1 Lysosome activity is modulated by multiple longevity pathways and is important for

2 lifespan extension in C. elegans

3
1, 2, 3 4 3 3 4 3, 5, *
Yanan Sun , Meijiao Li , Dongfeng Zhao , Xin Li , Chonglin Yang , Xiaochen Wang

4
1
College of Life science, Beijing Normal University, Beijing, 100875, China

5
2
National Institute of Biological Sciences, No. 7 Science Park Road, Zhongguancun Life Science

6 Park, Beijing, 102206, China

7
3
National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules,

8 Institute of Biophysics, Chinese Academy of Sciences, Beijing, 100101, China

9
4
State Key Laboratory of Conservation and Utilization of Bio-Resources in Yunnan, and Center

10 for Life Sciences, School of Life Sciences, Yunnan University, Kunming, 650091, China

11
5
College of Life Sciences, University of Chinese Academy of Sciences, Beijing, 100049, China

12 *
Correspondence: wangxiaochen@ibp.ac.cn

13 Tel: 86-10-64888878

14

15

16

17

18

19

20

21

22

1
23 Abstract

24 Lysosomes play important roles in cellular degradation to maintain cell homeostasis. In order

25 to understand whether and how lysosomes alter with age and contribute to lifespan regulation,

26 we characterized multiple properties of lysosomes during the aging process in C. elegans. We

27 uncovered age-dependent alterations in lysosomal morphology, motility, acidity and

28 degradation activity, all of which indicate a decline in lysosome function with age. The

29 age-associated lysosomal changes are suppressed in the long-lived mutants daf-2, eat-2 and

30 isp-1, which extend lifespan by inhibiting insulin/IGF-1 signaling, reducing food intake and

31 impairing mitochondrial function, respectively. We found that 43 lysosome genes exhibit

32 reduced expression with age, including genes encoding subunits of the proton pump

33 V-ATPase and cathepsin proteases. The expression of lysosome genes is upregulated in the

34 long-lived mutants, and this upregulation requires the functions of DAF-16/FOXO and

35 SKN-1/NRF2 transcription factors. Impairing lysosome function affects clearance of

36 aggregate-prone proteins and disrupts lifespan extension in daf-2, eat-2 and isp-1 worms. Our

37 data indicate that lysosome function is modulated by multiple longevity pathways and is

38 important for lifespan extension.

39

40 Key words:

41 Lysosome, aging, insulin/IGF-1 signaling, longevity pathways, DAF-16/FOXO,

42 SKN-1/NRF2, C. elegans

43

44

2
45

46 Introduction

47 Lysosomes are dynamic organelles responsible for macromolecule degradation and catabolite

48 recycling. Lysosomes also serve as a signaling hub to integrate nutritional, energy and growth

49 factor information and coordinate cellular responses through key regulatory modules docked

50 on the lysosomal surface (Lawrence and Zoncu, 2019). By acting as centers of degradation,

51 recycling and signaling, lysosomes play crucial roles in a variety of fundamental processes to

52 maintain cell and tissue homeostasis. Lysosomal dysfunction is associated with a number of

53 age-related pathologies, which suggests the importance of lysosome function in the aging

54 process (Carmona-Gutierrez et al., 2016).

55

56 Aging is considered as a process of gradual deterioration of physiological functions that leads

57 to decreased survival and increased risk of death (Lopez-Otin et al., 2013). One of the most

58 universal hallmarks of aging is the decline in protein homeostasis (Lopez-Otin et al., 2013).

59 Studies in a variety of organisms have uncovered age-dependent accumulation of misfolded

60 and damaged proteins, which may impair cell function and homeostasis, leading to the

61 development of age-related diseases (Cuervo and Dice, 2000, Terman and Brunk, 2004,

62 Martinez-Vicente et al., 2005). Misfolded, aggregated and damaged proteins can be removed

63 by the proteasome or cleared through the autophagy-lysosome pathway. As the key organelle

64 for cellular degradation, lysosomes exhibit age-related changes such as increased size,

65 number and content; increases and decreases in lysosomal hydrolase activity have also been

66 reported (Truschel et al., 2018, Sarkis et al., 1988, Cuervo and Dice, 1998, Hayflick, 1980,

3
67 Bolanowski et al., 1983, Yoon et al., 2010, Cuervo, 2010). Moreover, vacuolar acidity reduces

68 during replicative aging in budding yeast, and lysosomal pH appears to increase with age in

69 the C. elegans intestine (Hughes and Gottschling, 2012, Baxi et al., 2017). In addition, there

70 is evidence for increased lysosomal gene expression with age, which is considered as a

71 compensatory response to altered protein homeostasis (de Magalhaes et al., 2009, Cellerino

72 and Ori, 2017). Therefore, the causal connection between age-associated lysosomal changes

73 and accumulation of abnormal proteins remains unclear.

74

75 Like many other biological processes, the aging process is subjected to regulation. Intrinsic

76 and extrinsic longevity regulatory pathways have been identified that play evolutionarily

77 conserved roles. One such pathway is the insulin/IGF-1 signaling (IIS) pathway, which

78 controls aging in C. elegans, insects and mammals, and extends the lifespan of these

79 organisms when attenuated (Anisimov and Bartke, 2013). In worms, reducing IIS, such as

80 through mutation in the daf-2 gene, which encodes the sole C. elegans insulin/IGF-1 receptor,

81 leads to significantly increased adult longevity (Kenyon et al., 1993). The extension of

82 longevity by reduced IIS involves a phosphorylation cascade that ultimately results in nuclear

83 translocation of the DAF-16/Forkhead box (FOXO) and the SKN-1/Nuclear

84 factor-erythroid-related factor 2 (NRF2) transcription factors and subsequent transcriptional

85 regulation of their target genes (Murphy and Hu, 2013, Tullet et al., 2008). DAF-16 and

86 SKN-1 have both distinct and overlapping functions in lifespan extension under the condition

87 of reduced IIS (Tullet et al., 2008, Ewald et al., 2015). The heat-shock transcription factor

88 HSF-1 also acts downstream of the IIS pathway. HSF-1 may collaborate with DAF-16 to

4
89 regulate the expression of chaperone genes, thus contributing to the longevity of daf-2

90 mutants (Hsu et al., 2003). In addition to down-regulation of the IIS pathway, increased

91 longevity can be achieved by reducing food intake or impairing mitochondrial function. Both

92 caloric restriction and mild inhibition of mitochondrial respiration extend the lifespan of

93 many organisms (Kenyon, 2010). In worms, the feeding-defective eat-2 mutation

94 significantly lengthens the lifespan, and this requires the function of PHA-4/FOXA and

95 SKN-1/NRF2 transcription factors (Lakowski and Hekimi, 1998, Panowski et al., 2007, Park

96 et al., 2010). Reducing mitochondrial function may produce a low dose of stressors such as

97 reactive oxygen species (ROS), which elicit protective adaptive responses and induce

98 pro-longevity effects through DAF-16, SKN-1 and the hypoxia-inducible factor HIF-1

99 (Ventura, 2017, Senchuk et al., 2018, Schmeisser et al., 2013, Lee et al., 2010, Yang and

100 Hekimi, 2010). The different longevity regulatory pathways are not completely independent

101 but may utilize overlapping mechanisms as they share downstream transcription factors.

102

103 Consistent with the evidence that declining protein homeostasis serves as an aging marker,

104 long-lived worms can preserve their proteome with age. Several hundred proteins with

105 diverse functions have been identified that become more insoluble with age in wild-type C.

106 elegans (David et al., 2010). The increased protein insolubility and aggregation, however, is

107 significantly delayed or even halted in long-lived daf-2 worms (David et al., 2010). The

108 mechanisms by which daf-2 mutants maintain protein homeostasis are not fully understood.

109 In daf-2 animals, there is increased autophagy activity, which is important for lifespan

110 extension in these mutants (Melendez et al., 2003, Guo et al., 2014, Lapierre et al., 2013).

5
111 Lysosome function is essential for clearance of autophagic substrates. Constitutive autophagy

112 activity leads to more severe defects when lysosome function is compromised (Sun et al.,

113 2011). Overexpression of XBP-1s, the activated form of the UPRER transcription factor, is

114 found to increase lysosome activity to promote clearance of toxic proteins and extend C.

115 elegans lifespan (Imanikia et al., 2019). However, it is unclear whether and how lysosome

116 activity is modulated by longevity-promoting pathways, or how lysosomes contribute to

117 protein homeostasis and lifespan extension.

118 In this study, we employed cell biology assays to examine lysosomal changes with age in C.

119 elegans. We found that various lysosomal properties are altered, which indicates that

120 lysosome activity declines with age. The age-associated lysosomal changes are suppressed in

121 multiple different long-lived mutant worms, which exhibit increased expression of lysosome

122 genes. Our data suggest that lysosome activity is modulated by longevity pathways and is

123 essential for lifespan extension.

124

125 Results

126 Lysosomes undergo age-associated alternations in C. elegans

127 We examined lysosome morphology using the NUC-1::CHERRY reporter in C. elegans

128 adults at different ages. Lysosomes appeared mainly as small puncta at day 1 of adulthood in

129 hypodermis, while short tubules were observed at day 3 (Figure 1A, B). The tubular

130 lysosomal structures were increased in both length and abundance at day 5, leading to

131 formation of an extensive tubular network at day 9 (Figure 1C, D, I). The tubular lysosomal

132 network was still observed in the hypodermis at day 15 of adulthood, indicating that it

6
133 persisted during aging (Figure1-figure supplement 1A). In aged adults, the number of

134 vesicular lysosomes reduced gradually but the mean volume of each lysosome increased,

135 while the total volume of lysosomes also increased significantly (Figure 1J-L). Similar

136 changes in lysosome morphology, number and volume were also observed in body wall

137 muscle cells and intestinal cells with age even though tubular lysosomal structures were less

138 abundant in these two tissues compared to hypodermis (Figure 1-figure supplement 1C-H).

139 We next examined whether other lysosomal properties, including dynamics, acidification and

140 degradation activity, are altered in worms with increased age. To examine lysosome dynamics,

141 we measured Pearson’s correlation coefficient to compare the colocalization of lysosomes in

142 two time-lapse image frames taken 60 seconds apart. We found a higher level of

143 colocalization in adult hypodermis, resulting in a higher Pearson’s correlation coefficient than

144 in larvae (Figure 1M, N). This suggests that lysosomes are less dynamic in adults. Consistent

145 with this, the velocity of lysosomes was higher in larvae than in adults (Figure 1O). The

146 Pearson’s correlation coefficient did not change obviously in adults from day 1 to day 9, but

147 the velocity of lysosomes was significantly reduced at days 5 and 9, which suggests that

148 lysosome motility declines with age (Figure 1N, O). We examined lysosome acidity by

149 co-staining with LysoTracker Red (LTR) and LysoSensor Green DND-189 (LSG, pKa 5.2)

150 (Baxi et al., 2017). LTR is less sensitive to increased acidity than LSG and is used as a control

151 for normalizing the dye intake (Duvvuri et al., 2004). The fluorescence intensity ratio of LSG

152 vs LTR (LSG/LTR) is quantified to indicate lysosome acidity. We found that the LSG/LTR

153 ratio in the intestine was reduced in adults at days 3, 5 and 9 compared to day 1, which

154 suggests that lysosome acidity declines in aging adults (Figure 2A-D’’, I). The tubular

7
155 lysosomal structures enriched in the hypodermis of aged adults were weakly stained by

156 LysoTracker Red but were not labeled by LysoSensor Green, which suggests that lysosomal

157 tubules may be less acidic than the vesicular ones (Figure 2-figure supplement 1A-D).

158 Cathepsin L (CPL-1) is synthesized as an inactive pro-enzyme, which is converted to the

159 active mature form in lysosomes through proteolytic removal of the pro-domain (Stoka et al.,

160 2016). The processing of endogenous CPL-1 can be examined by Western blot and quantified

161 to indicate the degradation activity of lysosomes. We found that CPL-1 processing reduced

162 significantly in adults at days 5 and 9 compared to day 1, and pro-CPL-1 accumulated with

163 age (Figure 2N, O). These results suggest that lysosomal degradation activity decreases with

164 age. Altogether, these data suggest that lysosomes undergo a series of age-associated changes

165 including reduced vesicular but increased tubular morphology, increased mean and total

166 volume, and decreased acidity, motility and degradation activity.

167

168 Lysosome morphology and activity are well maintained in daf-2 mutants with age

169 We investigated whether these age-associated lysosomal changes are altered by longevity

170 regulatory factors. Insulin/IGF-1 signaling (IIS) is an evolutionarily conserved aging

171 regulatory pathway. Mutations in the insulin/IGF-1 receptor DAF-2 double the lifespan of

172 wild type (Kenyon et al., 1993). We found that lysosomes in the daf-2(e1370ts) mutant, which

173 has reduced function of DAF-2, appeared as small puncta and short tubules, and they were not

174 obviously changed with age in hypodermis (Figure 1E-H and Figure 1-figure supplement 1B).

175 daf-2(e1370ts) worms contained significantly more vesicular lysosomes than wild type, and

176 these vesicular lysosomes were smaller in size (Figure 1J, K). The tubular lysosomes were

8
177 shorter in length and they did not form a tubular network in aged daf-2 adults (Figure 1I). The

178 mean and total volume of lysosomes exhibited an age-dependent increase in wild type but

179 remained unchanged in daf-2 adults from day 1 to day 9 (Figure 1K, L). Increased number

180 and reduced mean volume of vesicular lysosomes were also observed in body wall muscle

181 cells of daf-2 mutants at different ages (Figure 1-figure supplement 1C, E, F). In the intestine

182 of daf-2 mutants, the number and mean volume of vesicular lysosomes was similar to that in

183 wild type (Figure 1-figure supplement 1D, G, H).

184 We found that lysosomes in daf-2 adults at different ages were more dynamic than in wild

185 type. The Pearson’s correlation coefficient was lower, and the velocity of lysosomes was

186 higher in daf-2 adults (Figure 1M-O). The lysosome velocity in daf-2 adults was similar to

187 that in wild-type larvae. The fluorescence intensity ratio of LSG/LTR at days 5 and 9 in daf-2

188 was higher than in wild type, and it was similar to the LSG/LTR ratio in wild type at day 1

189 (Figure 2E-I). This suggests that lysosomal acidity is maintained in daf-2 worms with age. To

190 further examine this, we fused the pH-sensitive fluorescent protein pHTomato with NUC-1,

191 and transiently expressed NUC-1::pHTomato using the heat-shock promoter. At 24 h post

192 heat-shock treatment, NUC-1::pHTomato overlapped well with the lysosomal membrane

193 protein SCAV-3, indicating delivery of the fusion protein to lysosomes (Figure 2-figure

194 supplement 1E-G’’). pHTomato has a pKa close to 7.8 and thus exhibits increased

195 fluorescence when the pH is increased (Li and Tsien, 2012). The average fluorescence

196 intensity of NUC-1::pHTomato in each lysosome was quantified in the hypodermis. Loss of

197 the lysosomal Ca2+ channel CUP-5 affects lysosome activity and acidity and causes increased

198 pHTomato intensity in lysosomes (Figure 2J, L, M) (Hersh et al., 2002, Treusch et al., 2004,

9
199 Sun et al., 2011, Miao et al., 2020). We found that NUC-1::pHTomato intensity was

200 significantly lower in daf-2(e1370ts) mutants than in wild type (Figure 2J, K, M). By contrast,

201 the average intensity of NUC-1::CHERRY, which is insensitive to pH, was unchanged in

202 daf-2 or cup-5 lysosomes compared with wild type (Figure 2-figure supplement 1H-K).

203 Collectively, these data suggest that lysosome acidity increases in daf-2 worms. We next

204 examined CPL-1 processing and found that significantly more mature CPL-1 was produced in

205 daf-2 worms than in wild type at different ages, which suggests that the degradation activity

206 of lysosomes is increased in daf-2 (Figure 2N, O). To corroborate this, we examined

207 lysosomal degradation activity using the NUC-1::CHERRY fusion protein. When delivered to

208 lysosomes, CHERRY is cleaved from the fusion protein by cathepsins, and the extent of

209 cleavage can be visualized by Western blot and quantified to indicate the degradation activity

210 of lysosomes (Miao et al., 2020). Consistent with the CPL-1 processing assay, we found

211 significantly increased CHERRY cleavage in daf-2 worms compared to wild type (Figure

212 1-figure supplement 1I, J).

213

214 The above results suggest that the properties of lysosomes – including morphology, dynamics,

215 acidity and degradation activity – are well maintained in daf-2 mutants, but not in wild type,

216 with age. To further test this, we examined lysosomes by high voltage electron microscopy

217 (HVEM). At day 1 of adulthood, 40% of wild-type lysosomes in hypodermis appeared as

218 membrane-enclosed, dense and spherical vesicles (Figure 3A, B, K). In addition, around 50%

219 of wild-type lysosomes contained both electron-dense and -lucent contents, with half of them

220 extending electron-lucent tubules (Figure 3D, E, K). In addition to the above two main classes,

10
221 a few lysosomal tubules with either dense (1.4%) or lucent (7.1%) contents were observed

222 (Figure 3C, F, K). We found that the ultrastructure of lysosomes changed dramatically in wild

223 type at day 5. The proportion of dense vesicular lysosomes reduced sharply from 40% to 3.7%

224 (Figure 3K). Lysosomes with both dense and lucent contents decreased markedly, and they

225 did not extend tubules (Figure 3K). Instead, the majority of hypodermal lysosomes at day 5

226 (81.4%) were lucent tubules that formed a tubular network, which is in good agreement with

227 the observations by fluorescence microscopy (Figure 1A, C, 3G, K). In daf-2(e1370ts)

228 mutants, most lysosomes at day 1 (70.8%) appeared as dense spherical vesicles that were

229 significantly smaller than in wild type (Figure 3H, L, M). In addition, vesicular lysosomes

230 with both dense and lucent contents were observed (Figure 3J, L). Importantly, the

231 ultrastructure of lysosomes did not change obviously in daf-2 worms at day 5, except for a

232 slightly higher percentage of dense tubules (1.4% vs 7.1%) and a lower percentage of the

233 dense-lucent vesicles (27.8% vs 17.1%; Figure 3L). These HVEM data are consistent with the

234 observations by fluorescence microscopy and together they indicate that lysosomal

235 morphology and properties are well maintained in daf-2 mutants with age.

236

237 Lysosome activity is increased in eat-2 and isp-1 mutants

238 Our data suggest that reducing IIS suppresses age-associated changes in lysosomal shape, size,

239 dynamics, acidity and degradation activity. We next examined whether lysosome patterns and

240 activity are altered in two other long-lived mutants, eat-2 and isp-1, which extend lifespan

241 through restricted caloric intake and impaired mitochondrial respiration, respectively

242 (Lakowski and Hekimi, 1998, Feng et al., 2001). We found that lysosome patterns in

11
243 isp-1(qm150) and eat-2(ad1116) mutants at different ages resembled those in daf-2(e1370ts),

244 except that tubular lysosomal structures were more abundant in eat-2(ad1116) than in daf-2

245 and isp-1 worms (Figure 4A-L). Like in daf-2 worms, the number of vesicular lysosomes

246 increased, and the mean volume decreased in eat-2 and isp-1 mutants; tubular lysosomes at

247 days 5 and 9 were shorter in length and did not form tubular networks (Figure 4M-O). The

248 velocity of lysosomes was significantly higher in eat-2 worms than in wild type at different

249 ages, while isp-1 lysosomes had a higher motility than wild type at day 1 and day 9 (Figure

250 4-figure supplement 1A). By examining the fluorescence intensity ratio of LSG/LTR, we

251 found that lysosome acidity was significantly higher in eat-2(ad1116) worms than in wild

252 type at all adult ages tested, while increased lysosome acidity was seen in isp-1(qm150)

253 mutants at days 3 and 5 but not day 9 (Figure 4-figure supplement 1B-J). In agreement with

254 this, the average intensity of NUC-1::pHTomato was significantly lower in eat-2 and isp-1

255 than in wild type, which suggests that lysosome acidity was increased (Figure 4P-S). We

256 found that more mature CPL-1 was produced in eat-2(ad1116) and isp-1(qm150) mutants than

257 in wild type at different ages except for isp-1 at day 9, where the percentage of mature CPL-1

258 was similar to wild type (Figure 4T-W). Collectively, these data suggest that like the IIS

259 mutant daf-2, lysosome morphology, motility, acidity and degradation activity are well

260 maintained with age in eat-2 mutants, whereas the appearance of age-related lysosomal

261 changes is delayed in isp-1(qm150) worms.

262

263 Expression of lysosome-related genes increases in long-lived worms in a DAF-16- and

264 SKN-1-dependent manner

12
265 To investigate how lysosome activity is maintained in long-lived worms, we examined the

266 expression of 85 lysosome-related genes by quantitative PCR (qRT-PCR). These genes

267 encode lysosomal membrane proteins, hydrolases and components of the proton pump

268 V-ATPase (Figure 5A and Supplementary file 1). We found that expression of 43 lysosomal

269 genes was significantly reduced at day 5 compared to day 1. They included 15 vha genes

270 encoding subunits of the V-ATPase and 17 cathepsin genes encoding lysosomal proteases,

271 which is consistent with reduced lysosomal acidity and degradation activity with age (Figure

272 5A-C and Supplementary file 1, 2). In addition, 13 lysosomal genes exhibited increased

273 expression with age and the expression of 29 lysosomal genes was unaltered at day 5

274 compared to day 1 (Figure 5A and Supplementary file 3, 4).

275 Among the 43 lysosome genes whose expression declined with age, 20 exhibited significantly

276 increased expression in daf-2 mutants compared to wild type at adult day 1 (Figure 5D and

277 Supplementary file 5). These 20 genes mainly encode lysosomal hydrolases, including 8

278 cathepsin proteases and 6 hydrolases that digest carbohydrates and lipids (Figure 5D and

279 Supplementary file 5). In isp-1(qm150) mutants, 10 out of the 43 lysosomal genes were

280 upregulated (Figure 5E and Supplementary file 5). Nine of the upregulated genes encode

281 hydrolases and expression of all of them, except for cpr-8, is increased in daf-2 mutants

282 (Figure 5D, E, Figure 6-figure supplement 1A and Supplementary file 5). In eat-2(ad1116)

283 mutants, 14 out of the 43 lysosome genes were upregulated and 8 of them encode V-ATPase

284 subunits (Figure 5F and Supplementary file 5). By contrast, the expression of very few vha

285 genes was increased in daf-2 and isp-1 mutants (Figure 5D, E and Figure 6-figure supplement

286 1A).

13
287

288 We next examined transcription factors that act downstream of the three longevity pathways.

289 The transcription factors DAF-16/FOXO, SKN-1/NRF2 and HSF-1 all respond to reduced IIS.

290 We found that loss of daf-16 and skn-1 led to reduced expression of 13 and 8 lysosomal genes,

291 respectively, in daf-2 worms (Figure 6A, B). We examined the 6 lysosomal genes whose

292 expression was reduced by both daf-16 and skn-1 mutations (Figure 6-figure supplement 1B).

293 Expression of these lysosomal genes did not further reduce in daf-16;daf-2;skn-1 triple

294 mutants, which suggests that DAF-16 and SKN-1 act in the same genetic pathway to regulate

295 their expression (Figure 6-figure supplement 1B). Consistent with this, loss of daf-16 or skn-1

296 led to increased pHTomato intensity, reduced fluorescence intensity ratio of LSG/LTR and

297 reduced CHERRY cleavage in daf-2 mutants, which indicates that DAF-16 and SKN-1

298 function is important for elevation of lysosome acidity and degradation activity in daf-2

299 mutants (Figure 6C-G, I, K-N and Figure 6-figure supplement 1C-H’’). The pHTomato

300 intensity, LSG/LTR fluorescence intensity ratio and CHERRY cleavage were not further

301 altered in daf-16;daf-2;skn-1 triple mutants, consistent with co-regulation of lysosomal gene

302 expression by DAF-16 and SKN-1 when IIS is impaired (Figure 6H-N and Figure 6-figure

303 supplement 1I-J’’). HLH-30 is the putative C. elegans homolog of human TFEB, a master

304 transcription factor for autophagy and lysosome biogenesis (O'Rourke and Ruvkun, 2013,

305 Settembre et al., 2011). It was reported recently that both HLH-30 and DAF-16 are required

306 for the longevity of daf-2 mutants and they act as combinatorial transcription factors to fulfill

307 this function (Lin et al., 2018). We found that loss of hlh-30 caused reduced expression of 6

308 hydrolase genes in daf-2 mutants, and 5 of them were also targeted by DAF-16 (Figure

14
309 6-figure supplement 1K, L). However, unlike daf-16(lf), loss of hlh-30 did not affect

310 NUC-1::CHERRY cleavage in daf-2 worms, which suggests that lysosome degradation

311 activity may be unaltered (Figure 6-figure supplement 1M). The CHERRY cleavage in

312 daf-16;daf-2;hlh-30 was higher than in daf-16;daf-2, suggesting that loss of hlh-30 may have

313 a beneficial effect on lysosomal degradation in daf-16;daf-2 (Figure 6-figure supplement 1M).

314 Loss of hsf-1 had no effect on lysosomal gene expression or NUC-1::CHERRY cleavage in

315 daf-2 worms, which suggests that HSF-1 is dispensable for lysosome regulation in daf-2

316 mutants (Figure 6-figure supplement 1N, O).

317

318 In addition to responding to insulin signaling, DAF-16 also acts downstream of the

319 mitochondrial pathway, while skn-1 RNAi reduces the lifespan of eat-2 (Senchuk et al., 2018,

320 Park et al., 2010). We found that loss of daf-16 and skn-1 also affected lysosome gene

321 expression in eat-2 and isp-1 mutants (Figure 7A, B, 8A, B). Loss of either daf-16 or skn-1

322 caused reduced expression of vha-12 and vha-15 in eat-2 mutants, which was further

323 decreased in daf-16;eat-2;skn-1 triple mutants (Figure 7-figure supplement 1A). These results

324 indicate that DAF-16 and SKN-1 have additive effects on the expression of vha-12 and

325 vha-15. Consistent with this, the NUC-1::pHTomato intensity in lysosomes was higher and

326 the LSG/LTR fluorescence intensity ratio was lower in daf-16;eat-2 and eat-2;skn-1 than in

327 eat-2, and these parameters were further altered in daf-16;eat-2;skn-1 (Figure 7C-L). In

328 addition, cleavage of CHERRY from NUC-1::CHERRY was reduced in daf-16;eat-2 and

329 eat-2;skn-1 compared to eat-2 single mutants, which suggests that lysosomal degradation

330 activity is also affected (Figure 7-figure supplement 1C, D). However, CHERRY cleavage

15
331 was not further decreased in daf-16;eat-2;skn-1 (Figure 7-figure supplement 1C, D). In isp-1

332 mutants, expression of 4 hydrolase genes (asp-4, asp-8, asm-1 and Y105E8B.9) was affected

333 by both daf-16 mutation and skn-1 RNAi, and their expression in triple mutants

334 (daf-16;isp-1skn-1 RNAi) was similar to the double mutant (Figure 7-figure supplement 1B).

335 These results suggest that DAF-16 and SKN-1 act together to regulate lysosomal gene

336 expression in isp-1. In agreement with this, loss of skn-1 or daf-16 led to increased pHTomato

337 intensity and reduced LSG/LTR fluorescence intensity ratio in isp-1 lysosomes, while these

338 parameters remained unchanged in daf-16;isp-1skn-1 RNAi worms (Figure 8C-L). The daf-16

339 mutation caused reduced NUC-1::CHERRY cleavage in isp-1, while skn-1 RNAi did not

340 obviously affect CHERRY cleavage in isp-1 or daf-16;isp-1 (Figure 7-figure supplement 1E,

341 F). We found that loss of PHA-4/FOXA, the key downstream effector of the dietary

342 restriction pathway, had no effect on lysosomal gene expression in eat-2 mutants, while loss

343 of HIF-1, the transcription factor acting downstream of the mitochondrial pathway, did not

344 reduce expression of lysosomal genes in isp-1 mutants, except for asp-8 (Figure 7M, 8M).

345 Loss of pha-4 and hif-1 had no effect on the acidity and degradation activity of lysosomes in

346 eat-2 and isp-1 mutants, respectively (Figure 7N-R, 8N-R and Figure 7-figure supplement

347 1G-J). Altogether, these data suggest that PHA-4 and HIF-1 are dispensable for lysosome

348 regulation in eat-2 and isp-1 mutants.

349

350 Lysosome function is important for clearance of aggregate-prone proteins and for

351 lifespan extension induced by multiple mechanisms

352 Protein insolubility or aggregation is an inherent part of normal aging due to reduced

16
353 proteostasis with age. We tested whether the decline in lysosome function contributes to the

354 accumulation of protein aggregates. NMY-2 was previously identified as an

355 aggregation-prone protein which becomes more insoluble with age (David et al., 2010,

356 Bohnert and Kenyon, 2017). Consistent with this, NMY-2::GFP fluorescence was almost

357 invisible in wild-type oocytes at day 1 of adulthood, but was visible as GFP puncta at day 5

358 (Figure 9A, B and Figure 9-figure supplement 1A, B). Loss of CUP-5, the lysosomal Ca2+

359 channel homologous to human TRPML, caused increased pHTomato intensity in lysosomes

360 and reduced fluorescence intensity ratio of LSG/LTR, which indicates that lysosomal acidity

361 is affected (Figure 2L, M and Figure 9-figure supplement 1P-X). Moreover, CPL-1 processing

362 was reduced significantly in cup-5 mutants at all adult ages tested, which is suggestive of

363 defects in lysosomal degradation activity (Figure 9-figure supplement 1Y, Z). In cup-5,

364 NMY-2::GFP fluorescence increased significantly in oocytes at days 1 and 5, but the number

365 of NMY-2::GFP puncta was not obviously increased (Figure 9C, D, I-K and Figure 9-figure

366 supplement 1C, D, M-O). The number of NMY-2::GFP puncta was reduced significantly in

367 oocytes of daf-2, eat-2 and isp-1 mutants at day 5, consistent with decreased formation and/or

368 accumulation of protein aggregates (Figure 9F, K and Figure 9-figure supplement 1F, J, O).

369 We found that loss of cup-5 caused significantly increased NMY-2::GFP fluorescence in daf-2,

370 eat-2 and isp-1 oocytes at both day 1 and day 5, and the number of NMY-2::GFP puncta also

371 increased at day 5 (Figure 9G-K and Figure 9-figure supplement 1G-O). This suggests that

372 lysosome function is important for clearance of aggregation-prone proteins and protein

373 aggregates in long-lived worms. We observed that the cup-5 mutation was more potent at

374 increasing the NMY-2::GFP fluorescence than the number of visible NMY-2::GFP aggregates

17
375 (Figure 9A-K and Figure 9-figure supplement 1A-O). This suggests that more soluble or

376 lower-molecular-weight forms of aggregate-prone proteins may be removed more efficiently

377 by lysosomes.

378 Finally, we examined whether lysosome function contributes to lifespan extension. The

379 lysosome-defective mutants cup-5(bp510) and cpl-1(qx304) were slightly short-lived

380 compared with wild type, and both of these mutations significantly reduced the lifespan in

381 daf-2, eat-2 and isp-1 worms (Figure 9L-Q). These data indicate that lysosome function is

382 important for lifespan extension induced by multiple mechanisms including reduced IIS,

383 caloric restriction and impaired mitochondrial respiration.

384

385 Discussion

386 In this study, we investigated how lysosomes change with age and contribute to lifespan

387 regulation. Our data indicate that lysosomes undergo a series of age-associated alterations in

388 C. elegans including shape, size, motility, acidity and degradation activity, which suggest a

389 decline in lysosomal function with age. We found that lysosomes are modulated by multiple

390 longevity regulatory pathways, and lysosome function is essential for lifespan extension.

391

392 Various lysosomal properties are altered with age

393 Age-related increases in the number and size of lysosomes have been observed previously in

394 several species such as Paramecium, nematodes and human cell lines (Sundararaman and

395 Cummings, 1976, J. Epstein, 1972, Lipetz and Cristofalo, 1972, Brandes et al., 1972). By

396 employing cell biology assays, we found that lysosomes undergo a series of age-related

18
397 changes including increased mean and total volume, and decreased motility, acidity and

398 degradation activity. This indicates that the overall function of lysosomes declines with age,

399 which explains in part the age-dependent decline in protein degradation described in various

400 systems (Cuervo and Dice, 1998). We observed that lysosomal morphology changes

401 dramatically with age, manifested as greatly increased tubular morphology and a concomitant

402 decrease in vesicular lysosomes. Tubular structures have been observed in the lysosome

403 reformation process when lysosomal contents are retrieved from phagolysosomes or

404 autolysosomes (Yu et al., 2010, Gan et al., 2019). Moreover, stimulation of macrophages and

405 dendritic cells (DCs) with agonists including LPS leads to reorganization of lysosomes into a

406 tubular network (Hipolito et al., 2018). These lysosomal tubules may be induced to fulfil a

407 variety of functions, such as expanding lysosomal volume, promoting phagosome maturation,

408 cargo sorting and exchange, and helping delivery of peptide-loaded MHC-II molecules to the

409 cell surface (Hipolito et al., 2018, Hipolito et al., 2019, Mantegazza et al., 2014, Boes et al.,

410 2002, Boes et al., 2003, Chow et al., 2002, Vyas et al., 2007). In C. elegans, we found

411 previously that catalytically active lysosomal tubules are formed during molting to promote

412 cuticle replacement (Miao et al., 2020). In aged adults, however, lysosomal tubules are static

413 and are not readily stained by LysoSensor Green (Figure 1N, O and Figure 2-figure

414 supplement 1B-D). Lysosome degradation activity, indicated by CPL-1 processing, is

415 obviously reduced in aged adults. Thus, the lysosomal tubules enriched in aged adults are

416 probably catalytically inactive. The HVEM analyses revealed that young adult worms contain

417 electron-lucent tubules emanating from electron-dense granules, consistent with retrieval

418 and/or recycling of lysosomal contents through tubules. In aged worms, the vast majority of

19
419 lysosomes are seen as electron-lucent tubules that form a tubular network, whereas very few

420 dense vesicular lysosomes are present (Figure 3G, K). It is possible that the lysosomal

421 retrieval, cargo sorting and/or catabolite recycling processes occur inefficiently in aged adults,

422 which leads to accumulation of catalytically inactive tubular lysosomal structures. Future

423 studies are needed to understand how lysosomal tubules are formed in aging adults and

424 whether and how they alter degradation, retrieval or recycling of lysosomal contents.

425 Consistent with changes in multiple lysosomal properties, we observed an age-related decline

426 in the expression of 43 lysosome-related genes (Figure 5A-C and Supplementary file 2). This

427 affects two main classes of lysosomal proteins, the cathepsin proteases (17 genes) and

428 subunits of the proton pump V-ATPase (15 genes), which may account for the age-associated

429 decline in lysosomal acidity and degradation. We observed that cpl-1 gene expression declines,

430 but the total CPL-1 protein level appears to increase with age in wild type. The increase in the

431 total CPL-1 protein level is probably caused by reduced CPL-1 processing (Figure 2N, 4T-W)

432 and a decline in CPL-1 protein turnover, consistent with the decline in lysosome activity in

433 aging worms. In addition to decreased expression of 43 lysosome genes, 13 lysosome genes

434 exhibit increased expression with age (Figure 5A and Supplementary file 3). This may reflect

435 a feed-back response caused by reduced lysosomal degradation with age as proposed

436 previously in mammals (de Magalhaes et al., 2009). Moreover, expression of 29

437 lysosome-related genes is unaltered in aging adults (Figure 5A and Supplementary file 4).

438 Thus, the overall profile of lysosomal transcripts is obviously remodeled, but not all

439 lysosomal gene expression patterns are altered during aging.

440

20
441 Lysosomes are modulated by multiple longevity pathways

442 We found that long-lived mutants representing three different longevity pathways all

443 exhibited increased activity and better maintenance of lysosomes with age. Reducing IIS by

444 the daf-2 mutation suppresses age-associated lysosomal changes. daf-2 lysosomes maintain

445 their vesicular morphology, ultrastructure, high motility, acidity and degradation activity with

446 age. The maintenance of lysosome activity with age is achieved at least in part through

447 transcriptional regulation of lysosome genes. Loss of daf-16 and skn-1 reduces lysosome gene

448 expression in daf-2 and causes decreased lysosomal acidity and degradation activity. In

449 addition to modulating lysosome gene expression, reducing IIS increases stress resistance and

450 reduces cellular damage (Shore and Ruvkun, 2013). This may reduce substrate loading into

451 lysosomes and thus help to maintain lysosome activity with age. Consistent with this, we

452 found previously that loss of daf-2 increases stress resistance in the lysosome-defective

453 mutant scav-3 and suppresses the membrane integrity defects in scav-3 (Li et al., 2016). In

454 addition to the IIS pathway, lysosomes are also modulated by caloric restriction and

455 mitochondrial pathways. In the feeding-defective mutant eat-2 and the mitochondrial mutant

456 isp-1, appearance of age-related lysosomal changes is suppressed or delayed, and lysosome

457 gene expression is increased. Thus, lysosomes may serve as a common target of multiple

458 longevity pathways. Notably, only 2 out of the 43 lysosomal genes that are downregulated

459 with age are targeted by all three pathways (Figure 6-figure supplement 1A). The IIS and

460 caloric restriction pathways seem to target different sets of lysosome genes, whereas genes

461 upregulated in isp-1 mutants are mostly shared with the IIS pathway (Figure 6-figure

462 supplement 1A). Future studies are needed to understand why and how lysosomal genes are

21
463 selectively regulated by different pathways.

464 We identified DAF-16 and SKN-1 as key factors involved in modulating lysosome gene

465 expression by multiple longevity pathways. By contrast, PHA-4 and HIF-1, the key

466 downstream effectors of the caloric restriction and mitochondrial pathways, respectively, are

467 dispensable for lysosome regulation. DAF-16 is reported to regulate lysosomal pH in the

468 intestine in response to the reproductive cycle (Baxi et al., 2017). In this process, DAF-16 is

469 activated by the DAF-9/Cytochrome P450 and DAF-12/Vitamin D receptor steroid signaling

470 pathway in the gonad, which leads to increased expression of V-ATPase genes (Baxi et al.,

471 2017). In addition, microarray analyses identified several vha genes that are upregulated by

472 SKN-1 under non-stress conditions (Oliveira et al., 2009). Here we found that loss of daf-16

473 and skn-1 reduces expression of lysosome genes that encode membrane proteins, hydrolases

474 and V-ATPase subunits in daf-2 and isp-1, and these two mutations affect lysosomal acidity

475 and/or degradation activity in a non-additive manner. This suggests that DAF-16 and SKN-1

476 act in concert to modulate lysosome activity in response to reduced IIS and impaired

477 mitochondrial function. On the other hand, DAF-16 and SKN-1 appear to act in parallel to

478 maintain expression of vha-12 and vha-5 in eat-2 mutants, and loss of their function affects

479 the acidity of eat-2 lysosomes in an additive manner. Further studies are needed to understand

480 how DAF-16 and SKN-1 cooperate to modulate lysosome gene expression in different

481 conditions.

482 The TFEB ortholog HLH-30 influences lifespan extension by multiple pathways via its role in

483 autophagy and lipophagy, but its functions are highly context-dependent (O'Rourke and

484 Ruvkun, 2013, Lapierre et al., 2013, Dall and Faergeman, 2019). It was reported recently that

22
485 DAF-16 and HLH-30 act as a complex to co-regulate longevity-promoting genes in IIS

486 mutants (Lin et al., 2018). Consistent with this, we found that expression of 6 lysosomal

487 hydrolase genes in daf-2 is reduced by loss of hlh-30 and 5 of them are also targeted by

488 DAF-16. The other 8 DAF-16-regulated lysosome genes are not affected by hlh-30 mutation.

489 The lysosome degradation activity in daf-2 worms, however, seems to be unaffected by

490 hlh-30 mutation, and is higher in daf-16;daf-2;hlh-30 than in daf-16;daf-2. We suspect that

491 loss of hlh-30 causes a decrease in the autophagy level, which may have a beneficial effect on

492 lysosomal activity due to reduced cargo loading into lysosomes.

493

494 Lysosome function is essential for lifespan extension

495 Our data indicate that lysosome function is essential for lifespan extension induced by

496 multiple mechanisms. Maintenance of lysosome activity and dynamics may promote

497 degradation of lipids, misfolded proteins and damaged organelles, which all accumulate with

498 age. Notably, autophagy capacity declines with age in several species, which may be

499 attributed to impaired activation and progression of autophagy and/or a decline in degradation

500 of autophagic cargo in lysosomes (Hansen et al., 2018). On the other hand, autophagy activity

501 increases in multiple long-lived mutants and is important for lifespan extension (Melendez et

502 al., 2003, Hansen et al., 2008, Lapierre et al., 2013, Toth et al., 2008). It is conceivable that

503 longevity pathways upregulate the functionality of both autophagy and lysosomes to achieve

504 efficient cellular clearance for lifespan extension. However, autophagy and lysosomes may be

505 differentially regulated by longevity pathways. For example, DAF-16 is not required for the

506 increased level of autophagy in daf-2 (Hansen et al., 2008), but is important for lysosome

23
507 regulation. Moreover, PHA-4 is required for the elevated autophagy in eat-2 mutants (Hansen

508 et al., 2008), but is dispensable for the upregulation of lysosomal activity. mTORC1 inhibits

509 autophagy activity but is important for lysosomal tubulation in the reformation process and

510 for LPS-induced tubulation of lysosomes in macrophages and DCs (Yu et al., 2010, Saric et

511 al., 2016, Hipolito et al., 2019). Inhibition of TORC1 has no effect on either appearance or

512 enrichment of tubular lysosomes in aged C. elegans (our unpublished results). Thus, TORC1

513 activity may not be required for age-associated lysosomal tubule formation in worms. Future

514 investigations are needed to understand how lysosomes are reshaped during aging and how

515 the regulation of lysosomes and autophagy is coordinated in different longevity-promoting

516 pathways. It is worth noting that in our study, the age-associated alterations in lysosomal

517 morphology, motility and acidity were mainly examined in hypodermal and intestinal cells,

518 which are big and amenable to cell biology analysis. We have not been able to examine the

519 age-related changes in lysosomal properties in small-sized cells such as neurons. Further

520 studies are required to understand whether lysosomes make tissue-specific contributions to

521 aging and lifespan extension.

522

523 Materials and methods

524

525

526

527

528

24
529

530

531

532

533

534

535

536

537

538

25
539 Key Resource Table
540
Key Resources Table
Reagent type
(species) or Designation Source or reference Identifiers Additional information
resource
Strain (C.
N2 CGC RRID:WB-STRAIN:N2_(ancestral) wild type (Bristol)
elegans)
Strain (C.
elegans) CF1038 DOI: 10.1126/science.1083701 RRID:WB-STRAIN:WBStrain00004840 daf-16(mu86)
Strain (C.
elegans) PS3553 DOI: 10.1126/science.1083701 RRID:WB-STRAIN:WBStrain00030901 hsf-1(sy441)
Strain (C.
DA1116 DOI: 10.1073/pnas.95.22.13091 RRID:WB-STRAIN:WBStrain00005548 eat-2(ad1116)
elegans)
Strain (C.
CF1041 DOI: 10.1126/science.1139952 RRID:WB-STRAIN:WBStrain00006375 daf-2(e1370ts)
elegans)
Strain (C.
elegans) HZ108 DOI: 10.4161/auto.7.11.17759 cup-5(bp510)
Strain (C.
DOI: 10.1534/g3.115.023010
elegans) QV225 RRID:WB-STRAIN:WBStrain00031273 skn-1(zj15)
Strain (C. DOI:
MQD887 RRID:WB-STRAIN:WBStrain00026670 isp-1(qm150)
elegans) 10.1016/s1534-5807(01)00071-5
Strain (C.
elegans) FX01978 Shohei Mitani RRID:WB-STRAIN:WBStrain00022468 hlh-30(tm1978)
Strain (C.
elegans) XW10101 DOI: 10.1091/mbc.E14-01-0015 cpl-1(qx304)

26
Strain (C.
elegans) ZG31 DOI: 10.1016/j.cub.2010.10.057 RRID:WB-STRAIN:WBStrain00040824 hif-1(ia4)
Strain (C. qxIs257
XW5399 DOI: 10.1126/science.1220281
elegans) (Pced-1NUC-1::CHERRY)
Strain (C. qxIs430
XW8056 DOI: 10.1083/jcb.201602090
elegans) (Pscav-3SCAV-3::GFP)
Strain (C. qxIs468
XW10197 DOI: 10.1016/j.devcel.2019.10.020
elegans) (Pmyo-3LAAT-1::GFP)
Strain (C. DOI: qxIs520
elegans) XW11282 10.1016/j.devcel.2019.10.020. (Pvha-6LAAT-1::GFP)
Strain (C. DOI: qxIs612
XW13734
elegans) 10.1016/j.devcel.2019.10.020. (PhsNUC-1::sfGFP::CHERRY)
Strain (C. qxIs750
XW19180 this paper
elegans) (PhsNUC-1::pHTomato)
Strain (C. zuIs45
JJ1473 DOI:10.1242/dev.00735 RRID:WB-STRAIN:WBStrain00022491
elegans) (Pnmy-2NMY-2::GFP)
Bacterial and
Vidal RNAi library Open Biosystems ORF RNAi collection V2 pha-4 and skn-1
virus strains
Antibody anti-CPL-1 (rat polyclonal) DOI: 10.1126/science.1220281 WB(1:1000)
anti-alpha-Tubulin(mouse
Antibody Sigma-Aldrich (Missouri, USA) Cat #T5168; RRID:AB_477579 WB(1:10000)
monoclonal)
anti-CHERRY(mouse SUNGENE
Antibody Cat#KM8017 WB(1:1000)
monoclonal) BIOTECH(Tianjin,China)
Recombinant Cloning described in
pPD49.26-PhsNUC-1::pHTomato this paper
DNA reagent 'Plasmid construction'
Sequence-based pHTomato S KpnI_MluI This paper PDFZ1322 cgcgGGTACCggaACGCGTATG

27
 reagent ATCAAGGAGTTCATGCGCTTC
Sequence-based pHTomato CAS SacI_NotI cgcgGAGCTCGCGGCCGC
This paper PDFZ1323
reagent TTACTGTGCCTCCGCTGGCGC
Sequence-based Other primers used in this paper,
This paper
reagent see Supplementary file 6
Chemical
LysoTracker™ Red DND-99 Invitrogen (Oregon, USA) Cat #L7528
compound, drug
Chemical
Invitrogen (Oregon, USA) Cat #L7535
compound, drug LysoSensor™ Green DND-189
Chemical
Invitrogen (Oregon, USA) 15596-018
compound, drug Trizol
Commercial
assay or kit PrimeScript RT Reagent Kit TaKaRa RR037A
Commercial
assay or kit FS Universal SYBR Green Master Roche 4913850001
Commercial SuperSignal West Pico PLUS.
assay or kit Chemilumines ThermoFisher 34577
Software,
Volocity PerkinElmer(Massachusetts, USA) RRID:SCR_002668
algorithm
Software,
Zen Carl Zeiss(Oberkochen, Germany) RRID:SCR_01367
algorithm
Software,
algorithm Image J N/A V1.42q, RRID:SCR_003070

541

28
542 C. elegans strains

543 Strains of C. elegans were cultured and maintained using standard protocols (Brenner, 1974)

544 unless indicated otherwise. The N2 Bristol strain was used as the wild type (WT) strain

545 Genome-integrated arrays (qxIs) were acquired by γ-irradiation to achieve stable expression

546 from arrays with low copy numbers. The following strains were used in this work: linkage

547 group (LG) I, daf-16(mu86), hsf-1(sy441); LG II, eat-2(ad1116); LG III, daf-2(e1370ts),

548 cup-5(bp510); LG IV, skn-1(zj15), isp-1(qm150), hlh-30(tm1978); LG V, cpl-1(qx304),

549 hif-1(ia4). The reporter strains used in this study include qxIs257 (Pced-1NUC-1::CHERRY),

550 qxIs468 (Pmyo-3LAAT-1::GFP), qxIs520 (Pvha-6LAAT-1::GFP), qxIs750 (PhsNUC-1::pHTomato),

551 qxIs612 (PhsNUC-1::sfGFP::CHERRY), zuIs45 (Pnmy-2NMY-2::GFP).

552

553 Microscopy and imaging analysis

554 Differential interference contrast (DIC) and fluorescence images were captured with an

555 Axioimager A1 (Carl Zeiss) equipped with epi-fluorescence [Filter Set 13 for GFP (excitation

556 BP 470/20, beam splitter FT 495, emission BP 503–530) and Filter Set 20 for Cherry

557 (excitation BP 546/12, beam splitter FT 560, emission BP 575–640)] and an AxioCam

558 monochrome digital camera (Carl Zeiss). Images were processed and viewed using

559 Axio-vision Rel. 4.7 software (Carl Zeiss). A 63× objective (Plan-Neofluar NA1.30) was used

560 with Immersol 518F oil (Carl Zeiss). Confocal images were captured by a Zeiss 880 inverted

561 laser scanning confocal microscope with 488 nm (emission filter BP 503–530) and 543 nm

562 (emission filter BP 560–615) lasers, and images were processed and viewed using Zen

563 software (Carl Zeiss). All images were taken at 20°C.

29
564

565 Time-lapse recording using spinning-disk microscopy

566 C. elegans adults at different ages (days 1, 3, 5, 9) were mounted on agar pads in M9 buffer

567 with 5 mM levamisole to prevent movement of the animals. Fluorescence images were

568 captured using a 60× objective (CFI Plan Apochromat Lambda; NA 1.45; Nikon) with

569 immersion oil (type NF) on an inverted fluorescence microscope (Eclipse Ti-E; Nikon) with a

570 spinning disk confocal scanner unit (UltraView; PerkinElmer) with 488 nm [emission filter

571 525 (W50)] and 561 nm [dual-band emission filter 445 (W60) and 615 (W70)] lasers. To

572 follow lysosomal dynamics in worms expressing NUC-1::CHERRY, images were captured

573 every 1 sec for 1-2 min. The collected images were viewed and analyzed using Volocity

574 software (PerkinElmer).

575

576 RNAi treatment

577 RNAi was performed by using the standard feeding method and Vidal RNAi library (Open

578 biosystem) (Rual et al., 2004). For most experiments, 3-5 L4 larvae (P0) were cultured on the

579 RNAi plate and F1 progeny at late larval and young adult stages were examined. The pha-4

580 and skn-1 RNAi led to death of the F1 progeny. In this case, ~50 bleached L1 larvae were

581 transferred to plates seeded with bacteria expressing either control double stranded RNA

582 (dsRNA; L4440 empty vector; Control RNAi) or dsRNA corresponding to pha-4 and skn-1.

583 The phenotype was examined at adult stages in the same generation.

584

585 Quantification of lysosomal tubule length

30
586 Fluorescence images of C. elegans adults at different ages (days 1, 3, 5, 9) expressing

587 NUC-1::CHERRY were captured by laser scanning confocal microscopy (Carl Zeiss). The

588 length of NUC-1::CHERRY-positive tubules in each worm was quantified by Image J

589 software. Tubular lysosomes that crossed one another were counted as two individual tubules.

590 10 lysosomal tubules were measured in each animal and at least 20 animals were scored in

591 each strain at each day.

592

593 Quantification of lysosome number and volume

594 Fluorescence images of C. elegans adults at different ages (days 1, 3, 5, 9) expressing

595 NUC-1::CHERRY in 10-15 z-series (0.5 µm /section) were captured by spinning-disk

596 microscopy. Serial optical sections were analyzed, and the volume and number of

597 NUC-1::CHERRY-positive vesicular lysosomes per unit area (31 x 43 µm2) was quantified by

598 Volocity software (PerkinElmer). At least 8 animals were quantified in each strain at each

599 stage. The total volume of vesicular and tubular lysosomes was quantified by Volocity. At

600 least 10 worms were quantified in each strain at each day.

601

602 Quantification of lysosome dynamics

603 Time-lapse images of C. elegans L4-stage larvae and adults at different ages (days 1, 3, 5, 9)

604 expressing NUC-1::CHERRY were captured by spinning-disk microscopy. To quantify

605 Pearson’s correlation coefficient, the colocalization of two frames taken 60 sec apart was

606 analyzed by Volocity software (PerkinElmer). The average velocity (displacement rate) of

607 tubular and vesicular lysosomes within 60 s was measured by Volocity software

31
608 (PerkinElmer). At least 10 independent videos were recorded and quantified in each strain at

609 each day.

610

611 LysoSensor Green and LysoTracker staining

612 C. elegans adults at different age (~ 40 at each age) were soaked in 80 µl M9 buffer

613 containing LysoSensor Green DND 189 and LysoTracker Red DND 99 at 10 µM for staining

614 in the intestine and 60 µM for staining in the hypodermis (Invitrogen, Oregon, USA).

615 Staining was carried out for 1 h at 20℃ in the dark. Worms were then transferred to NGM

616 plates with fresh OP50 and allowed to recover at 20°C for 1 h in the dark before examination.

617 The relative intensity of LSG/LTR was quantified by Volocity (PerkinElmer).

618

619 Quantification of NUC-1::pHTomato intensity

620 C. elegans adults (1 day post L4/adult molt) expressing PhsNUC-1::pHTomato were incubated

621 at 33℃ for 30 min and recovered at 20 ℃ for 24 h before examination. The average intensity

622 of pHTomato per lysosome in the hypodermis was measured by Volocity (PerkinElmer). At

623 least 20 worms were quantified in each strain.

624

625 Lysosome degradation activity assay

626 Examination and quantification of CPL-1 processing

627 About 50 C. elegans adults at different ages (days 1, 5, 9) were picked and washed three times

628 with M9. The worms were lysed by boiling followed by several rounds of freezing and

629 thawing. The resulting worm lysate was resolved by SDS-PAGE and the CPL-1 processing

32
630 was detected by anti-CPL antibodies (Antibody core, NIBS, 1:1000). α-tubulin antibody

631 (Sigma) was used at 1:5000 as an internal control. The band intensities of the mature and pro-

632 forms of CPL-1 were quantified by Image J software, then CPL-1 processing was quantified

633 by dividing the mature CPL-1 by the total CPL-1 (both pro- and mature forms). 3 independent

634 experiments were performed and quantified in each strain at each stage.

635 Quantification of NUC-1::CHERRY cleavage:

636 Adult worms (~50, 1 day post L4/adult molt) expressing NUC-1::CHERRY were washed

637 three times in M9. The worms were lysed by boiling followed by several rounds of freezing

638 and thawing. The resulting worm lysate was analyzed by Western blot using anti-CHERRY

639 antibodies (SUNGENE BIOTECH, China, 1:1000) and anti-tubulin antibodies (Sigma,

640 1:5000). The intensities of NUC-1::CHERRY and CHERRY bands were quantified by Image

641 J software and the extent of cleavage was calculated by dividing the amount of CHERRY by

642 the total amount of NUC-1::CHERRY and CHERRY. 3 independent experiments were

643 performed and quantified in each strain.

644

645 HVEM analysis

646 C. elegans adults at different ages (days 1, 5) were rapidly frozen using a high-pressure

647 freezer (EM PACT2; Leica Biosystems). Freeze substitution was performed in anhydrous

648 acetone containing 1% osmium tetroxide. The samples were kept sequentially at -90°C for 72

649 h, -60°C for 8 h, and -30°C for 8 h and were finally brought to 20°C for 10 h in a

650 freeze-substitution unit (EM AFS2; Leica Biosystems). The samples were washed three times

651 (1 h each time) in fresh anhydrous acetone and were gradually infiltrated with Embed-812

33
652 resin in the following steps: resin/acetone 1:3 for 3 h, 1:1 for 5 h, 3:1 overnight, and 100%

653 resin for 4 h. Samples were then kept overnight and embedded at 60°C for 48 h. The fixed

654 samples were cut into 70-nm sections with a microtome EM UC7 (Leica Biosystems) and

655 electron-stained with uranyl acetate and lead citrate. Sections were observed with a JEM-1400

656 (JEOL) operating at 80 kV. For quantitative analysis of lysosomes, three to five animals were

657 analyzed in each strain at each stage, using eight 70-nm sections (non-consecutive sections,

658 spaced at 5000 nm) in each animal. Images of each lysosome were taken at high

659 magnification (60,000× or 30,000×) and the numbers were counted manually. Lysosome

660 diameter was measured by Image J software.

661

662 Quantitative real-time PCR (qRT-PCR)

663 Worms were synchronized and cultured at 20℃ to different ages (adult day 1 and day 5).

664 Total RNA was extracted from 20 µl worm pallets at each stage using Trizol (Invitrogen/Life

665 Technologies, Carlsbad, CA) and reverse transcribed by a PrimeScript RT Reagent Kit

666 (TaKaRa). The reverse transcription products (cDNA) were diluted to 10 ng/µl and used as

667 the template for quantitative PCR. For quantitative RT-PCR, custom-designed primers were

668 mixed with SYBR Green Mix (Roche) and samples were analyzed using a PCR biosystems

669 QuantStudio 7 Flex (Applied Biosystems). The gene cdc-42 was used as the internal reference.

670 At least three independent experiments were performed with 3 replications each time.

671

672 Quantification of NMY-2::GFP intensity and number of puncta

673 Fluorescence images of C. elegans adults expressing NMY-2::GFP at different ages (days 1

34
674 and 5) were captured by laser scanning confocal microscopy (LSM 880, Carl Zeiss).

675 Fluorescence intensity in oocytes (the second, third and fourth oocytes counted from the

676 spermatheca) were measured by Volocity software. The number of NMY-2::GFP puncta in

677 oocytes was counted manually. 50 animals were quantified in each strain at each day.

678

679 Lifespan assay

680 Worms were synchronized and cultured at 20℃ until they reached the L4 stage. About 150

681 L4-stage worms (day 0) were picked to NGM plates with fresh OP50, 15 worms per plate.

682 Worms were considered dead when they failed to respond to gentle touches on the head and

683 tail with a worm picker. The surviving worms were counted every 2 days and were transferred

684 to new plates to avoid interference from the progeny. Animals that crawled off the plate,

685 exploded, bagged, or became contaminated were discarded. At least 100 worms were

686 quantified in each strain. At least 3 independent experiments were performed for each strain.

687 Representative survival curves are shown in Figure 9L, N, P and the mean lifespan from 3

688 experiments is shown in Figure 9M, O, Q.

689

690 Plasmid construction

691 To generate PhsNUC-1::pHTomato, pHTomato was amplified from plasmid PmitopHTomato

692 (Chen Chang Lab, Institute of Biophysics, Chinese Academy of Science, China) using

693 primers PDFZ1322/PDFZ1323 and was ligated to pPD49.26-Phyp-7NUC-1 through the Kpn

694 I-Mlu I /Sac I sites, followed by replacement of the hyp-7 promoter with the heat-shock

35
695 promoter (hs) through the BamH I site.

696

697 Statistical analysis

698 The standard deviation (SD) was used as y-axis error bars for bar charts plotted from the

699 mean value of the data. Data derived from different genetic backgrounds and/or different

700 stages were compared by Multiple t testing, paired t testing, one-way ANOVA with Tukey's

701 multiple comparisons test or two-way ANOVA with Fisher’s LSD test. Data were considered

702 statistically different when P<0.05. P<0.05 is indicated with single asterisks, P<0.001 with

703 double asterisks.

704

705 Acknowledgements

706 We thank Dr. Mengqiu Dong for discussion and critical reading of the manuscript and Dr.

707 Isabel Hanson for editing services. Some strains were provided by the CGC, which is funded

708 by NIH Office of Research Infrastructure Programs (P40OD010440). This work was

709 supported by the Ministry of Science and Technology (2016YFA0500203), the National

710 Natural Science Foundation of China (3163001, 91754203) and the Strategic Priority

711 Research Program of the Chinese Academy of Sciences (XDB19000000) to X. W. The

712 authors declare no competing financial interests.

713

714 References

715 ANISIMOV, V. N. & BARTKE, A. 2013. The key role of growth hormone-insulin-IGF-1

716 signaling in aging and cancer. Crit Rev Oncol Hematol, 87, 201-23.

36
717 BAXI, K., GHAVIDEL, A., WADDELL, B., HARKNESS, T. A. & DE CARVALHO, C. E.

718 2017. Regulation of Lysosomal Function by the DAF-16 Forkhead Transcription

719 Factor Couples Reproduction to Aging in Caenorhabditis elegans. Genetics, 207,

720 83-101.

721 BOES, M., BERTHO, N., CERNY, J., OP DEN BROUW, M., KIRCHHAUSEN, T. &

722 PLOEGH, H. 2003. T cells induce extended class II MHC compartments in dendritic

723 cells in a Toll-like receptor-dependent manner. J Immunol, 171, 4081-8.

724 BOES, M., CERNY, J., MASSOL, R., OP DEN BROUW, M., KIRCHHAUSEN, T., CHEN, J.

725 & PLOEGH, H. L. 2002. T-cell engagement of dendritic cells rapidly rearranges

726 MHC class II transport. Nature, 418, 983-8.

727 BOHNERT, K. A. & KENYON, C. 2017. A lysosomal switch triggers proteostasis renewal in

728 the immortal C. elegans germ lineage. Nature, 551, 629-633.

729 BOLANOWSKI, M. A., JACOBSON, L. A. & RUSSELL, R. L. 1983. Quantitative measures

730 of aging in the nematode Caenorhabditis elegans: II. Lysosomal hydrolases as

731 markers of senescence. Mech Ageing Dev, 21, 295-319.

732 BRANDES, D., MURPHY, D. G., ANTON, E. B. & BARNARD, S. 1972. Ultrastructural and

733 cytochemical changes in cultured human lung cells. J Ultrastruct Res, 39, 465-83.

734 BRENNER, S. 1974. The genetics of Caenorhabditis elegans. Genetics, 77, 71-94.

735 CARMONA-GUTIERREZ, D., HUGHES, A. L., MADEO, F. & RUCKENSTUHL, C. 2016.

736 The crucial impact of lysosomes in aging and longevity. Ageing Res Rev, 32, 2-12.

737 CELLERINO, A. & ORI, A. 2017. What have we learned on aging from omics studies? Semin

738 Cell Dev Biol, 70, 177-189.

37
739 CHOW, A., TOOMRE, D., GARRETT, W. & MELLMAN, I. 2002. Dendritic cell maturation

740 triggers retrograde MHC class II transport from lysosomes to the plasma membrane.

741 Nature, 418, 988-94.

742 CUERVO, A. M. & DICE, J. F. 1998. How do intracellular proteolytic systems change with

743 age? Front Biosci, 3, d25-43.

744 CUERVO, A. M. & DICE, J. F. 2000. When lysosomes get old. Exp Gerontol, 35, 119-31.

745 CUERVO, S. J. O. A. A. M. 2010. Changes in Lysosomes and Their autophagic Function in

746 Aging: The Comparative Biology of Lysosomal Function. In: WOLF, N. S. (ed.) The

747 Comparative Biology of Aging. Springer

748 DALL, K. B. & FAERGEMAN, N. J. 2019. Metabolic regulation of lifespan from a C.

749 elegans perspective. Genes Nutr, 14, 25.

750 DAVID, D. C., OLLIKAINEN, N., TRINIDAD, J. C., CARY, M. P., BURLINGAME, A. L.

751 & KENYON, C. 2010. Widespread protein aggregation as an inherent part of aging in

752 C. elegans. PLoS Biol, 8, e1000450.

753 DE MAGALHAES, J. P., CURADO, J. & CHURCH, G. M. 2009. Meta-analysis of

754 age-related gene expression profiles identifies common signatures of aging.

755 Bioinformatics, 25, 875-81.

756 DUVVURI, M., GONG, Y., CHATTERJI, D. & KRISE, J. P. 2004. Weak base permeability

757 characteristics influence the intracellular sequestration site in the multidrug-resistant

758 human leukemic cell line HL-60. J Biol Chem, 279, 32367-72.

759 EWALD, C. Y., LANDIS, J. N., PORTER ABATE, J., MURPHY, C. T. & BLACKWELL, T.

760 K. 2015. Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling

38
761 in longevity. Nature, 519, 97-101.

762 FENG, J., BUSSIERE, F. & HEKIMI, S. 2001. Mitochondrial electron transport is a key

763 determinant of life span in Caenorhabditis elegans. Dev Cell, 1, 633-44.

764 GAN, Q., WANG, X., ZHANG, Q., YIN, Q., JIAN, Y., LIU, Y., XUAN, N., LI, J., ZHOU, J.,

765 LIU, K., JING, Y., WANG, X. & YANG, C. 2019. The amino acid transporter

766 SLC-36.1 cooperates with PtdIns3P 5-kinase to control phagocytic lysosome

767 reformation. J Cell Biol, 218, 2619-2637.

768 GUO, B., HUANG, X., ZHANG, P., QI, L., LIANG, Q., ZHANG, X., HUANG, J., FANG, B.,

769 HOU, W., HAN, J. & ZHANG, H. 2014. Genome-wide screen identifies signaling

770 pathways that regulate autophagy during Caenorhabditis elegans development.

771 EMBO Rep, 15, 705-13.

772 HANSEN, M., CHANDRA, A., MITIC, L. L., ONKEN, B., DRISCOLL, M. & KENYON, C.

773 2008. A role for autophagy in the extension of lifespan by dietary restriction in C.

774 elegans. PLoS Genet, 4, e24.

775 HANSEN, M., RUBINSZTEIN, D. C. & WALKER, D. W. 2018. Autophagy as a promoter of

776 longevity: insights from model organisms. Nat Rev Mol Cell Biol, 19, 579-593.

777 HAYFLICK, L. 1980. Recent advances in the cell biology of aging. Mech Ageing Dev, 14,

778 59-79.

779 HERSH, B. M., HARTWIEG, E. & HORVITZ, H. R. 2002. The Caenorhabditis elegans

780 mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in

781 multiple cell types. Proc Natl Acad Sci U S A, 99, 4355-60.

782 HIPOLITO, V. E. B., DIAZ, J. A., TANDOC, K. V., OERTLIN, C., RISTAU, J., CHAUHAN,

39
783 N., SARIC, A., MCLAUGHLAN, S., LARSSON, O., TOPISIROVIC, I. &

784 BOTELHO, R. J. 2019. Enhanced translation expands the endo-lysosome size and

785 promotes antigen presentation during phagocyte activation. PLoS Biol, 17, e3000535.

786 HIPOLITO, V. E. B., OSPINA-ESCOBAR, E. & BOTELHO, R. J. 2018. Lysosome

787 remodelling and adaptation during phagocyte activation. Cell Microbiol, 20.

788 HSU, A. L., MURPHY, C. T. & KENYON, C. 2003. Regulation of aging and age-related

789 disease by DAF-16 and heat-shock factor. Science, 300, 1142-5.

790 HUGHES, A. L. & GOTTSCHLING, D. E. 2012. An early age increase in vacuolar pH limits

791 mitochondrial function and lifespan in yeast. Nature, 492, 261-5.

792 IMANIKIA, S., OZBEY, N. P., KRUEGER, C., CASANUEVA, M. O. & TAYLOR, R. C.

793 2019. Neuronal XBP-1 Activates Intestinal Lysosomes to Improve Proteostasis in C.

794 elegans. Curr Biol, 29, 2322-2338 e7.

795 J. EPSTEIN, S. H. A. D. G. 1972. Studies on ageing in nematodes III. Electronmicroscopical

796 studies on age-associated cellular damage. Mechanisms of ageing and Development,

797 1, 245-255.

798 KENYON, C., CHANG, J., GENSCH, E., RUDNER, A. & TABTIANG, R. 1993. A C.

799 elegans mutant that lives twice as long as wild type. Nature, 366, 461-4.

800 KENYON, C. J. 2010. The genetics of ageing. Nature, 464, 504-12.

801 LAKOWSKI, B. & HEKIMI, S. 1998. The genetics of caloric restriction in Caenorhabditis

802 elegans. Proc Natl Acad Sci U S A, 95, 13091-6.

803 LAPIERRE, L. R., DE MAGALHAES FILHO, C. D., MCQUARY, P. R., CHU, C. C.,

804 VISVIKIS, O., CHANG, J. T., GELINO, S., ONG, B., DAVIS, A. E., IRAZOQUI, J.

40
805 E., DILLIN, A. & HANSEN, M. 2013. The TFEB orthologue HLH-30 regulates

806 autophagy and modulates longevity in Caenorhabditis elegans. Nat Commun, 4, 2267.

807 LAWRENCE, R. E. & ZONCU, R. 2019. The lysosome as a cellular centre for signalling,

808 metabolism and quality control. Nat Cell Biol, 21, 133-142.

809 LEE, S. J., HWANG, A. B. & KENYON, C. 2010. Inhibition of respiration extends C.

810 elegans life span via reactive oxygen species that increase HIF-1 activity. Curr Biol,

811 20, 2131-6.

812 LI, Y., CHEN, B., ZOU, W., WANG, X., WU, Y., ZHAO, D., SUN, Y., LIU, Y., CHEN, L.,

813 MIAO, L., YANG, C. & WANG, X. 2016. The lysosomal membrane protein SCAV-3

814 maintains lysosome integrity and adult longevity. J Cell Biol, 215, 167-185.

815 LI, Y. & TSIEN, R. W. 2012. pHTomato, a red, genetically encoded indicator that enables

816 multiplex interrogation of synaptic activity. Nat Neurosci, 15, 1047-53.

817 LIN, X. X., SEN, I., JANSSENS, G. E., ZHOU, X., FONSLOW, B. R., EDGAR, D.,

818 STROUSTRUP, N., SWOBODA, P., YATES, J. R., 3RD, RUVKUN, G. & RIEDEL,

819 C. G. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial

820 transcription factors to promote stress resistance and longevity. Nat Commun, 9,

821 4400.

822 LIPETZ, J. & CRISTOFALO, V. J. 1972. Ultrastructural changes accompanying the aging of

823 human diploid cells in culture. J Ultrastruct Res, 39, 43-56.

824 LOPEZ-OTIN, C., BLASCO, M. A., PARTRIDGE, L., SERRANO, M. & KROEMER, G.

825 2013. The hallmarks of aging. Cell, 153, 1194-217.

826 MANTEGAZZA, A. R., ZAJAC, A. L., TWELVETREES, A., HOLZBAUR, E. L.,

41
827 AMIGORENA, S. & MARKS, M. S. 2014. TLR-dependent phagosome tubulation in

828 dendritic cells promotes phagosome cross-talk to optimize MHC-II antigen

829 presentation. Proc Natl Acad Sci U S A, 111, 15508-13.

830 MARTINEZ-VICENTE, M., SOVAK, G. & CUERVO, A. M. 2005. Protein degradation and

831 aging. Exp Gerontol, 40, 622-33.

832 MELENDEZ, A., TALLOCZY, Z., SEAMAN, M., ESKELINEN, E. L., HALL, D. H. &

833 LEVINE, B. 2003. Autophagy genes are essential for dauer development and

834 life-span extension in C. elegans. Science, 301, 1387-91.

835 MIAO, R., LI, M., ZHANG, Q., YANG, C. & WANG, X. 2020. An ECM-to-Nucleus

836 Signaling Pathway Activates Lysosomes for C. elegans Larval Development. Dev

837 Cell, 52, 21-37 e5.

838 MURPHY, C. T. & HU, P. J. 2013. Insulin/insulin-like growth factor signaling in C. elegans.

839 WormBook, 1-43.

840 O'ROURKE, E. J. & RUVKUN, G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis

841 and autophagy to nutrient availability. Nat Cell Biol, 15, 668-76.

842 OLIVEIRA, R. P., PORTER ABATE, J., DILKS, K., LANDIS, J., ASHRAF, J., MURPHY, C.

843 T. & BLACKWELL, T. K. 2009. Condition-adapted stress and longevity gene

844 regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell, 8, 524-41.

845 PANOWSKI, S. H., WOLFF, S., AGUILANIU, H., DURIEUX, J. & DILLIN, A. 2007.

846 PHA-4/Foxa mediates diet-restriction-induced longevity of C. elegans. Nature, 447,

847 550-5.

848 PARK, S. K., LINK, C. D. & JOHNSON, T. E. 2010. Life-span extension by dietary

42
849 restriction is mediated by NLP-7 signaling and coelomocyte endocytosis in C.

850 elegans. FASEB J, 24, 383-92.

851 RUAL, J. F., CERON, J., KORETH, J., HAO, T., NICOT, A. S., HIROZANE-KISHIKAWA,

852 T., VANDENHAUTE, J., ORKIN, S. H., HILL, D. E., VAN DEN HEUVEL, S. &

853 VIDAL, M. 2004. Toward improving Caenorhabditis elegans phenome mapping with

854 an ORFeome-based RNAi library. Genome Res, 14, 2162-8.

855 SARIC, A., HIPOLITO, V. E., KAY, J. G., CANTON, J., ANTONESCU, C. N. & BOTELHO,

856 R. J. 2016. mTOR controls lysosome tubulation and antigen presentation in

857 macrophages and dendritic cells. Mol Biol Cell, 27, 321-33.

858 SARKIS, G. J., ASHCOM, J. D., HAWDON, J. M. & JACOBSON, L. A. 1988. Decline in

859 protease activities with age in the nematode Caenorhabditis elegans. Mech Ageing

860 Dev, 45, 191-201.

861 SCHMEISSER, S., SCHMEISSER, K., WEIMER, S., GROTH, M., PRIEBE, S., FAZIUS, E.,

862 KUHLOW, D., PICK, D., EINAX, J. W., GUTHKE, R., PLATZER, M., ZARSE, K.

863 & RISTOW, M. 2013. Mitochondrial hormesis links low-dose arsenite exposure to

864 lifespan extension. Aging Cell, 12, 508-17.

865 SENCHUK, M. M., DUES, D. J., SCHAAR, C. E., JOHNSON, B. K., MADAJ, Z. B.,

866 BOWMAN, M. J., WINN, M. E. & VAN RAAMSDONK, J. M. 2018. Activation of

867 DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived

868 mitochondrial mutants in Caenorhabditis elegans. PLoS Genet, 14, e1007268.

869 SETTEMBRE, C., DI MALTA, C., POLITO, V. A., GARCIA ARENCIBIA, M., VETRINI, F.,

870 ERDIN, S., ERDIN, S. U., HUYNH, T., MEDINA, D., COLELLA, P., SARDIELLO,

43
871 M., RUBINSZTEIN, D. C. & BALLABIO, A. 2011. TFEB links autophagy to

872 lysosomal biogenesis. Science, 332, 1429-33.

873 SHORE, D. E. & RUVKUN, G. 2013. A cytoprotective perspective on longevity regulation.

874 Trends Cell Biol, 23, 409-20.

875 STOKA, V., TURK, V. & TURK, B. 2016. Lysosomal cathepsins and their regulation in aging

876 and neurodegeneration. Ageing Res Rev, 32, 22-37.

877 SUN, T., WANG, X., LU, Q., REN, H. & ZHANG, H. 2011. CUP-5, the C. elegans ortholog

878 of the mammalian lysosomal channel protein MLN1/TRPML1, is required for

879 proteolytic degradation in autolysosomes. Autophagy, 7, 1308-15.

880 SUNDARARAMAN, V. & CUMMINGS, D. J. 1976. Morphological changes in aging cell

881 lines of Paramecium aurella. I. Alterations in the cytoplasm. Mech Ageing Dev, 5,

882 139-54.

883 TERMAN, A. & BRUNK, U. T. 2004. Lipofuscin. Int J Biochem Cell Biol, 36, 1400-4.

884 TOTH, M. L., SIGMOND, T., BORSOS, E., BARNA, J., ERDELYI, P., TAKACS-VELLAI,

885 K., OROSZ, L., KOVACS, A. L., CSIKOS, G., SASS, M. & VELLAI, T. 2008.

886 Longevity pathways converge on autophagy genes to regulate life span in

887 Caenorhabditis elegans. Autophagy, 4, 330-8.

888 TREUSCH, S., KNUTH, S., SLAUGENHAUPT, S. A., GOLDIN, E., GRANT, B. D. &

889 FARES, H. 2004. Caenorhabditis elegans functional orthologue of human protein

890 h-mucolipin-1 is required for lysosome biogenesis. Proc Natl Acad Sci U S A, 101,

891 4483-8.

892 TRUSCHEL, S. T., CLAYTON, D. R., BECKEL, J. M., YABES, J. G., YAO, Y.,

44
893 WOLF-JOHNSTON, A., BIRDER, L. A. & APODACA, G. 2018. Age-related

894 endolysosome dysfunction in the rat urothelium. PLoS One, 13, e0198817.

895 TULLET, J. M., HERTWECK, M., AN, J. H., BAKER, J., HWANG, J. Y., LIU, S.,

896 OLIVEIRA, R. P., BAUMEISTER, R. & BLACKWELL, T. K. 2008. Direct

897 inhibition of the longevity-promoting factor SKN-1 by insulin-like signaling in C.

898 elegans. Cell, 132, 1025-38.

899 VENTURA, A. S. A. N. 2017. Mitochondrial Longevity Pathways. In: ANDERS OLSEN, M.

900 S. G. (ed.) Ageing: Lessions from C. elegans. Switzerland: Springer International

901 Publishing.

902 VYAS, J. M., KIM, Y. M., ARTAVANIS-TSAKONAS, K., LOVE, J. C., VAN DER VEEN, A.

903 G. & PLOEGH, H. L. 2007. Tubulation of class II MHC compartments is

904 microtubule dependent and involves multiple endolysosomal membrane proteins in

905 primary dendritic cells. J Immunol, 178, 7199-210.

906 YANG, W. & HEKIMI, S. 2010. A mitochondrial superoxide signal triggers increased

907 longevity in Caenorhabditis elegans. PLoS Biol, 8, e1000556.

908 YOON, J., KIM, K. J., CHOI, Y. W., SHIN, H. S., KIM, Y. H. & MIN, J. 2010. The

909 dependence of enhanced lysosomal activity on the cellular aging of bovine aortic

910 endothelial cells. Mol Cell Biochem, 340, 175-8.

911 YU, L., MCPHEE, C. K., ZHENG, L., MARDONES, G. A., RONG, Y., PENG, J., MI, N.,

912 ZHAO, Y., LIU, Z., WAN, F., HAILEY, D. W., OORSCHOT, V., KLUMPERMAN, J.,

913 BAEHRECKE, E. H. & LENARDO, M. J. 2010. Termination of autophagy and

914 reformation of lysosomes regulated by mTOR. Nature, 465, 942-6.

45
915

916 Figure legends

917 Figure 1 Lysosomes exhibit age-associated changes that are suppressed in the long-lived

918 mutant daf-2.

919 (A-H) Confocal fluorescence images of the hypodermis in wild type (WT; A-D) and

920 daf-2(e1370) (E-H) expressing NUC-1::CHERRY at different ages (adult days 1, 3, 5, 9).

921 White arrowheads indicate vesicular lysosomes; white and yellow arrows indicate short and

922 long lysosomal tubules, respectively.

923 (I-L) Tubule length (I), number (J) and volume (K, L) of lysosomes were quantified in wild

924 type (WT) and daf-2(e1370) at different ages. At least 20 (I, J) or 10 (K, L) animals were

925 scored in each strain at each day.

926 (M) Time-lapse images of lysosomes in the hypodermis in wild type (WT) and daf-2(e1370)

927 expressing NUC-1::CHERRY at adult day 1, with time point 0 s in red and 60 s in green. The

928 overlay (merge) shows lysosome movement over time. Pearson’s correlation coefficient and

929 average velocity of lysosomes were determined at the indicated stages and are shown in (N,

930 O). At least 10 animals were scored in each strain at each stage.

931 In (I, J, K, L, N, O), data are shown as mean ± SD. One-way ANOVA with Tukey’s multiple

932 comparison test (I) and two-way ANOVA with Fisher’s LSD test (J, K, L, N, O) was

933 performed to compare all other datasets with wild type at day 1, or datasets that are linked by

934 lines. *P<0.05; **P<0.001. All other points had P>0.05. N.S., no significance.

935 Scale bars: 5 μm.

936

46
937 Figure 2 Lysosomal acidity and degradation activity are increased in daf-2.

938 (A-H”) Confocal fluorescence images of the intestine in wild type (WT; A-D”) and

939 daf-2(e1370) (E-H”) adults at different ages stained by LSG DND-189 and LTR DND-99.

940 (I) The relative intensity of LSG/LTR in wild type and daf-2(e1370) at different ages was

941 quantified. At least 10 animals were scored in each strain at each day.

942 (J-L) Confocal fluorescence images of the hypodermis at adult day 2 in wild type (WT; J),

943 daf-2(e1370) (K) and cup-5(bp510) (L) expressing NUC-1::pHTomato controlled by the

944 heat-shock (hs) promoter. The average intensity of pHTomato per lysosome is shown in (M).

945 At least 20 animals were scored in each strain.

946 (N) Western blot analysis of CPL-1 processing in wild type (WT) and daf-2(e1370) at

947 different adult ages. The percentage of mature CPL-1 was quantified (O). Three independent

948 experiments were performed.

949 In (I, M, O), data are shown as mean ± SD. One-way ANOVA with Tukey's multiple

950 comparisons test (I, M) or two-way ANOVA with Fisher’s LSD test (O) was performed to

951 compare all other datasets with wild type (M) or wild type at day 1 (I, O), or to compare

952 datasets that are linked by lines. *P<0.05; **P< 0.001. All other points had P>0.05. N.S., no

953 significance.

954 Scale bars: 5 μm.

955

956 Figure 3 The ultrastructure of lysosomes changes dramatically in wild type with age but is

957 maintained well in daf-2.

958 (A-J) Representative HVEM images of lysosomes in the hypodermis in wild type (WT; A-G)

47
959 and daf-2 (e1370) (H-J). Yellow arrowheads indicate vesicular lysosomes or short lysosomal

960 tubules. White arrows indicate the lysosomal tubular network formed in wild type at day 5.

961 Scale bars: 500 nm.

962 (K, L) The percentage of lysosomes within a certain morphology group revealed by HVEM

963 was quantified in wild type (WT; K) and daf-2(e1370) (L) at different ages (day 1 and day 5).

964 At least 70 lysosomes were quantified in each strain at each age.

965 (M) The diameter of vesicular lysosomes in wild type (WT) and daf-2(e1370) at different

966 ages was quantified. At least 50 vesicular lysosomes were counted in each strain at each age.

967 One-way ANOVA with Tukey's multiple comparisons test was performed to compare all other

968 datasets with wild type at day 1, or datasets that are linked by lines. *P<0.05; **P<0.001.

969

970 Figure 4 eat-2(ad1116) and isp-1(qm150) mutants exhibit increased lysosome activity.

971 (A-L) Confocal fluorescence images of the hypodermis in wild type (WT; A-D), eat-2(ad1116)

972 (E-H) and isp-1(qm150) (I-L) expressing NUC-1::CHERRY at different adult ages. White

973 arrowheads indicate vesicular lysosomes; white and yellow arrows designate short and long

974 lysosomal tubules, respectively.

975 (M-O) The length of tubular lysosomes (M), and the number (N) and mean volume (O) of

976 vesicular lysosomes were quantified in wild type (WT), eat-2(ad1116) and isp-1 (qm150) at

977 different ages. At least 10 animals were scored in each strain at each age.

978 (P-R) Confocal fluorescence images of the hypodermis in wild type (WT; P), eat-2(ad1116)

979 (Q) and isp-1(qm150) (R) expressing NUC-1::pHTomato controlled by the heat-shock (hs)

980 promoter. The average intensity of pHTomato per lysosome was quantified (S). At least 20

48
981 animals were scored in each strain.

982 (T, V) Western blot analysis of CPL-1 processing in eat-2(ad1116) (T) and isp-1(qm150) (V)

983 at different ages. The percentage of mature CPL-1 was quantified (U, W). Three independent

984 experiments were performed.

985 In (M, N, O, S, U, W), data are shown as mean ± SD. One-way ANOVA with Tukey's

986 multiple comparisons test (M, S) or two-way ANOVA with Fisher’s LSD test (N, O, U, W)

987 was performed to compare all other datasets with wild type (S) or wild type at day 1(M, N, O,

988 U, W) or datasets that are linked by lines. *P<0.05; **P<0.001. All other points had P>0.05.

989 N.S., no significance. Scale bars: 5 μm.

990

991 Figure 5 Lysosomal gene expression is upregulated in the long-lived mutants daf-2, eat-2 and

992 isp-1.

993 (A) Expression of 85 lysosome-related genes in wild type at day 1 and day 5 was analyzed. 43

994 and 13 lysosomal genes were down- and up-regulated with age, respectively. Expression of 29

995 lysosomal genes was unaltered at day 5 compared with day 1.

996 (B, C) Quantitative RT-PCR (qRT-PCR) analyses of the 43 downregulated lysosomal genes in

997 wild type at day 1 and day 5.

998 (D-F) Expression of the 43 downregulated lysosomal genes was analyzed by qRT-PCR at day

999 1 in daf-2 (D), isp-1 (E) and eat-2 (F) worms.

1000 In (B-F), three independent experiments were performed. The transcription level of lysosomal

1001 genes in wild type (WT) at day 1 was normalized to “1” for comparison. Data are shown as

1002 mean ± SD. Multiple t testing was performed to compare mutant datasets with wild type.

49
1003 *P<0.05; **P<0.001.

1004

1005 Figure 6 DAF-16 and SKN-1 are required for the upregulation of lysosomal genes and

1006 maintenance of lysosomal acidity and activity in daf-2 mutants.

1007 (A, B) Expression of the 20 upregulated lysosomal genes in daf-2 mutants was analyzed by

1008 qRT-PCR in daf-16;daf-2 (A) and daf-2;skn-1 (B) worms at day 1. Three independent

1009 experiments were performed. The transcription level of lysosomal genes in daf-2(e1370) at

1010 day 1 was normalized to “1” for comparison.

1011 (C-J) Confocal fluorescence images of the hypodermis in the indicated strains expressing

1012 NUC-1::pHTomato controlled by the heat-shock (hs) promoter. Scale bars: 5 μm. The average

1013 intensity of pHTomato per lysosome was quantified (K). At least 20 animals were scored in

1014 each strain.

1015 (L) The relative intensity of LSG/LTR in the intestine was quantified in the indicated strains

1016 at day 2. At least 10 animals were scored in each strain.

1017 (M) Western blot analysis of CHERRY cleavage from NUC-1::CHERRY in the indicated

1018 strains at day 1. Quantification is shown in (N). Three independent experiments were

1019 performed.

1020 In (A, B, K, L, N), data are shown as mean ± SD. Multiple t testing (A, B), or one-way

1021 ANOVA with Tukey's multiple comparisons test (K, L, N) was performed to compare datasets

1022 of double mutants with daf-2 (A, B) or to compare all other datasets with wild type (L, N) or

1023 with wild type treated with control RNAi (K), or datasets that are linked by lines (K, L, N).

1024 *P<0.05; **P<0.001. All other points had P>0.05. N.S., no significance.

50
1025

1026 Figure 7 DAF-16 and SKN-1, but not PHA-4, regulate lysosomal acidity and gene expression

1027 in eat-2 mutants.

1028 (A, B, M) Expression of the 14 upregulated lysosomal genes in eat-2(ad1116) was analyzed

1029 by qRT-PCR in daf-16;eat-2 (A), eat-2;skn-1 (B) and eat-2;pha-4 RNAi (M) worms at day 1.

1030 Three independent experiments were performed. The transcription level of lysosomal genes in

1031 eat-2(ad1116) (A, B) or eat-2(ad1116) control RNAi (M) at day 1 was normalized to “1” for

1032 comparison.

1033 (C-J, N-Q) Confocal fluorescence images of the hypodermis in the indicated strains

1034 expressing NUC-1::pHTomato controlled by the heat-shock (hs) promoter. Scale bars: 5 μm.

1035 The average intensity of pHTomato per lysosome was quantified (K, R). At least 20 animals

1036 were scored in each strain.

1037 (L) The relative intensity of LSG/LTR in the intestine was quantified in the indicated strains

1038 at day 2. At least 10 animals were scored in each strain.

1039 In (A, B, K, L, M, R), data are shown as mean ± SD. Multiple t testing (A, B, M) or one-way

1040 ANOVA with Tukey's multiple comparisons test (K, L, R) was performed to compare datasets

1041 of double mutants with eat-2 (A, B), or eat-2 control RNAi (M), or to compare all other

1042 datasets with wild type treated with control RNAi (K, L, R), or datasets that are linked by

1043 lines (K, L, R). *P<0.05; **P<0.001. All other points had P>0.05. N.S., no significance.

1044

1045 Figure 8 DAF-16 and SKN-1, but not HIF-1, regulate lysosomal acidity and gene expression

1046 in isp-1 mutants.

51
1047 (A, B, M) Expression of the 10 upregulated lysosomal genes in isp-1(qm150) was analyzed

1048 by qRT-PCR in daf-16;isp-1 (A), isp-1 skn-1 RNAi (B) and isp-1;hif-1 (M) worms at day 1.

1049 Three independent experiments were performed. The transcription level of lysosomal genes in

1050 isp-1(qm150) or isp-1(qm150) control RNAi at day 1 was normalized to “1” for comparison.

1051 (C-J, N-Q) Confocal fluorescence images of the hypodermis in the indicated strains

1052 expressing NUC-1::pHTomato controlled by the heat-shock (hs) promoter. Scale bars: 5 μm.

1053 The average intensity of pHTomato per lysosome was quantified (K, R). At least 20 animals

1054 were scored in each strain.

1055 (L) The relative intensity of LSG/LTR in the intestine was quantified in the indicated strains

1056 at day 2. At least 10 animals were scored in each strain.

1057 In (A, B, K, L, M, R), data are shown as mean ± SD. Multiple t testing (A, B, M) or one-way

1058 ANOVA with Tukey's multiple comparisons test (K, L, R) was performed to compare datasets

1059 of double mutants with isp-1 (A, M), or isp-1 control RNAi (B), or to compare all other

1060 datasets with wild type (R) or with wild type treated with control RNAi (K, L), or to compare

1061 datasets that are linked by lines (K, L, R). *P<0.05; **P<0.001. All other points had P>0.05.

1062 N.S., no significance.

1063

1064 Figure 9 Lysosome activity is important for clearance of aggregate-prone proteins and

1065 lifespan extension.

1066 (A-H) Confocal fluorescence images of the oocytes in wild type (WT; A, B), cup-5(bp510) (C,

1067 D), daf-2(e1370) (E, F) and daf-2 cup-5 (G, H) expressing NMY-2::GFP at different ages.

1068 White arrows indicate NMY-2::GFP puncta. Scale bars: 10 μm.

52
1069 (I-K) The average intensity of NMY-2::GFP (I, J) and the number of NMY-2::GFP puncta (K)

1070 were quantified. 50 animals were scored in each strain.

1071 (L-Q) Lifespan analyses were performed in the indicated strains. More than 100 worms were

1072 examined in each strain and three independent experiments were performed. The mean

1073 lifespan in the indicated strains was quantified and is shown in (M, O, Q).

1074 In (I, J, M, O, Q), data are shown as mean ± SD. One-way ANOVA with Tukey's multiple

1075 comparisons test (I, J) or multiple t testing (M, O, Q) was performed to compare all other

1076 datasets with wild type, or datasets that are linked by lines. *P<0.05; **P<0.001. All other

1077 points had P>0.05.

1078

1079 Supplemental figure legends

1080 Figure 1-figure supplement 1 Lysosomes exhibit age-associated alterations in C. elegans.

1081 (A, B) Confocal fluorescence images of the hypodermis in wild type (WT; A) and

1082 daf-2(e1370) (B) expressing NUC-1::CHERRY at day 15. White arrowheads indicate

1083 vesicular lysosomes; white and yellow arrows designate short and longer tubular lysosomal

1084 structures, respectively.

1085 (C, D) Confocal fluorescence images of the body wall muscle cell (C) and the intestine (D) in

1086 wild type and daf-2(e1370) expressing LAAT-1::GFP at different ages (days 1, 3, 5, 9). White

1087 arrowheads indicate vesicular lysosomes; white and yellow arrows designate short and long

1088 tubular lysosomal structures, respectively.

1089 (E-H) The number (E, G) and average volume (F, H) of vesicular lysosomes labeled by

1090 LAAT-1::GFP in the body wall muscle cell (E, F) and the intestine (G, H) were quantified in

53
1091 wild type and daf-2(e1370) at the indicated stages. At least 10 animals were scored in each

1092 strain at each age.

1093 (I) Western blot analysis of NUC-1::CHERRY cleavage in wild type (WT) and daf-2(e1370)

1094 at day 1. Quantification is shown in (J). Three independent experiments were performed.

1095 In (E, F, G, H, J), data are shown as mean ± SD. Two-way ANOVA with Fisher’s LSD test

1096 (E-H) or paired t testing (J) was performed to compare all other datasets with wild type (J), or

1097 wild type at day 1 (E-H), or to compare datasets that are linked by lines (E-H). *P<0.05;

1098 **P< 0.001. All other points had P>0.05. N.S., no significance.

1099 Scale bars: 5 μm.

1100

1101 Figure 2-figure supplement 1 pHTomato can be used to probe lysosomal acidity in C.

1102 elegans.

1103 (A-B’’) Confocal fluorescence images of the hypodermis in wild type (WT) at day 1 (A-A’’)

1104 and day 5 (B-B’’) stained by LSG DND-189 and LTR DND-99. White arrowheads indicate

1105 vesicular lysosomes stained by both LSG and LTR; yellow arrowheads indicate an

1106 LTR-positive and LSG-negative vesicular lysosome. White arrows indicate lysosomal tubules

1107 stained by LTR but not LSG.

1108 (C, D) The relative intensity of LSG/LTR in the hypodermis (C) and the percentage of

1109 LTR-positive lysosomes stained by LSG (D) was quantified. At least 10 animals were

1110 quantified at each day.

1111 (E-G’’) Confocal fluorescence images of the hypodermis in wild type (WT, E-E’’),

1112 daf-2(e1370) (F-F’’) and cup-5 (bp510) (G-G’’) expressing SCAV-3::GFP and

54
1113 NUC-1::pHTomato controlled by the heat-shock (hs) promoter. NUC-1::pHTomato is

1114 delivered to lysosomes labeled by SCAV-3::GFP at 24 h post heat-shock treatment.

1115 (H-J) Confocal fluorescence images of the hypodermis in wild type (WT; H), daf-2(e1370) (I)

1116 and cup-5 (bp510) (J) expressing NUC-1::sfGFP::CHERRY controlled by the heat-shock (hs)

1117 promoter.

1118 (K) The average intensity of CHERRY in each lysosome was quantified. At least 20 animals

1119 were scored in each strain.

1120 In (C, D, K), data are shown as mean ± SD. Paired t testing (C, D) or one-way ANOVA with

1121 Tukey's multiple comparisons test (K) was performed to compare all other datasets with wild

1122 type at day 1 (C, D) or with wild type (K). **P<0.001. All other points had P>0.05.

1123 Scale bars: 5 μm.

1124

1125 Figure 4-figure supplement 1 Lysosome acidity and motility increase in eat-2(ad1116) and

1126 isp-1(qm150) mutants.

1127 (A) Lysosomal velocity was quantified in wild type (WT), eat-2(ad1116) and isp-1(qm150) at

1128 different ages (days 1, 3, 5, 9).

1129 (B-I’’) Confocal fluorescence images of the intestine in eat-2(ad1116) (B-E”) and

1130 isp-1(qm150) (F-I”) at different ages (days 1, 3, 5, 9) stained by LSG DND-189 and LTR

1131 DND-99. The asterisks in (B-G’’) indicate accumulation of the dye in the intestinal lumen.

1132 Scale bars: 5 μm. Quantification of the relative intensity of LSG/LTR is shown in (J).

1133 In (A, J), at least 10 animals were scored in each strain at each age, and data are shown as

1134 mean ± SD. One-way ANOVA with Tukey's multiple comparisons test (J) or two-way

55
1135 ANOVA with Fisher’s LSD test (A) was performed to compare all other datasets with wild

1136 type at day 1, or datasets that are linked by lines. *P<0.05; **P<0.001. All other points had

1137 P>0.05. N.S., no significance.

1138

1139 Figure 6-figure supplement 1 DAF-16 and SKN-1 play an overlapping role in regulating

1140 lysosomal gene expression in daf-2 mutants.

1141 (A) Venn diagram showing the genes that are upregulated in daf-2(e1370), eat-2(ad1116) and

1142 isp-1(qm150). Two genes (in red) are upregulated in all three long-lived mutants.

1143 (B) Left: Venn diagram showing the genes that are significantly downregulated by loss of

1144 daf-16 or skn-1 function in daf-2 mutants. Six genes (in red) depend on both daf-16 and skn-1.

1145 Right: Expression of the 6 DAF-16- and SKN-1-dependent lysosome genes in daf-2 was

1146 analyzed in the indicated double and triple mutants.

1147 (C-J’’) Confocal fluorescence images of the intestine stained by LSG DND-189 and LTR

1148 DND-99 in the indicated strains at day 2. The asterisks (C-C”, E-F”, H-I”) indicate

1149 accumulation of the dye in the intestinal lumen. Scale bars: 5 µm.

1150 (L, N) Expression levels of the 20 upregulated lysosomal genes in daf-2(e1370) were

1151 analyzed by qRT-PCR in daf-2;hlh-30 (L) and hsf-1;daf-2 (N) worms at day 1. Most

1152 HLH-30-responsive lysosomal genes in daf-2 are also targeted by DAF-16 (K).

1153 (M, O) Western blot analysis of NUC-1::CHERRY cleavage in the indicated strains at day 1.

1154 Quantification is shown in the right panels.

1155 In (B, L-O), three independent experiments were performed, and data are shown as mean ±

1156 SD. The transcription level of lysosomal genes in daf-2(e1370) at day 1 was normalized to “1”

56
1157 for comparison (B, L, N). Multiple t testing (B, L, N) or one-way ANOVA with Tukey's

1158 multiple comparisons test (M, O) was performed to compare datasets of double mutants with

1159 daf-2 (L, N), or to compare datasets of daf-2;skn-1 and daf-16;daf-2;skn-1 with daf-16;daf-2

1160 (B), or to compare all other datasets with wild type (M, O) or datasets that are linked by lines

1161 (B, M, O). *P<0.05; **P<0.001. All other points had P>0.05. N.S., no significance.

1162

1163 Figure S7-figure supplement 1 DAF-16 and SKN-1 regulate lysosomal gene expression in

1164 eat-2 and isp-1 mutants in different manners.

1165 (A, B) Left: Venn diagram showing the genes that were significantly downregulated by loss of

1166 daf-16 or skn-1 in eat-2 (A) and isp-1 (B) mutants. The genes that depend on both daf-16 and

1167 skn-1 are shown in red. Right: Expression of the DAF-16- and SKN-1-dependent lysosome

1168 genes was analyzed in the indicated double and triple mutants. The transcription level of

1169 lysosomal genes in eat-2(ad1116) (A) or isp-1(qm150) control RNAi (B) at day 1 was

1170 normalized to “1” for comparison.

1171 (C-J) Western blot analysis of NUC-1::CHERRY cleavage in the indicated strains at day 1 (C,

1172 E, G, I). Quantification analyses are shown in (D, F, H, J). The asterisk in (G) indicates a

1173 non-specific band.

1174 In (A, B, D, F, H, J), three independent experiments were performed and data are shown as

1175 mean ± SD. Multiple t testing (A, B) was performed to compare datasets of eat-2;skn-1 and

1176 daf-16;eat-2;skn-1 with daf-16;eat-2 (A), or to compare datasets of isp-1 skn-1 RNAi and

1177 daf-16;isp-1 skn-1 RNAi with daf-16;isp-1 control RNAi (B). One-way ANOVA with

1178 Fisher’s LSD test (D, F, J) or paired t testing (H) was performed to compare all other datasets

57
1179 with wild type (D, J) or with wild type treated with control RNAi (F), or to compare

1180 eat-2;pha-4 RNAi with eat-2 control RNAi (H), or datasets that are linked by lines (A, B, D,

1181 F, J). *P<0.05; **P<0.001. All other points had P>0.05. N.S., no significance.

1182

1183 Figure 9-figure supplement 1 Lysosome activity is important for clearance of

1184 aggregate-prone proteins in eat-2 and isp-1 mutants.

1185 (A-L) Confocal fluorescence images of the oocytes in wild type (WT; A, B), cup-5(bp510) (C,

1186 D), eat-2(ad1116) (E, F), eat-2;cup-5 (G, H), isp-1(qm150) (I, J) and cup-5;isp-1 (K, L)

1187 expressing NMY-2::GFP at day 1 and day 5. Scale bars: 10 μm.

1188 (M-O) The average intensity of NMY-2::GFP (M, N) and the number of NMY-2::GFP puncta

1189 (O) was quantified. 50 animals were counted in each strain at each day.

1190 (P-W’’) Confocal fluorescence images of the intestine in wild type (WT; P-S”) and

1191 cup-5(bp510) (T-W”) adults at different ages stained by LSG DND-189 and LTR DND-99.

1192 The asterisks in (Q-W”) indicate accumulation of the dye in the intestinal lumen. Scale bars: 5

1193 µm. Quantification is shown in (X).

1194 (Y) Western blot analysis of CPL-1 processing in wild type (WT) and cup-5(bp510) at

1195 different adult ages. The percentage of mature CPL-1 was quantified and shown in (Z). Three

1196 independent experiments were performed.

1197 In (M, N, X, Z), data are shown as mean ± SD. One-way ANOVA with Tukey's multiple

1198 comparisons test (M, N, X) or two-way ANOVA with Fisher’s LSD test (Z) was performed to

1199 compare all other datasets with wild type (M, N), or with wild type at day 1 (X, Z) or datasets

1200 that are linked by lines. *P<0.05; **P<0.001. All other points had P>0.05. N. S., no

58
1201 significance.

1202

1203 Source data

1204 1. Figure 1-source data 1

1205 Numerical data that are represented as a bar graph in Figure 1I-L, N, O.

1206 2. Figure 1-source data 2

1207 Numerical data that are represented as a bar graph in Figure 1-figure supplement 1E- H

1208 and J.

1209 3. Figure 2-source data 1

1210 Numerical data that are represented as a bar graph in Figure 2I, M and O.

1211 4. Figure 2-source data 2

1212 Numerical data that are represented as a bar graph in Figure 2-figure supplement 1C, D

1213 and K.

1214 5. Figure 3-source data 1

1215 Numerical data that are represented as a bar graph in Figure 3K-M.

1216 6. Figure 4-source data 1

1217 Numerical data that are represented as a graph in Figure 4M, N, O, S, U and W.

1218 7. Figure 4-source data 2

1219 Numerical data that are represented as a graph in Figure 4-figure supplement 1A and J.

1220 8. Figure 5-source data 1

1221 Numerical data that are represented as a bar graph in Figure 5B-F.

1222 9. Figure 6-source data 1

59
1223 Numerical data that are represented as a bar graph in Figure 6A, B, K, L, N.

1224 10. Figure 6-source data 2

1225 Numerical data that are represented as a bar graph in Figure 6-figure supplement 1B, L-O.

1226 11. Figure 7-source data 1

1227 Numerical data that are represented as a bar graph in Figure 7A, B, K-M, R.

1228 12. Figure 7-source data 2

1229 Numerical data that are represented as a bar graph in Figure 7-figure supplement 1A, B,

1230 D, F, H, J.

1231 13. Figure 8-source data 1

1232 Numerical data that are represented as a bar graph in Figure 8A, B, K-M, R.

1233 14. Figure 9-source data 1

1234 Numerical data that are represented as a bar graph in Figure 9I-Q.

1235 15. Figure 9-source data 2

1236 Numerical data that are represented as a bar graph in Figure 9-figure supplement 1M-O,

1237 X and Z.

1238

1239 Supplementary files

1240 Supplementary file 1 The 85 lysosome-related genes analyzed by RT-PCR.

1241 Supplementary file 2 Expression of 43 lysosomal genes is reduced in wild type (WT) at
1242 Day 5.
1243 Supplementary file 3 Expression of 13 lysosomal genes is increased in wild type (WT) at
1244 Day 5.
1245 Supplementary file 4 Expression of 29 lysosome genes is unaltered in wild type (WT) at
1246 Day 5.
1247 Supplementary file 5 Lysosome gene expression is upregulated in daf-2, eat-2 and isp-1
1248 mutants.

60
1249 Supplementary file 6 Primers used for quantitative RT-PCR, related to key resource
1250 table.

1251

1252

61