EXCLI Journal 2018;17:159-168 – ISSN 1611-2156

Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

Review article:

MICROSATELLITE INSTABILITY IN COLORECTAL CANCER

Jafar Nouri Nojadeh1, 2, Shahin Behrouz Sharif 1, 3, Ebrahim Sakhinia1, 4, 5, *
1
Department of Medical Genetics, Faculty of Medicine, Tabriz University of Medical
Sciences, Tabriz, Iran
2
Stem Cell and Regenerative Medicine Institute, Tabriz University of Medical Sciences,
Tabriz, Iran
3
Department of Molecular Medicine, Pasteur Institute of Iran, Tehran
4
Tuberculosis and Lung Disease Research Center, Tabriz University of Medical Sciences,
Tabriz, Iran
5
Tabriz Genetic Analysis Centre (TGAC), Tabriz University of Medical Sciences,
Tabriz, Iran

* Corresponding author: Ebrahim Sakhinia, PhD, Department of Medical Genetics, Faculty

of Medicine, Daneshgah Street, 516661557, Tabriz, Iran, E-mail: esakhinia@yahoo.co.uk

http://dx.doi.org/10.17179/excli2017-948

This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0/).

ABSTRACT
Colorectal cancer (CRC) is a heterogeneous disease that is caused by the interaction of genetic and environmental
factors. Although it is one of the most common cancers worldwide, CRC would be one of the most curable cancers
if it is detected in the early stages. Molecular changes that occur in colorectal cancer may be categorized into three
main groups: 1) Chromosomal Instability (CIN), 2) Microsatellite Instability (MSI), and 3) CpG Island Methylator
phenotype (CIMP). Microsatellites, also known as Short Tandem Repeats (STRs) are small (1-6 base pairs) re-
peating stretches of DNA scattered throughout the entire genome and account for approximately 3 % of the human
genome. Due to their repeated structure, microsatellites are prone to high mutation rate. Microsatellite instability
(MSI) is a unique molecular alteration and hyper-mutable phenotype, which is the result of a defective DNA
mismatch repair (MMR) system, and can be defined as the presence of alternate sized repetitive DNA sequences
which are not present in the corresponding germ line DNA. The presence of MSI is found in sporadic colon,
gastric, sporadic endometrial and the majority of other cancers. Approximately, 15-20 % of colorectal cancers
display MSI. Determination of MSI status in CRC has prognostic and therapeutic implications. As well, detecting
MSI is used diagnostically for tumor detection and classification. For these reasons, microsatellite instability anal-
ysis is becoming more and more important in colorectal cancer patients. The objective of this review is to provide
the comprehensive summary of the update knowledge of colorectal cancer classification and diagnostic features
of microsatellite instability.

Keywords: CRC, MSI, DNA MMR system

INTRODUCTION (Siegel et al., 2012; Jemal et al., 2011). The

majority of colorectal cancer cases are spo-
Colorectal cancer (CRC) is the third most
prevalent cancer in humans and the third most radic (about 75 %) that display no apparent
evidence of having inherited disorders, sug-
common cause of cancer related deaths in
gesting contribution of genetic and environ-
both males and females that contributes to a
mental factors, whereas only 25 % of the pa-
significant public health problem worldwide
tients have family histories of the disease

159
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

(Jasperson et al., 2010). Only 5-6 % of pa- Gruber, 2010). In this review, we provide the
tients with colorectal cancer with a family comprehensive summary of the current
background are due to inherited mutations in knowledge in the field of colorectal cancer
major CRC genes, while the rest are the result classification and diagnostic features of mi-
of accumulation of both genetic mutations crosatellite instability.
and epigenetic modifications of several genes
(Migliore et al., 2011). According to the cur-
TYPES OF CRC AND THEIR
rent knowledge, CRC mainly develops
GENETIC BASIS
through a gradual accumulation of genetic
and epigenetic alterations of the genome According to etiology and genetics of the
(Fearon and Vogelstein, 1990). Molecular disease, CRC is usually classified into three
changes that occur in colorectal cancer may distinct groups: sporadic, familial, and hered-
be categorized into three main groups: 1) itary (Table 1) (Sameer, 2013).
Chromosomal Instability (CIN), 2) Microsat-
ellite Instability (MSI), and 3) CpG Island Sporadic CRC
Methylator phenotype (CIMP) that silences Sporadic colorectal cancer is the most
gene function with aberrant hypermethylation common type of CRC and includes approxi-
(Worthley and Leggett, 2010). CIN-positive mately 75 % of cases that display no apparent
CRCs are featured with alterations in the evidence of having inheritance of disorder.
structure and number of chromosome besides However, this is unclear, since genetic factors
increased mutation rates in both tumor sup- seem to affect the likelihood of cancer even in
pressor genes and oncogenes. Actually, muta- the absence of specific mutations. Sporadic
tion rates in single nucleotides are higher in colorectal cancer is common among elder
MSI-positive CRCs than in CIN-positive people, probably as a result of environmental
CRCs (Cancer Genome Atlas Network, factors, dietary, and aging (Arvelo et al.,
2012). On the other hand, 15-20 % of CRCs 2015). MSI-H sporadic colorectal cancers
display MSI caused by defective DNA mis- are the most often (about 70 %-95 %) caused
match repair (MMR) system (Vilar and
Table 1: Types of colorectal cancer and their genes
Types of CRC Genes involvement Chromosomal locus Inheritance
pattern
Sporadic APC 5q22.2 Non-inherited
K-RAS 12p12.1
DCC 18q21.2
P53 17p13.1
COX-2 2p14.1
BCL-2 18q21.33
related MMR genes
etc.
Familial Unknown --- Non-inherited
Hereditary
FAP APC 5q22.2 AD
MAP MUTYH 1p34.1 AR
PJS STK11/ LKB1 19p13.3 AD
SPS Unknown --- ---
LS MLH1 3p22.2 AD
MSH2 2p21-p16.3
MSH6 2p16.3
PMS2 7p22.1
CRC: colorectal cancer, FAP: Familial adenomatous polyposis, MAP: MUTYH-associated polyposis, PJS: Peutz-Jeghers syn-
drome, SPS: Serrated polyposis syndrome, LS: Lynch syndrome, AD: Autosomal Dominant, AR: Autosomal Recessive

160
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

by alteration of MLH1 gene via somatic pro- gene: Attenuated FAP (AFAP), Gardner syn-
motor hypermethylation (Copija et al., drome, Turcot syndrome, and Gastric Adeno-
2017). carcinoma and Proximal Polyposis of the
Stomach (GAPPS).
Familial type of CRC
This type of CRC is often considered spo- MUTYH-associated polyposis (MAP)
radic and not any associated gene has been MUTYH-associated polyposis is one of
identified yet. People with a history of colo- the hereditary polyposis syndromes which is
rectal cancer in a first-degree relative are at an autosomal recessive disease and is caused
increased risk of two to three times higher by a biallelic germline mutation in MUTYH
than the normal population (Lin, 2012). gene on chromosome 1p34.1. MUTYH gene
encodes an enzyme called MYH glycosylase
Hereditary type of CRC that is involved in a DNA repair system called
The hereditary type of CRC is divided into Base Excision Repair (BER). The number of
five subtypes: polyps in MAP disease is less than FAP and it
is phenotypically similar to attenuated FAP
Familial adenomatous polyposis (FAP) (Goodenberger and Lindor, 2011). The aver-
Familial adenomatous polyposis is the age age for diagnosis of MAP is between 40-
most common hereditary polyposis syn- 60 years old and if MAP is not recognized and
drome, which is an autosomal dominant dis- treated, patients will have an 80 % risk of de-
ease caused by a mutation in the APC gene on veloping CRC (Theodoratou et al., 2010). The
chromosome 5q21. The APC gene is a tumor majority of studied CRCs in people with
suppressor gene that produces APC protein, a MAP were microsatellite stable; although the
multifunction protein which controls how MSI-H (high-level microsatellite instability)
quickly cells grow and prevent the develop- phenotype is reported in the minority of CRCs
ment of tumors. The normal function of APC of persons with MAP (Nielsen et al., 2011;
protein is the regulation of β-catenin by its Castillejo et al., 2014).
degradation. β-catenin plays an important role
in cell communication, Wnt signalling path- Peutz-Jeghers syndrome (PJS)
way, and growth by acting as a transcription Peutz-Jeghers syndrome is a rare autoso-
factor for proliferation genes. Mutations in mal dominant disorder, which is one of the
the APC gene lead to loss of APC function hereditary polyposis syndromes and is char-
and result in an accumulation of β-catenin. acterized by multiple benign hamartomatous
Many different mutations (e.g. insertions, de- polyps in the gastrointestinal tract, most often
letions, nonsense mutations) of the APC gene found in the small intestine. The number of
are described as a cause of FAP (Bogaert and polyps in PJS is less than MAP syndrome and
Prenen, 2014). In addition to APC mutation, those polyps are present from childhood (Gi-
other mutations, such as K-RAS, DCC, P53, ardiello and Trimbath, 2006). The major
COX-2, BCL-2 and etc. are required to de- cause of this disease is germ line mutations in
velop cancer (Zeichner et al., 2012). In FAP the STK11 (serine threonine kinase 11) gene,
patients, polyps are mainly found in the prox- also known as the LKB1, which is a tumor
imal colon and rarely in the rectum. The aver- suppressor gene and is located on chromo-
age age for people with FAP to develop some 19p13.3 (Chae and Jeon, 2014). Muta-
polyps is 35 years and if FAP is not recog- tions in this gene change the structure and/or
nized and treated, most likely it will develop function of the STK11 protein, disrupting its
colorectal cancer (Laurent et al., 2011). There ability to restrain cell division with the loss of
are four subtypes of FAP that are caused by kinase activity. Microsatellite instability,
different germ line mutations in the APC

161
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

LOH nearby the APC gene, and KRAS muta- these genes interrupts DNA repair and causes
tions have been identified in some tumors an alteration in the short-tandem DNA repeti-
(Shah and Lindor, 2010). tive sequences or microsatellites, resulting in
the development of a phenotype known as mi-
Serrated polyposis syndrome (SPS) crosatellite instability which is a hallmark of
Serrated polyposis syndrome is a rela- Lynch syndrome. This syndrome is account-
tively rare syndrome characterized by multi- ing for approximately 2-3 % of the total CRC
ple serrated polyps of the colon, which was cases (Hampel et al., 2005). High-level mi-
previously known as the hyperplastic polypo- crosatellite instability is observed in approxi-
sis syndrome (Sweetser et al., 2013). This mately 90 % of LS-associated CRCs (Boland
syndrome is usually considered sporadic and and Shike, 2010).
underlying genetic causes are related to
germline mutations of oncogene-induced se- CONSENSUS MOLECULAR SUB-
nescence pathway genes (Gala et al., 2014). TYPES OF CRC
These tumors will be more often considered
To resolve inconsistencies between CRC
MSI-low or MSS (Microsatellite Stable) classifications based on gene expressions re-
(Guarinos et al., 2012). There are three crite-
ported and simplify clinical translation four
ria for diagnosis of SPS and an individual
Consensus Molecular Subtypes (CMSs) with
would be considered affected if have at least
distinct features have been reported. The
one of them; A) at least five serrated polyps
CMS1 are (microsatellite instability immune,
proximal to sigmoid with at least two of them
14 %), hypermutated, microsatellite unstable
being greater than 1 cm; B) Any number of
and are immunogenic. The CMS2 are (canon-
serrated polyps occurring proximal to the sig-
ical, 37 %), epithelial, marked WNT and
moid colon in an individual who has a first- MYC signalling activation and have the high-
degree relative with SPS; and C) more than 20 est overall survival. The CMS3 are (meta-
serrated polyps distributed throughout the co- bolic, 13 %), epithelial and evident metabolic
lon. Furthermore, it would be noteworthy to cancer phenotype; and the CMS4 (mesenchy-
indicate that SPS has been associated with an mal, 23 %), prominent transforming growth
increased risk of developing CRC considering factor–β activation, stromal invasion and an-
previous studies (Rex et al., 2012). giogenesis that have a worst survival. The
Consensus Molecular Subtypes of CRC with
Lynch syndrome (LS) clear biological interpretability may have a
Lynch syndrome (LS), also was known as better prognosis, therapeutic response, and
Hereditary non-polyposis colorectal cancer, is potential new treatment strategies (Guinney et
the most common hereditary colon cancer al., 2015; Thanki et al., 2017).
syndrome which is an autosomal dominant
disease and is caused by germline mutations
in one of several DNA mismatch repair MOLECULAR BASIS OF DNA
(MMR) genes, including MSH2 on chromo- MISMATCH REPAIR SYSTEM
some 2p16, MLH1 on chromosome 3p21, DNA mismatch repair system (MMR)
MSH6 on chromosome 2p16, and PSM2 on corrects erroneous insertion, deletion, and
chromosome 7p22 (Lynch et al., 2009). base-base mismatches generated during DNA
MSH2 and MLH1 mutations account for the replication and recombination that have es-
majority of Lynch syndrome cases (Lynch caped the proofreading process (Jiricny,
and Shaw, 2013). MMR genes encode pro- 2006). This repair pathway is highly con-
teins that are critical to the suitable repair of served from bacteria to humans and safe-
DNA sequence mismatch and correct base guards the integrity of the genome (Hsieh and
mismatches or small deletions or insertions Yamane, 2008). MutS and MutL are the main
(Shi and Washington, 2012). Inactivation of proteins involved in prokaryote MMR system

162
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

that function as homodimers whereas, in eu- The presence of MSI is found in the spo-
karyotes, MSH2, MSH3, and MSH6 are hom- radic colon, gastric, sporadic endometrial and
ologs for MutS; MLH1, MLH2, MLH3 are the majority of other cancers (Yamamoto and
MutL homologs. There are also other homo- Imai, 2015). Determination of MSI status in
logs for MutL (post-meiotic segregation) CRC has prognostic and therapeutic implica-
named PMS1 and PMS2 which interact as tions. As well, MSI can be used diagnostically
heterodimers (Fukui, 2010). When a mis- for tumor detection and classification (Setaffy
match is detected in the eukaryotic genome, and Langner, 2015). MSI has always been as-
DNA mismatch repair system functions sociated with an improved prognosis, stage
through a series of steps: MSH2 associates for stage. Recently the reason for this has
with MSH6 or MSH3 causing the formation been discovered, a reason that has changed
of MutSα and MutSβ heterodimers, respec- our approach to advanced MSI-high disease.
tively. MutSα recognizes single base mis- The unstable microsatellites are highly immu-
matches and small insertion/deletion loops nogenic, so that therapy that activates the im-
(IDLs), while MutSβ recognizes larger loops. mune system can have almost miraculous ef-
MutSα or MutSβ can recruit MutLα, MutLβ fects on unstable tumors. This has led to pro-
or MutLγ heterodimers (if MLH1 couples posals to develop tumor vaccines and to turn
with PMS2, PMS1 or MLH3, respectively) by MSS tumors into MSI to make them more im-
means of exchanging adenosine triphosphate munogenic.
(ATP) to adenosine diphosphate (ADP). This
complex (MutS-MutL) creates a sliding
DETECTION OF MSI
clamp around the DNA. The proteins in slid-
ing clamp interact with exonuclease-1 and MSI is detected indirectly by analysis of
proliferating cell nuclear antigen (PCNA). MMR protein expression by Immunohisto-
This complex excises the daughter strand chemical (IHC) staining, or directly by PCR-
back to the site of the mismatch. Finally, re- based amplification of specific microsatellite
synthesize and re-ligation are performed by repeats, which is the most common method to
DNA polymerase and DNA ligase, respec- detect MSI (Buecher et al., 2013).
tively. The correction occurs (Figure 1) (Li,
2008; Martín-López and Fishel, 2013). IHC method
Immunohistochemical analysis can deter-
mine loss of expression of one or more of
MICROSATELLITE INSTABILITY MMR proteins. Actually, IHC is correlates
(MSI) with MSI but it is not a perfect test for MSI
Microsatellites, also known as Short Tan- determination. It is a test of expression of mis-
dem Repeats (STRs) are small (1-6 base match repair proteins in cells. In this method,
pairs) repeating stretches of DNA scattered antibodies against MMR proteins such as
throughout the entire genome (both in coding MLH1, MSH2, PMS2 and MSH6 provide in-
and non-coding regions) and account for ap- formation of the MMR system functionality.
proximately 3 % of the human genome. Due IHC analysis with PMS2 and MSH6 antibod-
to their repeated structure, microsatellites are ies is able to detect most abnormalities in the
prone to high mutation rate (Ellegren, 2004). corresponding encoding genes as well as mu-
Microsatellite instability in tumor DNA is de- tations in MLH1 and MSH2; however, IHC
fined as the presence of alternate sized repet- assay with MLH1/MSH2 antibodies can de-
itive DNA sequences that are not present in tect a fraction of MLH1 or MSH2 abnormali-
the corresponding germline DNA. Microsat- ties but not all of them. Therefore, IHC anal-
ellite instability (MSI) is a molecular pheno- ysis with MSH6 and PMS2 antibodies has
type due to a defective DNA mismatch repair more diagnostic potential than analysis with
system. MLH1 and MSH2 antibodies (Shia, 2008).

163
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

The main relevance of MSI and IHC is as a end labeled (the sense strand or antisense
screening test for Lynch Syndrome. Universal strand of each primer), a sequencer, and ap-
MSI/IHC on tumors is increasingly per- propriate software. The principle of this
formed throughout the world. method is to measure the presence of different
lengths of specific microsatellite markers in
PCR-based method tumor cells comparing to normal cells
For MSI analysis by the fluorescent mul- (Setaffy and Langner, 2015).
tiplex PCR-based method, we need DNA
from tumor tissues and normal tissues, a se-
ries of primers one of which is fluorescently

Figure 1: Mechanism of mismatch repair system: (1) MutSα or MutSβ has recognized the mismatched
DNA base pairs during replication that the DNA polymerase has matched the mistake base G (guano-
sine) in daughter strand with the T (thymidine) on the template. MutSα or MutSβ can recruit MutLα,
MutLβ or MutLγ heterodimers by means of exchanging ATP to ADP. This complex (MutS-MutL) creates
a sliding clamp around the DNA and moves along the new DNA chain when it encounters the DNA
polymerase complex. (2) The proteins in sliding clamp interact with exonuclease-1 (EXO1) and prolifer-
ating cell nuclear antigen (PCNA). This complex excises the daughter strand back to the site of the
mismatch. Finally, re-synthesize and re-ligation are performed by DNA polymerase and DNA ligase,
respectively. The correction occurs (Boland and Goel, 2010).

164
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

In the first attempt to the diagnosis of MSI vitarne and Schnitzler, 2007). The chemother-
in CRC, a consensus conference recom- apeutic treatment is effective in some certain
mended a panel of microsatellite markers in- patients, but it can cause many adverse ef-
cluded three dinucleotide repeats (D5S346, fects, nonetheless (Rothenberg et al., 2001;
D2S123, and D17S250) and 2 mononucleo- Adlard et al., 2002). MSI-H is one of the po-
tide repeats (BAT25 and BAT26). Three dis- tential predictive points to the chemothera-
tinct MSI phenotypes have been described. If peutic treatment efficacy and to the level of
two or more microsatellite markers are mu- adverse effects in a patient; therefore, several
tated, the tumor is considered MSI-high clinical trials have been conducted regarding
(MSI-H); if only one is mutated, the tumor is this opinion (De la Chapelle and Hampel,
defined as MSI-low (MSI-L); and if none of 2010). There are different therapeutic re-
the examined loci demonstrate instability, the sponses in MSI-H CRCs depending on type of
tumor will be considered Microsatellite Sta- adjuvant chemotherapy. When a tumor is to
ble (MSS). This panel was known as the Be- be MSI-high, for diagnosis it is either Lynch
thesda panel (Rodriguez-Bigas et al., 1997). or Methylated. If IHC is done and the unex-
A few years later, it was found that mon- pressed protein is MSH2, PMS2 or MSH6
onucleotide markers have a better specificity then it is Lynch. Germline testing is indicated.
and sensitivity than dinucleotide repeats (di- If the unexpressed protein is MLH1 it could
nucleotide markers have a polymorphic na- be a CIMP tumor with hypermethylation of
ture) (Suraweera et al., 2002) and hence Be- MLH1 promoter, or Lynch. To tell which is
thesda guideline criteria were revised by NCI which, BRAF mutation testing or methylation
(National Cancer Institute) at the following assay on the tumor are helpful. For treatment
conference in 2004 (Umar et al., 2004). After it is a candidate for immune activation ther-
that, the uses of panels containing more mon- apy if it is advanced. If not advanced it has a
onucleotide markers have been increased due good prognosis and will not respond to 5 FU
to their higher sensitivity and specificity in based therapy.
the diagnosis of MSI in CRCs (Table 2)
(Buhard et al., 2004; Xicola et al., 2007; Goel CONCLUSION AND
et al., 2010; You et al., 2010; Agostini et al., CONCLUDING REMARK
2010; Cicek et al., 2011).
Since CRC is one of the most prevalent
cancers in humans and causes a remarkable
MSI IN TREATMENT public health problem worldwide, identifying
The uses of MSI status in the prediction of the ways of diagnosis and treatment of CRC
response to adjuvant chemotherapy is contro- is of most importance. MSI is a significant ge-
versial although it has been confirmed that netic marker in CRC that can be useful in di-
colorectal tumors displaying MSI have a bet- agnosis, prognosis, and prediction of chemo-
ter prognosis compared with MSS tumors. therapeutic treatment efficacy. Nowadays,
Antimetabolites (5-flourouracil), Alkylating molecular techniques have been developed
agents and Topoisomerase Inhibitors are the for detection of MSI and drug development
three categories of chemotherapeutic agents strategies are focused on specific tumor mo-
that are used in CRC treatment (Warusa- lecular characteristics.

165
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

Table 2: Microsatellite markers used to detect of MSI in CRC

Marker Associated MS repeat Chromoso- Primer Sequences Size
Gene mal (bp)
Location
Mononucleotide Markers
BAT25 c-kit 25 (T) intron 16 4q12 F:TCGCCTCCAAGAATGTAAGT 122–
R: TCTGCATTTTAACTATGGCTC 124
BAT26 MSH2 26 (A) intron 5 2p21 F: TGACTACTTTTGACTTCAGCC 116–
R:AACCATTCAACATTTTTAACCC 117
NR27 Inhibitor of 27(A) 5’UTR 11q22 F: AACCATGCTTGCAAACCACT 86–87
apoptosis R: CGATAATACTAGCAATGACC
protein-1
NR21 SLC7A8 21 (T) 5’UTR 14q11 F: TAAATGTATGTCTCCCCTGG 98–99
R: ATTCCTACTCCGCATTCACA

NR22 Transmem- 22 (T)3’UTR 11q24-25 F: GAGGCTTGTCAAGGACATAA 138–

brane R: AATTCGGATGCCATCCAGTT 143
precursor
protein B5
NR-24 Zinc finger 2 24 (T)3’UTR 2q11 F: GCTGAATTTTACCTCCTGAC 132
(ZNF-2) R: ATTGTGCCATTGCATTCCAA
BAT-RII TGFBR2 (A)n 3p24.1 F: AAGCTCCCCTACCATGACT 114
R: TGCACTCATCAGAGCTACAG
Bat40 3b-HSD (A)n 1p13.1 F: AGTCCATTTTATATCCTCAAGC 142-
R: GTAGAGCAAGACCACCTTG 146
CAT25 Caspase-2 25(T)3’UTR 7q34 F: CCTAGAAACCTTTATCCCTGCTT 146-
(CASP2) R: GAGCTTGCAGTGAGCTGAGA 148

Dinucleotide Markers
D18S34 DCC CA (n) 18q12.2- F: CAGAAAATTCTCTCTGGCTA 103
18q12.3 R: CTCATGTTCCTGGCAAGAAT

D2S123 Linked to CA (n) 2p16 F: AAACAGGATGCCTGCCTTTA 197-

MSH2 R: GGACTTTCCACCTATGGGAC 227
D5S346 Linked to CA (n) 5q22-23 F: ACTCACTCTAGTGATAAATCGGG 96
APC R:AGCAGATAAGACAGTATTACTAGTT
D17S250 Mfd15A CA (n) 17q12 F: GGAAGAATCAAATAGACAAT 151
R: GCTGGCCATATATATATTTAAACC

D17S520 --- (CA)n l 7p 1 2 F: GGAGAAAGTGATACAAGGGA 130-

R: TAGTTAGATTAATACCCACC 136
D3S1260 --- (CA)n 3p23-3p21 F: CTACCAGGGAAGCACTGTAG 185
3p24.2-3p22 R: CATGTACCTGAGCACCTACTG

D18S69 --- (CA)13TA(CA)15 18q21 F: CATTAGCAGTCTGGAAATCCTC 193-

(T/GA)7 R: CGCTATTGTACTGAAAACCTGA 210

D10S197 --- (CA)n 10p12 F: ACCACTGCACTTCAGGTGAC 161-

R: GTGATACTGTCCTCAGGTCTCC 173
D18S58 --- (CA)n 18q22.3 F: GCTCCCGGCTGGTTTT 144-
R: GCAGGAAATCGCAGGAACTT 160
D17S261 Mfd41 (CA)n 17p12–p11.1 F: CAGGTTCTGTCATAGGACTA 157–
R: TTCTGGAAACCTACTCCTGA 171

REFERENCES Agostini M, Enzo MV, Morandi L, Bedin C, Pizzini S,

Mason S, et al. A ten markers panel provides a more
Adlard JW, Richman SD, Seymour MT, Quirke P. Pre- accurate and complete microsatellite instability analy-
diction of the response of colorectal cancer to systemic sis in mismatch repairdeficient colorectal tumors. Can-
therapy. Lancet Oncol. 2002;8:75-82. cer Biomark. 2010;6:49–61.

Arvelo F, Sojo F, Cotte C. Biology of colorectal can-

cer. Ecancermedicalscience. 2015;9:520.

166
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

Bogaert J, Prenen H. Molecular genetics of colorectal Gala MK, Mizukami Y, Le LP, Moriichi K, Austin T,
cancer. Ann Gastroenterol. 2014;27:9–14. Yamamoto M, et al. Germline mutations in oncogene-
induced senescence pathways are associated with mul-
Boland CR, Goel A. Microsatellite instability in colo- tiple sessile serrated adenomas. Gastroenterology.
rectal cancer. Gastroenterology. 2010;138:2073–87. 2014;146:520–9.
Boland CR, Shike M. Report from the Jerusalem work- Giardiello FM, Trimbath JD. Peutz-Jeghers syndrome
shop on Lynch syndrome-hereditary nonpolyposis col- and management recommendations. Clin Gastroen-
orectal cancer. Gastroenterology. 2010;138:2197,e1– terol Hepatol. 2006;4:408–15.
7.
Goel A, Nagasaka T, Hamelin R, Boland CR. An opti-
Buecher B, Cacheux W, Rouleau E, Dieumegard B, mized pentaplex PCR for detecting DNA mismatch re-
Mitry E, Lièvre A. Role of microsatellite instability in pair-deficient colorectal cancers. PLoS One. 2010;
the management of colorectal cancers. Dig Liver Dis. 5(2):e9393.
2013;45:441–9.
Goodenberger M, Lindor NM. Lynch syndrome and
Buhard O, Suraweera N, Lectard A, Duval A, Hamelin MYH-associated polyposis: review and testing strat-
R. Quasimonomorphic mononucleotide repeats for egy. J Clin Gastroenterol. 2011;45:488–500.
high-level microsatellite instability analysis. Dis Mark-
ers. 2004;20:251–7. Guarinos C, Sánchez-Fortún C, Rodríguez-Soler M,
Alenda C, Payá A, Jover R. Serrated polyposis syn-
Cancer Genome Atlas Network. Comprehensive mo- drome: molecular, pathological and clinical aspects.
lecular characterization of human colon and rectal can- World J Gastroenterol. 2012;18:2452–61.
cer. Nature. 2012;487:330-7.
Guinney J, Dientsmann R, Wang X, de Reyniès A,
Castillejo A, Vargas G, Castillejo MI, Navarro M, Bar- Schliker A, Soneson C, et al. The consensus molecular
berá VM, González S, et al. Prevalence of germline subtypes of colorectal cancer. Nat Med. 2015;21:
MUTYH mutations among Lynch-like syndrome pa- 1350–6.
tients. Eur J Cancer. 2014;50:2241–50.
Hampel H, Frankel WL, Martin E, Arnold M,
Chae HD, Jeon CH. Peutz-Jeghers syndrome with Khanduja K, Kuebler P, et al. Screening for the Lynch
germline mutation of STK11. Ann Surg Treat Res. syndrome (hereditary nonpolyposis colorectal cancer).
2014;86:325–30. N Engl J Med. 2005;352:1851–60.

Cicek MS, Lindor NM, Gallinger S, Bapat B, Hopper Hsieh P, Yamane K. DNA mismatch repair: molecular
JL, Jenkins MA, et al. Quality assessment and correla- mechanism, cancer, and ageing. Mech Ageing Dev.
tion of microsatellite instability and immunohisto- 2008;129:391-407.
chemical markers among population- and clinic-based
colorectal tumors results from the Colon Cancer Fam- Jasperson KW, Tuohy TM, Neklason DW, Burt RW.
ily Registry. J Mol Diagn. 2011;13:271-81. Hereditary and familial colon cancer. Gastroenterol-
ogy. 2010;138:2044–58.
Copija A, Waniczek D, Witkoś A, Walkiewicz K,
Nowakowska-Zajdel E. Clinical significance and prog- Jemal A, Bray F, Center MM, Ferlay J, Ward E, For-
nostic relevance of microsatellite instability in sporadic man D. Global cancer statistics. CA Cancer J Clin.
colorectal cancer patients. Int J Mol Sci. 2017;18:107. 2011;61:69-90.

De la Chapelle A, Hampel H. Clinical relevance of mi- Jiricny J. The multifaceted mismatch-repair system.
crosatellite instability in colorectal cancer. J Clin On- Nat Rev Mol Cell Biol. 2006;7:335–46.
col. 2010;28:3380–7.
Laurent S, Franchimont D, Coppens JP, Leunen K,
Ellegren H. Microsatellites: simple sequences with Macken L, Peeters M, et al. Familial adenomatous pol-
complex evolution. Nat Rev Genet. 2004;5:435–45. yposis: clinical presentation, detection and surveil-
lance. Acta Gastroenterol Belg. 2011;74:415–20.
Fearon ER, Vogelstein B. A genetic model for colorec-
tal tumorigenesis. Cell. 1990;61:759–67. Li G-M. Mechanisms and functions of DNA mismatch
repair. Cell Res. 2008;18:85-98.
Fukui K. DNA mismatch repair in eukaryotes and bac-
teria. J Nucleic Acids. 2010;2010:260512. Lin OS. Colorectal cancer screening in patients at mod-
erately increased risk due to family history. World J
Gastrointest Oncol. 2012;4:125–30.

167
 EXCLI Journal 2018;17:159-168 – ISSN 1611-2156
Received: November 04, 2017, accepted: January 13, 2018, published: January 22, 2018

Lynch HT, Shaw TG. Practical genetics of colorectal Siegel R, Naishadham D, Jemal A. Cancer statistics.
cancer. Chin Clin Oncol. 2013;2:12. CA Cancer J Clin. 2012;62:10-29.

Lynch HT, Lynch PM, Lanspa SJ, Snyder CL, Lynch Suraweera N, Duval A, Reperant M, Vaury C, Furlan
JF, Boland CR. Review of the Lynch syndrome: his- D, Leroy K, et al. Evaluation of tumor microsatellite
tory, molecular genetics, screening, differential diag- instability using five quasimonomorphic mononucleo-
nosis, and medicolegal ramifications. Clin Genet. tide repeats and pentaplex PCR. Gastroenterology.
2009;76:1–18. 2002;123:1804–11.

Martín-López J V, Fishel R. The mechanism of mis- Sweetser S, Smyrk TC, Sinicrope FA. Serrated colon
match repair and the functional analysis of mismatch polyps as precursors to colorectal cancer. Clin Gastro-
repair defects in Lynch syndrome. Fam Cancer. enterol Hepatol. 2013;11:760–7.
2013;12:159–68.
Thanki K, Nicholls ME, Gajjar A, Senagore AJ, Qiu S,
Migliore L, Migheli F, Spisni R, Coppedè F. Genetics, Szabo C, et al. Consensus molecular subtypes of colo-
cytogenetics, and epigenetics of colorectal cancer. J Bi- rectal cancer and their clinical implications. Int Biol
omed Biotechnol. 2011;2011:792362. Biomed J. 2017;3:105-11.

Nielsen M, Morreau H, Vasen HF, Hes FJ. MUTYH- Theodoratou E, Campbell H, Tenesa A, Houlston R,
associated polyposis (MAP). Crit Rev Oncol Hematol. Webb E, Lubbe S, et al. A large-scale metaanalysis to
2011;79:1–16. refine colorectal cancer risk estimates associated with
MUTYH variants. Br J Cancer. 2010;103:1875-84.
Rex DK, Ahnen DJ, Baron JA, Batts KP, Burke CA,
Burt RW, et al. Serrated lesions of the colorectum: re- Umar A, Boland CR, Terdiman JP, Syngal S, de la
view and recommendations from an expert panel. Am Chapelle A, Ruschoff J, et al. Revised Bethesda Guide-
J Gastroenterol. 2012;107:1315-29. lines for hereditary nonpolyposis colorectal cancer
(Lynch syndrome) and microsatellite instability. J Natl
Rodriguez-Bigas MA, Boland CR, Hamilton SR, Hen- Cancer Inst. 2004;96:261–8.
son DE, Jass JR, Khan PM, et al. A National Cancer
Institute Workshop on Hereditary Nonpolyposis Colo- Vilar E, Gruber SB. Microsatellite instability in colo-
rectal Cancer Syndrome: meeting highlights and Be- rectal cancer- the stable evidence. Nat Rev Clin Oncol.
thesda Guidelines. J Natl Cancer Inst. 1997;89:1758– 2010;7:153-62.
62.
Warusavitarne J, Schnitzler M. The role of chemother-
Rothenberg ML, Meropol NJ, Poplin EA, Van Cutsem apy in microsatellite unstable (MSI-H) colorectal can-
E, Wadler S. Mortality associated with Irinotecan plus cer. Int J Colorectal Dis. 2007;22:739-48.
bolus Flourouracil/Leucovorin. Summary findings of
an independent panel. J Clin Oncol. 2001;19:3801-7. Worthley DL, Leggett BA. Colorectal cancer: molecu-
lar features and clinical opportunities. Clin Biochem
Sameer AS. Colorectal cancer: Molecular mutations Rev. 2010;31:31-8.
and polymorphisms. Front Oncol. 2013;3:114.
Xicola RM, Llor X, Pons E, Castells A, Alenda C, Pi-
Setaffy L, Langner C. Microsatellite instability in col- nol V, et al. Performance of different microsatellite
orectal cancer: clinicopathological significance. Pol J marker panels for detection of mismatch repairdefi-
Pathol. 2015;66:203-18. cient colorectal tumors. J Natl Cancer Inst. 2007;99:
244–52.
Shah NB, Lindor NM. Lower gastrointestinal tract can-
cer predisposition syndromes. Hematol Oncol Clin N Yamamoto H, Imai K. Microsatellite instability: An
Am. 2010;24:1229–52. update. Arch Toxicol. 2015;89:899–921.

Shi C, Washington K. Molecular testing in colorectal You JF, Buhard O, Ligtenberg MJ, Kets CM, Niessen
cancer: diagnosis of Lynch syndrome and personalized RC, Hofstra RM, et al. Tumours with loss of MSH6
cancer medicine. Am J Clin Pathol. 2012;137:847–59. expression are MSI-H when screened with a pentaplex
of five mononucleotide repeats. Br J Cancer. 2010;103:
Shia J. Immunohistochemistry versus microsatellite in- 1840–5.
stability testing for screening colorectal cancer patients
at risk for hereditary nonpolyposis colorectal cancer Zeichner SB, Raj N, Cusnir M, Francavilla M, Hirzel
syndrome. Part I. The utility of immunohistochemistry. A. A de novo germline APC mutation (3927del5) in a
J Mol Diagn. 2008;10:293–300. patient with familial adenomatous polyposis: case re-
port and literature review. Clin Med Insights Oncol.
2012;6:315-23.

168