 °C for 24 h until processing. Using a sterile scalpel, the typical lesions of the sampled tubers were cut and superficially disinfested using commercial 1.5% sodium hypochlorite, followed by washing thrice with sterile water. The disinfested lesions were transferred and macerated in 50 mL conical tubes with 5 mL of sterile water. Subsequently, serial dilutions up to 1 × 10−7 were carried out, and 0.1 mL were inoculated in Petri dishes with 2% water agar, and incubated for 6 days at 28 °C. Colonies with typical morphologies of Streptomyces were transferred to Petri dishes with Yeast Malt Extract (YME) medium with 1.5% agar-agar until a pure culture was obtained [13,14]. Finally, the microscopic [15,16,17] and macroscopic characteristics [18] of the pure cultures were analyzed.

2.2. Molecular Identification and Phylogenetic Analysis

The obtained isolates were cultured individually in 20 mL of YME and incubated at 28 °C at 160 rpm for 6 days. The microscopic characteristics of the culture were confirmed and high-quality DNA extraction was carried out according to the protocol described by Raeder and Broda [19]. The DNA concentration and quality were quantified with a spectrophotometer (Nanodrop; Thermo Scientific, Waltham, MA, USA) and 2% agarose gel electrophoresis.
Using the primers shown in Table 1, partial recA and rpoB genes of the obtained isolates were amplified. The MyTaq™ DNA Polymerase (Meridian Bioscience, Cincinnati, OH, USA) reaction kit was used, and PCR cycles were as follows: initial denaturation at 94 °C for 3 min, followed by 30 cycles of 94 °C for 30 s, primer alignment at 67 °C for recA and 56 °C for rpoB for 40 s and extension at 72 °C for 30 s; the final extension was carried out at 72 °C for 5 min.
Amplicons were analyzed using 1.5% agarose gel electrophoresis and purified using the EZ-10 Spin Column DNA Gel Extraction Minipreps Kit (BioBasic, Markham, ON, Canada). Then, they were sequenced with the Sanger platform at LANGEBIO in CINVESTAV Irapuato, Mexico. Sequence chromatograms were edited with MEGA v. 10.2, and the obtained DNA sequences were analyzed by using the Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI) (accessed on 21 May 2024) for the taxonomic affiliation of the studied isolates. To further taxonomic identification, a phylogenetic analysis of the two-locus DNA sequence (partial recA and rpoB genes) of the Streptomyces isolates and 16 previously characterized Streptomyces strains from NCBI, plus Nocardiopsis dassonvillei NCTC 10488 as outgroup (Table 2), was carried out. For this, the edited sequences were aligned with MUSCLE in SeaView v. 5.0.5 [21,22], concatenated in SequenceMatrix v. 1.7.8 [23], and then subjected to partitioned maximum likelihood (ML) phylogenetic analyses with IQ-TREE 1.6.10 [24] with ultrafast bootstrap [25]. ModelFinder [26] was employed to identify the optimal molecular evolution models for each partition based on the Bayesian information criterion scores [27]. DNA sequences were deposited in the NCBI GenBank under the following accession numbers: recA PP919089, PP919090, and PP919091 and rpoB PP919092, PP919093, and PP919094.

2.3. Pathogenicity and Biocontrol Tests

Pathogenicity tests were carried out on potato variety FL2027 slices. For this, fresh potatoes were disinfected using commercial 1.5% sodium hypochlorite and washed thrice with sterile water, then were cut into 1 cm thick slices. These potato slices were placed in glass Petri dishes and sterilized (121 °C for 15 min). Meanwhile, Streptomyces isolates were cultured in YME broth and incubated at 28 °C at 160 rpm for 6 days. Then, the sterilized potato slices were inoculated with 10 µL of 1 × 105 UFC mL−1 bacterial suspension (three inoculations per slice by triplicate), while sterile water was used as control. The slices were incubated at 30 °C for 6 days. After this, lesions and symptoms of common scab were analyzed.
To find bacterial strains capable of controlling the growth of phytopathogenic Streptomyces, six bacterial strains belonging to Culture Collection of Native Soil and Endophytic Microorganisms (COLMENA; www.itson.mx/colmena, accessed on 2 August 2024) were confronted in vitro. These bacterial strains have previously shown promising biological control against phytopathogenic fungi and/or plant growth promotion activity [4,28,29,30,31,32,33]. These bacterial strains were as follows: (i) Bacillus cabrialesii subsp. cabrialesii TE3T [28,34], (ii) B. cabrialesii subsp. tritici TSO2T [28], (iii) B. paralicheniformis TRQ65 [35], (iv) B. mexicanus FSQ1T [36], (v) B. subtilis TE3T-UV25, and (vi) B. inaquosorum TSO22 [37]. These bacterial strains were grown in nutrient broth (NB) for 24 h at 28 °C and 160 rpm for agitation. After this, the biomass of the bacterial strains was pelleted with centrifugation at 5000 rpm for 10 min and then resuspended in sterile distilled water to adjust to OD630nm = 0.5 or 1 × 105 UFC mL−1. The pathogenic Streptomyces strains were cultured as previously described (in YME broth at 28 °C at 160 rpm for 6 days) and adjusted with sterile distilled water to obtain 1 × 105 UFC mL−1. The confrontations were carried out in Petri dishes containing YME agar, where 1 mL of the pathogenic Streptomyces strains was inoculated by extension on the agar surface; then, 10 µL of each potential biocontrol bacteria were inoculated in three equidistant points from the center of the Petri dish. Sterile water was used as a control. Three replicates were made for each treatment and were incubated at 30 °C for 48 h. After this incubation period, the biocontrol activity of the studied bacteria against pathogenic Streptomyces strains was determined by observing an inhibition halo.

2.4. Biocontrol of the Common Scabs and Increase in Potato Yield by Beneficial Strains under Commercial Field Conditions

Bacteria showing the highest biocontrol capacity against pathogenic Streptomyces strains were evaluated in potato variety FL2027 under commercial field conditions from December 2023 to April 2024. This assay consisted of 0.5 ha, where 2 L of the Bacillus inoculant (1 × 108 cells/mL of each strain) was applied. This inoculant was applied through the drip irrigation system on 4 December 2023; 1 January 2024; 7 February 2024; and 15 March 2024. An area of the same size was used as a control, where no Bacillus inoculant was applied. Once harvested, the percentage of potatoes with symptoms of common scab was calculated by analyzing subsamples of 50 tubers, and the yield was also determined.

3. Results

3.1. Sampling and Isolation of Streptomyces

The study fields showed the presence of tubers with typical lesions of common scab caused by Streptomyces, from superficial to deep lesions, such as a concave elevation in less serious injuries and a convex shape in more severe ones; the affected areas were rough to the touch, with a corky, cracked appearance. (Figure 1). From these potato wounds, 17 bacteria with morphological characteristics typical of the genus Streptomyces were isolated. In general, the isolates presented white, irregular, concave colonies hard to contact with aerial filaments and microscopically presented Gram + staining and formation of bacterial filaments. These isolates showed similar morphology and were classified into three more abundant groups; thus, one strain of each group was selected for further studies.

3.2. Molecular Identification and Phylogenetic Analysis

BLAST searches and comparisons, using the partial recA and rpoB sequences of the isolated Streptomyces strains as queries, identified that these three isolates are closely similar to Streptomyces caniscabiei, with most similarity percentages above 98% (Table 3).
To further identify the studied Streptomyces strains, a phylogenetic analysis was conducted using fragments of recA (636 bp, 91 informative, GTR + F + I + G4 model) and rpoB (292 bp, 23 informative, TIM + F + I + G4 model) genes. This analysis included the three isolates under study, 16 previously characterized isolates of Streptomyces and Nocardiopsis dassonvillei NCTC 10488 as the outgroup (Figure 2). The Streptomyces isolates were nested closely to strains of the species Streptomyces caniscabiei (Figure 2).

3.3. Pathogenicity and Biocontrol Assays

The three Streptomyces caniscabiei (PRV23, PRV28, and PEP11) strains were assayed for their potential to cause common scab in potato slices. After 6 days, all potato slices inoculated with Streptomyces strains showed symptoms of common scabs, while the control treatment did not present symptoms (Figure 3). The lesions produced by the three strains were observed to be similar in shape and size. Therefore, all tested strains were considered pathogenic. In general, the observed symptoms were dark brown spots around the inoculation area, as shown in Figure 3.
To determine the best bacterial strain to control the pathogenic Streptomyces caniscabiei strains, a confrontation assay in vitro was carried out. It was observed that against strain PVR23, the bacterial strains with better biocontrol were FSQ1T, TE3T_UV25, and TSO2T, while TE3T did not show biocontrol activity. On the other hand, the bacterial strains that better controlled PVR28 were TSO22 and TE3T_UV25, while the rest had little to no biocontrol. Finally, strain PEP11 was inhibited by strains TSO22, TE3T_UV25, and TSO2T. Given these results, strains TE3T_UV25 (B. subtilis) and TSO2T (B. cabrialesii subsp. tritici) were selected as biocontrollers with better activity against Streptomyces caniscabiei and were selected for further field experiments.

3.4. Biocontrol and Growth Promotion Trials on Potatoes under Commercial Field Conditions

Field biocontrol and growth promotion trials were carried out in a commercial plot of potato, using the strains with the highest in vitro biocontrol capacity against Streptomyces caniscabiei. Potato tubers quantified in this trial had signs of common scab, with superficial to deep-pitted lesions, showing superficial necrosis and depressions on the surface with raised borders around the affected area in the most severe cases, signs equal to those previously observed during the sample collection and isolation of the Streptomyces strains. The results showed a decrease in the incidence of common scabs [from 31% (un-inoculated control) to 21% (inoculated treatment)] and a yield increase of 5 tons/ha [from 40.5 tons/ha (un-inoculated control) to 45.5 tons/ha (inoculated treatment)].

4. Discussion

Potato yield is hindered by different diseases, after potato late blight (Phytophthora infestans) and bacterial soft rot (Erwinia spp.), potato common scab is one of the main concerns for farmers around the world [38]. Common scab impacts various root crops such as radishes, beets, carrots, turnips, and sweet potatoes, potentially leading to significant economic losses [39]. In this study, 17 Streptomyces isolates were obtained from symptomatic potato common scab tubers from commercial fields located in the Yaqui Valley, Mexico, from which three representative isolates were selected for further studies. After morphological and molecular identification, the selected isolates were taxonomically affiliated with Streptomyces caniscabiei. It is well known that common agricultural practices (flood and irrigation, tilling, chemical fertilization, pesticide use, etc.) impact soil microbial diversity, often decreasing it [40]. Additionally, monoculture practices, exert pressure on the selection of certain microorganisms over others, further affecting overall microbial diversity [41]. This could explain why the isolates obtained in this study belong to the same species. Based on the pathogenicity assay, they were identified as pathogenic for potatoes, confirming their role as the causal agents of the common scabs in this crop. Streptomyces caniscabiei was first reported as a new species in 2022, describing isolates from scab lesions on potatoes, where strains of this species have been isolated in the United States, Egypt, and China, with the earliest known isolates dating back to 1961, from common scab in California and Maine, USA [42]. To our knowledge, this is the first report of Streptomyces caniscabiei causing common scab in potato in Mexico.
Many microbes are naturally beneficial to plants, aiding in maintaining plant growth and yield under both abiotic and biotic stresses, promoting plant growth, and protecting plants from diseases, and this has been extensively documented by numerous researchers [43,44]. Therefore, the use of plant growth-promoting rhizobacteria (PGPR) as bioinoculants for potato production represents a sustainable biological strategy since they have different mechanisms of action, but they are generally grouped into two categories: (i) direct mechanisms that improve plant nutrition, such as mineral solubilization, nitrogen fixation, phytohormone production/stimulation, to mention few [44]; and (ii) indirect mechanisms, influencing the plant health by suppressing phytopathogens, with mechanisms such as competition for space and nutrients, antibiosis, production of lytic enzymes, and inducing systemic resistance in the host, among others [45]. In this sense, we tested six Bacillus strains preserved in COLMENA as biocontrollers against the studied pathogenic Streptomyces caniscabiei PVR23, PVR28, and PEP11 and found that B. cabrialesii subsp. tritici TSO2T and B. subtilis TE3T_UV25 were among the best strains to inhibit the potato scab pathogen’s growth in vitro. Strain TSO2T was recently identified and reported as a novel subspecies of B. cabrialesii [28]. This strain has previously demonstrated plant growth-promoting capabilities, including phosphate solubilization and indole production [30]. Previous studies tested strain TSO2T for biocontrol activity against the wheat pathogen Bipolaris sorokiniana [31,32] and Fusarium languescens, the causal agent of wilt in jalapeño peppers [4], and both cases showed great biocontrol activity. Similarly, strains of B. subtilis, known to produce bioactive metabolites, had been successfully tested and used for biological control against many pathogens as Botrytis cinerea in maize [46], Acidovorax citrulli causing bacterial fruit blotch [47], Ralstonia solanacearum in tomato [48], Pseudomonas syringae [49], Fusarium verticillioides in maize [50], Phytophthora infestans in potato [51], and many more [52,53].
The use of this microbial consortium in commercial potato fields showed a decrease in the symptoms of common scab incidence and improved production yield. Here, the application of the selected Bacillus strains reduced the common scab symptoms from 31% (un-inoculated control) to 21% (inoculated treatment) (Table 3). Previous studies on the biological control of Bacillus against Streptomyces have concluded that some of the secondary metabolites produced by this genus repress the Streptomyces development and consequently decrease the common scab [54]. Some of these mechanisms of action, such as antibiosis, are found in B. cabrialesii subsp. tritici strain TSO2T, previously demonstrated with genome mining of biosynthetic gene clusters for the production of fengycin, bacilysin, subtilosin A, bacillibactin, bacillaene, sporulation killing factor, and surfactin [4,31], while also having swarming motility, thanks to which strain TSO2T has an advantage over other microorganisms when competing for space and nutrients due to its ability to colonize spaces more quickly and secrete the aforementioned metabolites over a larger area [4,28]. On the other hand, strains of B. subtilis have been shown to produce promising bioactive metabolites that have earned much attention in recent years, such as broad-spectrum antimicrobial, anticancer, anti-inflammatory, and antinematicidal metabolites [55]. It has been demonstrated that ~5% of the wild-type B. subtilis genome is exclusively devoted to the synthesis of bioactive compounds [55,56]. Specifically, for biological control, the focus is on antimicrobial metabolites such as cyclic and linear lipopeptides, polyketides (PKs), volatile compounds, and other ribosomal (RPs) and non-ribosomal peptides (NRPs) [55,57,58]. Studies on these mechanisms of action against Streptomyces were carried out by Lin et al. [59], who studied the use of Bacillus amyloliquefaciens Ba01 against S. scabies, and hypothesized the possible excretion of lipopeptides such as surfactin, iturin A, and fengycin as the action mechanism of strain Ba01 for the reduction in the severity of common scab in pot trials, which later Feng et al. [60] determined that the srf gene cluster of this strain, responsible for the excretion of surfactin, was responsible for the inhibition of S. scabies. On the other hand, a study on Bacillus subtilis YPS-32 by Zhou et al. [61] showed the antagonistic capacity of this strain against Streptomyces through the production of surfactin and fengycin. Later studies by Tao et al. [62] described that Bacillus velezensis Y6, through the secretion of lipopeptides and the increase in systemic resistance in plants, reduced the severity of common scab, as well as increased production.
Besides a decrease in the presence of common scabs, an increment of 5 tons/ha in potato yield was observed. Similarly, increases up to 12.75% in potato crop yield were observed by Kumbar et al. [51] by the inoculation of B. subtilis. Furthermore, B. subtilis has been widely reported as a plant growth promoter, as it can solubilize phosphorus through the production of organic acids, increase the content of iron in plants by facilitating iron mobility through acidification of the rhizosphere, inducing the upregulation of iron acquisition genes in plants and siderophores production; in addition, B. subtilis can actively promote cell division and plant growth by either producing plant growth hormones directly or by inducing their production [63,64,65]. Plant growth-enhancing capabilities have also been reported in B. cabrialesii, which is capable of producing indoles, solubilizing phosphorus, and producing siderophores [29,66,67]. Thus, the Bacillus species studied here represent a promising alternative to reduce the incidence of common scabs and increase the yield in the potato crop sustainably.

5. Conclusions

Potato is one of the most important crops worldwide, and the Yaqui Valley in Mexico represents one of the most significant productive regions of the country. Given the importance of this crop, numerous studies have been conducted to increase its production sustainably and cost-effectively. One alternative to achieve this is the use of beneficial micro-organisms, among which the genus Bacillus is widely studied and used for its biocontrol and plant growth promotion capabilities, as well as its resistance to harsh environmental conditions. In this study, we identified three isolates of Streptomyces caniscabiei as the causal agents of potato common scab in commercial fields in the Yaqui Valley. In vitro confrontation tests showed that two strains of Bacillus were effective in controlling the pathogen’s growth. These were used in a field trial, where not only the symptoms of common scab were decreased but an increase in yield production was also observed. These results are significant because (i) to our knowledge, this is the first report of Streptomyces caniscabiei causing common scab in Mexico, and (ii) two biological control agents against S. caniscabiei were found to be effective in both in vitro and field trials. This is the first step toward sustainable potato production in the region. Thus, currently, more studies around this disease and its control are carried out by our team to a better understanding of the interactions and mechanisms of the studied micro-organisms, harnessing its potential to achieve sustainable and more productive agriculture.

Author Contributions

Conceptualization, S.d.l.S.-V., A.C.M.-M. and R.A.C.-L.; methodology, formal analysis, data curation, A.C.M.-M., R.A.C.-L., A.I.O.-M., A.R.-C., J.D.M.-C., F.E.-C., F.I.P.-C. and S.d.l.S.-V.; writing—original draft preparation, A.C.M.-M., R.A.C.-L. and S.d.l.S.-V.; writing—review and editing, S.d.l.S.-V. and A.C.M.-M.; supervision, S.d.l.S.-V.; project administration, S.d.l.S.-V.; funding acquisition, S.d.l.S.-V. and A.C.M.-M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Asociación de Productores de Hortalizas del Yaqui y Mayo (APHYM) and Patronato para la Investigación y Experimentación Agrícola del Estado de Sonora (PIAES) project “Identificación de agentes de control biológico contra Meloidogyne sp., Fusarium sp. y Streptomyces sp.” and PROFAPI ITSON project 2024-0580. A.C.M.-M. was funded by Consejo Nacional de Humanidades, Ciencias y Tecnologías (CONAHCYT), for a postdoctoral fellowship (CVU: 440879, application number: 2306476). R.A.C.-L was funded by CONAHCYT for a master’s degree (scholarship number: 1221581).

Data Availability Statement

The genetic sequence data generated in this study are openly available in NCBI accession numbers PP919089 to PP919094.

Acknowledgments

The authors thank all members of the LBRM-COLMENA for their dedication and commitment to the development of all research projects.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Campos, H.; Ortiz, O. The Potato Crop: Its Agricultural, Nutritional and Social Contribution to Humankind; Campos, H., Ortiz, O., Eds.; Springer: Cham, Switzerland, 2020; ISBN 978-3-030-28682-8. [Google Scholar]
  2. SIAP, Servicio de Iinformación Agroalimentaria y Pescquera. Anuario Estadístico de La Produccion Agrícola: Papa. 2022. Available online: https://nube.siap.gob.mx/cierreagricola/ (accessed on 18 June 2024).
  3. Ibarra-Villarreal, A.L.; Villarreal-Delgado, M.F.; Parra-Cota, F.I.; Yepez, E.A.; Guzmán, C.; Gutierrez-Coronado, M.A.; Valdez, L.C.; Saint-Pierre, C.; de los Santos-Villalobos, S. Effect of a Native Bacterial Consortium on Growth, Yield, and Grain Quality of Durum Wheat (Triticum Turgidum L. subsp. durum) under Different Nitrogen Rates in the Yaqui Valley, Mexico. Plant Signal. Behav. 2023, 18, 2219837. [Google Scholar] [CrossRef] [PubMed]
  4. Montoya-Martínez, A.C.; Figueroa-Brambila, K.M.; Escalante-Beltrán, A.; López-Montoya, N.D.; Valenzuela-Ruíz, V.; Parra-Cota, F.I.; Estrada Alvarado, M.I.; de los Santos-Villalobos, S. Biological Control Mechanisms of Bacillus cabrialesii subsp. tritici TSO2T against Fusarium languescens, the Causal Agent of Wilt in Jalapeño Peppers. Horticulturae 2023, 9, 964. [Google Scholar] [CrossRef]
  5. Kobayashi, Y.O.; Kobayashi, A.; Maeda, M.; Someya, N.; Takenaka, S. Biological Control of Potato Scab and Antibiosis by Antagonistic Streptomyces sp. WoRs-501. J. Gen. Plant Pathol. 2015, 81, 439–448. [Google Scholar] [CrossRef]
  6. Zhang, X.Y.; Li, C.; Hao, J.J.; Li, Y.C.; Li, D.Z.; Zhang, D.M.; Xing, X.; Liang, Y. A Novel Streptomyces sp. Strain PBSH9 for Controlling Potato Common Scab Caused by Streptomyces galilaeus. Plant Dis. 2020, 104, 1986–1993. [Google Scholar] [CrossRef]
  7. Labeda, D.P.; Goodfellow, M.; Brown, R.; Ward, A.C.; Lanoot, B.; Vanncanneyt, M.; Swings, J.; Kim, S.B.; Liu, Z.; Chun, J.; et al. Phylogenetic Study of the Species within the Family Streptomycetaceae. Antonie Van Leeuwenhoek 2012, 101, 73–104. [Google Scholar] [CrossRef]
  8. Sarwar, A.; Latif, Z.; Zhang, S.; Zhu, J.; Zechel, D.L.; Bechthold, A. Biological Control of Potato Common Scab With Rare Isatropolone C Compound Produced by Plant Growth Promoting Streptomyces A1RT. Front. Microbiol. 2018, 9, 1–10. [Google Scholar] [CrossRef]
  9. Dos Lopes, M.J.S.; Dias-Filho, M.B.; Gurgel, E.S.C. Successful Plant Growth-Promoting Microbes: Inoculation Methods and Abiotic Factors. Front. Sustain. Food Syst. 2021, 5, 1–13. [Google Scholar] [CrossRef]
  10. Romano, I.; Ventorino, V.; Pepe, O. Effectiveness of Plant Beneficial Microbes: Overview of the Methodological Approaches for the Assessment of Root Colonization and Persistence. Front. Plant Sci. 2020, 11, 1–16. [Google Scholar] [CrossRef]
  11. de los Santos-Villalobos, S.; Díaz-Rodríguez, A.M.; Ávila-Mascareño, M.F.; Martínez-Vidales, A.D.; Parra-Cota, F.I. Colmena: A Culture Collection of Native Microorganisms for Harnessing the Agro-Biotechnological Potential in Soils and Contributing to Food Security. Diversity 2021, 13, 337. [Google Scholar] [CrossRef]
  12. García-Montelongo, A.M.; Montoya-Martínez, A.C.; Morales-Sandoval, P.H.; Parra-Cota, F.I.; de los Santos-Villalobos, S. Beneficial Microorganisms as a Sustainable Alternative for Mitigating Biotic Stresses in Crops. Stresses 2023, 3, 210–228. [Google Scholar] [CrossRef]
  13. Dees, M.W.; Sletten, A.; Hermansen, A. Isolation and Characterization of Streptomyces Species from Potato Common Scab Lesions in Norway. Plant Pathol. 2013, 62, 217–225. [Google Scholar] [CrossRef]
  14. Wanner, L.A. Field Isolates of Streptomyces Differ in Pathogenicity and Virulence on Radish. Plant Dis. 2004, 88, 785–796. [Google Scholar] [CrossRef]
  15. Kumar, V.; Bharti, A.; Gusain, O.; Bisht, G.S. Scanning Electron Microscopy of Streptomyces without Use of Any Chemical Fixatives. Scanning 2011, 33, 446–449. [Google Scholar] [CrossRef] [PubMed]
  16. Loria, R.; Bukhalid, R.A.; Fry, B.A.; King, R.R. Plant Pathogenicity in the Genus Streptomyces. Plant Dis. 1997, 81, 836–846. [Google Scholar] [CrossRef] [PubMed]
  17. Yepes-García, J.; Caicedo-Montoya, C.; Pinilla, L.; Toro, L.F.; Ríos-Estepa, R. Morphological Differentiation of Streptomyces clavuligerus Exposed to Diverse Environmental Conditions and Its Relationship with Clavulanic Acid Biosynthesis. Processes 2020, 8, 1038. [Google Scholar] [CrossRef]
  18. Lerat, S.; Forest, M.; Lauzier, A.; Grondin, G.; Lacelle, S.; Beaulieu, C. Potato Suberin Induces Differentiation and Secondary Metabolism in the Genus Streptomyces. Microbes Environ. 2012, 27, 36–42. [Google Scholar] [CrossRef]
  19. Raeder, U.; Broda, P. Rapid Preparation of DNA from Filamentous Fungi. Appl. Microbiol. 1985, 1, 17–20. [Google Scholar] [CrossRef]
  20. Lapaz, M.I.; Huguet-Tapia, J.C.; Siri, M.I.; Verdier, E.; Loria, R.; Pianzzola, M.J. Genotypic and Phenotypic Characterization of Streptomyces Species Causing Potato Common Scab in Uruguay. Plant Dis. 2017, 101, 1362–1372. [Google Scholar] [CrossRef] [PubMed]
  21. Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
  22. Gouy, M.; Guindon, S.; Gascuel, O. Sea View Version 4: A Multiplatform Graphical User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol. Biol. Evol. 2010, 27, 221–224. [Google Scholar] [CrossRef]
  23. Vaidya, G.; Lohman, D.J.; Meier, R. Cladistics Multi-Gene Datasets with Character Set and Codon Information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
  24. Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  25. Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
  26. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
  27. Chernomor, O.; Von Haeseler, A.; Minh, B.Q. Terrace Aware Data Structure for Phylogenomic Unference from Supermatrices. Syst. Biol. 2016, 65, 997–1008. [Google Scholar] [CrossRef] [PubMed]
  28. de los Santos-Villalobos, S.; Valenzuela-Ruiz, V.; Montoya-Martínez, A.C.; Parra-Cota, F.I.; Santoyo, G.; Larsen, J. Bacillus cabrialesii subsp. cabrialesii subsp. nov. and Bacillus cabrialesii subsp. tritici subsp. nov., Plant Growth-Promoting Bacteria and Biological Control Agents Isolated from Wheat (Triticum turgidum subsp. durum) in the Yaqui Valley, Mexico. Int. J. Syst. Evol. Microbiol. 2023, 73, 005779. [Google Scholar] [CrossRef] [PubMed]
  29. Rojas-Padilla, J.; Chaparro-Encinas, L.A.; Robles-Montoya, R.I.; de los Santos-Villalobos, S. Growth Promotion on Wheat (TriticumtTurgidum L. subsp. durum) by Co-Inoculation of Native Bacillus Strains Isolated from the Yaqui Valley, Mexico. Nov. Sci. 2020, 12, 127. [Google Scholar] [CrossRef]
  30. Valenzuela-Aragon, B.; Parra-Cota, F.I.; Santoyo, G.; Arellano-Wattenbarger, G.L.; de los Santos-Villalobos, S. Plant-Assisted Selection: A Promising Alternative for in vivo Identification of Wheat (Triticum turgidum L. subsp. durum) Growth Promoting Bacteria. Plant Soil 2018, 435, 367–384. [Google Scholar] [CrossRef]
  31. Valenzuela-Ruiz, V.; Parra-Cota, F.I.; Santoyo, G.; De los Santos-Villalobos, S. Potential Biocontrol Mechanisms of Bacillus sp. TSO2 against Bipolaris sorokiniana, Spot Blotch in Wheat. Rev. Mex. Fitopatol. Mex. J. Phytopathol. 2022, 40, 230–239. [Google Scholar] [CrossRef]
  32. Villa-Rodríguez, E.; Parra-Cota, F.; Castro-Longoria, E.; López-Cervantes, J.; de los Santos-Villalobos, S. Bacillus subtilis TE3: A Promising Biological Control Agent against Bipolaris sorokiniana, the Causal Agent of Spot Blotch in Wheat (Triticum turgidum L. subsp. durum). Biol. Control 2019, 132, 135–143. [Google Scholar] [CrossRef]
  33. Villa-Rodriguez, E.; Moreno-Ulloa, A.; Castro-Longoria, E.; Parra-Cota, F.I.; de los Santos-Villalobos, S. Integrated Omics Approaches for Deciphering Antifungal Metabolites Produced by a Novel Bacillus Species, B. cabrialesii TE3T, against the Spot Blotch Disease of Wheat (Triticum turgidum L. subsp. durum). Microb. Res. 2021, 251, 126826. [Google Scholar] [CrossRef]
  34. de los Santos Villalobos, S.; Robles, R.I.; Parra Cota, F.I.; Larsen, J.; Lozano, P.; Tiedje, J.M. Bacillus cabrialesii sp. nov., an Endophytic Plant Growth Promoting Bacterium Isolated from Wheat (Triticum turgidum subsp. durum) in the Yaqui Valley, Mexico. Int. J. Syst. Evol. Microbiol. 2019, 69, 3939–3945. [Google Scholar] [CrossRef] [PubMed]
  35. Valenzuela-Ruiz, V.; Robles-Montoya, R.I.; Parra-Cota, F.I.; Santoyo, G.; del Carmen Orozco-Mosqueda, M.; Rodríguez-Ramírez, R.; de los Santos-Villalobos, S. Draft Genome Sequence of Bacillus paralicheniformis TRQ65, a Biological Control Agent and Plant Growth-Promoting Bacterium Isolated from Wheat (Triticum turgidum subsp. durum) Rhizosphere in the Yaqui Valley, Mexico. 3 Biotech 2019, 9, 1–7. [Google Scholar] [CrossRef]
  36. de los Santos Villalobos, S.; Félix Pablos, C.M.; Ruiz, V.V.; Parra Cota, F.I. Bacillus mexicanus sp. nov., a Biological Control Bacterium Isolated from the Common Bean (Phaseolus vulgaris L.) Crop in Sinaloa, Mexico. Int. J. Syst. Evol. Microbiol. 2023, 73, 10. [Google Scholar] [CrossRef]
  37. Morales-Sandoval, P.H.; Valenzuela-Ruíz, V.; Santoyo, G.; Hyder, S.; Mitra, D.; Zelaya-Molina, L.X.; Ávila-Alistac, N.; Parra-Cota, F.I.; de los Santos-Villalobos, S. Draft Genome of a Biological Control Agent against Bipolaris sorokiniana, the Causal Phytopathogen of Spot Blotch in Wheat (Triticum turgidum L. subsp. durum): Bacillus inaquosorum TSO22. Open Agric. 2024, 9, 20220309. [Google Scholar] [CrossRef]
  38. Santos-Cervantes, M.E.; Felix-Gastelum, R.; Herrera-Rodríguez, G.; Espinoza-Mancillas, M.G.; Mora-Romero, A.G.; Leyva-López, N.E. Characterization, Pathogenicity and Chemical Control of Streptomyces acidiscabies Associated to Potato Common Scab. Am. J. Potato Res. 2017, 94, 14–25. [Google Scholar] [CrossRef]
  39. Wanner, L.A.; Kirk, W.W. Streptomyces—from Basic Microbiology to Role as a Plant Pathogen. Am. J. Potato Res. 2015, 92, 236–242. [Google Scholar] [CrossRef]
  40. Barros-Rodríguez, A.; Rangseekaew, P.; Lasudee, K.; Pathom-Aree, W.; Manzanera, M. Impacts of Agriculture on the Environment and Soil Microbial Biodiversity. Plants 2021, 10, 2325. [Google Scholar] [CrossRef] [PubMed]
  41. Gupta, A.; Singh, U.B.; Sahu, P.K.; Paul, S.; Kumar, A.; Malviya, D.; Singh, S.; Kuppusamy, P.; Singh, P.; Paul, D.; et al. Linking Soil Microbial Diversity to Modern Agriculture Practices: A Review. Int. J. Environ. Res. Public Health 2022, 19, 3141. [Google Scholar] [CrossRef]
  42. Nguyen, H.P.; Weisberg, A.J.; Chang, J.H.; Clarke, C.R. Streptomyces caniscabiei np. nov., Which Causes Potato Common Scab and is Distributed across the World. Int. J. Syst. Evol. Microbiol. 2022, 72, 005225. [Google Scholar] [CrossRef]
  43. Radhakrishnan, R.; Hashem, A.; Abd Allah, E.F. Bacillus: A Biological Tool for Crop Improvement through Bio-Molecular Changes in Adverse Environments. Front. Physiol. 2017, 8, 1–14. [Google Scholar] [CrossRef] [PubMed]
  44. Basu, A.; Prasad, P.; Das, S.N.; Kalam, S.; Sayyed, R.Z.; Reddy, M.S.; El Enshasy, H. Plant Growth Promoting Rhizobacteria (PGPR) as Green Bioinoculants: Recent Developments, Constraints, and Prospects. Sustainability 2021, 13, 1140. [Google Scholar] [CrossRef]
  45. Köhl, J.; Kolnaar, R.; Ravensberg, W.J. Mode of Action of Microbial Biological Control Agents against Plant Diseases: Relevance beyond Efficacy. Front. Plant Sci. 2019, 10, 1–19. [Google Scholar] [CrossRef] [PubMed]
  46. Bolivar-Anillo, H.J.; González-Rodríguez, V.E.; Cantoral, J.M.; García-Sánchez, D.; Collado, I.G.; Garrido, C. Endophytic Bacteria Bacillus subtilis, Isolated from Zea mays, as Potential Biocontrol Agent against Botrytis Cinerea. Biology 2021, 10, 492. [Google Scholar] [CrossRef]
  47. Gu, X.; Zeng, Q.; Wang, Y.; Li, J.; Zhao, Y.; Li, Y.; Wang, Q. Comprehensive Genomic Analysis of Bacillus subtilis 9407 Reveals Its Biocontrol Potential against Bacterial Fruit Blotch. Phytopathol. Res. 2021, 3, 1–12. [Google Scholar] [CrossRef]
  48. Sun, Y.; Su, Y.; Meng, Z.; Zhang, J.; Zheng, L.; Miao, S.; Qin, D.; Ruan, Y.; Wu, Y.; Xiong, L.; et al. Biocontrol of Bacterial Wilt Disease in Tomato Using Bacillus subtilis Strain R31. Front. Microbiol. 2023, 14, 1281381. [Google Scholar] [CrossRef] [PubMed]
  49. Bais, H.P.; Fall, R.; Vivanco, J.M. Biocontrol of Bacillus subtilis against Infection of Arabidopsis Roots by Pseudomonas syringae is Facilitated by Biofilm Formation and Surfactin Production. Plant Physiol. 2004, 134, 307–319. [Google Scholar] [CrossRef]
  50. Cavaglieri, L.; Orlando, J.; Rodríguez, M.I.; Chulze, S.; Etcheverry, M. Biocontrol of Bacillus subtilis against Fusarium verticillioides in vitro and at the Maize Root Level. Res. Microbiol. 2005, 156, 748–754. [Google Scholar] [CrossRef]
  51. Kumbar, B.; Mahmood, R.; Nagesha, S.N.; Nagaraja, M.S.; Prashant, D.G.; Kerima, O.Z.; Karosiya, A.; Chavan, M. Field Application of Bacillus subtilis Isolates for Controlling Late Blight Disease of Potato Caused by Phytophthora infestans. Biocatal. Agric. Biotechnol. 2019, 22, 101366. [Google Scholar] [CrossRef]
  52. Wang, X.Q.; Zhao, D.L.; Shen, L.L.; Jing, C.L.; Zhang, C.S. Application and Mechanisms of Bacillus subtilis in Biological Control of Plant Disease. In Role of Rhizospheric Microbes in Soil; Meena, V.S., Ed.; Springer: Singapore, 2018; pp. 225–250. ISBN 978-981-10-8401-0. [Google Scholar]
  53. Nagórska, K.; Bikowski, M.; Obuchowski, M. Multicellular Behaviour and Production of a Wide Variety of Toxic Substances Support Usage of Bacillus subtilis as a Powerful Biocontrol Agent. Acta Biochim. Pol. 2007, 54, 495–508. [Google Scholar] [CrossRef]
  54. Sarwar, A.; Latif, Z.; Zhang, S.; Hao, J.; Bechthold, A. A Potential Biocontrol Agent Streptomyces violaceusniger AC12AB for Managing Potato Common Scab. Front. Microbiol. 2019, 10, 1–10. [Google Scholar] [CrossRef] [PubMed]
  55. Iqbal, S.; Begum, F.; Rabaan, A.A.; Aljeldah, M.; Al Shammari, B.R.; Alawfi, A.; Alshengeti, A.; Sulaiman, T.; Khan, A. Classification and Multifaceted Potential of Secondary Metabolites Produced by Bacillus subtilis Group: A Comprehensive Review. Molecules 2023, 28, 927. [Google Scholar] [CrossRef]
  56. Belda, E.; Sekowska, A.; Le Fèvre, F.; Morgat, A.; Mornico, D.; Ouzounis, C.; Vallenet, D.; Médigue, C.; Danchin, A. An Updated Metabolic View of the Bacillus subtilis 168 Genome. Microbiology 2013, 159, 757–770. [Google Scholar] [CrossRef] [PubMed]
  57. Kiesewalter, H.T.; Lozano-Andrade, C.N.; Wibowo, M.; Strube, M.L.; Maróti, G.; Snyder, D.; Jørgensen, T.S.; Larsen, T.O.; Cooper, V.S.; Weber, T.; et al. Genomic and Chemical Diversity of Bacillus subtilis Secondary Metabolites against Plant Pathogenic Fungi. mSystems 2021, 6, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  58. Caulier, S.; Nannan, C.; Gillis, A.; Licciardi, F.; Bragard, C.; Mahillon, J. Overview of the Antimicrobial Compounds Produced by Members of the Bacillus subtilis Group. Front. Microbiol. 2019, 10, 1–19. [Google Scholar] [CrossRef] [PubMed]
  59. Lin, C.; Tsai, C.-H.; Chen, P.-Y.; Wu, C.-Y.; Chang, Y.-L.; Yang, Y.-L.; Chen, Y.-L. Biological Control of Potato Common Scab by Bacillus amyloliquefaciens Ba01. PLoS ONE 2018, 13, e0196520. [Google Scholar] [CrossRef] [PubMed]
  60. Feng, R.-Y.; Chen, Y.-H.; Lin, C.; Tsai, C.-H.; Yang, Y.-L.; Chen, Y.-L. Surfactin Secreted by Bacillus amyloliquefaciens Ba01 Is Required to Combat Streptomyces scabies Causing Potato Common Scab. Front. Plant Sci. 2022, 13, 1–14. [Google Scholar] [CrossRef] [PubMed]
  61. Zhou, Y.; Li, Q.; Peng, Z.; Zhang, J.; Li, J. Biocontrol Effect of Bacillus subtilis YPS-32 on Potato Common Scab and Its Complete Genome Sequence Analysis. J. Agric. Food Chem. 2022, 70, 5339–5348. [Google Scholar] [CrossRef] [PubMed]
  62. Tao, H.; Wang, S.; Li, X.; Li, X.; Cai, J.; Zhao, L.; Wang, J.; Zeng, J.; Qin, Y.; Xiong, X.; et al. Biological Control of Potato Common Scab and Growth Promotion of Potato by Bacillus velezensis Y6. Front. Microbiol. 2023, 14, 1295107. [Google Scholar] [CrossRef]
  63. Blake, C.; Christensen, M.N.; Kovács, Á.T. Molecular Aspects of Plant Growth Promotion and Protection by Bacillus subtilis. Mol. Plant-Microbe Interact. 2021, 34, 15–25. [Google Scholar] [CrossRef]
  64. Saeid, A.; Prochownik, E.; Dobrowolska-Iwanek, J. Phosphorus Solubilization by Bacillus Species. Molecules 2018, 23, 2897. [Google Scholar] [CrossRef] [PubMed]
  65. Freitas, M.A.; Medeiros, F.H.V.; Carvalho, S.P.; Guilherme, L.R.G.; Teixeira, W.D.; Zhang, H.; Paré, P.W. Augmenting Iron Accumulation in Cassava by the Beneficial Soil Bacterium Bacillus subtilis (GBO3). Front. Plant Sci. 2015, 6, 1–7. [Google Scholar] [CrossRef] [PubMed]
  66. Valenzuela Ruiz, V.; Santoyo, G.; Gómez Godínez, L.J.; Cira Chávez, L.A.; Parra Cota, F.I.; de los Santos Villalobos, S. Complete Genome Sequencing of Bacillus cabrialesii TE3T: A Plant Growth-Promoting and Biological Control Agent Isolated from Wheat (Triticum turgidum subsp. durum) in the Yaqui Valley. Curr. Res. Microb. Sci. 2023, 4, 100193. [Google Scholar] [CrossRef]
  67. Figueroa-Brambila, K.M.; Escalante-Beltrán, A.; Montoya-Martínez, A.C.; Díaz-Rodríguez, A.M.; López-Montoya, N.D.; Parra-Cota, F.I.; de los Santos-Villalobos, S. Bacillus cabrialesii: Five Years of Research on a Novel Species of Biological Control and Plant Growth-Promoting Bacteria. Plants 2023, 12, 2419. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 10 00865 g001
Figure 1. Typical lesions of common scabs on potatoes sampled in commercial fields in the Yaqui Valley, Mexico.
Figure 1. Typical lesions of common scabs on potatoes sampled in commercial fields in the Yaqui Valley, Mexico.
Horticulturae 10 00865 g001
Horticulturae 10 00865 g002
Figure 2. Maximum likelihood (ML) phylogenetic tree derived from a two-locus dataset. ML bootstrap support (ML-BS) is based on 5000 pseudoreplicates of the data. The outgroup was rooted in sequences of Nocardiopsis dassonvillei NCTC 10488. The bold highlight is used to identify the strains isolated in this study; accession numbers of reference genome assemblies’ sequences are shown in parenthesis.
Figure 2. Maximum likelihood (ML) phylogenetic tree derived from a two-locus dataset. ML bootstrap support (ML-BS) is based on 5000 pseudoreplicates of the data. The outgroup was rooted in sequences of Nocardiopsis dassonvillei NCTC 10488. The bold highlight is used to identify the strains isolated in this study; accession numbers of reference genome assemblies’ sequences are shown in parenthesis.
Horticulturae 10 00865 g002
Horticulturae 10 00865 g003
Figure 3. Streptomyces caniscabiei pathogenicity test in potato slices. (a) Un-inoculated control; (b) inoculated with the studied Streptomyces caniscabiei.
Figure 3. Streptomyces caniscabiei pathogenicity test in potato slices. (a) Un-inoculated control; (b) inoculated with the studied Streptomyces caniscabiei.
Horticulturae 10 00865 g003
Table 1. PCR primers for the taxonomic affiliation of the studied isolates.
Table 1. PCR primers for the taxonomic affiliation of the studied isolates.
GenePrimer NameSequence (5′-3′)Amplicon Size (bp)Reference
recArecAPFCCGCRCTCGCACAGATTGAACGSCAATTC913[20]
recAPRGCSAGGTCGGGGTTGTCCTTSAGGAAGTTGCG
rpoBSRPOF1TCGACCACTTCGGCAACCGC352
SRPOR1TCGATCGGGCACATGCGGCC
Table 2. Description of the comparative strains used for phylogenetic analysis.
Table 2. Description of the comparative strains used for phylogenetic analysis.
Reference Streptomyces StrainAccession NumberLocationYear of IsolationIsolation Source
Streptomyces acidiscabies NRRL B-16521GCA_020010905.1UnknownUnknownPotato tuber
Streptomyces bottropensis ATCC 25435GCA_000383595.1North AmericaUnknownForest soil
Streptomyces caniscabiei ID03-3AGCA_014852565.2USA2003Potato tuber
Streptomyces caniscabiei ND05-13AGCA_014930415.1USA2005Potato tuber
Streptomyces caniscabiei NRRL B-24093GCA_002155765.1Egypt1999Potato
Streptomyces caniscabiei NRRL B-2801GCA_002155725.1USA1961Russet Burbank potato
Streptomyces europaeiscabiei NRRL B-24443GCA_000988945.1France1998Potato
Streptomyces griseiscabiei NRRL B-2795GCA_020010925.1USA1961Potato tuber
Streptomyces griseorubiginosus NBC 00586GCA_036345135.1Denmark2017Soil
Streptomyces neyagawaensis NRRL B-3092GCA_001418645.1Japan1963Unknown
Streptomyces niveiscabiei NRRL B-24457GCA_001419795.1South Korea2005Potato
Streptomyces phaeolivaceus GY16GCA_009184865.1China2018Broussonetia papyrifera
Streptomyces purpureus KA281GCA_000384175.1USAUnknownSoil with decomposing organic matter
Streptomyces scabies NRRL B-16523GCA_001005405.1USA1984Scabby potato
Streptomyces stelliscabiei NRRL B-24447GCA_001008135.1France1998Potato
Streptomyces turgidiscabies ATCC 700248GCA_033794965.1Japan1991Potato
Nocardiopsis dassonvillei NCTC10488GCA_900638215.1Unknown1953Unknown
All information on the comparative strains was obtained from the NCBI database.
Table 3. BLAST results of partial recA and rpoB sequences of the three studied isolates obtained from potatoes from the Yaqui Valley, Mexico.
Table 3. BLAST results of partial recA and rpoB sequences of the three studied isolates obtained from potatoes from the Yaqui Valley, Mexico.
Streptomyces IsolaterecA Partial Gene BLASTn NCBI aSimilarity
(%)		rpoB Partial Gene BLASTn NCBI aSimilarity
(%)
PRV23Streptomyces caniscabiei strain ID03-3A100Streptomyces caniscabiei strain ID03-3A100
PRV28Streptomyces caniscabiei strain ID03-3A100Streptomyces caniscabiei strain ID03-3A99.35
PEP11Streptomyces caniscabiei strain ID03-3A100Streptomyces purpureus strain ATCC 2140599.31
a The accession number for Streptomyces caniscabiei strain ID03-3A chromosome was CP119182.1 and for Streptomyces purpureus strain ATCC 21405; the rpoB gene was AY280794.1.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Montoya-Martínez, A.C.; Chávez-Luzanía, R.A.; Olguín-Martínez, A.I.; Ruíz-Castrejón, A.; Moreno-Cárdenas, J.D.; Esquivel-Chávez, F.; Parra-Cota, F.I.; de los Santos-Villalobos, S. Biological Control of Streptomyces Species Causing Common Scabs in Potato Tubers in the Yaqui Valley, Mexico. Horticulturae 2024, 10, 865. https://doi.org/10.3390/horticulturae10080865

AMA Style

Montoya-Martínez AC, Chávez-Luzanía RA, Olguín-Martínez AI, Ruíz-Castrejón A, Moreno-Cárdenas JD, Esquivel-Chávez F, Parra-Cota FI, de los Santos-Villalobos S. Biological Control of Streptomyces Species Causing Common Scabs in Potato Tubers in the Yaqui Valley, Mexico. Horticulturae. 2024; 10(8):865. https://doi.org/10.3390/horticulturae10080865

Chicago/Turabian Style

Montoya-Martínez, Amelia C., Roel Alejandro Chávez-Luzanía, Ana Isabel Olguín-Martínez, Abraham Ruíz-Castrejón, Jesús Daniel Moreno-Cárdenas, Fabiola Esquivel-Chávez, Fannie I. Parra-Cota, and Sergio de los Santos-Villalobos. 2024. "Biological Control of Streptomyces Species Causing Common Scabs in Potato Tubers in the Yaqui Valley, Mexico" Horticulturae 10, no. 8: 865. https://doi.org/10.3390/horticulturae10080865

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop