Solution key- 7.

013 Problem Set 4- 2015

Question 1
The biosynthesis of the amino acid Phenylalanine is an example of multi-step biochemical pathway
where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. Phenylalanine
(Phe) is further converted to amino acid Tyrosine (Tyr) by the enzyme phenylalanine hydroxylase
(PAH).

E1 E2 E3 PAH
A B C Phe Tyr

Prof. Sive gives you three haploid (ploidy = n) strains of yeast (Strain 1, Strain 2 and Strain 3) each
of which fails to grow in the absence of Phe. She further explains that Strain 1 has a mutation in Gene 1
that encodes E1, Strain 2 has a mutation in Gene 2 that encodes E2 and Strain 3 has a mutation in
Gene 3 that encodes E3. She asks you to clone the allele of Gene 1 that can restore the ability of Strain
1 to synthesize Phe. She also suggests that you should proceed with the assumption that the
mutations outlined above are the only mutations in strains 1, 2 and 3.

a) You begin by constructing a yeast genomic library in E. coli bacterial cells. From the choices below,
circle all the yeast strain(s) from which you could potentially isolate the genomic DNA to achieve your
objective. Explain why you circled this option(s).

Wild- type Strain 1 Strain 2 Strain 3

You can isolate the genomic DNA from any strain that has a wild- type copy of Gene 1. Thus you can use the
genomic DNA from the wild- type yeast cells. Based on the information provided you can also use the genomic
DNA isolated from Strain 2 (that only has mutation in Gene 2 ) and strain 3 (that only has mutation in Gene 3)
since both these strains have alleles of Gene 1 that encode the wild-type copy of E1 and should therefore be able
to restore its ability to produce phenylalanine i.e. convert Strain 1 from Phe- ( ie. cannot synthesize Phe) to Phe+
(ie. can synthesize Phe).

b) You successfully isolate yeast genomic DNA from the strain(s) that you chose in part (a). You need
to choose a plasmid vector that you could use as a cloning vector to create the yeast genomic library in
E. coli . You want to transform Strain 1 so that the plasmid can self-replicate and express Gene 1 in
strain 1. From the choices below, circle the minimum feature(s) that your plasmid vector should have
to execute this plan.

i. Bacterial ori site v. Yeast promoter

ii. Yeast ori site vi. Selection marker gene for bacterial cells

iii. Bacterial promoter vii. Selection marker gene for yeast cells

iv. Recognition site(s) for restriction enzyme(s) / Multiple cloning site (MCS)

Note: You need the plasmid vector that has a restriction enzyme site(s) (MCS site) that will allow you to clone the
genomic DNA insert. You want the recombinant plasmid to replicate both in yeast and bacterial cells, so you need
the plasmid to have both the yeast and bacterial origins (ori) of replication. You need a selection marker to select
the bacterial cells that have been transformed with recombinant plasmid from those that remain untransformed.
Since you are ONLY amplifying the recombinant plasmid in E.coli you will NOT need a bacterial promoter. Since
the yeast genomic DNA will have its own inherent yeast promoter, you do not need to have an additional yeast
promoter as a part of the plasmid vector. You can select the transformed yeast cells from the untransformed by
growing them in a medium that lacks phenylalanine , so you do not need a yeast selection marker.

1
Question 1 continued
c) You generate a restriction map of the plasmid that you want to use as a cloning vector. You cut the
plasmid with the following combination of the restriction enzymes and determine the size of the
resulting DNA fragments by DNA gel electrophoresis. The size of the DNA fragments after digestion by
restriction enzymes is tabulated below.

Complete the schematic of the cloning vector by showing all the restriction enzyme sites and include
the distance (in kb) between them. Note: The AmpR and KanR represent the ampicillin and kanamycin
resistant genes that are a part of the plasmid vector. Please note that 1kb or 1 kilo base pairs is equal to 1000bp.

1kb Y
0.5kb
Enzyme(s) X Y Z X+Y X+Z Y+ Z
Z
R
Fragment 1 4kb 2kb 4kb 2kb 2.5kb 2 kb X Kan

Fragment 2 2kb 1kb 1.5kb 1.5kb 4kb

R
Amp
Fragment 3 1kb 0.5kb
1.5kb
1kb
Y
Cloning vector

d) You then isolate the yeast genomic DNA and digest it with Bgl-II restriction enzyme. You want to
clone the Bgl-II digested genomic DNA fragments into the plasmid vector that has the following
recognition sites for restriction enzyme Z, Y and X. Please note: A slash (/) represents the cutting site for
each restriction enzyme.
Bgl-II X Y Z
5A/GATCT3 5G/GATCC3 5A/AGCTT3 5G/GATAC3
3TCTAG/A5 3CCTAG/G5 3TTCGA/A5 3CCTAT/G5

i. Which enzyme (Choose from X, Y and Z) would you use to cut the plasmid so that it has ends
that are compatible to the ends of the Bgl-II digested yeast genomic DNA fragments?

ii. On the schematic below, write the resulting 6- base pair sequences at the two points of
ligation of plasmid and the yeast genomic DNA fragments.
5GGATCT3 Yeast genomic DNA 5AGATCC3
3CCTAGA5 fragment 3TCTAGG5

e) You mix the genomic fragments with the cut vectors and add DNA ligase to generate a ligation mix.
You transform E. coli cells with the ligation mix and select the transformed clones by plating the
bacterial cells on specific growth media. What growth medium(s) would you use to select the
recombinant bacterial clones? Explain your choice.
R S
The E.coli cells transformed with the recombinant plasmid will be amp and Kan . You will first plate /
s S
grow the bacterial cells (Kan & amp ) in minimal media that contains neither ampicillin nor kanamycin
and let them form colonies (Plate 1, master plate). You will then replica plate the colonies from Plate 1
on plate 2 that contains minimal media with ampicillin. Only those bacterial cells that have been
transformed either with the recombinant plasmid (that has the yeast genomic insert) or the self-ligated
plasmid will grow and form colonies on Plate 2. You will then replica plate the colonies from Plate 2 on
Plate 3 that contains minimal media with ampicillin and kanamycin. Only those bacterial cells that have
been transformed with the self-ligated plasmid will grow and form colonies on Plate 3. Thus the
colonies that grew on plate 2 but not on plate 3 will be the colonies containing recombinant plasmid.
2
 Question 1 continued
f) You successfully identify a recombinant vector in bacterial cells that can restore the ability of yeast
Strain 1 to produce Phe. What growth medium(s) would you use to select the transformed yeast Strain
1? Explain your choice.
You will plate the transformed yeast strain 1 in growth medium that lacks phenylalanine. The
recombinant plasmid that has a wild- type copy of Gene 1 can now synthesize Phe and therefore will
grow and form colonies on the medium that lacks Phe.

g) You also have another strain of yeast (Strain 4) that cannot produce phenylalanine (phe-). You use
the yeast genomic library that you prepared to restore the phenylalanine productivity of Strain 4. Your
friend also tries to do the same using the yeast genomic library that she prepared. You find that you can
successfully restore the phenylalanine productivity of Strain 4, unlike your friend. Based on the above
information, explain how your yeast genomic library may differ from the one that your friend used.
Note: Give only one possible explanation.
You must have used the wild- type yeast strain( or a strain) that has the wild- type copy of the gene that
can restore the phenylalanine productivity of strain 4. In contrast, your friend may have prepared a
yeast genomic library using a yeast strain that lacks this gene and can therefore not complement the
mutation that Strain 4 has.

h) You also have a strain of E. coli bacterial cells that cannot produce phenylalanine (phe-). Can you
use the yeast genomic library that you prepared to restore a phe bacterial cell to a phe+ cell? Why or
why not? Note: Give only one explanation that supports your answer.
Most likely, you wont be able to do so. There are multiple correct answers some of which are below.
Bacterial cells may have different sets of phe synthesizing enzymes compared to the eukaryotic yeasts.
The bacterial cells cannot splice out the introns. The bacterial and yeast promoters are different. The
post- translational modifications that are critical for enzyme activity may be different in prokaryotes and
eukaryotes. Any reasonable explanation will be accepted.

i) In humans, the PAH enzyme that converts phenylalanine to tyrosine is located on chromosome 12.
Absence of functional PAH results in phenylketonuria (PKU), an inborn error of metabolism. Based
on this information, what would be the most likely mode of inheritance of PKU? Choose from
autosomal recessive, autosomal dominant, X linked recessive, X- linked dominant, Y linked and
mitochondrial mode of inheritance and explain why you selected this option(s).
The gene encoding PAH is located on chromosome 12. The PKU patients LACK the functional copy of
PAH. Taken together, these two points show that the disease has an autosomal recessive mode of
inheritance.

j) A point mutation in the splice donor site of Intron 12 of the PAH gene is one of the most common
mutations observed in the PKU patients. Complete the following by selecting from longer, shorter, or
the same size.

i. The nascent mRNA corresponding to the PAH protein is __ of the same size as _than that in the
normal healthy individuals.

ii. The mature mRNA corresponding to the PAH protein is __ longer _ than that in the normal healthy
individuals.

iii. The PAH protein produced in the PKU patients is ___ longer/ shorter (both possible)___ than (in
the terms of the number of amino acids) that in normal healthy individuals. Explain why you
selected this option(s). You can select longer than and in the explanation write intron sequence is
now being read as a part of the reading frame. In contrast, you can also select shorter than and
explain that the intron sequence is being read as a part of the reading frame and within this intron
sequence is a premature stop codon that results in a truncated protein.
3
Question 2
The amino acid tyrosine gets converted to adrenaline hormone through the following multi-step
reaction pathway wherein each step is catalyzed by a unique enzyme (E4 E7).

E4 E5 E6 E7
Tyrosine DOPA Dopamine noradrenaline Adrenaline

Following a sudden stress, we all experience an instant rush of adrenaline, which results in fight- or-
flight response. This response is triggered through a G protein-coupled receptor as shown in the
schematic below.

(adrenaline)

Cell
membrane

Glycogen
Glycogen
Protein Kinase A
phosphorylase
Glucose

Used to produce energy for Fight- or flight response.

The major steps of the above signaling pathway are outlined below.

Step 1: Adrenaline hormone circulating in the blood, binds to adrenaline receptor on the surface of target
cells. This binding activates the adrenaline receptor.
Step 2: The activated receptor activates G protein by converting it from its - GDP bound inactive form
to the - GTP bound active form. The - GTP protein has an inherent GTPase activity and hence can
hydrolyze its GTP to get converted to the GDP bound inactive form.
Step 3: The - GTP binds to and activates the membrane bound adenylate cyclase enzyme.
Step 4: Activated adenylate cyclase catalyzes the conversion of ATP to cyclic AMP (cAMP).
Step 5: cAMP activates protein kinase A, which activates the glycogen phosphorylase enzyme.
Step 6: The activated Glycogen phosphorylase catalyzes the conversion of glycogen to glucose that is
used to make the ATP needed for the fight- or flight response.
a) Circle the correct option and explain why you circled this option. The above pathway is an example
of an endocrine/ paracrine/ autocrine pathway.
This is an example of endocrine signaling since adrenaline hormone travels through the blood
stream to reach the target cells that are expressing the - adrenergic receptors thus triggering this
signaling pathway.
4
Question 2 continued
b) Considering only the information provided in Questions 1 & 2 of this problem set, would you expect
to see a normal fight or flight response in a PKU patient? Why or why not?
You wont expect to see this response in PKU patients since they do not convert phenylalanine to
tyrosine, which is a component of the multi- step pathway that results in adrenaline synthesis. In the
absence of adrenaline ligand there wont be any fight or flight response.

In order to further understand the above signaling pathway, you examine it in the following three
individuals.
#1 is given pertussis toxin that prevents G proteins from exchanging GDP for GTP.
#2 is given cholera toxin that prevents G proteins from hydrolyzing GTP to GDP.
#3 has a receptor that activates the G proteins independent of a ligand.
c) In which of the three individual(s) will the released adrenaline cause a constitutive activation
of adenylate cyclase? Explain why you selected this individual(s).
Adrenaline, once bound to its receptor, will cause a constitutive activation of adenylate cyclase enzyme
in Individual 2. This is because the binding of adrenaline to its receptor will activate the receptor, which
in turn will activate G-protein by converting it from its GDP bound form to its GTP bound form. Once G-
protein is activated it will not be able to hydrolyze GTP to GDP in the presence of cholera toxin. Hence,
the G- protein will continue to stay in its GTP bound active form and will therefore constitutively activate
adenylate cyclase. (Individual #3 also accepted if there was a proper explanation).

d) In which of the three individual(s) will you see a constitutive activation of adenylate cyclase
independent of adrenaline? Explain why you selected this individual(s).
You will see this in Individual #3 since this individual has an adrenaline receptor that activates the G-
protein irrespective of the presence or absence of adrenaline. The activated G- protein then activates
the downstream signaling components.

e) Of the components shown in the pathway, identify the one that acts as a second messenger and
explain why you selected this component.
Second messengers are the molecules that relay signals from receptors on the cell surface to target
molecules inside the cell, in the cytoplasm or nucleus. They greatly amplify the strength of the signal. In
this signaling pathway this is being done by cAMP, which makes it a 2nd messenger.

f) The effect of adrenaline is limited to specific cell type and NOT ALL cell types in an individual. Why is
this so?
This is because although ALL the cell types in a person will have the same set of genes, different cell
types will express different sets of genes. So the gene that encodes adrenaline receptor will NOT be
expressed in all cell type but just in specific cell type(s).

g) The signaling pathway shown in this question is an example of rapid signaling unlike the pathways
that involve the activation of transcription factors and may take hours or days to elicit the final response.
Why are the signaling pathways that involve transcription factors mechanistically slower compared to
the pathways presented in this question?
Signaling pathways involving transcription factors include additional steps and also involve the change
in gene expression that which needs more time compared to the signaling such as the one described in
this question. Transcription and translation usually take longer than protein modification.
h) Many enzymes get activated once specific amino acid residues are phosphorylated. Of the choices
below, circle the amino acid(s) that can be potentially phosphorylated and explain why you selected
these amino acid(s). Note: Please take a look at the amino acid chart that is provided on the last page
of Problem set 1.
Methionine Serine Tyrosine Tryptophan Threonine
These three amino acids have hydroxyl group as part of their side chains that can be phosphorylated.
5
Question 2 continued
i) Adrenaline binds to the - adrenergic receptor. This receptor is a plasma membrane protein and is
comprised of 7- transmembrane/ membrane spanning domains.

i. On the schematic, label the N and C ends of the - adrenergic receptor as it is translated in the
endoplasmic reticulum and localized in the cell membrane by filling in the boxes.

C Cytoplasm N Outside
ER membrane Cell membrane
ER Lumen Cytoplasm
N C
ii. If the gene encoding the - adrenergic receptor (AR gene) shows a deletion of the bases
corresponding to signal sequence of - adrenergic receptor, in which region of the cell
(choose from cytoplasm, RER, golgi, plasma membrane) would you expect to see the
protein if it is translated?
It will be made as a cytosolic protein and will eventually degraded since it is at wrong location.

Question 3
You friend plans to clone and express the cDNA copy of the human PAH gene that catalyzes the
conversion of Phe -> Tyr in bacterial cells.

The following is the schematic of PAH cDNA. Please note: The recognition sites of different restriction
enzymes (EcoR1, BamH1, Kpn1, and Sal1) flanking the PAH cDNA are shown. Your friend wants to
use the following plasmid (5kb) as the vector to clone PAH cDNA. Please note: This plasmid contains
R
ampicillin- resistance gene (Amp ). It has the recognition sequence for restriction enzymes Nde1, EcoR1, Kpn1,
Xho1 and BamH1. The recognition sequence for each restriction enzyme is given below. A slash (/) represents
the site at which the restriction enzyme cuts.
Kpn1 EcoR1

EcoR1 BamH1 Sal1 Kpn1

(2Kb)
PAH cDNA
Bacterial Promoter
Direction of Transcription
BamH1 Nde1
Nde1 5G/GATCC3 5CA/TATG3
EcoR1
Kpn1 3CCTAG/G5 3GTAT/AC5
Xho1
EcoR1 Kpn1
BamH1 5G/AATTC3 5GGTAC/C3
Ori 5kb 3CTTAA/G5 3C/CATGG5
Sal1 Xho1
5G/TCGAC3 5C/TCGAG3
3CAGCT/G5 3GAGCT/C5

R
Amp

Kpn1

6
Question 3 continued
a) Circle true or false for each of the statements below.
The cDNA copy of a gene has its own inherent promoter (True/ False)
The cDNA copy of a gene corresponds to the mature mRNA (True/ False).
The cDNA libraries prepared from different cell types of a person are identical (True/ False).
The cDNA library in general lacks information about the enhancers (True/ False).

b) Your friend wants to design a cloning strategy that would ensure the expression of PAH protein.
To achieve this

i. Which restriction enzyme(s) would your friend use to cut the PAH cDNA? EcoR1 and Sal1
ii. Which restriction enzyme(s) would your friend use to cut the plasmid vector? EcoR1 and Xho1

Note: Only this strategy will allow cloning of the cDNA insert in the right orientation with respect to the
promoter.

c) Your friend next transforms the E. coli bacterial cells with a mixture of plasmid and the PAH cDNA
that were digested with the restriction enzyme(s) that you selected in part (b).

i. What growth medium would your friend use to select the transformed bacterial cells?
Medium that contains ampicillin that will allow only the transformed cells to grow and form colonies

ii. Unfortunately after all the hard work, your friend observes that the transformed bacterial cells do
not express PAH enzyme. Provide one possible explanation.
There are many possible explanations some of which are: the bacterial cells lack the appropriate
translation factors, protein processing in eukaryotes differ from prokaryotes, protein modifications (ie.
glycosylation, myristylation) crucial for the synthesis of functional protein are different in eukaryotes
than prokaryotes. Any reasonable explanation will be accepted.

Question 4
In contrast to the strategy that your friend adopted in Question 3, you decide to make a DNA construct
that will encode an in-frame fusion protein between the C- terminus of the PAH gene and the N-
terminus of red fluorescence protein (RFP) gene as shown in the schematic below. Note: The arrow
represents the direction of transcription.

5 3
cDNA for PAH gene cDNA for RFP gene
3 5

The following is the partial cDNA sequence encoding the C- terminus of PAH gene. Please note: The
DNA corresponding to the stop codon is underlined. The gray boxes and bars above the sequence
show the recognition sites for specific restriction enzymes. Each codon is separated from the next by a
vertical line. Xho1 Mfe1
5TCAAGAAAATTGCCGCCTCGAGCCCCAATTGCATGTAGCAA3
3AGTTCTTTTAACGGCGGAGCTCGGGGTTAACGTACATCGTT5

The following is the partial cDNA sequence encoding the N- terminus of the RFP gene. Please note:
The DNA corresponding to the start codon is bold and underlined. The gray boxes and bars above the
sequence show the restriction enzyme recognition sites.
Sal1 Mfe1 EcoR1
5ATGGTCGACGCAATTGGAGGGAATTCCATGCCA3
3TACCAGCTGCGTTAACCTCCCTTAAGGTACGGT5
7
Question 4 continued
The recognition sequences and the cleavage sites (indicated by /) for each enzyme are given below.

Mfe1 EcoR1 Xho1 Sal1

5C/AATTG3 5G/AATTC3 5C/TCGAG3 5G/TCGAC3
3GTTAA/C5 3CTTAA/G5 3GAGCT/C5 3CAGCT/G5

You use the following pairs of restriction enzymes to digest the C- terminus of PAH gene and the N-
terminus of RFP.

Options Restriction enzyme cutting the sequence encoding the.

C-terminus of PAH gene N- terminus of RFP gene

1 Mfe1 Mfe1

2 Mfe1 EcoR1

3 Xho1 Sal1

a) Circle the option for the restriction enzymes pair (choose from option 1, 2, 3) that will give you an in-
frame PAH - RFP fusion gene following their ligation.

b) Give the resulting 6- base pair sequence at the point of ligation of the C- terminus of PAH gene with
the N- terminus of RFP gene. Shade or box the sequence corresponding to the N terminus of the RFP
gene.
5CAATTC3
3GTTAAG5

You successfully create a DNA fragment that encodes the PAH-RFP fusion gene product as shown
below. You plan to clone the fusion gene as a restriction enzyme Y cut fragment into the following
vector that will allow you to amplify and express it in the liver cells isolated from a mouse model of PKU.
Ubiquitous
Mammalian
promoter
Y 2kb 1kb Y
Mammalian

PAH gene RFP ORI 4kb

Y

Fusion Gene

Plasmid vector
c) What modification should you make in the plasmid vector to ensure that the fusion gene is expressed
only in the liver cell of the PKU mouse?
It should have a cell type specific mammalian promoter instead of a ubiquitous mammalian promoter.

d) Following transfection (meaning introduction of DNA into a eukaryotic cell, similar to transformation
for prokaryotes), how would you screen the liver cells to identify the ones who have been successfully
transfected with the recombinant plasmid and are expressing PAH? Give only one screening method.
The cells that have been successfully transfected with the recombinant plasmid carrying the fusion
gene insert will fluoresce red unlike the remaining cells. These cells can be further screened for their
ability to produce phenylalanine.

8
Question 4 continued
e) You reintroduce the stably transfected liver cells back into the adult PKU female mouse to alleviate
the symptoms of the disease. The PKU female mouse, mates with a male mouse whose genotype is
+ +
PAH /PAH . What is the possible genotype(s) of their offspring?
Although the somatic cell gene therapy in this case has successfully alleviated the symptoms of PKU
-
mouse, the gametes produced by the mouse will still have the genotype PAH . So the offspring mice
+ -
will have the genotype. PAH /PAH .

f) What modification would you make to your experiment in part (e) that would allow you to produce a
+ +
PAH / PAH offspring?
You should reproductive cell gene therapy wherein you introduce the PAH-RFP fusion gene into a
+
zygote so that genotype of the zygote is either PAH /PAH- if one copy of the fusion gene is introduced)
+
or PAH /PAH+ ( if two copies of the fusion gene introduced). All cells of a mouse including the
+
gametes originate from the zygote. So a zygote with genotype PAH /PAH- will produce gametes of
+ +
genotype PAH or PAH- at equal frequency. In contrast, if the zygote had the genotype PAH /PAH+,
+
the gametes will only have the genotype PAH . If a PAH+ or PAH- ovum fuses with a PAH+ sperm the
resulting mouse would have a normal phenotype (PAH+/PAH+ or PAH+/PAH-)

Question 5
You are studying another disease that shows an autosomal recessive mode of inheritance and is
associated with the mutation in Gene X. You clone a 2.5kb linear double stranded DNA fragment
that includes the allele of Gene X that is associated with the wild- type phenotype (Fragment A). You
also clone the 2.5kb linear double stranded DNA fragment that includes the allele of Gene X that is
associated with disease phenotype (Fragment B). You know that Fragment B differs from Fragment A
by a point (single base pair) mutation. Note: A point mutation can be a basepair substitution (a
missense, nonsense or silent mutation), an insertion or a deletion (that mostly results in a frameshift).

The DNA sequence that flanks (at the two ends) Fragment A and Fragment B is given below.

5- GGGAAGGCACGTACC------TTACGGACTATCCCC-3
2.5kb
3- CCCTTCCGTGCATGG----AATGCCTGATAGGGG-5

a) You use the polymerase chain reaction (PCR) to amplify Fragments A and B. Design the primers
(each 5 nucleotides long) that you would use to amplify both strands of the 2.5kb long DNA fragments
and label their 5 and the 3 ends.
The Primer that can bind to the bottom strand will have the sequence 5GGGAA3 and the primer that
will bind to the top strand will be 5GGGGA3. Note: Typically primers are 20-25 nucleotides long.

b) You PCR amplify the DNA fragment by running 30 PCR cycles. You subject the PCR mix (DNA to be
amplified, corresponding primers, Taq DNA polymerase, dNTPs and reaction buffer) in each cycle
sequentially to a temperature of 95OC, 55OC and 70OC. You then repeat the cycle.

i. At which of the above temperatures would the strands unwind? 95OC

ii. At which of the above temperatures would the primers anneal? 55OC

iii. At which of the above temperatures would the complementary DNA strands be made? 70OC

iv. Complete the statement by selecting appropriate temperatures. Taq DNA polymerase performs its
O O
polymerizing activity at __70 C _but is also stable at___95 C (in fact ALL listed temperatures)__.

9
Question 5 continued
v. Errors in PCR are far more compared to the errors observed during DNA replication within the
cell. What activity might the Taq DNA polymerase lacks compared to the DNA polymerase?
It lacks the 3->5 exonuclease (proofreading) activity

c) You PCR amplify Fragment A and digest it with a series of restriction enzymes. The recognition
sequences for the restriction enzymes used are given below and the site at which they cut is shown by
a slash (/). You resolve the restriction digested DNA fragments on a DNA gel and create the following
restriction maps for fragment A and Fragment B. Note: The numbers in the restriction enzymes maps
represent the size of each digested DNA fragment in kilobases (kb).
EcoR1 0.5kb Nhe1 (1.2kb) EcoR1 (0.8kb)
5G/AATTC3
3CTTAA/G5
Restriction map of Fragment A cloned from healthy donor
Nhe1
5G/CTAGC3 0.5kb Sal1 (1.2kb) EcoR1 (0.8kb)
3CGATC/G5
Sal1
5G/TCGAC3 Restriction map of Fragment B cloned from affected individual
3CAGCT/G5

Using the fluorescence di- deoxy sequencing method, you sequence both Fragment A and Fragment B
by using the non- coding/ template strand for sequencing. The fluorescence profiles below show the
base sequence corresponding to the first 15 bases in the coding/ mRNA like strands of Fragment A (in
schematic A) and Fragment B (in schematic B).

5 A 5 A
T T
G G
C C
T T
A A
G G
C T
G C
A G
C A
T C
A T
A AA
T A A
Schematic A 3 Schematic B 3A

i. Write the sequence of the first 15 base pairs of the double helical DNA Fragments A and B, in
the space below.

Fragment A (from Schematic A): Fragment B (from Schematic B):

5ATG/CTAGCGACTAAT3 5ATGCTAG/TCGACTAA3
3TACGATC/GCTGATTA5 3TACGATCAGCT/GATT3
Nhe1 site Sal1 site
ii. Circle the recognition sites for the relevant restriction enzymes (EcoR1/ Nhe1/ Sal1) on
Fragment A and Fragment B above. The sites are highlighted in blue.
10
Question 5 continued
iii. Write the amino acid sequence encoded by the coding sequence shown in schematic A and
schematic B for Fragment A and Fragment B. Label the N and the C ends. Note: You should
consult a codon chart such as the one provided with Recitation 7.

Amino acid sequence for Fragment A: N--met-leu-ala-thr-asn-------C

Amino acid sequence for Fragment B: N--met-leu-val-asp-C (stop codon)

iv. On sequence that you gave in part (ii), box the base pair in Fragment B that accounts for the
point mutation that results in the disease phenotype. It is shown in red and is shaded.

Question 6
Recent developments in Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and
CRISPR associated endonuclease (Cas9) technologies in eukaryotic cells have allowed for rapid
engineering of the eukaryotic genome. A 20-bp guide RNA targets the Cas9 endonuclease to a
genomic locus by hybridization with unwound DNA. Following recognition of the complementary strand,
Cas9 creates a double stranded break (DSB, indicated with arrowheads) that the cell can repair in an
error-prone manner that introduces insertions or deletions. The guide RNA requires a 5-NGG-3
consensus sequence at the 3 end of the genomic target strand (where N could be any nucleotide). This
5-NGG-3 is not present in the guide RNA as shown in the schematic. Reference: Cong et al, Science
2013.

consensus
sequence
Cas9 Protein
Genomic Locus DSB
5 GATTACAGCTATCAGGTATCTGG 3
3 CTAATGTCGATAGTCCATAGACC 5
no 5-NGG-3
GAUUACAGCUAUCAGGUAUC

Guiding RNA Scaffold

RNA

You are given a sequence below, which encodes a protein that you would like to knock out to study
how it contributes to a cell:

Coding: 5-TACATCATCTACGCATTTATCTGGATGCACATGGCCGTTATGCAAGAATTAATTATGAGTATGAGCACTACTCATAATAGTCGAG-3
Template: 3-ATGTAGTAGATGCGTAAATAGACCTACGTGTACCGGCAATACGTTCTTAATTAATACTCATACTCGTGATGAGTATTATCAGCTC-5
5UTR Exon 1 intron 1 exon 2 3UTR

a) Design one guide RNA to target this gene of interest and explain why you have selected this.
You can give any of the following sequences.
5CGCAUUUAUCUGGAUGCACA3 1st exon targeting
5CATAATTAATTCTTGCATAA3 Intron targeting
5ACATCATCTACGCATTTATC3 5UTR targeting

b) You look to see whether you have knocked out your protein of interest in a population of cells and
noticed that not every cell has had the protein knocked out. List one possible explanation.
There are many possible answers some of which are below. Any reasonable answer will be accepted.
For example, (1) the Cas9 gene/ guideRNA wasnt 100% effective and some cells didnt get hit (2)
chromatin structure prevented Cas9 protein from degrading the gene (3) the DNA was repaired via a
higher fidelity repair mechanism (4) some cells had a mutation at one or both of the targeting sites,
preventing the gene from being completely knocked out.

11
Question 7
You are studying the following pedigree for a disease that is associated with mutations in Gene A and
shows a specific mode of inheritance. You identify a rare SNP that is a part of Gene A. Please note: All
the individuals with the disease phenotype are shaded. People marrying into the family for generations I & II only
have the wild-type alleles of Gene A. Also listed are the alleles of SNP for some individuals. Assume complete
penetrance.

1 2
P-O The two letters identify the alleles of the
1: G, T
2: C, G SNP that would be found on the top
strand of each of the two homologous
chromosomes. For example, SNP:
G-I 3 44 5 6 7 8 9 G,T indicates that on one of the
T, G G, G T, G homologous chromosomes the top
strand would contain a G, while on the
other chromosome the top strand would
G-II contain a T.
10 11 12

a) What is the mode of inheritance of this disease? X- linked recessive

T
b) Give the genotype at the SNP locus of Individual #4. SNP T or X Y or TY (all acceptable)

c) SNPs re often used as the markers to predict the allele a person may have for a particular trait. They
may be located within the gene, in the regulatory regions of the gene and regions between the gene (
intergenic regions). The SNP specified in the pedigree above is a part of the gene and it reduces the
amount of protein encoded by the gene. Based on this information, give the possible location(s) of
this SNP from the options below and explain why you selected this option(s). Choose from promoter,
coding region, UTRs, splice donor site and splice acceptor site

All the options provided can influence the amount of protein encoded by the gene. Mutation in promoter
sequence can convert a strong promoter into a weak promoter or vice versa thus influencing the
expression of gene. Mutation (such as nonsense mutation) in the coding region may result in a short,
truncated, nonfunctional protein that may get degraded. The UTRs are regulatory regions and therefore
a mutation in these sequences may influence translation. A mutation in the splice donor or acceptor site
may result in the introduction of a premature stop codon as a result of which the protein produced may
be truncated, nonfunctional or not produced.

12