Hilgendorf Bio 07
Hilgendorf Bio 07
Hilgendorf Bio 07
Keren Hilgendorf
B.S. Biology (Option: Biology Honors)
Supervising Professor:
Acknowledgements
I would like to thank Nicola Davies and Erin Murphy for their mentoring, patience, and help you truly impacted both the person and the scientist I have become. I would also like to thank Dr. Shelley Payne for the opportunity to work and learn in her lab as well as for countless advice and help throughout my undergraduate years. Finally I would like to thank my parents for fostering my appreciation for science and supporting me throughout the years.
ii
Shigella species, including Shigella dysenteriae, are causative agents of bacillary dysentery, a disease characterized by severe diarrhea and blood in the stool. Although a number of genes required for virulence have been characterized in S. dysenteriae, others remain to be identified. These additional virulence-associated genes can be identified by screening mutants of S. dysenteriae in a plaque assay. The plaque assay is used to infer virulence by measuring the ability of the bacteria to invade, grow within, and spread between eukaryotic cells, resulting in the formation of plaques, small holes in a monolayer of eukaryotic cells. Mutants that have lost the ability to form normal plaques are necessarily avirulent. A previously described non-directed mutant, SDU380, lost the ability to form plaques. Further characterization revealed that this strain had sustained a 33 kilobase deletion. None of the genes in the deleted region are known virulence genes. The purpose of this study was to identify and characterize a novel virulence gene in this deleted region that resulted in the inability of SDU380 to form plaques. Different mutant strains missing only some of the genes deleted in SDU380 were constructed and tested for virulence in a plaque assay. This analysis revealed that the loss of the gene yciB is responsible for the failure of SDU380 to form plaques. The role of the protein YciB in S. dysenteriae virulence is unknown, though the yciB gene is a known virulence-associated gene in Shigella flexneri, a species with a similar lifestyle to that of S. dysenteriae. In S. flexneri, YciB plays a role in septation, an essential step in cell division. Further analysis showed that loss of YciB in S. dysenteriae also results in an intracellular growth defect. However, this defect does not seem to be due to loss of ability to undergo septation and no growth defect is observed in vitro.
iii
Table of Contents
Table of Contents........................................................................................................................... iv List of Figures ................................................................................................................................ vi List of Tables ................................................................................................................................. vi I. INTRODUCTION ....................................................................................................................... 1 A. General Background ............................................................................................................... 1 B. Pathogenesis............................................................................................................................ 3 1. Invasion of epithelium......................................................................................................... 3 2. Intracellular Replication...................................................................................................... 5 3. Intracellular and Intercellular Spread.................................................................................. 5 4. Epithelial cell death............................................................................................................. 6 C. Plaque Assay........................................................................................................................... 7 D. Avirulent strain SDU380 ........................................................................................................ 8 1. Genes in Deleted Region in order of chromosomal location .............................................. 9 E. Purpose of this study ............................................................................................................. 14 II. MATERIALS AND METHODS ............................................................................................. 15 A. Bacterial Strains, Plasmids, and Oligonucleotides................................................................ 15 B. Media and Growth Conditions .............................................................................................. 18 C. General Molecular Techniques ............................................................................................. 19 1. Recombinant DNA Methods............................................................................................. 19 2. Polymerase Chain Reaction (PCR) ................................................................................... 19 3. DNA Sequencing .............................................................................................................. 19 4. Transformation of Bacterial Strains .................................................................................. 20 D. Tissue Culture ....................................................................................................................... 21 1. Invasion Assays................................................................................................................. 21 2. Plaque Assays ................................................................................................................... 21
iv
E. In vitro Competition Assays ................................................................................................. 22 1. Colony Size Assay ............................................................................................................ 22 2. End Point Analysis............................................................................................................ 22 3. Growth Assay ................................................................................................................... 22 F. Construction of Mutant Strains ............................................................................................. 23 1. KHS100 2. KHS101 3. KHS103 ................................................................................................................... 23 ................................................................................................................... 23 ................................................................................................................... 24
2. oppABC is not required for plaque formation in S. dysenteriae........................................ 25 3. trpEDC is not required for plaque formation in S. dysenteriae ........................................ 26 4. yciB is a virulence gene is S. dysenteriae .......................................................................... 27 B. Characterization of virulence gene yciB ............................................................................... 30 1. Background ................................................................................................................... 30
2. YciB complements plaque formation of SDU380 ............................................................ 30 3. YciB may play an essential role in intracellular replication and/or intercellular spread .. 32 4. A S. dysenteriae yciB mutant shows no in vitro growth defect......................................... 37 IV. DISCUSSION......................................................................................................................... 40 A. Identification of virulence gene yciB .................................................................................... 40 B. Characterization of yciB ........................................................................................................ 42 V. REFERENCES......................................................................................................................... 44
List of Figures
Figure 1: Figure 2: Shigella pathogenesis .................................................................................................6 SDU380, a spontaneous mutant of clinical isolate SDU378, has lost the ability to form plaques. ..........................................................................................................7 Figure 3: Figure 4: Deleted region in SDU380..........................................................................................9 The S. dysenteriae oligopeptide permease mutation is not responsible for the no-plaque phenotype of SDU380..............................................................................26 Figure 5: The S. dysenteriae tryptophan biosynthesis deletion is not responsible for the no-plaque phenotype of SDU380..............................................................................27 Figure 6: Figure 7: Figure 8: Figure 9: yciB is a S. dysenteriae virulence gene. ....................................................................28 The S. dysenteriae yciB gene is tightly regulated. ....................................................29 The S. dysenteriae yciB gene is tightly regulated. ....................................................31 The S. dysenteriae yciB gene is essential for in vivo intracellular replication and spread .................................................................................................................36 Figure 10: Figure 11: Figure 12: The S. dysenteriae protein YciB does not affect in vitro growth..............................37 YciB does not affect in vitro growth rate..................................................................38 Varying the amount of YciB has no effect on colony size .......................................39
List of Tables
Table 1: Bacterial strains used in this study................................................................................. 15 Table 2: Plasmids used in this study ............................................................................................. 16 Table 3: Primers used in this study ............................................................................................... 17
vi
accounting for the pervasiveness of shigellosis in developing countries and among children (3, 15).
B. Pathogenesis
With an infectious dose of only 10 to 100 bacteria, Shigella species are extremely virulent (7, 15). The site of pathogenesis is the human colon, where Shigella infection results in inflammation, a non-specific immune response, and destruction of the colon epithelium, a single layer of cells facing the lumen (interior) of the colon and acting as a barrier to bacteria (12, 15). The destruction of the epithelium leads to the characteristic symptoms of shigellosis, including watery diarrhea, abdominal pain, and blood in the stool (7, 19). Shigellae are usually ingested via a food or water source and, because they are highly acid resistant, can pass undamaged through the stomach and small intestine. Once in the colon, Shigellae go through three stages of pathogenesis: invasion of human colonic epithelial cells, replication within these cells, and spread to infect neighboring cells (Fig. 1) (15). This results in the death of host epithelial cells (15). Genes necessary for these three stages are usually found in one of three pathogenicity islands (sections of the chromosome) or on a virulence plasmid (7). 1. Invasion of epithelium Shigellae invade human epithelial cells from the basolateral side (Fig. 1), the side away from the lumen (7, 19). To access the basolateral side of the intestinal epithelium, the bacteria cross the epithelial layer through one of three mechanisms. x The colonic epithelial layer contains M cells, specialized cells that endocytose (take up) samples of the contents of the intestinal lumen and transport these samples to the other side of the epithelial layer to a pocket filled with white blood cells, cells of the immune system (7). This arrangement forms an integral part of the immune system, as it allows the body to prepare for pathogens before the infection can occur. Shigellae, like some other pathogens including Salmonella and Yersinia, are able to
take advantage of this system by using M cells to cross the epithelial layer (7, 19). Once phagocytosed (taken up) by macrophages (a type of white blood cell) in the pocket on the basolateral side of the intestinal epithelium, Shigella turns on genes (primarily ipaD) that cause lysis of the phagocytic vacuole and apoptosis (cell death) of the macrophage (7). This results in the bacteria being released into the submucosa, the space on the basolateral side of the epithelial layer (7). This is the main form of Shigella invasion. x Apoptosis of macrophages also induces inflammation, recruiting more cells of the immune system to the site of infection (7, 19). Some of these cells, called PMN cells (polymorphonuclear leukocytes), squeeze between the epithelial cells, creating gaps in the epithelial layer (7). Once again, Shigellae take advantage of the host defenses by crossing the epithelial layer through the gaps created by the PMN cells (19). x Shigellae can also cross the epithelial layer by manipulating proteins in tight junctions, structures anchoring adjacent epithelial cells to each other (7). Thus, the bacteria create gaps and cross the epithelial layer independently of the immune response system as well. Once on the basolateral side of the epithelial layer, Shigellae stimulate epithelial cells to engulf them (7, 19). This is achieved by inducing a rearrangement of the cytoskeletal network of filaments that gives structural support to the epithelial cell. This results in the formation of membrane extensions surrounding the bacteria, internalizing the pathogen (7, 19). To accomplish this, Shigellae bind receptors (51 and CD44) on the epithelial cell (19). These receptors are associated with the actin cytoskeleton, suggesting that the initial binding of the bacteria to the epithelial cell begins the process of cytoskeleton rearrangement (19). The
receptors are bound by proteins (IpaB-C-D) on the surface of the bacterium (19). Upon binding the bacterium inserts a two-protein complex (IpaB and IpaC) into the epithelial cell membrane, forming a pore through which components of a type III secretion system (encoded by the mxispa locus) transport two proteins (IpaA and IpaC) into the epithelial cell (7, 19). These two proteins coordinate the cytoskeleton rearrangement that results in the engulfment of the bacteria (7, 19). Once internalized, Shigellae use IpaB to lyse the membranous vacuole that is formed as a result of the engulfing, releasing the bacteria into the host epithelial cell cytoplasm (Fig. 1) (19). 2. Intracellular Replication Once inside the host epithelial cell, Shigellae multiply rapidly, doubling in number every 40 minutes (7). Replication includes growth of the bacterium, replication of the genetic material contained within the bacterium, equal distribution of the replicated genetic material to different parts of the cell (binary fission), followed by division (septation) of the bacterium resulting in two equivalent daughter cells. 3. Intracellular and Intercellular Spread Shigellae move within the host epithelial cell and into neighboring cells by manipulating the host cytoskeletal system (Fig. 1). Shigellae express and localize a protein (IcsA) to one pole of the bacterium, where it interacts with a host protein (N-WASP), stimulating polymerization (growth) of actin, a filament of the cytoskeleton system (7). Actin polymerization on one pole of the bacterium propels the bacteria through the interior of the host epithelial cell until it encounters the plasma membrane (structure that surrounds each epithelial cell) and forms a protrusion into the epithelial cell adjacent to the already infected host cell (7). This protrusion containing Shigellae is endocytosed by the neighboring cell, resulting in a double membraned
vesicle containing the bacteria inside this epithelial cell (7). Once again Shigella lyses the membranes of the vacuole it is contained within (IpaB and IpaC mediated) (7). Free in the new host epithelial cell, the bacteria continue to replicate and spread.
Lumen 1
6 5
Basolateral
4 3 Sub-mucosa 2
Figure 1: Shigella pathogenesis (4) 1. M-cell dependent invasion of host epithelial layer. 2. Uptake of Shigellae by macrophages on the basolateral side of the epithelium. 3. Release of Shigellae into the sub-mucosa following Shigellae induced macrophage apoptosis. 4. Shigellae stimulated uptake by epithelial cell. 5. Shigellae induced evasion of membranous vacuole releasing the bacteria into the host cytoplasm. 6. Intracellular and intercellular spread as a result of actin polymerization 4. Epithelial cell death Cell death or necrosis of host epithelial cells was initially thought to be a result of overpacking of Shigellae in host cells due to continuous replication of the bacteria (7). It is now, however, thought that the death of host epithelial cells is caused by the inflammatory response of the host attacking and killing infected epithelial cells (7). The destruction of the epithelial layer in turn leads to the characteristic symptoms of shigellosis (15).
C. Plaque Assay
Since the only natural host of Shigellae are humans, Shigellae virulence cannot be studied using animal models (7, 15, 19). Virulence can, however, be inferred using the plaque assay (Fig. 2 left side) (19). In this assay, a monolayer of human epithelial cells is infected with Shigellae and then incubated for 4 days. The plaque assay tests the ability of the bacteria to invade, grow intracellularly, and spread from cell-to-cell, three essential steps of Shigella virulence (7, 15). If the bacteria are successful in all three of these activities, epithelial cell death results in the formation of plaques, small clearings within the monolayer. A strain that can form wild-type (normal) plaques is not necessarily virulent, since other factors, such as sensitivity to pH of the stomach, may prevent the bacteria from reaching the colon. Mutants that have lost the ability to form plaques (Fig. 2 right side) are, however, necessarily avirulent as the steps required for plaque formation are essential to the pathogenesis of Shigella species (7, 15).
Figure 2: SDU380, a spontaneous mutant of clinical isolate SDU378, has lost the ability to form plaques.
Figure 3: Deleted region in SDU380 1. Genes in Deleted Region in order of chromosomal location a. Oligopeptide permease (opp) operon
This operon (series of genes that are co-regulated and code for proteins that usually function together) makes up a substantial part of the deletion of SDU380. It encodes five proteins (OppA, OppB, OppC, OppD, OppF) that form a transport system for small peptides (10). As such this operon is important in cell-cell signaling, transport of peptides as carbon and nitrogen sources, cell wall component recycling, and many other important bacterial functions (9, 20). Although no research studies have shown a virulence-associated role of the oligopeptide permease system in Shigella, several studies have revealed that the opp operon is involved in the pathogenesis of other bacteria. In many bacterial species the olgopeptide permease complex is involved in quorum sensing, a process to monitor bacterial population density and that may be
involved in virulence initiation (9). In Vibrio fluvialis, another human pathogen, the oligopeptide permease operon appears to be involved in biofilm production. Biofilms are formed by aggregates of bacteria that function together to protect one another and that are involved in many diseases (10). Another study revealed a role for the products of the opp operon in the pathogenesis of group A streptococci, a Gram positive human pathogen (9, 10, 31). b. Cardiolipin synthase (cls)
Cardiolipin synthase is an enzyme that catalyzes the last step in the synthesis of cardiolipin, a lipid found in cell membranes (29). Though Escherichia coli lacking this enzyme were found to be less viable when the bacteria have reached maximal density and have an increased doubling time, no evidence exists to suggest that cls is a virulence-associated gene in E. coli or another bacterial species (29). c. Potassium channel (kch)
This channel allows for bacterial uptake of potassium within the host epithelial cell (18). The kch gene shares substantial homology with potassium channel genes in eukaryotic cells (18). Although no studies have shown a role in virulence for this potassium channel in Shigella species, a study has identified a similar protein, SapG, in Salmonella typhimurium that when deleted results in reduced virulence in a mouse model of infection (18). d. Putative gene yciI
This gene is poorly characterized. It may encode a protein involved in cell morphology since this is the putative role of a yciI homologue in Haemophilus influenzae (32). No studies have revealed a role of yciI in pathogenesis.
10
e.
TonB
Shigellae need to acquire many essential nutrients such as iron to survive. Inside the host epithelial cell, Shigellae are dependent on the host cell for these essential nutrients (23, 28). There are several iron transport systems that Shigella uses to transport iron from the host epithelial cell cytoplasm into the bacterium (23, 28). TonB-dependent systems are a major type of iron transport system used both outside and inside host cells (23). TonB is involved in the transport of iron complexes across the outer bacterial membrane, one of two membranes surrounding all Gram negative bacteria. TonB is associated with outer membrane receptors and transduces the energy required to transport iron complexes across the outer membrane (23, 28). TonB was shown to be involved in the virulence of several Salmonella species, Vibrio species, Pseudomonas species, Haemophilus species, and Escherichia coli (28). However, a S. dysenteriae mutant lacking tonB was found to be able to form plaques in a plaque assay, indicating that tonB is not responsible for the no-plaque phenotype of SDU380 (4). f. Putative operon yciCBA
While yciC and yciA are uncharacterized, yciB, also called ispA, is a known virulenceassociated gene in S. flexneri (6, 12). YciB is a putative membrane protein (6, 12). S. flexneri lacking yciB were found to have lost the ability to form plaques in a plaque assay, indicating that yciB is essential for S. flexneri virulence (6, 12). Further analysis of the S. flexneri yciB mutant showed that this strain is avirulent due to a septation (cell division) deficiency as well as an actin polymerization deficiency (6, 12). The inability to properly divide results in the formation of long filaments of partially attached bacteria that presumably hinders intercellular spread. The inability to polymerize actin causes the bacteria to be unable to generate the propelling force
11
necessary to spread to neighboring cells (6, 12). There have been no studies conducted to investigate the possible role of yciB (ispA) in S. dysenteriae. g. Putative gene yciD
This gene encodes a putative outer membrane protein. In Salmonella, yciD was shown to encode a cell envelope protein (24). There are no studies that have shown a role of yciD in bacterial pathogenesis. h. Putative gene yciE
This gene codes for a stress protein (11). Stress proteins are a set of proteins that are expressed by organisms under particular stress condition for increased protection of the organism and are known to play a role in virulence (22) i. Tryptophan Biosynthesis (trp) operon
This operon also makes up a substantial part of the deletion in SDU380. As the name suggests, the tryptophan biosynthesis operon encodes proteins that are involved in the synthesis of the amino acid tryptophan from precursors in the absence of tryptophan in the bacterial environment. Though there is no evidence suggesting that the tryptophan biosynthesis operon is involved in Shigella pathogenesis, a study has shown that tryptophan is involved in the virulence of pathogenic E. coli against both Caenorhabditis elegans (microscopic worms) and humans (1). Tryptophan, either acquired from the environment or through biosynthesis, was shown to be involved in the regulation of Shiga toxin production and of pathogenicity gene expression in pathogenic E. coli (1).
12
j.
These two genes are not well characterized. Crystal structure analysis suggests that yciO codes for an RNA binding protein (8). YciV is a putative enzyme of unknown function. Neither gene is known to play a role in pathogenesis. k. Putative gene yciL
This gene is also known as rluB and encodes a pseudouridine synthase, an enzyme that catalyzes the conversion of uridine to pseudouridine in RNA molecules, in particular rRNA and tRNA (5). No studies have revealed a role for yciL (rluB) in pathogenesis.
13
14
15
Table 2: Plasmids used in this study Plasmid pGEM-T Easy pHM5 pQE2 pKH1 Description Cloning vector Allelic exchange vector Expression vector, IPTG inducible Splice overlap PCR of S. dysenteriae O-4576S1GW trpEDC cloned into pGEM-T Easy PCR of S. dysenteriae O4576S1-GW oppABC cloned into pGEM-T Easy Kanamycin resistance gene from pUC4K cloned into the SmaI site of pKH1 XbaI EcoRV fragment (trpEDC::aph) of pKH3 cloned into pHM5 Chloramphenicol resistance gene from pMTL24Cam cloned into the SmaI site of pKH2 XbaI SphI fragment (oppABC::chl) of pKH7 cloned into pHM5 Splice overlap PCR of S. dysenteriae O-4576S1-G yciCBA cloned into pGEM-T Easy Chloramphenicol resistance gene from pMTL24Cam cloned into the SmaI site of pKH12 SalI EcoRV fragment (yciCBA::chl) of pKH13 cloned into pHM5 Plasmid carrying E. coli yciCBA and tonB Reference or source Promega (25) Qiagen This work
pKH2
This work
pKH3
This work
pKH5
This work
pKH7
This work
pKH8
This work
pKH12
This work
pKH13
This work
pKH14
This work
pRZ526
(21)
16
pND55
Table 3: Primers used in this study Primer Name trp.1 trp.2 trp.3 trp.4 opp.3 opp.4 yciB.3 yciB.4 yciB.5 yciB.6 Sequence GCCAGATTGATATCTACCCAATTGCCGG CACCGCCAGTCCCGGGTAAGGAGTTCTGGC GAACTCCTTACCCGGGACTGGCGGTGACGG CGCTTTCTTGCACTCTAGAATAAACGCCG TACCCGCATGCGTCACACTGG TAGCGATGTCTAGACCACCACC CGCTACGCAGATATCAACTCGATCG GGATTTATCTTCCCGGGCTTCATTTTACGATTCCG GAAGCCCGGGAAGATAAATCCTAACC CTGCTGATCTAGAACCGC
17
B.
E. coli strains were cultured in Luria-Bertani broth (LB broth) (10g tryptone, 5g yeast extract and 10g NaCl per liter) at 37C or grown on Luria-Bertani agar (LB agar) at 37C. S. dysenteriae strains were cultured in LB broth at 30C or at 37C or grown on tryptic soy broth agar (TSB agar) plus 0.01% Congo red dye at 37C. Antibiotics were added to LB broth as follows: 250 g/ml of carbenicillin, 50 g/ml of kanamycin, 35 g/ml of chloramphenicol, and 200 g/ml of streptomycin. Strains containing a tonB mutation were supplemented with 40 PM FeSO4. Isopropyl-E-d-thiogalactosidase (IPTG) was used to induce expression of genes cloned behind an inducible plasmid promoter.
18
C.
1.
Recombinant DNA Methods The QIAprep Spin Miniprep kit (Qiagen, Santa Clarita, CA) was used to isolate plasmid
DNA as indicated by the manufacturer. The QIAquick gel extraction kit (Qiagen) was used to isolate DNA fragments from agarose gels as described in the manufacturers instructions. Enzymes used for endonuclease restriction digests and DNA ligations were purchased from New England Biolabs (Beverly, MA) and Promega (Madison, WI). The reactions were performed as described by Sambrook and Russel (27). HindIII or BstEII digested DNA was used as size markers to estimate DNA fragments separated by gel electrophoresis.
2.
Polymerase Chain Reaction (PCR) PCR reactions were carried out in an Applied Biosystems GeneAmp thermocycler or an
MJ Research PTC-200 thermocycler using Taq polymerase (Qiagen) as indicated the manufacturer. A 100 L PCR reaction contained the following: template DNA, 5 units of Taq polymerase, 10 M of each primer, 250 M of each dNTP, and 1x Taq reaction buffer. Small scale 20 L PCR reactions at the same relative concentrations were carried out for screening purposes. The following PCR program was used: 1) 5 minutes at 94C; 2) 30 seconds at 94C; 3) 30 seconds at 50C; 4) 1 minute per 1000 bp of expected PCR fragment size at 72C; 6) repeat steps 2 through 4 29 times; 7) 7 minutes at 72C.
3.
DNA Sequencing Mutations in bacterial strains were verified by DNA sequencing using the automated dye
termination procedure. Sequences were analyzed on an ABI 377A DNA sequencer by the Core Facility at the Institute for Cellular and Molecular Biology at the University of Texas at Austin.
19
4.
Transformation of Bacterial Strains a. Electroporation of Shigella This technique, as described by Sambrook and Russel (26) was used to introduce
plasmids into electrocompetent bacterial strains. Bacteria were made electrocompetent as follows: Strains were grown till mid-log at 30C in two milliliter LB broth containing appropriate antibiotics and chilled on ice for one hour. Bacteria were harvested by 6000x centrifugation at 4C for 10 minutes and washed with 25 ml of ice cold water. Centrifugation was repeated and bacteria were washed with 10 ml of ice cold water. This was repeated one more time with 5 ml of ice cold water. After a final centrifugation bacteria were resuspended in 250 L of ice cold water plus 10% glycerol. One hundred L of electrocompetent cells were used per electroporation. b. Conjugation S. dysenteriae mutants were constructed by allelic exchange. Plasmids were introduced into S. dysenteriae by conjugation. This was achieved by centrifuging one ml each of overnight cultures of donor strain containing the plasmid with the mutated allele, recipient strain, and helper strain and resuspending each pellet in 100 L LB broth. Twenty L of each suspension was mixed and dotted onto an LB agar plate. The plate was incubated at 37C for 6-8 hours. The bacteria were collected with a swab and resuspended in 1 ml LB broth. Bacteria were plated onto agar plates containing appropriate antibiotics to select for successful transconjugants.
20
D.
Tissue Culture
Henle cells (intestinal 407 cells) purchased from the American Type Culture Collection, Manassas, Va. were used for all cultured cell experiments. Cells were grown in Henle medium (Eagles minimum essential medium, 2 mM glutamine, and 10% fetal bovine serum) in a 5% CO2 atmosphere at 37C.
1.
Invasion Assays To determine the stage of pathogenesis for which a putative virulence gene is essential,
invasion assays were performed. General instructions as described by Hong et al. (6) were followed with the following adjustment: the monolayer of Henle cells was incubated for 15 minutes following infection before medium containing extracellular bacteria was removed and replaced by medium containing 20 g/ml gentamicin to kill any remaining extracellular bacteria. Monolayers were stained with Wright-Giemsa stain (Baxter Scientific Products, McGaw Park, Ill.) and observed under the microscope.
2.
Plaque Assays Plaque assays were performed to infer virulence of S. dysenteriae mutants. General
instructions are described by Oaks et al. (17) with the modifications by Hong et al. (6) and the following adjustments: monolayers of Henle cells were grown to confluence in 35 mm diameter plates (approximately 2106 cells per plate) and infected with 2104 bacteria. Medium was removed after 60 minutes and replaced with medium containing 0.45% (weight/volume) glucose and 20g of gentamicin per mL. Plaque assays were incubated for 48 to 96 hours. Medium was removed and monolayers were stained with Wright-Giemsa stain.
21
E.
1.
Colony Size Assay This assay was used to compare mutant and wild type in vitro growth on LB agar.
Bacteria were grown overnight and diluted. Approximately 100 bacteria were plated on LB agar and incubated overnight at 37C. Bacteria carrying a complemented plasmid were grown in the presence of 0, 1, 10, or 100 M IPTG. Using a microscope, the size of 10 colonies per plate was measured and the mean was calculated and compared.
2.
End Point Analysis This technique was used to compare mutant and wild type in vitro growth in LB broth.
Three overnight cultures of each bacterial strain were diluted approximately 1:100 so that each culture contained an equal number of bacteria. Bacteria containing a complementing plasmid were grown in the presence of 0, 1, 10, or 100 M IPTG. Cultures were grown at 37C for approximately 8 hours and absorbance was measured at 600 nm.
3.
Growth Assay This technique was used to further investigate in vitro growth rates in LB broth.
Bacteria were grown as described in the section labeled End Point Analysis with the following modifications: the optical density (A650) of each culture was measured at the 2, 3, 4, 5, 6, 7, and 24 hours. Bacteria containing a complementing plasmid were grown in the presence of 1 M or 100 M IPTG.
22
KHS100 The S. dysenteriae trp mutant was constructed as follows: Using primers trp.1 and trp.2
and primers trp.3 and trp.4, two fragments containing parts of trpE and trpD and parts of trpD and trpC were amplified from O4576S1-GW. The two fragments were combined using overlapextension PCR with primers trp.1 and trp.2, creating a SmaI site within trpD. The resulting PCR fragment was cloned into pGEM-T Easy and designated pKH1. pHK1 contains a unique XbaI site upstream of the cloned fragment and a unique EcoRV site downstream of the fragment. A HincII fragment of pUC5K carrying the aph gene (Kan resitance) was inserted into the SmaI site internal to trpD, yielding pKH3. After double digestion of pKH3 with XbaI and EcoRV, the cloned fragment was inserted into XbaI EcoRV digested pHM5, yielding pKH5. pKH5 was transferred into O4576S1-G via conjugation. Recombination and allelic replacement was confirmed by PCR analysis of sucrose-resistant, carbenicillin-sensitive, kanamycin-resistant isolated colonies. The resulting trpEDC::kan strain was designated KHS100. DNA sequenc analysis verified successful mutant construction.
2.
KHS101 The S. dysenteriae opp mutant was contructed as follows: Primers opp.3 and opp.4 were
used to amplify part of oppA, oppB, and part of oppC from O4576S1-GW. The resulting PCR fragment was cloned into pGEM-T Easy and designated pKH2. The plasmid contains a SphI site downstream of the cloned fragment and a unique XbaI site upstream the fragment in addition to a SmaI site internal to oppB. A SmaI fragment of pMTL24Cam carrying the cat gene (Chl resistance) was inserted into the SmaI site in oppB, yielding pKH7. The cloned fragment containing the cat gene was removed from pKH7 using SphI and XbaI and inserted into SphI
23
XbaI digested pHM5, yielding pKH8. pKH8 was transferred into O4576S1-G via conjugation and recombination and allelic replacement was confirmed by PCR analysis of sucrose-resistant, carbenicillin-sensitive, chloramphenicol -resistant isolated colonies. The resulting oppABC::chl strain was designated KHS101 and DNA sequence analysis verified successful mutant construction.
3.
KHS103 The S. dysenteriae yciB mutant was constructed as follows: Using primers yciB.3 and
yciB.4 a DNA fragment containing parts of yciC and yciB was amplified from O4576S1-G. Another fragment containing part of yciB, yciA, and part of tonB was amplified from O4576S1G using primers yciB.5 and yciB.6. The two fragments were combined using overlap-extension PCR with primers yciB.3 and yciB.6, creating a deletion and a SmaI site within yciB. This PCR fragment was cloned into pGEM-T Easy and designated pKH12. The plasmid contains a unique SalI site upstream of the cloned fragment and an EcoRV site downstream of the fragment. A SmaI fragment of pMTL24Cam carrying the cat gene (Chl resistance) was inserted into the SmaI site in yciB, yielding pKH13. The SalI and EcoRV fragment of pKH13 (the cloned fragment) was inserted into SalI EcoRV digested pHM5, yielding pKH14. pKH14 was transferred into O4576S1-G via conjugation and recombination and allelic replacement was confirmed by PCR analysis of sucrose-resistant, carbenicillin-sensitive, chloramphenicolresistant isolated colonies. The resulting yciB::chl strain was designated KHS103. DNA sequence analysis verified successful mutant construction.
24
25
Figure 4:
The S. dysenteriae oligopeptide permease mutation is not responsible for the no-plaque phenotype of SDU380. A S. dysenteriae mutant lacking oppABC and the S. dysenteriae wild-type parental strain were tested in a plaque assay. There was no observable difference in plaque number and size, indicating that gene(s) other than in the oligopeptide permease operon are responsible for the loss of ability of SDU380 to form plaques.
3.
trpEDC is not required for plaque formation in S. dysenteriae A S. dysenteriae trpEDC mutant, KHS101, was constructed and tested in a plaque assay.
The mutant strain was able to form wild-type plaques, indicating that genes other than the ones encoding the tryptophan biosynthesis system are responsible for the no-plaque phenotype of SDU380 (Fig. 5).
26
Figure 5:
The S. dysenteriae tryptophan biosynthesis deletion is not responsible for the no-plaque phenotype of SDU380. A S. dysenteriae mutant lacking trpEDC and the S. dysenteriae wild-type parental strain were tested in a plaque assay. Both strains formed plaques of approximately same size and number, indicating that gene(s) other than in the tryptophan biosynthesis operon account for the loss of ability to form plaques of SDU380. 4. yciB is a virulence gene is S. dysenteriae A S. dysenteriae yciB mutant, KHS103, was constructed and tested in a plaque assay. The mutant was not able to form plaques, indicating that yciB is a virulence gene (Fig. 6). Complementing KHS103 with a plasmid carrying yciB, pND55, restored the ability to form plaques when yciB was expressed at low levels (0M IPTG, 1M IPTG and 10M IPTG). Overexpression of yciB with 100M IPTG resulted in loss of ability to form plaques, indicating that yciB expression is tightly controlled in S. dysenteriae (Fig. 7).
27
Figure 6: yciB is a S. dysenteriae virulence gene. A S. dysenteriae mutant lacking yciB and the S. dysenteriae wild-type parental strain were tested for virulence in a plaque assay. The mutant did not form plaques, indicating that it is avirulent and that yciB is a virulence gene.
28
Figure 7: The S. dysenteriae yciB gene is tightly regulated. Complementing the S. dysenteriae yciB mutant with yciB restored the ability to form plaques when the plasmid was not induced or only slightly induced (0M IPTG, 1M IPTG, or 10M IPTG). Overexpression of yciB in the presence of 100M IPTG did not complement plaque formation.
29
B. Characterization of virulence gene yciB 1. Background As briefly mentioned in the introduction, yciB is a known virulence gene in S. flexneri. A S. flexneri mutant lacking yciB is therefore unable to form plaques and further characterization of the mutant revealed that this is likely due to both an intracellular growth defect and an intracellular spread defect (12). The mutant forms long filaments that appear to be unable to completely septate. The mutant is also unable to spread intracellularly, a step in pathogenesis that depends on the bacterias ability to polymerize actin. The loss of ability of the S. dysenteriae mutant to form plaques in a plaque assay indicates that yciB is a virulence gene. Complementation studies of SDU380 with yciB were done to determine whether yciB is the only virulence gene in the deleted region and an invasion assay was performed to study during which stage of S. dysenteriae pathogenesis YciB is essential. 2. YciB complements plaque formation of SDU380 Complementing SDU380 with a plasmid carrying yciB restored plaque formation if yciB was expressed in low levels (0M IPTG or 1M IPTG) (Fig. 8). This indicates that only the yciB gene was responsible for the no-plaque phenotype of SDU380. Expression of yciB at higher levels (10M IPTG or 100M IPTG) did not complement the plaque phenotype, further indicating yciB is highly regulated in S. dysenteriae (Fig. 8).
30
Figure 8: The S. dysenteriae yciB gene is tightly regulated. Complementing SDU380 with yciB restored the ability to form plaques when yciB was not induced or only slightly induced (0M IPTG or 1M IPTG). Overexpression of yciB (10M IPTG or 100M IPTG) did not complement plaque formation.
31
3.
YciB may play an essential role in intracellular replication and/or intercellular spread The yciB mutant KHS103, the wild-type parental strain O4576S1-G, and the mutant
complemented with pND55 (yciB) in the presence of 1M IPTG were compared in the invasion assay. Figure 9 shows two representative images per strain at 2, 4, 6, and 8 hours post infection. All three strains appear to grow at a similar rate during the first 2 hours after infection. At the 4 hour time point, the mutant has multiplied significantly less than either the wild-type strain or the mutant strain carrying the complementing plasmid. While both the wild-type strain and the mutant strain carrying the complementing plasmid show signs of intercellular spread at 6 hours post-infection, the yciB mutant strain does not. The number of bacteria in cells at the 8 hour time point varies too much for all three strains to draw any conclusions. This may partially be due to increased bacterial death in the overcrowded epithelial cells. Overall, the mutant appears to grow significantly slower than wild-type and shows no sign of intercellular spread.
32
33
34
35
Figure 9: The S. dysenteriae yciB gene is essential for in vivo intracellular replication and spread No growth defect is apparent in the yciB mutant 2 hours post-infection. At the 4 hour time point the mutant has replicated significantly less than the wild-type strain and the complemented mutant. Both the wild-type strain and the mutant carrying a complementing plasmid show signs of intercellular spread at the 6 hour time point.
36
4.
A S. dysenteriae yciB mutant shows no in vitro growth defect a. Comparison of growth rates of S. dysenteriae yciB mutant and parental strain in LB broth showed no significant difference In vitro growth of KHS103, O4576S1-G, and KHS103 complemented with pND55 with
varying amounts of IPTG were compared in an end point analysis and in a growth analysis. The yciB mutant did not show an in vitro growth defect compared to the parental strain O4576S1-G, and expression of pND55 with varying amounts of IPTG did not cause a significant difference in growth (Fig. 10, 11). This suggests that yciB expression is only important for in vivo S. dysenteriae growth.
2 1.8
Optical Density (A650)
Figure 10: The S. dysenteriae protein YciB does not affect in vitro growth No growth defect of KHS103 versus O4576S1-G was observed in an end point analysis. No significant difference in growth between KHS103, O4576S1-G, and KHS103 complemented with pND55 in the presence of 0, 1, 10, or 100M
37
IPTG was observed. This suggests that YciB is not essential for in vitro growth of S. dysenteriae.
10
0.1 0 5 10 15 20 25 30
Figure 11: YciB does not affect in vitro growth rate KHS103, O4576S1-G, and KHS103 complemented with pND55 in the presence of 1M IPTG and 100M IPTG showed no significant difference in growth rates. This suggests that YciB doesnt play an important role in in vitro growth.
38
b.
Comparison of growth of S. dysenteriae yciB mutant and parental strain on LB agar showed no significant difference
Comparing the average colony size of KHS103, O4576S1-G, and KHS103 complemented with pND55 further suggested that YciB has no in vitro growth effect. The complemented strain was grown on various amounts of IPTG to test if altered expression of yciB resulted in a growth defect. Both KHS103 and O4576S1-G were grown in the presence of no IPTG and 5M IPTG as controls. While supplementing the complemented KHS103 strain with 100M IPTG resulted in significantly smaller colonies compared to no IPTG supplement, all strains, including the controls, formed smaller colonies on 5M IPTG, suggesting that the difference observed on 100M IPTG was a function of increased IPTG amounts, not of increased expression of yciB (Fig 12). Thus, while the level of YciB is important for in vivo pathogenesis and therefore presumably growth, the level of YciB has no in vitro growth effect.
Colony Size Assay-yciB
Figure 12: Varying the amount of YciB has no effect on colony size The level of YciB has no effect on average colony sizes of KHS103, O4576S1-G, and KHS103 complemented with pND55.
) (0 M G G 6S 1 45 7 0045 7 6S 1 (5
KH S1
39
40
YciB is very important in S. dysenteriae pathogenesis. However, the levels of IPTG at which plaque formation of the mutant carrying a complementing plasmid could be restored were different in KHS103, which could form plaques when yciB was expressed with 0 M, 1 M, and 10 M IPTG, and SDU380, which could form plaques when yciB was expressed with 0 M and 1 M IPTG. This difference is likely due to genetic differences other than yciB between the two mutant strains. In other words, genes other than yciB in the deleted region of SDU380 affect virulence, but only yciB is essential in restoring ability to form plaques of SDU380.
41
B. Characterization of yciB
While the plaque assay is sufficient to identify a virulence genes, further studies are necessary to understand the nature of its involvement in virulence. An invasion assay was done to identify the stage of pathogenesis affected by loss of YciB. The data suggested that YciB affects intracellular growth and intercellular spread. This conclusion is based on the observation that at four hours post-infection infected eukaryotic cells contained fewer numbers of mutant bacteria relative to wild-type and mutant carrying a complementing plasmid. Furthermore, while both wild-type and mutant carrying a complementing plasmid showed signs of intercellular spread at the six hour time point, KHS103 showed no indication of spread. There is no evidence indicating whether loss of YciB affects these two steps of pathogenesis directly or indirectly. While both S. flexneri and S. dysenteriae yciB mutants were defective in intracellular growth and intercellular spread, the two mutant strains displayed a different phenotype. The S. flexneri yciB mutant had a septation defect resulting in long filaments formation (12). No such defect was displayed by the S. dysenteriae yciB mutant. This difference is not surprising, since the two species, despite a similar general lifestyle and similar genetic makeup, are distinct. The growth defect of the S. dysenteriae yciB mutant was further studied in vitro. Neither an endpoint analysis nor a growth curve verified the growth defect of KHS103 in vitro. While the colony size assay showed some indication that YciB affects replication rate, as seen by the decreasing average colony size with increasing amounts of IPTG and thus presumably yciB expression, the data were insufficient to conclude that the growth defect was solely due to YciB levels. A growth defect in vivo but not in vitro is not uncommon and suggests that YciB is regulated by a multitude of signals, including specifically intracellular signals.
42
While further analysis is necessary to identify the signals involved in YciB regulation and the extent of YciB involvement in S. dysenteriae virulence, this study identified a novel virulence gene in S. dysenteriae. The findings further suggest that YciB affects intracellular growth and intercellular spread, both essential steps in Shigella pathogenesis.
43
V. REFERENCES
1. Anyanful, A., J. M. Dolan-Livengood, T. Lewis, S. Sheth, M. N. Dezalia, M. A. Sherman, L. V. Kalman, G. M. Benian, and D. Kalman. 2005. Paralysis and killing of Caenorhabditis elegans by enteropathogenic Escherichia coli requires the bacterial tryptophanase gene. Mol Microbiol 57:988-1007. Ashkenazi, S. 2004. Shigella infections in children: new insights. Semin Pediatr Infect Dis 15:246-52. Baer J.T., V. D. J., Reingold A.L., Aragon T., Angulo F. J., and Bradford W.Z. 1999. HIV Infection as a Risk Factor for Shigellosis. Emerging Infectious Diseases 5:820-823. Davies, N. M. L. 2006. Iron Acquisition by Shigella dysenteriae and Shigella flexneri. University of Texas at Austin, Austin. Del Campo, M., Y. Kaya, and J. Ofengand. 2001. Identification and site of action of the remaining four putative pseudouridine synthases in Escherichia coli. Rna 7:1603-15. Hong, M., Y. Gleason, E. E. Wyckoff, and S. M. Payne. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect Immun 66:4700-10. Jennison, A. V., and N. K. Verma. 2004. Shigella flexneri infection: pathogenesis and vaccine development. FEMS Microbiol Rev 28:43-58. Jia, J., V. V. Lunin, V. Sauve, L. W. Huang, A. Matte, and M. Cygler. 2002. Crystal structure of the YciO protein from Escherichia coli. Proteins 49:139-41. Lazazzera, B. A. 2001. The intracellular function of extracellular signaling peptides. Peptides 22:1519-27. Lee, E. M., S. H. Ahn, J. H. Park, J. H. Lee, S. C. Ahn, and I. S. Kong. 2004. Identification of oligopeptide permease (opp) gene cluster in Vibrio fluvialis and characterization of biofilm production by oppA knockout mutation. FEMS Microbiol Lett 240:21-30. Liu, D., Y. Zhao, X. Fan, Y. Sun, and R. O. Fox. 2004. Expression, crystallization and preliminary crystallographic analysis of YciE, a stress protein from Escherichia coli. Acta Crystallogr D Biol Crystallogr 60:1888-9. Mac Siomoin, R. A., N. Nakata, T. Murai, M. Yoshikawa, H. Tsuji, and C. Sasakawa. 1996. Identification and characterization of ispA, a Shigella flexneri chromosomal gene essential for normal in vivo cell division and intracellular spreading. Mol Microbiol 19:599-609.
2. 3.
4. 5. 6.
7. 8. 9. 10.
11.
12.
44
13.
Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170:2575-83. Mills, M., and S. M. Payne. 1997. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutant. Infect Immun 65:5358-63. Niyogi, S. K. 2005. Shigellosis. J Microbiol 43:133-43. Niyogi, S. K., M. R. Saha, and S. P. De. 1994. Enteropathogens associated with acute diarrhoeal diseases. Indian J Public Health 38:29-32. Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation by virulent Shigella flexneri. Infect Immun 48:124-9. Parra-Lopez, C., R. Lin, A. Aspedon, and E. A. Groisman. 1994. A Salmonella protein that is required for resistance to antimicrobial peptides and transport of potassium. Embo J 13:3964-72. Philpott, D. J., J. D. Edgeworth, and P. J. Sansonetti. 2000. The pathogenesis of Shigella flexneri infection: lessons from in vitro and in vivo studies. Philos Trans R Soc Lond B Biol Sci 355:575-86. Podbielski, A., B. Pohl, M. Woischnik, C. Korner, K. H. Schmidt, E. Rozdzinski, and B. A. Leonard. 1996. Molecular characterization of group A streptococcal (GAS) oligopeptide permease (opp) and its effect on cysteine protease production. Mol Microbiol 21:1087-99. Postle, K., and W. S. Reznikoff. 1978. HindII and HindIII restriction maps of the attphi80-tonB-trp region of the Escherichia coli genome, and location of the tonB gene. J Bacteriol 136:1165-73. Raivio, T. L. 2005. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol Microbiol 56:1119-28. Reeves, S. A., A. G. Torres, and S. M. Payne. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect Immun 68:6329-36. Robbe-Saule, V., C. Coynault, M. Ibanez-Ruiz, D. Hermant, and F. Norel. 2001. Identification of a non-haem catalase in Salmonella and its regulation by RpoS (sigmaS). Mol Microbiol 39:1533-45. Runyen-Janecky, L. J., and S. M. Payne. 2002. Identification of chromosomal Shigella flexneri genes induced by the eukaryotic intracellular environment. Infect Immun 70:4379-88.
14.
19.
20.
21.
25.
45
Sambrook, J., and D. W. Russel. 2001. Molecular Cloning: A Laboratory Manual, 3 ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2 ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Torres, A. G., P. Redford, R. A. Welch, and S. M. Payne. 2001. TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect Immun 69:6179-85. Tropp, B. E. 1997. Cardiolipin synthase from Escherichia coli. Biochim Biophys Acta 1348:192-200. Tzipori, S., A. Sheoran, D. Akiyoshi, A. Donohue-Rolfe, and H. Trachtman. 2004. Antibody therapy in the management of shiga toxin-induced hemolytic uremic syndrome. Clin Microbiol Rev 17:926-41, table of contents. Wang, C. H., C. Y. Lin, Y. H. Luo, P. J. Tsai, Y. S. Lin, M. T. Lin, W. J. Chuang, C. C. Liu, and J. J. Wu. 2005. Effects of oligopeptide permease in group a streptococcal infection. Infect Immun 73:2881-90. Willis, M. A., F. Song, Z. Zhuang, W. Krajewski, V. R. Chalamasetty, P. Reddy, A. Howard, D. Dunaway-Mariano, and O. Herzberg. 2005. Structure of YciI from Haemophilus influenzae (HI0828) reveals a ferredoxin-like alpha/beta-fold with a histidine/aspartate centered catalytic site. Proteins 59:648-52.
29. 30.
31.
32.
46