Molecular Immunology 71 (2016) 4253

Contents lists available at ScienceDirect

Molecular Immunology
journal homepage: www.elsevier.com/locate/molimm

Neem leaf glycoprotein promotes dual generation of central and

effector memory CD8+ T cells against sarcoma antigen vaccine to
induce protective anti-tumor immunity
Sarbari Ghosh, Madhurima Sarkar, Tithi Ghosh, Ipsita Guha, Avishek Bhuniya, Akata Saha,
Shayani Dasgupta, Subhasis Barik, Anamika Bose 1 , Rathindranath Baral ,1
Department of Immunoregulation and Immunodiagnostics, Chittaranjan National Cancer Institute (CNCI), 37, S. P. Mukherjee Road, Kolkata 700026, India

a r t i c l e

i n f o

Article history:
Received 27 November 2015
Received in revised form 8 January 2016
Accepted 20 January 2016
Available online 3 February 2016
Keywords:
Neem leaf glycoprotein
Central memory CD8+ T cells
Effector memory cells
Sarcoma antigen
KLF2
FOXO

a b s t r a c t
We have previously shown that Neem Leaf Glycoprotein (NLGP) mediates sustained tumor protection by
activating host immune response. Now we report that adjuvant help from NLGP predominantly generates
CD44+ CD62Lhigh CCR7high central memory (TCM; in lymph node) and CD44+ CD62Llow CCR7low effector
memory (TEM; in spleen) CD8+ T cells of Swiss mice after vaccination with sarcoma antigen (SarAg).
Generated TCM and TEM participated either to replenish memory cell pool for sustained disease free states
or in rapid tumor eradication respectively. TCM generated after SarAg + NLGP vaccination underwent
signicant proliferation and IL-2 secretion following SarAg re-stimulation. Furthermore, SarAg + NLGP
vaccination helps in greater survival of the memory precursor effector cells at the peak of the effector
response and their maintenance as mature memory cells, in comparison to single modality treatment.
Such response is corroborated with the reduced phosphorylation of FOXO in the cytosol and increased
KLF2 in the nucleus associated with enhanced CD62L, CCR7 expression of lymph node-resident CD8+ T
cells. However, spleen-resident CD8+ T memory cells show superior efcacy for immediate memory-toeffector cell conversion. The data support in all aspects that SarAg + NLGP demonstrate superiority than
SarAg vaccination alone that benets the host by rapid effector functions whenever required, whereas,
central-memory cells are thought to replenish the memory cell pool for ultimate sustained disease free
survival till 60 days following post-vaccination tumor inoculation.
2016 Elsevier Ltd. All rights reserved.

1. Introduction
Cancer vaccinology deals with the awakening of the immune
system to cancer by presenting antigens. These antigens are associated with tumor cells and participating in either prevention of
the cancer development (prophylactic cancer vaccines) or existing
cancer treatment (therapeutic cancer vaccine). In use for cancer
prevention, vaccines must elicit long term memory without the
potential of causing autoimmunity (Finn, 2003). The major problem in developing an efcient cancer vaccine is the lack of TSAs
(antigens present only on tumor cells) and the weakness of immune
responses against TAAs (antigens present mostly on tumor cells but
also on some normal cells), usually recognized by the immune system as self-antigens (Buonaguro et al., 2011; Cunto-Amesty et al.,

Corresponding author. Fax: +91 033 2475 7606.

E-mail address: baralrathin@hotmail.com (R. Baral).
1
Both authors contributed equally to this work.
http://dx.doi.org/10.1016/j.molimm.2016.01.007
0161-5890/ 2016 Elsevier Ltd. All rights reserved.

2003; Kaech et al., 2002). Nevertheless, in the last 20 years, several different vaccines from whole tumor cells or tumorcell lysates
have been evaluated in preclinical models and clinical trials. Vaccine adjuvants trigger the activation and maturation of dendritic
cells (DCs), so that DCs loaded with antigen, migrate to the proximal
lymph nodes and acquire the ability to optimally present antigens
for initiation of de novo T cell responses (Dubensky and Reed, 2010;
Mohan et al., 2013).
A productive encounter of nave CD8+ T cells to antigen stimulation follows a prototypical, tri-phasic response consisting of:
(i) activation phase; (ii) death phase and iii. immunologic memory phase (Klebanoff et al., 2006). According to Sallusto et al.
(2004); Sallusto et al. (1999), memory T cells are divided broadly
into central (TCM) and effector (TEM) memory T cells. TCMs are
antigen-experienced cells that constitutively express CD62L and
CCR7, two surface molecules necessary for cellular extravasation in
high endothelial venules and migration to T-cell zones of peripheral lymph nodes. Whereas TEMs are antigen-experienced T cells
that have these markers signicantly downregulated and popu-

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

late to the peripheral tissues, such as, the liver and lung (Masopust
et al., 2001). Adoptively transferred self/tumor-reactive CD8+ TCMs
are observed to be superior mediator of antitumor immunity to
an established cancer compared to TEM cells, when given in combination with a systemically administered tumor antigen vaccine
(Klebanoff et al., 2005). TCM cells have greater proliferative capacity
upon antigen re-encounter compared with TEM cells (Bachmann
et al., 2005), thereby, leading to generation of a larger absolute
number of terminally differentiated effector T cells that can inltrate the peripheral sites to mediate antigen clearance. These data
suggest that TCM may be more potent on a per cell basis in
mediating antigen clearance compared with TEM cells. Therefore,
generation of TCM should be an important immunologic end-point
to consider in future preventive and therapeutic vaccine trials.
In the present study, we have reported that vaccination with sarcoma antigen (SarAg), along with neem leaf glycoprotein (NLGP),
a global immunomodulator, generates antigen-specic central
memory CD8+ T cells (TCM) in lymph nodes and effector memory
CD8+ T cells (TEM) in spleen during vaccination-post vaccination
window. Furthermore, this vaccination schedule shows signicant
protection against growth of sarcoma tumor expressing SarAg by
inducing effective conversion of memory-to-effector cells. Superior
protection from tumor growth, along with tumor free survival till
experiment termination, provides evidence in favor of the adjuvant
efcacy of NLGP.
2. Materials and methods
2.1. Antibodies and reagents
RPMI-1640 and Fetal Bovine Serum (FBS) were purchased from
Life Technologies (NY, USA). Lymphocyte separation media (LSM)
was procured from MP Biomedicals, Irvine, CA, USA and HiMedia, Mumbai, India. Fluorescence conjugated different anti-mouse
antibodies (CD44, CD127, CD69, Ly6C-FITC conjugated and CD8,
CD62L, CCR7, Granzyme B-PE conjugated), puried anti-mouse
antibodies (CD8, Ki67, KLF2, FOXO3, pFOXO3, pAKT (ser), pAKT
(thr), pmTOR) were procured from either BD-Pharmingen or Biolegend (San Diego, CA, USA) or Santa Cruz (Dallas, Texas, USA). TMB
substrate solutions (for ELISA), CytoFix/CytoPerm solutions (for
intracellular staining) were procured from BD-Pharmingen, San
Diego, CA, USA. LDH cytotoxicity detection kit was purchased from
Roche Diagnostics, Mannheim, Germany. RT-PCR primers were
designed and procured from MWG Biotech AG, Bangalore, India.
2.2. Neem leaf glycoprotein (NLGP)
Extract from neem (Azadirachta indica) leaves was prepared
by the method as described previously (Chakraborty et al., 2010).
Mature leaves of same size and color (indicative of same age),
taken from a standard source, were shed-dried and pulverized. Leaf
powder was soaked overnight in phosphate-buffered saline (PBS),
pH 7.4. Supernatant was collected by centrifugation at 1500 rpm,
extensively dialyzed against PBS, pH 7.4 and concentrated by Centricon membrane lter (Millipore Corporation, MA, USA) with
10 kDa molecular weight cut-off. Puried NLGP was checked for
its quality by electrophoresis and HPLC using routine laboratory
methods. Biological activity of puried NLGP was checked by tumor
growth restriction assay before use. The protein concentration was
measured by FolinLowry method (Lowry et al., 1951).

43

was microscopically validated. Disrupted cells were sonicated and

lysates were centrifuged at 15,000 g (30 min, 4 C). The supernatant was recovered as SarAg. The protein concentration was
measured using Folins phenol reagent (Lowry et al., 1951) and
stored at 20 C. Similarly, melanoma antigen (MelAg) was prepared from B16 melanoma cells grown in culture.
2.4. Mice and immunization
Female Swiss mice (Age: 46 weeks; Body weight: 2427 g)
were obtained from the Institutional Animal Care and Maintenance
Department of Chittaranjan National Cancer Institute, Kolkata, and
maintained under standard laboratory conditions. Autoclaved dry
pellet diet and water were given ad libitum. Mice (n = 6) were vaccinated sub-cutaneously with the SarAg and SarAg + NLGP in the
lower right ank. Vaccination was done at an interval of seven days
for 4 weeks time period (Kalli et al., 2013; Hariharan et al., 1995).
One group of mice was kept as vaccine free control (PBS treated).
Animal experiments were performed according to the guidelines
established by the Institutional Animal Care and Ethics Committee
of CNCI, Kolkata, India, following their approval.
2.5. Tumor inoculation in vaccinated mice
Three groups of Swiss mice (n = 6 in each group) that were vaccinated with PBS, SarAg and SarAg + NLGP, were inoculated with
sarcoma cells (1 106 cells/mice) in the lower right ank (the site
of immunization) 30 days after the completion of the vaccination
schedule. Growth of solid tumor (in mm3 ) and survivability was
monitored bi-weekly in these three cohorts of mice (PBS, SarAg
and SarAg + NLGP) by caliper measurement using the formula:
(width2 length)/2. Tumors were monitored till day 60 from the
day of tumor inoculation. Tumors were checked macroscopically
by caliper measurement regularly and tumor size was recorded as
a tumor area (in mm3 ) and mice were sacriced if tumors became
ulcerated or reached a size >250 mm2 within 120 days (Saha et al.,
2006). At experiment termination tumors were checked microscopically after histological preparation.
2.6. Generation and culture of bone marrow derived DCs and
antigen pulsing
Primary bone marrow-derived DCs (BmDCs) were obtained
from mouse bone marrow (from tibia and femurs) precursor
according to the protocol described (Mallick et al., 2014). Tissue
pieces were minced through a nylon mesh into a single-cell suspension. Next, erythrocytes were lysed by resuspending the cell pellet
in a hypotonic buffer (9.84 g/l NH4 Cl, 1 g/l KHCO3 , 0.1 mM EDTA)
and incubating the cell suspension for 10 min on ice. The cells were
washed and cultured in a six-well plate at 2 106 cells/well with
RPMI-1640 containing rmGM-CSF (10 ng/ml) and rmIL-4 (5 ng/ml).
On day 6 of culture, non-adherent cells obtained from these cultures were considered to be immature bone marrow-derived DCs.
Immature BmDCs (1 106 cells/ml) on day 8 were incubated with
SarAg/MelAg (5 g/ml of culture) for overnight in same culture condition. MelAg was used as an unrelated, non-specic control to see
the antigen specicity of the generated TCM phenotype cells for
SarAg.
2.7. CD8+ CD62Lhigh T cell (central memory phenotype)
purication

2.3. Sarcoma antigen preparation

Peritoneally grown sarcoma cells were collected, washed in PBS
and then lysed by ve freeze (in liquid nitrogen)-thaw (at room
temperature) cycles (Mallick et al., 2014). Total cell disruption

CD8+ CD62Lhigh T cells were puried from the single cell suspension of TDLN and spleen using Magnetic Assisted Cell Sorter
(MACS) according to the manufacturers instruction (Barik et al.,
2013a). In brief, CD8+ T cells were puried by magnetic bead

44

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

attached anti-CD8 antibody. The isolated cells were labelled with

biotinylated anti-CD62L antibody followed by incubation with
streptavidin microbeads. The cell suspension was then loaded
on a MACS column and allowed to pass through. The cellular fraction that stuck to the walls of the tube is the required
CD8+ CD62Lhigh T cell fraction. The purity of cells was checked by
ow cytometry and cell preparation with >90% purity was taken for
experiment.
2.8. Flow cytometric analysis of cells from lymph nodes and
spleen
Single cells were prepared from the harvested lymph nodes and
spleens of mice from the 3 groups (PBS, SarAg, SarAg + NLGP) aseptically. T cell surface phenotypic markers were assessed by ow
cytometry after labeling of cells (1 106) with mouse uorescence
labelled antibodies (CD8, CD44, CD62L, CD69, Ly6C and CD127)
as per manufacturers recommendation. After labeling, cells were
washed in FACS buffer (PBS with 1% FBS). Similarly, intracellular
molecules, like, IFN, Granzyme B were stained with anti-mouse
uorescence labelled antibodies using cytox-cytoperm reagents
as described before (Goswami et al., 2014; Mallick et al., 2013b). In
all ow cytometric staining, cells were xed with 1% paraformaldehyde in PBS and cytometry was performed with Cell Quest software
on a FACS Caliber (Becton Dickinson, Mountainview, CA). Suitable
negative isotype controls were used to rule out the background
uorescence. Percentage of each positive population and MFI were
determined by using quadrant statistics.
2.9. Detection of antigen specic CD8+ T cells
Splenocytes and lymph node cells were prepared from the harvested spleens and lymph nodes. The cells were stimulated for 6
hr in vitro with/without SarAg (5 g/ml) in RPMI-1640 containing
10% FBS and brefeldin A (1 mg/ml). Brefeldin A was used to detect
IFN intracellularly in CD8+ T cells by ow cytometry. The cells
were harvested and stained with anti-mouse CD8-PE rst, then,
cells were permeabilized with CytoPerm wash buffers and stained
with anti-mouse IFN. The gate for IFN+ cells was selected on an
unstimulated sample for each mouse. This value was subtracted
from the antigen stimulated values to determine the frequency of
antigen specic CD8+ T cells (Hamilton and Harty, 2002).
2.10. Proliferation of TCM cells in in vitro
The TCM cells (CD8+ CD62Lhigh T cells) were puried from three
groups of mice and co-cultured with the SarAg/MelAg pulsed DCs
for 72 hr at 37 C with 5% CO2 . After incubation, the cells were pelleted down and 7080% chilled ethanol was added to the pellet
(15 107 cells) with vortexing and then incubated at 20 C for
2 hr. The cells were washed twice with staining buffer and centrifuged for 10 min at 200 g. Cells were then resuspended to a
concentration of 1 107 cells/ml and transferred into each sample
tube to add anti-Ki67 antibody and mixed gently. The tubes were
incubated at room temperature for 2030 min in dark. Cells were
washed and 0.5 ml of staining buffer was added to each tube and
analyzed ow cytometrically.
2.11. Intracellular staining of phosphorylated proteins
The lymph node and spleen cells were stimulated with SarAg
(1 g/ml) for 30 min at 37 C with 5% CO2 . After stimulation, the
cells were washed and xed in fresh 2% paraformaldehyde for
10 minutes at room temperature (Krutzik and Nolan, 2003), followed by permeabilization of cells with 90% methanol for 1 h at
4 C. Next, the cells were stained with anti-mouse puried pAKT

Table 1
Primer sequences of various cytokine genes studied.
Name

Primer sequences (5 -3 )

Product size

-Actin-F
-Actin-R

CAACCGTGAAAAGATGACCC
ATGAGGTAGTCTGTCAGGTC

228 bp

IL-7Ra-F
IL-7Ra-R

CCACAATGAGTGCCCTACCT
GACCGGACAGACACTCCAAT

238 bp

Eomesodermin-F
Eomesodermin-R

CCACTACAATGTTTTCGTGG
TTGTTGTTGTTTGCACCTTT

217 bp

Bcl-6- F
Bcl-6- R

AGCAAGAACGCCTGCATCCTTC
CATCTCTGTATGCTGTGGCGACTG

417 bp

(thr308), pAKT (ser473), pmTOR, FOXO3, KLF2 antibodies. After

30 min of incubation, cells were stained with secondary anti-rabbitFITC and anti-goat-PE antibodies. The cells were then analysed with
Cell Quest software on a FACS Calibar (Becton Dickinson, Mountainview, CA).
2.12. Isolation of RNA and RTPCR analysis
CD8+ CD62Lhigh T cells were puried from lymph nodes and
spleens by MACS as mentioned above. Total RNA was isolated
using the Trizol reagent (Invitrogen, USA). The cDNA synthesis was
carried out using RevertAidTM rst strand cDNA synthesis kit (Fermentas, K1622) following the manufacturers protocol and PCR
were carried out using gene-specic oligonucleotide primers, as
listed in Table 1. PCR products were identied by image analysis
software for gel documentation (Gel DocTM XR + system, BioRad)
following electrophoresis on 1.5% agarose gels, stained with ethidium bromide.
2.13. Cytosolic and nuclear lysate preparation
Single cells from lymph nodes were prepared in chilled PBS
and then centrifuged at 3000 rpm for 10 min. The cell pellet was
re-suspended in ice-cold nuclear extraction buffer and incubated
for 1 h at 4 C. The cells were then centrifuged at 6000 rpm for
5 min. The supernatant was isolated as the cytosolic fraction. The
remaining pellet was dissolved in nuclear extraction buffer and
kept in vortex for 30 min at 4 C. The suspension was centrifuged at
12,000 rpm for 10 min. The supernatant was collected as the nuclear
fraction (Dimauro et al., 2012). The separation was validated by
western blot analysis of house keeping marker proteins (nuclear
HISTONE H1 and cytosolic GAPDH).
2.14. Western blot analysis
Nuclear and cytosolic lysate (50 g) were separated on 12.5%
SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane for Western Blotting. Incubation was performed for different
primary antibodies, e.g., histone h1, GAPDH, KLF2, FOXO3 and
pFOXO3 and the procedure was followed as published (Barik et al.,
2013a; Banerjee et al., 2014).
2.15. Immunouorescence studies
For immunouoroscence analysis, CD8+ T cells from lymph
nodes were harvested to prepare cytospin slides. Cells were xed
with 2% paraformaldehyde and then permeabilized with 0.1%
Triton-X-100. All washing steps were performed using 0.5% BSA
in PBS while blocking steps were carried out using 2% BSA in PBS.
For detection of the presence of pFOXO3, cells were incubated with
puried anti-mouse pFOXO3 antibody, followed by FITC conjugated
anti-rabbit secondary antibody. All sections were counterstained

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

45

Fig. 1. Generation of antigen specic CD8+ T cell response after sarcoma antigen (SarAg) vaccination with/without NLGP. (A) Vaccination schedule of Swiss mice with SarAg
with/without NLGP. (B) Percent positive CD8+ T cells during and after SarAg and SarAg + NLGP vaccination in lymph nodes and spleen, as determined by ow cytometry.
(C) Ex vivo cytotoxicity of sarcoma and carcinoma cells by CD8+ T cells from lymph nodes and spleens of the PBS, SarAg and SarAg + NLGP vaccinated mice as determined
by LDH release assay. (D) Percent positive antigen experienced CD8+ cells expressing CD44 in lymph nodes and spleens as studied by ow cytometry in three groups of
mice. (E) Frequencies of antigen specic CD8+ T cells expressing IFN after in vitro antigenic stimulation with SarAg and CarAg in the presence of brefeldinA in lymph nodes
and spleens as monitored by ow cytometry. Bar diagram represents mean SD of three individual observations from each group at each time point. ***p < 0.001, **p < 0.01,
*p < 0.05.

with DAPI and then mounted. Images were acquired using Leica
DM 1000, Fluorescent Microscope (Leica, BM 4000B, Germany).

3. Results
3.1. Vaccination with SarAg along with NLGP adjuvant generates
superior antigen specic CD8+ T cell response

2.16. Cytotoxicity assay

Cellular cytotoxicity of lymph node and spleen cells was determined by measuring lactate dehydrogenase (LDH) released by
target cells using a commercially available kit (Roche Diagnostics,
Mannheim, Germany) (Barik et al., 2013a; Mallick et al., 2013b).

2.17. Detection of cytokine secretion by ELISA

IL-2 secretion from TCM phenotype cells after co-culture with
SarAg/MelAg pulsed DCs for 72 h was assessed by ELISA (BDPharmingen, OptEIATM ) as per manufacturers instruction (Barik
et al., 2013a) and optical density was measured at 450 nm using
microplate reader (BioTek Instruments Inc., Vermont, USA).

2.18. Statistical analysis

All results represent the average of separate in vivo and in vitro
experiments. In each experiment a value represents the mean of
three individual observations and is presented as mean standard
deviation (SD) or standard error (SE) and p < 0.05 is considered signicant. Statistical signicance was established by students t-test
using INSTAT 3 Software (Graphpad Inc., USA).

Two groups of mice were vaccinated with SarAg and

SarAg + NLGP along with a PBS treated control group (Fig. 1A). Status of CD8+ T cells was studied in vaccination and post-vaccination
period in lymph nodes and spleens, two important secondary lymphoid organs. In lymph nodes, the frequencies of CD8+ T cells
were increased gradually and reached a peak on day 30, 2 days
after the completion of vaccination (Fig. 1B). Upregulated CD8+
T cell response was superior in SarAg + NLGP vaccinated groups
than those mice group vaccinated with SarAg alone, however, no
response was observed in PBS control mice. As assessed on day 60
post vaccination schedule, a decline in the number of CD8+ T cells
was observed in both the groups. The decline might correspond to
the contraction phase of the CD8+ T cell immune response. On the
contrary, in spleen a peak response was observed on day 10 (after
two vaccinations) that yielded highest frequencies of CD8+ T cells
in the SarAg + NLGP vaccinated mice (Fig. 1B). The post vaccination contraction phase was observed in both the vaccinated groups.
Repetition of the similar experiment yielded identical result.
Further, antigen specic cytotoxic ability of the CD8+ T cells after
SarAg and SarAg + NLGP vaccination was checked toward sarcoma
and carcinoma cells. In case of both lymph node and spleen, extent
of cytotoxicity was signicantly greater toward antigen positive
sarcoma than carcinoma cells (Sarcoma vs Carcinoma, 80% vs 30%)
(Fig. 1C). Combination of NLGP with SarAg vaccine provided superior cytotoxicity of CD8+ T cells over SarAg alone toward sarcoma

46

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

Fig. 2. Enhanced generation of SarAg specic CD8 memory phenotypic cells by NLGP adjuvant. (A) Gating strategy of lymphocytes and CD8+ cells in ow cytometry. (B)
Expression of CD69 on CD8+ T cells in lymph nodes and spleens of mice at different time points, as studied by ow cytometry. (C) Expression of Ly6C in CD8+ T cells in
lymph nodes and spleens of mice, as determined by ow cytometry. (D) Surface expression of IL-7R on CD8+ T cells in lymph nodes and spleens of mice, as studied by
ow cytometry. Representative histogram represents memory phenotype cells on day 60. (E) Transcriptional level analysis of IL-7R gene at different time points in CD8+ T
cells of lymph nodes and spleens from representative mice, as determined by RT-PCR and bar diagram shows mean relative expression. Bar diagram represents mean SD
of three individual observations from each group at each time point. ***p < 0.001, ** p < 0.01, *p < 0.05.

on post vaccination days 10, 30 and 60 (n = 3 in each group at each

time point). Next, we studied the antigen priming status of CD8+
T cells with CD44 marker expression on lymph node and spleen
cells (n = 3 in each group at each time point) (Fig. 1D). In lymph
nodes, the antigen priming is signicantly higher on day 30 and
day 60 in the vaccinated mice with more number of CD8+ CD44+
T cells in SarAg + NLGP cohort. A similar trend of CD44 expression
was found in spleen, but maximum number of CD8+ CD44+ T cells
was detected on day 10. Such antigen (SarAg) specicity of CD8+ T
cells was studied by SarAg specic IFN release assay after in vitro
antigen stimulation, using carcinoma antigen (CarAg) as control
(Fig. 1E) (n = 3 in each group at each time point). The frequency
of antigen specic CD8+ T cells is higher in SarAg + NLGP cohort
than SarAg group on day 30/60 in lymph nodes and day 10/30/60

in spleens, suggesting more antigen specic CD8+ T cells in both

immune organs after SarAg + NLGP vaccination.
3.2. Vaccination with SarAg along with NLGP adjuvant generates
enhanced number of memory phenotypic cells
In absence of any inammation or post antigenic stimulation
phase, the CD8+ memory T cells generated are maintained in a quiescent state (with minimum activation) (Alp et al., 2015). To study
this particular aspect of memory T cells in our settings, the activation status of CD8+ T cells (as gated in Fig. 2A) was examined
and found that in SarAg and SarAg + NLGP cohort the number of
CD8+ CD69+ T cells is higher on day 10 and 30 in lymph nodes as
well as spleens (during and just after the end of vaccination) (n = 3

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

in each group at each time point). Whereas on day 60, the observed
high CD69 expression was downregulated on CD8+ T cells more
intensely in mice of SarAg + NLGP cohort than SarAg mice group
indicating low activation or resting state of the CD8+ T cells in both
lymph nodes and spleen (Fig. 2B). Next, we studied the expression
of Ly6C, a good marker of memory CD8+ T cells (Walunas et al.,
1995; Hanninen et al., 2011), in all the three cohorts (Fig. 2C) (n = 3
in each group at each time point). The number of CD8+ Ly6C+ T cells
was increased on days 10 and 30 in both vaccinated cohorts and was
maintained till day 60 in these two immune organs. The number
of CD8+ Ly6C+ T cells is higher in SarAg + NLGP cohort than SarAg,
indicating more number of memory phenotype cells in the former
group of mice. Furthermore, memory CD8+ T cells require IL-7 for
their survival and maintenance (Bradley et al., 2005; Scluns et al.,
2000; Nanjappa et al., 2008; Dong et al., 2012), thus, memory precursors are identied as CD8+ IL-7R+ . Accordingly, we studied the
expression of IL-7R (CD127) on CD8+ T cells during and after vaccination (Fig. 2D) (n = 3 in each group at each time point). In lymph
nodes, the number of CD8+ CD127+ T cells was signicantly upregulated in SarAg + NLGP than SarAg cohort, which was maintained
till day 60 in the former. A similar observation was found in case of
splenic CD8+ T cells. The CD127 expression is also validated in the
transcriptional level by RTPCR and results show the similar day
dependent increment of IL-7R in lymph nodes and spleens from
vaccinated mice groups (n = 3 in each group at each time point), particularly in those injected with SarAg + NLGP (Fig. 2E). Therefore, it
can be concluded that at this point more number of memory phenotypic CD8+ T cells are generated in SarAg + NLGP cohort than SarAg
group as CD69low Ly6Chigh CD127high phenotype.
3.3. Vaccination with SarAg along with NLGP adjuvant facilitates
generation of central memory phenotype of CD8+ T cells in lymph
nodes with more effector memory phenotypes in spleen
Memory phenotype cells are broadly classied into two subtypes: central memory (TCM) and effector memory (TEM) based on
their migration patterns (Klebanoff et al., 2006; Sallusto et al., 2004;
Sallusto et al., 1999; Masopust et al., 2001; Bouneaud et al., 2005;
Lanzavechhia and Sallusto, 2005). As reported by Klebanoff et al.
(2006) and Sallusto et al. (2004); Sallusto et al. (1999) in TCM
cells the migration molecules like CD62L and CCR7 are upregulated, whereas, those are downregulated in TEM cells. Therefore,
we studied the expression of these molecules on the antigen
primed CD8+ T cells (CD8+ CD44+ ). In lymph nodes, the number of
CD8+ CD44+ CD62L+ cells (representing TCM phenotype) was significantly upregulated in SarAg + NLGP cohort with modest increase in
SarAg monotherapy group on day 30 post vaccination time frame
(Fig. 3A, 3C) (n = 3 in each group at each time point) that, declines
again on day 60 probably coinciding with the decrease in CD8+ T
cell frequency. However, the MFI values gradually increases from
day 0 to day 60 with greater expression of CD62L in SarAg + NLGP
cohort than SarAg (data not shown). In spleen, the number of
CD8+ CD44+ CD62L+ T cells increases on day 10 post vaccination
and then decreases gradually toward day 60 (with more number
of CD8+ CD44+ CD62L+ TCM cells in SarAg + NLGP cohort) (Fig. 3A,
C). Next, we studied the expression of CCR7 on CD8+ CD44+ T cells.
In lymph nodes, the frequencies of CD8+ CD44+ CCR7+ T cells (n = 3
in each group at each time point) increase on day 30 and then
reduce on day 60 in both the vaccinated cohorts. However, the
TCM phenotype cells were more in SarAg + NLGP than only SarAg
cohort till day 60 (Fig. 3D, F). In spleens, the number as well as
MFI of CD8+ CD44+ CCR7+ T cells is high on day 10 and gradually
decreases toward day 60 (Fig. 3D, F). Effector memory phenotype cells (CD8+ CD44+ CD62L and CD8+ CD44+ CCR7 ) were more
prominent in spleen on days 10, 30 and 60 during SarAg + NLGP
vaccination in comparison to lymph nodes (Fig. 3B, E).

47

The central memory CD8+ T cells were characterized further on

the basis of upregulation of transcription factors, like, eomesodermin (eomes) and bcl-6 (Banerjee et al., 2010; Ichii et al., 2004).
RT-PCR analysis (n = 3 in each group) demonstrated that eomes
and bcl-6 were expressed in greater extent in the CD8+ CD62Lhigh
T cells from SarAg + NLGP vaccinated mice over SarAg cohort on
day 60, where less increment was noted. No such changes were
demonstrated in non-vaccinated controls (Fig. 3G).
3.4. SarAg with NLGP vaccination generates central memory
phenotype of lymph node CD8+ T cells in association with
downregulation of mTOR/AKT and upregulation of KLF2/FOXO3
In quiescent state of a cell on post vaccination day 60, CD8+
T cells maintain their CD62Lhigh CCR7high IL7Rhigh status through
KLF2 and FOXO3 signaling in nucleus (Navarro and Cantrell, 2014;
Michelini et al., 2013; Cao et al., 2010). After its phosphorylation
with help of AKT/mTOR signaling FOXO moves to cytoplasm. Foxo
transcriptional factors are nuclear but when phosphorylated they
exit the nucleus and form a complex with 14-3-3 in the cytosol thereby terminating their transcriptional activity (Finlay and
Cantrell, 2011). Accordingly, it was observed that on post vaccination day 60, lymph node cells from SarAg + NLGP vaccinated
mice showed downregulated phosphorylation of mTOR than SarAg
cohort (Fig. 4A). Further, we studied the expression of pAKT (ser)
(Fig. 4B) and pAKT (thr) (Fig. 4B) in CD8+ T cells. No change in
expression was observed between SarAg and SarAg + NLGP groups
for pAKT (ser), however, the pAKT (thr) expression was reduced in
SarAg + NLGP cohort than SarAg vaccinated mice. Such downregulated phosphorylation of mTOR and AKT (thr) might be associated
with reduced phosphorylation of FOXO (Navarro and Cantrell,
2014). In the nucleus, FOXOs induce expression of transcription
factor KLF2, which directly regulates transcription of genes encoding CD62L and CCR7 that control T cell trafcking. Flow cytometric
analysis demonstrated increased KLF2 expression (Fig. 4C) and
reduced pFOXO3 (Fig. 4D) expression on day 60 in mice vaccinated with SarAg + NLGP (n = 3 in each group). Moreover, western
blot analysis showed upregulated expression of FOXO3 and KLF2
in nucleus and reduced pFOXO3 levels in the cytoplasm in the
SarAg + NLGP vaccinated mice than the SarAg cohort in CD8+ T cells
(Fig. 4E) (n = 3 in each group). Moreover, the immunouorescence
studies show decreased expression of pFOXO3 in the cytoplasm of
CD8+ T cells from SarAg + NLGP vaccinated mice than SarAg cohort
(Fig. 4F). High nuclear expression of FOXO3 as well as KLF2 can
be corroborated with the increased CD62L and CCR7 expression in
central memory CD8+ T cells from the lymph nodes in SarAg + NLGP
vaccinated mice. Similar observation was not detected in spleen
(data not shown).
3.5. Vaccination with SarAg with NLGP adjuvant induces better
proliferation of central memory cells and operates effector
response on antigen re-encounter
The TCM cells are best characterized by their proliferative potential on antigen-reencounter (Klebanoff et al., 2005; Zaph et al.,
2004). Therefore, on post vaccination day 60 (which probably coincides with the beginning of the memory phase), the MACS puried
CD8+ CD44high CD62Lhigh TCM population from lymph node and
spleen cells was studied for proliferation in vitro. Accordingly, TCM
phenotype cells from vaccinated mice of both cohorts were cocultured with SarAg and MelAg (unrelated antigen) pulsed ex-vivo
generated mDCs. The MelAg was used as an unrelated, non-specic
control to see the antigen specicity of the generated TCM phenotype cells for SarAg. In both lymph nodes and spleens, TCM
cells from SarAg + NLGP cohort showed superior SarAg specic
proliferation than SarAg group. Such antigen specic prolifera-

48

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

Fig. 3. Enhanced generation of central memory phenotype of CD8+ T cells by NLGP. (AC) Bar diagrams and representative diagrams showing surface expression of CD44 and
CD62L, as studied by ow cytometry in lymph nodes and spleens of PBS, SarAg and SarAg + NLGP vaccinated mice. (DF) Bar diagrams and representative diagrams showing
surface expression of CCR7 as studied by ow cytometry in lymph nodes and spleens. Representative histogram represents TCM population on day 60. (G) Transcriptional
level analysis of eomesodermin and bcl-6, as performed by RTPCR on day 60 in CD8+ CD62L+ T cells from lymph nodes and spleens and mean relative expression. Bar diagram
represents mean SD of three individual observations from each group at each time point. ***p < 0.001, **p < 0.01, *p < 0.05.

tion was signicantly less when MelAg pulsed DCs were used.
Again, the frequencies of proliferating Ki67+ TCM cells are more
prominent in case of lymph nodes than spleen. This is further corroborated with the increased IL-2 secretion from lymph node T cells
of SarAg + NLGP vaccinated mice than SarAg group (n = 4 in each
group) (Fig. 5A).
Antigen primed memory T cells show a more pronounced and
heightened response on secondary challenge with the same antigen, thereby, providing protective immunity to the host (Roberts
et al., 2005; Bachman et al., 2005). Thus, two vaccinated mice were
inoculated with sarcoma cells (SarAg+ ) on day 60 post vaccination
period (Fig. 5B) and tumor growth was monitored in vaccinated and
non-vaccinated mice (Fig. 5B). No tumor was visible in both cohorts
of vaccinated mice (SarAg and SarAg + NLGP) till day 102 (all mice
of PBS group died at this time point so tumor growth was monitored till this day). Superior protection was noticed in SarAg + NLGP
cohort where none of the mice developed tumor (0/6) till the end of
the experiment i.e., day 120 (day 60 post tumor inoculation). On the
other hand, tumor appeared in 4/6 mice from SarAg cohort (n = 6 in
each group) (Fig. 5B).

The memory CD8+ T cells so generated by SarAg + NLGP vaccination impart protection to the host by means of effector functions,
as described (Lalvani et al., 1997). In order to identify the rationale
behind tumor growth restriction in vaccinated mice in our settings, the memoryeffector conversion (by downregulated CD62L
and increased Granzyme B expression) was next studied and
mice from SarAg and SarAg + NLGP cohorts were sacriced on day
67 post vaccination as outlined in Fig. 5B1 (to study immediate memory-to-effector conversion) to harvest lymph nodes and
spleens. Alterations of CD62L and GranzymeB were noted signicantly in SarAg + NLGP cohort than SarAg alone (n = 6 in each group)
(Fig. 5C). The CD62L downregulation was noted in both lymph
nodes and spleen, whereas, Granzyme B expressed more intensely
in spleen than lymph nodes, exhibiting more effector functions
in spleen. Next, the remaining mice were sacriced at the end of
tumor growth monitoring on day 120 post vaccination (to study late
memory-to-effector conversion, in relation to tumor free status). In
lymph nodes (now the tumor draining lymph node) of SarAg + NLGP
vaccinated mice, the frequencies of CD8+ T cells with CD62L expression was higher than SarAg treated mice, whereas, the Granzyme

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

49

Fig. 4. Enhanced TCM generation in lymph node depends on upregulated nuclear KLF2 expression and reduced cytosolic FOXO3 phosphorylation. (AD) Intracellular
expression of pmTOR, pAKT ser, pAKT thr, KLF2 and pFOXO3 in CD8+ T cells on day 60, as determined by ow cytometry in lymph nodes of PBS, SarAg and SarAg + NLGP
vaccinated mice. Bar diagram represents mean SD of three individual observations on day 60. *p < 0.05, **p < 0.01. Representative histogram in each case is presented. (E)
Protein level expression of KLF2, FOXO3 and pFOXO3, as determined by western blot analysis in cytosolic and nuclear cell fractions. Representative blot and mean relative
expression are presented from three groups of mice as described in A. GAPDH and HISTONE H1 were used as controls for cytosolic and nuclear fractions respectively. (F)
Immunouorescence study of CD8+ T cells showing expression of pFOXO3 in the cytoplasm in the lymph node of SarAg and SarAg + NLGP vaccinated mice.

B expression was prominent in spleen of the same cohort (n = 6 in

each group) (Fig. 5D). This coincides with the fact that lymph nodes
are primarily the niche for TCM cells (Klebanoff et al., 2006; Sallusto
et al., 2004; Sallusto et al., 1999). Therefore, at this point it can be
concluded that on post vaccination tumor inoculation the TCM phenotype cells are proliferating thereby increasing their number in
lymph nodes, whereas, the immediate effector functions are more
prominent in spleens compared to lymph nodes (due to more TEM
populations).

4. Discussion
We have reported earlier that NLGP restricts the growth of
murine sarcoma and melanoma signicantly in CD8+ T cell dependent manner (Mallick et al., 2013b; Barik et al., 2013a,b; Banerjee
et al., 2014). In that case, NLGP may help to present antigen (SarAg
or MelAg) to CD8+ T cells by inuencing APCs (Goswami et al., 2010;
Sarkar et al., 2008) to induce effector functions. In an effort to examine the adjuvanicity of NLGP further to generate central and/or
effector memory T cell functions that may participate for maintenance of disease free survival and to protect the host from further
tumor occurence, Swiss mice were vaccinated with SarAg with or
without NLGP weekly for four weeks in total. NLGP or its precursor
NLP was proved to be effective as adjuvant to enhance the antibody response against different tumor antigens and its adjuvant

efcacy is comparable to Freunds adjuvant or QS-21 (Baral et al.,

2005; Mandal-Ghosh et al., 2007; Sarkar et al., 2008). Additionally,
NLGP/NLP is non-toxic and inexpensive (Haque et al., 2006; Mallick
et al., 2013a). Here, the status of CD8+ T cells in context of memory
generation after completion of the SarAg /+ NLGP vaccination protocol was studied. We have found that following vaccination of mice
with SarAg, CD8+ T cell response was upregulated in presence of
NLGP adjuvant, which was maintained till day 30 post vaccination
period and declined subsequently as monitored on day 60. Robust
CD8+ T cell response following four NLGP vaccinations was reported
earlier (Mallick et al., 2013), however, present results suggest that
decline in CD8+ T cell pool after termination of vaccination might
have effector and/or memory functions. Antigen specic effector
functions after SarAg + NLGP vaccination were maintained till day
60 in lymph node and splenic cells, as denoted by greater cytotoxicity to SarAg+ sarcoma cells, rather than killing of the SarAg
carcinoma cells. NLGP helps in obtaining antigen experience of concerned T cells which was reected in CD8+ CD44high cells. In course
of this examination, interestingly, we have found greater frequency
of antigen specic CD8+ T cells in SarAg + NLGP cohort than SarAg
treated group on day 60 (Fig. 6A).
Based on this preliminary observation, we checked the activation status of involved CD8+ T cells. These cells possess high
activation initially on day 10, however, signicantly declined afterwards on day 60. Activation in terms of CD69 expression was

50

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

Fig. 5. Superior tumor protection and proliferation of TCM cells on SarAg re-encounter in presence of NLGP. (A) Proliferation of Ki67 expressing CD8+ CD62Lhigh TCM cells
and IL-2 secretion from lymph nodes and spleens (n = 4 in each group) after their co-culture with SarAg/MelAg pulsed DCs in vitro for 72 h. **p < 0.01, *p < 0.05. (B) On day
60, following 4 weeks of vaccination schedule, mice of three groups (n = 6 in each case) were inoculated with sarcoma and tumor growth was monitored till the end of the
experiment (day 120). Diagrammatic representation of the experimental design and tumor growth restriction curve are presented. Table in B represents tumor free and
tumor relapsed mice within day 102120. (C, D) Surface expression of CD62L and intracellular expression of Granzyme B on CD8+ T cells from lymph nodes and spleens from
three groups of mice (n = 6 in each case) on days 67 and 120 respectively, as determined by ow cytometry. **p < 0.01, *p < 0.05.

reciprocally correlated with Ly6C expression, denoting the generation of memory phenotypes. Maintenance of these memory cells
requires cytokines, like, IL-7, as conrmed by high expression of
concerned receptors (IL-7R) in the memory precursor cells. As we
obtained CD69low Ly6Chigh CD127high CD8+ T cells specically after
SarAg + NLGP vaccination, the question was next addressed to know
the nature of these antigen experienced CD44+ memory cells. In
comparison between SarAg and SarAg + NLGP cohort, it was distinctly observed that greater number of CD62L and CCR7 expressing
CD8+ T cells was detected in the latter group indicating crucial
role of NLGP in generation of central memory cell pool. Further
conrmation was obtained by observing the greater expression of
transcription factor eomesodermin and bcl-6, markers of central
memory cells.
Experimental
evidences
suggest
the
generation
of
CD62Lhigh CCR7high CD127high CD8+ T cells, those are also
CD44+ CD69low , thus indicating the maintenance of sustained
central memory pool following SarAg + NLGP vaccination. These
TCM phenotypes were maintained by FOXO dependent KLF2
nuclear expression, as we obtained greater nuclear expression
of KLF2 and reduced cytosolic phosphorylation of FOXO3a in
SarAg + NLGP vaccinated cohort. This quiescent situation is maintained by NLGP adjuvant assisted vaccination that suppresses the
AKT/mTOR-induced phosphorylation of FOXO and its subsequent
cytoplasmic translocation. It is important to mention here that
SarAg + NLGP vaccination resulted in less phosphorylation of AKT

and mTOR on day 60 post vaccination period than SarAg vaccination only. A major role for AKT in the context of TCR signalling
is to control the phosphorylation and localization of the Foxo
transcription factors, including FOXO1, FOXO3a and FOXO4 (Finlay
and Cantrell, 2011). The Foxo transcription factors are nuclear and
active in quiescent T cells, but when phosphorylated by AKT they
exit the nucleus and form a complex with 14-3-3 proteins in the
cytosol, thereby, terminating their transcriptional activity (Navarro
and Cantrell, 2014; Michelini et al., 2013). Accordingly, quiescent
state is maintained better by KLF2/FOXOs after SarAg + NLGP
vaccination (Fig. 6B).
Above discussion establishes the fact that SarAg + NLGP vaccine
generates superior central memory response than SarAg vaccine
only. To ascertain the functional utility of such memory response,
related (SarAg) and unrelated (MelAg) antigens were presented to
CD8+ CD44high CD62Lhigh TCM phenotype cells via DCs to observe
their proliferation status. NLGP assisted SarAg vaccine showed
greater proliferation, as indicated by more number of proliferative
Ki67+ cells, after in vitro exposure of TCM cells to related antigen
only. This in vitro observation provides clue that SarAg + NLGP vaccine generated memory response might be effective at the time
of tumor initiation for tumor eradication. Further conrmation of
this speculation appeared in in vivo study after inoculation of sarcoma cells in both groups of vaccinated mice on day 60 (when
mice possessing good number of TCM phenotypes) and maintained till day 120. Although, initially both groups of vaccinated

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

51

Fig. 6. Schematic representation of generation of memory CD8+ T cell. (A) Generation of effector cells, memory precursors and two subsets of memory T cells (central
memory, TCM; effector memory, TEM) in lymph nodes and spleen from SarAg + NLGP and SarAg immunized group on day 60. (B) In case of TCR triggering, FOXOs migrate to
cytosol, undergo phosphorylation by 14-3-3. This inhibits expression of KLF2 and transcription of its downstream genes CD62L, CCR7 and IL7R. But in the absence of TCR
triggering (as in memory T cells), FOXOs are retained in the nucleus thereby leading to expression of KLF2 and transcription of its target genes required for cell trafcking.
NLGP mediated increased expression of cell trafcking molecules is by the inhibited phosphorylation of FOXO in the cytoplasm and increased FOXO and KLF2 expression in
the nucleus.

mice showed tumor restriction in comparison to control mice, in

later phase tumor appears in 4 mice among 6 in SarAg vaccine
group, whereas, no tumor was detected in SarAg + NLGP vaccinated mice. This is in concert to the observations that antigen
specic memory CD8+ T cells can rapidly acquire cytotoxic function upon re-exposure to antigen (Klebanoff et al., 2005; Barber
et al., 2003). The experiment was terminated on day 120 to full the ethical requirement as tumor of mice from untreated group
was greater than 250 mm2 in either direction. Tumor restriction
was well correlated with the effector prole of CD8+ T cells as
evaluated by upregulation of Granzyme B and downregulation of
CD62L. As studies were undertaken in lymph nodes and spleens,
substantial difference in the number of proliferating effector cells
was noted that can be concluded as on tumor inoculation the TCM
phenotype cells are proliferating, thereby, increasing their number
in lymph nodes, the primary niche of TCM cells. However, the CD62L

downregulation and Granzyme B expression is more prominent

in spleen than lymph node. The fact should be mentioned here
that our immunization schedule with adjuvant help from NLGP
generates both TCM and TEM populations in lymph nodes and
spleens. However, the TCM population was predominant in lymph
nodes than spleen and the reverse is true for TEM. This observation can be corroborated with high effector GranzymeB expression
in spleen and upregulated CD62L expression in lymph nodes on
day 120 in SarAg + NLGP vaccinated mice at the termination of
experiment. This is probably responsible for the tumor free state
of SarAg + NLGP cohort in post vaccination, post tumor inoculation phase. This observation is supported by the fact that TEM cells
present an immediate defence, while TCM cells proliferate in the
secondary lymphoid organs thereby producing a supply of new
effectors (Roberts et al., 2005; Harris et al., 2002).

52

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

In conclusion, it can be stated that adjuvant help from nontoxic NLGP (Mallick et al., 2013a) may generate robust effector
functions of CD8+ T cells during SarAg vaccination that can be maintained as antigen specic memory in quiescent state after end of
the immunization period. Most effectively, such memory response
can be converted to effector response on further sarcoma antigenic
exposure. Thus, NLGP may be considered as an ideal vaccine adjuvant with SarAg vaccine and, hopefully, such adjuvanicity would be
applicable for other vaccines too.
Conict of interest
None.
Acknowledgements
We acknowledge Dr. Jaydip Biswas, Director, CNCI, Kolkata,
India, for providing necessary facilities. Thanks to Dr. Subrata
Laskar, Burdwan University, India, for his help in characterization of
NLGP. The work was partially supported by Department of Science
and Technology, New Delhi (DST/INSPIRE FELLOWSHIP/2011/188
to SG and DST Young Scientist Scheme SB/YS/LS-289/2013 to AB)
and Indian Council of Medical Research, New Delhi (grant no.
59/6/2011/BMS/TRM). The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the
manuscript.
References
Alp, O.S., Durlanik, S., Schulz, D., McGrath, M., Grun, J.R., Bardua, M., Ikuta, K.,
Sgouroudis, E., Riedel, R., Zehentmeier, S., Hauser, A.E., Tsuneto, M., Melchers,
F., Tokoyoda, K., Chang, H.D., Thiel, A., Radbruch, A., 2015. Memory CD8+ T cells
colocalize with IL-7+ stromal cells in bone marrow and rest in terms of
proliferation and transcription. Eur. J. Immunol. 45, 975987.
Bachmann, M.F., Wolint, P., Schwarz, K., Oxenius, A., 2005. Recall proliferation
potential of memory CD8+ T cells and antiviral protection. J. Immunol. 175,
46774685.
Banerjee, A., Gordon, S.M., Intlekofer, A.M., Paley, M.A., Mooney, E.C., Lindsten, T.,
Wherry, E.J., Reiner, S.L., 2010. Cutting edge: the transcription factor
eomesodermin enables CD8+ T cells to compete for the memory cell niche. J.
Immunol. 185, 49884992.
Banerjee, S., Ghosh, T., Barik, S., Das, A., Ghosh, S., Bhuniya, A., Bose, A., Baral, R.,
2014. Neem leaf glycoprotein prophylaxis transduces immune dependent stop
signal for tumor angiogenic switch within tumor microenvironment. PLoS One
9, e110040.
Baral, R., Mandal, I., Chattopadhyay, U., 2005. Immunostimulatory neem leaf
preparation acts as an adjuvant to enhance the efcacy of poorly immunogenic
B16 melanoma surface antigen vaccine. Int. Immunopharmacol. 5, 13431352.
Barber, D.L., Wherry, J.E., Ahmed, R., 2003. Cutting edge: rapid in vivo killing by
memory CD8 T cells. J. Immunol. 171, 2731.
Barik, S., Banerjee, S., Mallick, A., Goswami, K.K., Roy, S., Bose, A., Baral, R., 2013a.
Normalization of tumor microenvironment by neem leaf glycoprotein
potentiates effector T cell functions and therapeutically intervenes in the
growth of mouse sarcoma. PLoS One 8, e66501.
Barik, S., Banerjee, S., Sarkar, M., Bhuniya, A., Roy, S., Bose, A., Baral, R., 2013b.
Neem leaf glycoprotein optimizes effector and regulatory functions within
tumor microenvironment to intervene therapeutically the growth of B16
melanoma in C57BL/6 mice. Trials Vaccinol.
Bouneaud, C., Garcia, Z., Kourilsky, P., Pannitier, C., 2005. Lineage relationships,
homeostasis, and recall capacities of central and effector memory CD8 T cells
in vivo. J. Exp. Med. 201, 579590.
Bradley, L.M., Hanes, L., Swain, S.L., 2005. IL-7: maintaining T-cell memory and
achieving homeostasis. Trends Immunol. 26, 172176.
Buonaguro, L., Petrizzo, A., Tornesello, M.L., Buonaguro, F.M., 2011. Translating
tumor antigens into cancer vaccines. Clin. Vac. Immunol. 18, 2334.
Cao, Z., Sun, X., Icli, B., Wara, A.K., Feinberg, M.W., 2010. Role of Kruppel-like factors
in leukocyte development function, and disease. Blood 116, 44044414.
Chakraborty, K., Bose, A., Chakraborty, T., Sarkar, K., Goswami, S., Pal, S., Baral, R.,
2010. Restoration of dysregulated CC chemokine signaling for
monocyte/macrophagechemotaxis in head and neck squamous cell carcinoma
patients by neem leaf glycoprotein maximizes tumor cell cytotoxicity. Cell.
Mol. Immunol. 7, 396408.
Cunto-Amesty, G., Monzavi-Karbassi, B., Luo, P., Jousheghany, F., Kieber-Emmons,
T., 2003. Strategies in cancer vaccines development. Int. J. Parasitol. 33,
597613.

Dimauro, I., Pearson, T., Caporossi, D., Jackson, M.J., 2012. A simple protocol for the
subcellular fractionation of skeletal muscle cells and tissue. BMC Res. Notes 5,
513517.
Dong, H., Franklin, N.A., Roberts, D.J., Yagita, H., Glennie, M.J., Bullock, T.N.J., 2012.
CD27 stimulation promotes the frequency of IL-7 receptor-expressing memory
precursors and prevents IL-12-mediated loss of CD8 + T cell memory in the
absence of CD4 + T cell help. J. Immunol. 188, 38293838.
Dubensky Jr., T.W., Reed, S.G., 2010. Adjuvants for cancer vaccines. Semin.
Immunol. 22, 155161.
Finn, O.J., 2003. Cancer vaccines: between the idea and the reality. Nat. Rev.
Immunol. 3, 630641.
Finlay, D., Cantrell, D., 2011. Metabolism: migration and memory in cytotoxic T
cells. Nat. Rev. Immunol. 11, 109117.
Goswami, K.K., Barik, S., Sarkar, M., Bhowmick, A., Biswas, J., Bose, A., Baral, R.,
2014. Targeting STAT3 phosphorylation by neem leaf glycoprotein prevents
immune evasion exerted by supraglottic laryngeal tumor induced M2
macrophages. Mol. Immunol. 59, 119127.
Goswami, S., Bose, A., Sarkar, K., Roy, S., Chakraborty, T., Sanyal, U., Baral, R., 2010.
Neem leaf glycoprotein matures myeloid derived dendritic cells and optimizes
anti-tumor T cell functions. Vaccine 28, 12411252.
Hamilton, S.E., Harty, J.T., 2002. Quantitation of CD8+ T cell expansion, memory,
and protective immunity after immunization with peptide-coated dendritic
cells. J. Immunol. 169, 49364944.
Hanninen, A., Maksimow, M., Alam, C., Morgan, D.J., Jalkanen, S., 2011. Ly6C
supports preferential homing of central memory CD8+ T cells into lymph
nodes. Eur. J. Immunol. 41, 634644.
Hariharan, K., Braslawsky, J., Black, A., Raychaudhuri, S., Hanna, N., 1995. The
induction of cytotoxic T cells and tumor regression by soluble antigen
formulation. Cancer Res. 55, 34863489.
Harris, N.L., Watt, V., Ronchese, F., Le Gros, G., 2002. Differential T cell function and
fate in lymph node and nonlymphoid tissues. J. Exp. Med. 195, 317326.
Haque, E., Mandal, I., Pal, S., Baral, R., 2006. Prophylactic dose of neem (Azadirachta
indica) leaf preparation restricting murine tumor growth is nontoxic,
hematostimulatory and immunostimulatory. Immunopharmacol.
Immunotoxicol. 28, 3350.
Ichii, H., Sakamoto, A., Kuroda, Y., Tokuhisa, T., 2004. Bcl-6 acts as an amplier for
the generation and proliferative capacity of central memory CD8+ T cells. J.
Immunol. 173, 883891.
Kaech, S.M., Wherry, E.J., Ahmed, R., 2002. Effector and memory T-cell
differentiaion: implications for vaccine development. Nat. Rev. Immunol. 2,
251262.
Kalli, F., Machiorlatti, R., Battaglia, F., Parodi, A., Conteduga, G., Ferrara, F., Proietti,
M., Tardito, S., Sanguineti, M., Millo, E., Fenoglio, D., De Palma, R., Inghirami, G.,
Filaci, G., 2013. Comparative analysis of cancer vaccine settings for the
selection of an effective protocol in mice. J. Transl. Med. 1, 111.
Klebanoff, C.A., Gattinoni, L., Restifo, N.P., 2006. CD8+ T cell memory in tumor
immunology and immunotherapy. Immunol. Rev. 211, 214224.
Klebanoff, C.A., Gattinoni, L., Torabi-Parizi, P., Kerstann, K., Cardones, A.R.,
Finkelstein, S.E., Palmer, D.C., Antony, P.A., Hwang, S.T., Rosenberg, S.A.,
Waldmann, T.A., Restifo, N.P., 2005. Central memory self/tumor reactive CD8+
T cells confer superior anti-tumor immunity compared with effector memory
T cells. Proc. Natl. Acad. Sci. U. S. A. 102, 95719576.
Krutzik, P.O., Nolan, G.P., 2003. Intracellular phospho-protein staining techniques
for ow cytometry: monitoring single cell signaling events. Cytometry A 55,
6170.
Lalvani, A., Brookes, R., Hambleton, S., Britton, W.J., Hill, A.V., McMichael, A.J., 1997.
Rapid effector function in CD8+ memory T cells. J. Exp. Med. 186, 859865.
Lanzavechhia, A., Sallusto, F., 2005. Understanding the generation and function of
memory T cell subsets. Curr. Opin. Immunol. 17, 326332.
Lowry, O.H., Rosenbrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement
with the Folin phenol reagent. J. Biol. Chem. 193, 265275.
Mallick, A., Ghosh, S., Banerjee, S., Majumder, S., Das, A., Mondal, B., Barik, S.,
Goswami, K.K., Pal, S., Laskar, S., Sarkar, K., Bose, A., Baral, R., 2013a. Neem leaf
glycoprotein is nontoxic to physiological functions of swiss mice and sprague
dawley rats: histological, biochemical and immunological perspectives. Int.
Immunopharmacol. 15, 7383.
Mallick, A., Barik, S., Goswami, K.K., Banerjee, S., Ghosh, S., Sarkar, K., Bose, A.,
Baral, R., 2013. Neem Leaf glycoprotein activates CD8+ T cells to promote
therapeutic anti-tumor immunity inhibiting the growth of mouse sarcoma.
PLoS One 8, e47434.
Mallick, A., Barik, S., Ghosh, S., Roy, S., Sarkar, K., Bose, A., Baral, R., 2014.
Immunotherapeutic targeting of established sarcoma in Swiss mice by
tumor-derived antigen-pulsed NLGP matured dendritic cells is CD8+ T-cell
dependent. Immunotherapy 6, 821831.
Mandal-Ghosh, I., Chattopadhyay, U., Baral, R., 2007. Neem leaf preparation
enhances Th1 type immune response and anti-tumor immunity against breast
tumor associated antigen. Cancer Immun. 7, 817.
Masopust, D., Vezys, V., Marzo, A.L., Lefrancois, L., 2001. Preferential localization of
effector memory cells in nonlymphoid tissue. Science 291, 24132417.
Michelini, R.H., Deodens, A.L., Goldwrath, A.W., Hedrick, S.M., 2013. Differentiation
of CD8 memory T cells depends on Foxo1. J. Exp. Med. 210, 11891200.
Mohan, T., Verma, P., Rao, D.N., 2013. Novel adjuvants and delivery vehicles for
vaccine development: a road ahead. Indian J. Med. Res. 138, 779795.
Nanjappa, S.G., Wallent, J.H., Morre, M., Suresh, M., 2008. Effects of IL-7 on memory
CD8 T cell homeostasis are inuenced by the timing of therapy in mice. J. Clin.
Invest. 118, 10271039.

S. Ghosh et al. / Molecular Immunology 71 (2016) 4253

Navarro, M.N., Cantrell, D.A., 2014. Serine-threonine kinases in TCR signaling. Nat.
Immunol. 15, 808814.
Roberts, A.D., Ely, K.H., Woodland, D.L., 2005. Differential contributions of central
and effector memory T cells to recall responses. J. Exp. Med. 202, 123133.
Saha, A., Baral, R.N., Chatterjee, S.K., Mohanty, K., Pal, S., Foon, K.A., Primus, F.J.,
Krieg, A.M., Weiner, G.J., Bhattacharya-Chatterjee, M., 2006. CpG
oligonucleotides enhance the tumor antigen-specic immune response of an
anti-idiotype antibody-based vaccine strategy in CEA transgenic mice. Cancer
Immunol. Immunother. 55, 515527.
Sallusto, F., Lenig, D., Forster, R., 1999. Two subsets of memory T lymphocytes with
distinct homing potentials and effector functions. Nature 401, 708712.
Sallusto, F., Geginat, J., Lanzavecchia, A., 2004. Central memory and effector
memory T cell subsets: function: generation and maintenance. Annu. Rev.
Immunol. 22, 745763.

53

Sarkar, K., Bose, A., Chakraborty, K., Haque, E., Ghosh, D., Goswami, S., Chakraborty,
T., Laskar, S., Baral, R., 2008. Neem leaf glycoprotein helps to generate
carcinoembryonic antigen specic antitumor immune responses utilizing
macrophage mediated antigen presentation. Vaccine 26, 43524362.
Scluns, K.S., Kieper, W.C., Jameson, S.C., Lefrancois, L., 2000. Interleukin-7 mediates
the homeostasis of nave and memory CD8 T cells in vivo. Nat. Immunol. 1,
426432.
Walunas, T.L., Bruce, D.S., Dustin, L., Loh, D.Y., Bluestone, J.A., 1995. Ly6C is a
marker of memory CD8+ T cells. J. Immunol. 155, 18731883.
Zaph, C., Uzonna, J., Beverly, S.M., Scott, P., 2004. Central memory T cells mediate
long-term immunity to Leishmania major in the absence of persistent
parasites. Nat. Med. 10, 11041110.