Basic & Clinical Pharmacology & Toxicology Doi: 10.1111/bcpt.

12196

Preventative Effect of Zingiber officinale on Insulin Resistance in

a High-Fat High-Carbohydrate Diet-Fed Rat Model and its
Mechanism of Action
Yiming Li1, Van H. Tran1, Bhavani P. Kota1, Srinivas Nammi2, Colin C. Duke1 and Basil D. Roufogalis1,3
1
Faculty of Pharmacy, The University of Sydney, Sydney, NSW, Australia, 2School of Science and Health, University of Western Sydney, Sydney,
NSW, Australia and 3Discipline of Pharmacology, School of Medical Sciences, Sydney Medical School, The University of Sydney, Sydney, NSW,
Australia
(Received 9 November 2013; Accepted 2 January 2014)

Abstract: Insulin resistance is a core component of metabolic syndrome and usually precedes the development of type 2 diabetes
mellitus. We have examined the preventative effect of an ethanol extract of ginger (Zingiber officinale, Zingiberaceae) on insulin
resistance in a high-fat high-carbohydrate (HFHC) diet-fed rat model of metabolic syndrome. The HFHC control rats displayed
severe insulin resistance, whilst rats treated with ginger extract (200 mg/kg) during HFHC diet feeding showed a significant
improvement of insulin sensitivity using the homeostatic model assessment of insulin resistance (HOMA-IR) after 10 weeks
(p < 0.01). An in vitro mechanistic study showed that (S)-[6]-gingerol, the major pungent phenolic principle in ginger, dose-
dependently (from 50 to 150 lM) increased AMPK a-subunit phosphorylation in L6 skeletal muscle cells. This was accompa-
nied by a time-dependent marked increment of PGC-1a mRNA expression and mitochondrial content in L6 skeletal muscle cells.
These results suggest that the protection from HFHC diet-induced insulin resistance by ginger is likely associated with the
increased capacity of energy metabolism by its major active component (S)-[6]-gingerol.

The prevalence of type 2 diabetes has been escalating in the symptoms related to metabolic syndrome. It was reported that
last few decades. Type 2 diabetes is a progressive disease usu- ginger extracts and the major pungent phenolic component
ally predisposed by a cluster of conditions in the metabolic (S)-[6]-gingerol reduced blood glucose level in diabetic animal
syndrome, including insulin resistance, dyslipidaemia, visceral models and promoted glucose uptake in in vitro cultured cells
obesity and hypertension [1, 2]. It is now widely recognised [15–19]. We previously reported that a ginger total extract and
that a high-calorie western food diet contributes greatly to the its pungent gingerol principles enhanced glucose uptake in L6
development of metabolic syndrome [3, 4]. More recent stud- rat skeletal muscle cells [20]. In this present study, we exam-
ies suggested that diets with high content of fat and simple ined the preventative effect of total ginger extract in a high-fat
carbohydrate, especially fructose, are strongly associated with high-carbohydrate (HFHC) diet-fed insulin-resistant rodent
insulin resistance [5–7]. model. We have investigated the mechanism of its action by
Insulin resistance in skeletal muscle ― the major site of analysing skeletal muscle tissues from the animal models and
postprandial glucose disposal ― is one of the earliest signs in the effects of (S)-[6]-gingerol in cultured L6 skeletal muscle
the development of type 2 diabetes [8]. Glucose uptake into cells.
skeletal muscle is primarily through glucose transporter 4
(GLUT4), which is modulated by insulin signalling or the
Materials and Methods
alternative pathway via activation of AMP-activated protein
kinase (AMPK) [9]. AMPK plays a key role in regulating cel- Materials. L6 rat myoblast culture was purchased from European
lular energy metabolism. Activation of AMPK leads to Collection of Cell Cultures (ECACC, Salisbury, UK). RNeasy Mini
increased glucose uptake and fatty acid influx into cells, and kit was from Qiagen (Chadstone Centre, Vic, Australia). Wizard
Minipreps DNA purification kit was from Promega (Sydney, NSW,
is accompanied by up-regulation of peroxisome proliferator- Australia). DyNAmoTM SYBRâ Green 2-Step qRT-PCR kit and
activated receptor gamma coactivator 1-alpha (PGC-1a), a Micro BCATM protein assay kit were purchased from Thermo Fisher
potent transcriptional cofactor in regulating mitochondrial Scientific (Scoresby, Vic, Australia). Metformin (98%) was purchased
biogenesis and function [10–14]. from Toronto Research Chemicals Inc. (North York, ON, Canada).
Ginger (Zingiber officinale Roscoe, family Zingiberaceae) is Insulin (rat) EIA kit (589501) was from Cayman Chemical (Ann
Arbor, MI, USA). Monoclonal rabbit phospho-AMPKaThr172/AMPKa
a widely used spice and medicinal herb. Recent research has
primary antibody and LumiGLOâ detection system were purchased
demonstrated promising results with ginger in alleviating from Cell Signaling Technology (Arundel, Qld, Australia).
Author for correspondence: Basil D. Roufogalis, Discipline of Pharma- Total ginger extract was prepared as reported previously [20].
cology, School of Medical Sciences, Sydney Medical School, The Uni- Briefly, freeze-dried powder (1 kg) of ginger rhizome (Grade A, pro-
versity of Sydney, Sydney, NSW 2006, Australia (fax +61 2 9351 4391, vided by Buderim Ginger Limited, Yandina, Qld, Australia) was
e-mail basil.roufogalis@sydney.edu.au). extracted with ethanol (3 L) with stirring at room temperature. The fil-

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
2 YIMING LI ET AL.

trate was collected and evaporated off at reduced pressure to afford a Protein extraction and Western blotting analysis. To prepare protein
liquid residue (55 g) as total ginger extract containing 15.6
0.5% of samples from rat skeletal muscle, approximately 50 mg of rat tissues
(S)-[6]-gingerol. (S)-[6]-Gingerol (purity of 94.0%) was obtained by were homogenised in ice-cold RIPA buffer containing protease and
further fractionation and purification carried out by a normal-phase phosphatase inhibitor cocktail. The in vitro study protein samples were
short-column vacuum chromatography (NP-SCVC) system. collected from cultured L6 myotubes following (S)-[6]-gingerol
treatment at 50, 100 and 150 lM for 10 min. The protein content of
Animals and diets. Adult male Sprague–Dawley (SD) rats all the samples was quantified using the Micro BCATM protein assay
(180–200 g) were obtained from Laboratory Animal Services, The kit. For Western blotting, 20 lg (from animal tissues) or 30 lg (from
University of Sydney, and maintained at ambient temperature of L6 myotubes) of protein samples were loaded onto 4–12% SDS-
24
2°C with 12-hr light/dark cycle. Standard chow and high-fat PAGE, then transferred onto nitrocellulose membrane and blocked
high-carbohydrate (HFHC) diet (SF11-092) were supplied by with 5% BSA in Tween-Tris-buffered saline (TBST) solution. The
Specialty Feed, Perth Australia. The nutrition composition in standard membrane was incubated with rabbit phospho-AMPKaThr172 or total
chow is 59.4% total carbohydrate (cereal grain as the main AMPKa primary antibody in 1% BSA/TBST at 4°C overnight,
carbohydrate source), 20% protein and 4.8% fat, containing digestible followed by anti-rabbit HRP-linked secondary antibody probing. The
energy 14.0 MJ/kg; the HFHC diet (sugar as carbohydrate source) blots were visualised using the LumiGLOâ detection system following
contained 17.7% sucrose, 17.7% fructose, 19.4% protein and 40% fat, the manufacturer’s instructions. The intensity of bands was determined
with a digestible energy of 24.1 MJ/kg. The experimental protocol using the ImageJ image processing programme (NIH, Bethesda, MD,
was approved by the Animal Ethics Committee of the University of USA).
Sydney (protocol number L24/3-2007/3/4559).
Experiment design: After acclimatisation to laboratory conditions PGC-1a mRNA expression in L6 myotubes. L6 rat skeletal muscle cells
for 1 week on arrival, the rats were weight-matched and divided into were differentiated into myotubes as described above. (S)-[6]-Gingerol
five groups, each consisting of seven rats. Group 1 was fed the stan- (150 lM) was added at the indicated times. Total RNA was isolated
dard chow diet as normal control, Group 2 was HFHC control. Both using RNeasy Mini kit according to the manufacturer’s instructions.
control groups received vehicle (40% DMSO + 10% vegetable Reverse transcription and real-time PCR were performed using
oil + 20% acacia gum) 0.2 mL/100 g body-weight by oral gavage DyNAmoTM SYBRâ Green 2-Step qRT-PCR Kit in ABI 7500 RT PCR
once daily for 10 weeks . Groups 3 and 4 were treated with total gin- system (Applied Biosystem, Carlsbad, CA, USA). Housekeeping gene
ger extract 100 mg/kg and 200 mg/kg, respectively, by oral gavage glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as
daily starting on the same day of HFHC diet feeding. Group 5 was an internal control included in each real-time PCR. Primer sequences for
treated with metformin 200 mg/kg by oral gavage daily as a positive PGC-1a were forward AATGCAGCGGTCTTAGCACT, reverse
control starting on the same day of HFHC diet feeding. Rats were GTGTGAGGAGGGTCATCGTT; and for GAPDH, forward AGA
allowed to access food and water ad libitum. Food intake was CAGCCGCATCTTCTTGT, reverse CTTGCCGTGGGTAGAGTCAT.
recorded daily. Blood samples were collected from the lateral saphe- Relative levels of mRNA were analysed by the delta-delta-Ct method.
nous vein after overnight fasting at weeks 4, 6, 8 and 10. The serum
was subsequently separated to determine glucose levels by the Veteri- Measurement of relative mitochondrial content in L6 myotubes. L6 rat
nary Pathology Diagnostic Services, the University of Sydney. At the skeletal muscle cells were differentiated into myotubes as describe
end of week 10, all rats were killed under ketamine/xylazine anaesthe- above, then incubated with (S)-[6]-gingerol (150 lM) for 24 hr. DNA
sia. The skeletal muscle tissues were collected and snap-frozen in samples were extracted using the Wizard mini kit. The sequences of
liquid nitrogen then stored in a 80°C freezer for further analysis. primers of mitochondrial specific DNA mCYTB are forward
ACAAAATCCCATTCCATCCA, reverse GTTGGGAATGGAGCG
Oral glucose tolerance test. The baseline blood glucose level was TAGAA; and nuclear specific GAPDH, forward CCGTTGTCCCA
measured using an Accu-check glucometer after 16 hr fasting. After ATCTGTTCT, reverse TGTGAGGGAGATGCTCAGTG. Quantitative
administration of 40% D-glucose solution (20 g/kg bw), the blood real-time PCR was performed using DyNAmoTM SYBRâ Green in ABI
glucose of rat was measured at 30, 60, 90 and 120 min after dosing. 7500 RT PCR system (Applied Biosystem). The results of the
The oral glucose tolerance test (OGTT) results were expressed as the quantitative PCR were expressed as the ratios of the mean mitochondrial
integrated area under the curves (AUG) over a period of 0–120 min. DNA value of triplicate measurements to the mean nuclear DNA value
of triplicate measurements (mtDNA: nDNA).
Determination of serum insulin concentrations. Serum insulin
concentration was determined using insulin (rat) enzyme immunoassay Statistics. All data are presented as mean
S.E.M. Results were
(EIA) kit following the manufacturer’s instructions. Briefly, fifty analysed using one-way analysis of variance (ANOVA) followed by the
microlitres of serum sample from each rat was added to the test wells. Newman-Keuls post hoc test for significance. Differences were
Each sample was analysed in duplicate. Insulin concentration was considered significant when p values were less than 0.05 (p < 0.05).
determined by measuring the absorbance at 405 nm using a
POLARstar microplate reader.
The insulin resistance index was determined by the homeostatic Results
model assessment of insulin resistance (HOMA-IR) using the follow-
ing HOMA-IR formula [21]: Effect of ginger extract on body-weight, food intake and
feeding efficiency in HFHC diet-fed rats.
HOMA-IR ¼(fasting serum insulinðlU=mLÞ During the 10-week feeding with HFHC diet, the growth rate
 fasting serum glucoseðmg=dLÞÞ=405 of the HFHC control group was not different to that of stan-
dard chow-fed rats, as shown in fig. 1. The amount of food
Cell culture. L6 myoblasts were maintained in a-minimal essential consumption in HFHC diet-fed rats (13.97 g/rat/day) was
medium with 10% foetal bovine serum (FBS) at 37°C in an significantly lower than that in standard chow-fed normal
atmosphere of 5% CO2. When myoblasts grew to confluence, cells group (24.67 g/rat/day) (table 1). However, their calculated
were allowed to fuse into multi-nucleated myotubes in a-MEM
energy intakes were similar in terms of digestive energy units
containing 2% heat-treated newborn calf serum (CS).

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
 GINGER EFFECT ON INSULIN RESISTANCE IN A HFHC DIET-FED RAT MODEL 3

550 normal control and ginger extract-treated group, and then con-
Normal control
HFHC control tinued to increase slightly for a further 30 min before declin-
500 Ginger (100 mg/kg) ing. The AUC of HFHC control also tended to be higher than
Ginger (200 mg/kg)
Meformin (200 mg/kg)
normal control (p < 0.1). The blood glucose level in normal
450 rats was increased more gradually and declined more rapidly
Body weight (g)

than the HFHC control group. In the ginger extract-treated

400 HFHC group, the blood glucose progressively increased simi-
lar to the normal control up to 1 hr, then dropped gradually
350 (fig. 2A). The AUC of ginger treatment group was signifi-
cantly smaller than that in the HFHC control (p < 0.05)
300 (fig. 2B).
Insulin resistance indices were determined after 10-week
250 feeding and treatments. The serum insulin concentration and
0 1 2 3 4 5 6 7 8 9 10 HOMA-IR in the HFHC control were significantly higher than
Time (week) the normal control (p < 0.05) (table 3). This result indicated
Fig. 1. Effect of ginger extract on body-weight gain in high-fat high- that insulin resistance had developed in the HFHC diet-fed rat
carbohydrate (HFHC) diet-fed rats. The body-weight changes of model. Ginger extract treatment (200 mg/kg) markedly
experimental groups were recorded during the 10-week feeding. All decreased serum insulin level in HFHC diet-fed rats and
data are presented as mean
S.E.M. of seven rats in each group. improved insulin sensitivity (p < 0.05), same as the positive
control metformin group.
(kcal). Ginger extract (200 mg/kg) and metformin (200 mg/kg) Metformin did not overtly change the blood glucose level
treatment reduced weight gain slightly in the HFHC diet-fed in HFHC diet-fed rats (table 2). The AUC of the response to
rats over 10 weeks, but these did not reach statistical signifi- high glucose challenge is slightly lower in the metformin
cance. The feeding efficiency [body-weight gain (g)/energy group than that in HFHC control; however, the serum insulin
intake (kcal)] in these two groups was comparable to the concentration in the metformin group was maintained at nor-
HFHC control. mal level after 10-week feeding with HFHC diet. Therefore,
the calculated HOMA-IR value was drastically reduced when
compared to the HFHC control (p < 0.01). These results indi-
Effect of ginger extract on serum glucose level, the oral
cated that metformin is effective in ameliorating HFHC diet-
glucose tolerance test and insulin resistance in HFHC diet-fed
induced insulin resistance, as previously reported in a clinical
rats.
study [22].
During the 10-week feeding, there were no significant differ-
ences in the blood glucose level between the HFHC diet-fed rat
control and normal control. However, a marked reduction in Effect of ginger extract on AMPKaThr172 phosphorylation and
blood glucose in the high-dose ginger extract (200 mg/kg) treat- total AMPKa expression in rat skeletal muscle.
ment group was observed after week 6 (p < 0.01). This reduc- Previously, we showed that ginger extract and its major pun-
tion continued up to 10 weeks treatment when compared to gent principle (S)-[6]-gingerol enhanced glucose uptake with
HFHC and normal controls (p < 0.001), as shown in table 2. associated activation of AMPKa in cultured L6 skeletal mus-
An oral glucose tolerance test (OGTT) was conducted in cle cells in vitro [23]. Here, we examined the AMPKaThr172
normal control, HFHC control, ginger extract (200 mg/kg) and phosphorylation in isolated skeletal muscle tissue after
metformin (200 mg/kg) treated HFHC groups over a period of 10-week treatment with ginger extract in HFHC diet-fed rats.
120 min at the end of week 10. In HFHC diet-fed rats, the The HFHC diet did not significantly alter AMPKaThr172 phos-
blood glucose level increased rapidly following glucose load- phorylation level and protein content of AMPKa in skeletal
ing within 30 min., when it was significantly higher than both muscle tissue. Ginger extract, however, increased AMPK

Table 1.
Effect of ginger extract on food intake and feeding efficiency in rats fed a high-fat high-carbohydrate (HFHC) diet for 10 weeks.
Body-weight (g)
Food consumption Total energy intake Feeding efficiency
Groups Initial Final Weight gain (g) (g/rat/day) (kcal/rat/day) (g/kcal)
Normal control 270.1
3.3 481.0
21.3 210.9
18.5 24.67
0.24 82.54
0.81 2.56
0.24
HFHC control 269.1
4.8 485.0
17.3 215.9
19.2 13.97
0.46*** 80.44
2.65 2.68
0.24
Ginger (100 mg/kg) 275.0
4.8 484.4
12.0 209.4
11.0 14.07
0.49*** 81.06
2.80 2.58
0.14
Ginger (200 mg/kg) 266.4
5.3 451.7
16.5 185.3
13.0 13.06
0.52*** 75.21
3.02 2.46
0.17
Metformin (200 mg/kg) 274.1
2.9 448.6
14.8 174.4
14.3 13.43
0.54*** 77.38
3.14 2.25
0.18
Data are expressed as the mean
S.E.M. of seven rats, ***p < 0.001 versus normal control. Ginger extract and metformin were given to HFHC
diet-fed rats by oral gavage daily.

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
4 YIMING LI ET AL.

Table 2.
Effect of ginger extract on serum glucose (mmol/L) in rats fed a high-fat high-carbohydrate (HFHC) diet from 4 to 10 weeks.
Week
Group 4 6 8 10
Normal control 3.21
0.17 3.18
0.19 3.52
0.15 3.91
0.20
HFHC control 3.47
0.23 3.60
0.21 3.80
0.19 4.20
0.19
Ginger (100 mg/kg) 3.91
0.20 4.22
0.13 3.97
0.22 4.40
0.17
Ginger (200 mg/kg) 2.89
0.23 2.75
0.17## 2.86
0.24*,## 2.95
0.15***,###
Metformin (200 mg/kg) 3.80
0.29 3.60
0.18 3.67
0.23 4.08
0.18
Data are expressed as the mean
S.E.M. of 7 rats, *p < 0.05, ***p < 0.001 versus normal control; ##
p < 0.01, ###
p < 0.001 versus HFHC
control. Ginger extract and metformin were given to HFHC diet fed rats by oral gavage daily.

A 8.5 Table 3.
8 Effect of ginger extract on serum insulin concentration and insulin
resistance index (HOMA-IR) in high-fat high-carbohydrate (HFHC)
Blood glucose (mmol/L)

7.5 * diet-fed rats.

7
Insulin concentration
6.5
Group (ng/mL) HOMA-IR
6
Normal control 0.170
0.035 0.766
0.183
5.5 ## Normal control HFHC control 0.767
0.178** 3.628
0.851**
5 HFHC control
Ginger (200 mg/kg) 0.316
0.099## 1.025
0.331##
Ginger (200 mg/kg)
4.5 Metformin (200 mg/kg) 0.172
0.048## 1.178
0.423##
Metformin (200 mg/kg)
4 Data are expressed as the mean
S.E.M. of seven rats, **p < 0.01
0 30 60 90 120
Time (minute)
versus normal control; ##p < 0.01 versus HFHC control. Ginger
extract and metformin were given to HFHC diet-fed rats by oral
B 820 gavage daily.
800
780 #
AUC 0-120 min

760 ment with (S)-[6]-gingerol (150 lM) for 1 hr increased PGC-

740 1a mRNA expression by 50%, and this was increased further
720 by more than two fold after 5 and 24 hr (fig. 4B). As PGC-1a
700 is the ‘master regulator’ of mitochondrial biogenesis, the effect
680
of (S)-[6]-gingerol on the mitochondrial content was then
660
NC HFHC Ginger Metformin determined by measuring the mitochondrial DNA mCYTB.
After 24-hr treatment, the relative mitochondrial content
Fig. 2. Effect of ginger extract on oral glucose tolerance in high-fat
high-carbohydrate (HFHC) diet-fed rats. (A) Blood glucose level in increased by 50% in (S)-[6]-gingerol-treated cells, significantly
rats. Each point represents mean
S.E.M. of seven rats. *p < 0.05 higher than that in vehicle control (fig. 4C).
versus normal control, ##p < 0.01 versus HFHC control. (B) The area
under the curve (AUC) of blood glucose. Data are expressed as
mean
S.E.M. of seven rats. #p < 0.05 versus HFHC control. NC, Discussion
normal control; HFHC, high-fat high-carbohydrate control; Ginger,
ginger extract (200 mg/kg) in HFHC rats, Metformin: metformin Western diet characterised by high-calorie and low-fibre con-
(200 mg/kg) in HFHC rats. tent is believed to be associated with the increasing prevalence
of chronic diseases caused by metabolic disturbances [26]. To
investigate the effect of ginger (Zingiber officinale Roscoe) in
protein expression by 29.0% and AMPKaThr172 phosphoryla-
preventing diet-induced metabolic syndrome and its characteris-
tion by 46.0% above the HFHC control (fig. 3B and C). Met-
tic insulin resistance, we employed a model where animals were
formin significantly increased AMPKa phosphorylation, which
fed a high-fat and high-simple-carbohydrate diet, which mimics
is consistent with its previously reported effects [24, 25].
the nutritional composition of a cafeteria-style western diet.
Although numerous studies have been performed to investigate
(S)-[6]-Gingerol enhanced phosphorylated-AMPK aThr172 and animal models with diet-induced metabolic disease, the results
promoted mitochondrial biogenesis in L6 myotubes. were not always consistent. This is likely due to the variation of
We then investigated the mechanism of ginger in regulating the diet compositions [27–29]. In this regard, a study compared
glucose homeostasis by examining the effect of (S)-[6]-ginger- four types of high-fat diet formulas and concluded that a combi-
ol, the major pungent phenolic principle in ginger, on energy nation of saturated fatty acid (SFA) and mono-unsaturated fatty
metabolism capacity in skeletal muscle cells. As shown acid (MUFA) was most effective in producing a valid rat model
in fig. 4A, (S)-[6]-gingerol dose-dependently increased with metabolic syndrome [30]. Carbohydrate, as a major source
AMPKaThr172 phosphorylation after 10-min incubation. Treat- of energy supply, is recommended to comprise 40–50% of the

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
 GINGER EFFECT ON INSULIN RESISTANCE IN A HFHC DIET-FED RAT MODEL 5

A A
p-AMPKαThr172 p-AMPKα Thr172

Total AMPKα Total-AMPKα

0 50 100 150
α-tubulin
(S)-[6]-gingerol (μM)
NC HFHC Ginger Metformin
8.0
**

p-AMPKα/t-AMPKα
*# 7.0
B 250% 214.2% 6.0
5.0 *
p-AMPKα/α-tublin

200% 160.1% 4.0

3.0 *
150% 114.1%
2.0
100% 1.0
0.0
50% 0 50 100 150
(S)-[6]-gingerol (μM)
0% B
NC HFHC Ginger Metformin
3.5 *

PGC-1 α mRNA expression

C 200% 3.0
*

(Arbitrary unit)
136.5% 2.5
t-AMPKα/α-tublin

150% 2.0
107.5% 100.6%
1.5
100%
1.0
50% 0.5
0.0
0% 0 1 5 24
NC HFHC Ginger Metformin Time (hr)
Fig. 3. Effect of ginger extract on AMPKaThr172 phosphorylation and C 2.0
AMPKa protein expression in skeletal muscle tissue from high-fat high- *
Mitochondrial content

carbohydrate (HFHC) diet-fed rats. (A) Representative immunoblots of

1.5
(Arbitrary unit)

protein expression of AMPKa and its phosphorylation status in skeletal

muscle tissue. (B) Phospho-AMPKa/a-tubulin ratio. (C) t-AMPKa/a-
tubulin ratio. Data are presented as mean
S.E.M. of three independent
experiments. *p < 0.05 versus normal control, #p < 0.05 versus HFHC 1.0
control. NC, Normal control; HFHC, high-fat high-carbohydrate control;
Ginger, ginger extract (200 mg/kg) in HFHC rats; Metformin, metfor-
0.5
min (200 mg/kg) in HFHC rats.

0.0
total food intake in a healthy diet [31]. However, recent data Control (S)-[6]-Gingerol
have shown that simple carbohydrate consumption, especially
Fig. 4. Effect of (S)-[6]-gingerol on AMPKaThr172 phosphorylation,
added sucrose and fructose, is detrimental and has increased
PGC-1a mRNA expression and mitochondrial content in L6 myotu-
dramatically worldwide [32]. Although a small amount of oral bes. (A) Representative immunoblots of dose-dependent effect of
fructose intake may be beneficial in improving glycaemic con- (S)-[6]-gingerol on AMPKaThr172 phosphorylation after 10-min treat-
trol in type 2 diabetic patients by promoting hepatic glucose ment. Data are presented as mean
S.E.M. of three independent
uptake, long-term high fructose intake leads to impairment of experiments. (B) PGC-1a mRNA expression in L6 myotubes after
treatment with (S)-[6]-gingerol (150 lM) for 1, 5 and 24 hr. (C) Rela-
insulin action and increases the risk of type 2 diabetes [5,
tive mitochondrial content in L6 myotubes after 24-hr treatment with
33–37]. Here, we used a modified high-fat high-carbohydrate (S)-[6]-gingerol (150 lM). All data are presented as mean
S.E.M.
diet formulation containing 23.1% SFA and 13.34% MUFA as of three independent experiments performed in triplicate. *p < 0.05
lipid source, 17.7% sucrose and 17.7% fructose replacing grain versus control, **p < 0.01 versus control.
starch and crude fibre as the carbohydrate source. Interestingly,
during the 10-week feeding, the body-weight of HFHC control
rats did not differ from normal rats. This could be explained by Insulin resistance is one of the key components of meta-
the fact that the caloric ingestion was equivalent in the two bolic syndrome which leads to the overt onset of type 2 dia-
groups. Similar results have been reported by other groups betes. High content of lipid in the diet is believed to
previously [38–40]. However, manifest insulin resistance was contribute greatly to the occurrence of insulin resistance [41].
displayed in the HFHC diet-fed rats. In insulin-resistant individuals, the reduced physiological

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
6 YIMING LI ET AL.

response of peripheral tissues usually results in hyperinsulina- drial biogenesis in L6 myotubes. These results show that
emia to maintain blood glucose within the normal range [42]. ginger has beneficial effects on modulating glucose metabo-
The insulin resistance is most commonly evaluated by the lism in rats fed a high-calorie diet and suggest that ginger
homeostatic model assessment of insulin resistance (HOMA- may be effective in preventing the development of metabolic
IR) which takes consideration of both fasting blood glucose syndrome and type 2 diabetes.
and insulin concentration. In the present study, although the
blood glucose in HFHC diet-fed rats remained normal, the Conflict of Interest
serum insulin level increased dramatically. The calculated The authors declare that there is no conflict of interest asso-
HOMA-IR value (=3.628) in HFHC rats is significantly ciated with this paper.
higher than the proposed cut-off point (=2.29), indicating
severe insulin resistance [43]. Ginger treatment (200 mg/kg) Acknowledgements
was found to be effective in preventing insulin resistance This work was supported by an Australian Research Coun-
induced by HFHC diet feeding. cil Linkage grant.
We next investigated the significance of the finding that
References
(S)-[6]-gingerol, a major active component in ginger, increased
AMPKa phosphorylation in L6 myotubes. AMPK activation 1 Wilson PW, D’Agostino RB, Parise H, Sullivan L, Meigs JB. Met-
leads to enhanced energy expenditure and is strongly associ- abolic syndrome as a precursor of cardiovascular disease and type
ated with transcriptional adaptation, including increased per- 2 diabetes mellitus. Circulation 2005;112:3066–72.
2 Alberti KG, Zimmet P, Shaw J. The metabolic syndrome–a new
oxisome proliferator-activated receptor-c coactivator 1a (PGC-
worldwide definition. Lancet 2005;366:1059–62.
1a). PGC-1a is expressed at high level in tissues with active 3 Lutsey PL, Steffen LM, Stevens J. Dietary intake and the develop-
oxidative metabolism, such as skeletal muscle, heart and ment of the metabolic syndrome: the Atherosclerosis Risk in Com-
brown adipose tissue, and plays a key role in regulating mito- munities study. Circulation 2008;117:754–61.
chondrial biogenesis [11]. Recent clinical findings indicate that 4 Hill MJ, Metcalfe D, McTernan PG. Obesity and diabetes: lipids,
down-regulation of PGC-1a and defects in mitochondrial ‘nowhere to run to’. Clin Sci (Lond) 2009;116:113–23.
5 Sluijs I, van dSY, van dA, Spijkerman AM, Hu FB, Grobbee DE
function are closely related to the pathogenesis of insulin et al. Carbohydrate quantity and quality and risk of type 2 diabetes
resistance and type 2 diabetes [44, 45]. Mitochondria in insu- in the European Prospective Investigation into Cancer and Nutri-
lin-resistant offspring of type 2 diabetic patients were found tion-Netherlands (EPIC-NL) study. Am J Clin Nutr 2010;92:905–
lower in density and impaired in activity compared with con- 11.
trol subjects [46, 47]. A similar finding was reported in the 6 Basciano H, Federico L, Adeli K. Fructose, insulin resistance, and
metabolic dyslipidemia. Nutr Metab (Lond) 2005;2:5.
skeletal muscle of insulin-resistant elderly individuals [48].
7 Storlien LH, Baur LA, Kriketos AD, Pan DA, Cooney GJ, Jenkins
The present study showed that (S)-[6]-gingerol treatment sig- AB et al. Dietary fats and insulin action. Diabetologia
nificantly increased mRNA expression of PGC-1a within 5 hr 1996;39:621–31.
in L6 myotubes, and a marked rise of mitochondrial content 8 Petersen KF, Shulman GI. Pathogenesis of skeletal muscle insulin
was detected at a later time. resistance in type 2 diabetes mellitus. Am J Cardiol 2002;90:11G–
From the overall results obtained in our study, we hypothe- 8G.
9 Klip A. The many ways to regulate glucose transporter 4. Appl
size that the metabolic capacity of skeletal muscle is enhanced
Physiol Nutr Metab 2009;34:481–7.
by feeding total ginger extract together with a HFHC diet in 10 Kurth-Kraczek EJ, Hirshman MF, Goodyear LJ, Winder WW. 5’
rats, thereby effectively lowering insulin resistance. There is AMP-activated protein kinase activation causes GLUT4 transloca-
growing evidence showing that insulin resistance is also asso- tion in skeletal muscle. Diabetes 1999;48:1667–71.
ciated with adipocyte-secreted cytokines [49–51]. Considering 11 Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated pro-
the well-known anti-inflammatory and antioxidant properties tein kinase: ancient energy gauge provides clues to modern under-
standing of metabolism. Cell Metab 2005;1:15–25.
of ginger, the combination of these effects might contribute to
12 Liang H, Ward WF. PGC-1alpha: a key regulator of energy metab-
the prevention of insulin resistance observed in the HFHC olism. Adv Physiol Educ 2006;30:145–51.
diet-fed rodent model [52–54]. 13 Hardie DG. AMP-activated protein kinase: a cellular energy sensor
with a key role in metabolic disorders and in cancer. Biochem Soc
Trans 2011;39:1–13.
Conclusion 14 Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha
V et al. Mechanisms controlling mitochondrial biogenesis and res-
To our knowledge, this is the first study of ginger in a high- piration through the thermogenic coactivator PGC-1. Cell
fat, high-carbohydrate, diet-induced insulin resistance animal 1999;98:115–24.
model. The major findings of the study are that ginger extract 15 Nammi S, Sreemantula S, Roufogalis BD. Protective effects of eth-
markedly decreased circulating insulin and prevented insulin anolic extract of Zingiber officinale rhizome on the development
resistance in HFHC diet-fed rats. A concomitant analysis of metabolic syndrome in high-fat diet-fed rats. Basic Clin Pharma-
col Toxicol 2009;104:366–73.
showed that AMPKa phosphorylation and total AMPKa in
16 Sekiya K, Ohtani A, Kusano S. Enhancement of insulin sensitivity
skeletal muscle tissue tended to increase in HFHC diet-fed rats in adipocytes by ginger. BioFactors 2004;22:153–6.
treated with ginger extract. An in vitro mechanistic study 17 Noipha K, Ratanachaiyavong S, Ninla-Aesong P. Enhancement of
showed that (S)-[6]-gingerol enhanced AMPKa activation, glucose transport by selected plant foods in muscle cell line L6.
increased PGC-1a gene expression and promoted mitochon- Diabetes Res Clin Pract 2010;89:e22–6.

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)
 GINGER EFFECT ON INSULIN RESISTANCE IN A HFHC DIET-FED RAT MODEL 7

18 Islam MS, Choi H. Comparative effects of dietary ginger (Zingiber 37 Tobey TA, Mondon CE, Zavaroni I, Reaven GM. Mechanism of
officinale) and garlic (Allium sativum) investigated in a type 2 dia- insulin resistance in fructose-fed rats. Metabolism 1982;31:608–12.
betes model of rats. J Med Food 2008;11:152–9. 38 Wilkes JJ, Bonen A, Bell RC. A modified high-fat diet induces
19 Madkor HR, Mansour SW, Ramadan G. Modulatory effects of gar- insulin resistance in rat skeletal muscle but not adipocytes. Am J
lic, ginger, turmeric and their mixture on hyperglycaemia, dyslip- Physiol 1998;275(4 Pt 1):E679–86.
idaemia and oxidative stress in streptozotocin-nicotinamide diabetic 39 Panchal SK, Poudyal H, Iyer A, Nazer R, Alam MA, Diwan V
rats. Br J Nutr 2011;105:1210–7. et al. High-carbohydrate, high-fat diet-induced metabolic syndrome
20 Li Y, Tran VH, Duke CC, Roufogalis BD. Gingerols of Zingiber and cardiovascular remodeling in rats. J Cardiovasc Pharmacol
officinale enhance glucose uptake by increasing cell surface 2011;57:611–24.
GLUT4 in cultured L6 myotubes. Planta Med 2012;78:1549–55. 40 Axelsen LN, Lademann JB, Petersen JS, Holstein-Rathlou NH,
21 Maehata E, Yano M, Shiba T, Yamakado M, Inoue M, Suzuki S. Ploug T, Prats C et al. Cardiac and metabolic changes in long-term
Insulin resistance index (HOMA-R method). Nihon Rinsho high fructose-fat fed rats with severe obesity and extensive intra-
2002;60(Suppl 8):341–50. myocardial lipid accumulation. Am J Physiol Regul Integr Comp
22 Freemark M, Bursey D. The effects of metformin on body mass Physiol 2010;298:R1560–70.
index and glucose tolerance in obese adolescents with fasting hy- 41 Samuel VT, Petersen KF, Shulman GI. Lipid-induced insulin resis-
perinsulinemia and a family history of type 2 diabetes. Pediatrics tance: unravelling the mechanism. Lancet 2010;375:2267–77.
2001;107:E55. 42 Laakso M. How good a marker is insulin level for insulin resis-
23 Li Y, Tran VH, Koolaji N, Duke C, Roufogalis BD. (S)-[6]- tance? Am J Epidemiol 1993;137:959–65.
Gingerol enhances glucose uptake in L6 myotubes by activation 43 Radikova Z, Koska J, Huckova M, Ksinantova L, Imrich R, Vigas
of AMPK in response to [Ca2 + ] i. J Pharm Pharm Sci M et al. Insulin sensitivity indices: a proposal of cut-off points for
2013;16:304–12. simple identification of insulin-resistant subjects. Exp Clin Endo-
24 Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J et al. crinol Diabetes 2006;114:249–56.
Role of AMP-activated protein kinase in mechanism of metformin 44 Kelley DE, He J, Menshikova EV, Ritov VB. Dysfunction of mito-
action. J Clin Invest 2001;108:1167–74. chondria in human skeletal muscle in type 2 diabetes. Diabetes
25 Hawley SA, Gadalla AE, Olsen GS, Hardie DG. The antidiabetic 2002;51:2944–50.
drug metformin activates the AMP-activated protein kinase cascade 45 Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S
via an adenine nucleotide-independent mechanism. Diabetes et al. Coordinated reduction of genes of oxidative metabolism in
2002;51:2420–5. humans with insulin resistance and diabetes: potential role of
26 Robson AA. Preventing diet induced disease: bioavailable nutrient- PGC1 and NRF1. Proc Natl Acad Sci USA 2003;100:8466–71.
rich, low-energy-dense diets. Nutr Health 2009;20:135–66. 46 Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes
27 Holemans K, Caluwaerts S, Poston L, Van Assche FA. Diet- N et al. Reduced mitochondrial density and increased IRS-1 serine
induced obesity in the rat: a model for gestational diabetes mell- phosphorylation in muscle of insulin-resistant offspring of type 2
itus. Am J Obstet Gynecol 2004;190:858–65. diabetic parents. J Clin Invest 2005;115:3587–93.
28 Dobrian AD, Davies MJ, Prewitt RL, Lauterio TJ. Development of 47 Petersen KF, Dufour S, Befroy D, Garcia R, Shulman GI. Impaired
hypertension in a rat model of diet-induced obesity. Hypertension mitochondrial activity in the insulin-resistant offspring of patients
2000;35:1009–15. with type 2 diabetes. N Engl J Med 2004;350:664–71.
29 Zhang M, Lv XY, Li J, Xu ZG, Chen L. The characterization of 48 Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman
high-fat diet and multiple low-dose streptozotocin induced type 2 DL et al. Mitochondrial dysfunction in the elderly: possible role in
diabetes rat model. Exp Diabetes Res 2008;2008:704045. insulin resistance. Science 2003;300:1140–2.
30 Buettner R, Parhofer KG, Woenckhaus M, Wrede CE, Kunz- 49 Marette A. Mediators of cytokine-induced insulin resistance in
Schughart LA, Scholmerich J et al. Defining high-fat-diet rat mod- obesity and other inflammatory settings. Curr Opin Clin Nutr
els: metabolic and molecular effects of different fat types. J Mol Metab Care 2002;5:377–83.
Endocrinol 2006;36:485–501. 50 Morino K, Petersen KF, Shulman GI. Molecular mechanisms of
31 NHMRC. Australian dietary guideline. NHMRC, editor.2003. insulin resistance in humans and their potential links with mito-
32 Tappy L, Le KA. Metabolic effects of fructose and the worldwide chondrial dysfunction. Diabetes 2006;55(Suppl 2):S9–15.
increase in obesity. Physiol Rev 2010;90:23–46. 51 Scheen AJ. Pathophysiology of type 2 diabetes. Acta Clin Belg
33 Hu FB, van Dam RM, Liu S. Diet and risk of Type II diabetes: 2003;58:335–41.
the role of types of fat and carbohydrate. Diabetologia 2001; 52 Chrubasik S, Pittler MH, Roufogalis BD. Zingiberis rhizoma: a
44:805–17. comprehensive review on the ginger effect and efficacy profiles.
34 Thorburn AW, Storlien LH, Jenkins AB, Khouri S, Kraegen EW. Phytomedicine 2005;12:684–701.
Fructose-induced in vivo insulin resistance and elevated plasma tri- 53 Dugasani S, Pichika MR, Nadarajah VD, Balijepalli MK, Tandra
glyceride levels in rats. Am J Clin Nutr 1989;49:1155–63. S, Korlakunta JN. Comparative antioxidant and anti-inflammatory
35 Stanhope KL, Havel PJ. Fructose consumption: potential mecha- effects of [6]-gingerol, [8]-gingerol, [10]-gingerol and [6]-shogaol.
nisms for its effects to increase visceral adiposity and induce dysli- J Ethnopharmacol 2010;127:515–20.
pidemia and insulin resistance. Curr Opin Lipidol 2008;19:16–24. 54 Li XH, McGrath KC, Nammi S, Heather AK, Roufogalis BD.
36 Shiota M, Galassetti P, Monohan M, Neal DW, Cherrington AD. Attenuation of liver pro-inflammatory responses by Zingiber offici-
Small amounts of fructose markedly augment net hepatic glucose nale via inhibition of NF-kappa B activation in high-fat diet-fed
uptake in the conscious dog. Diabetes 1998;47:867–73. rats. Basic Clin Pharmacol Toxicol 2012;110:238–44.

© 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society)