Int J Enteric Pathog. 2016 February; 4(1): e32472.

doi: 10.17795/ijep32472
Published online 2016 February 3. Research Article

An Efficient DNA Extraction Method for Lactobacillus casei, a Difficult-to-

Lyse Bacterium
1,2 1,*
Mojtaba Alimolaei and Mehdi Golchin
1Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, IR Iran
2Department of Anaerobic Bacterial Vaccine Research and Production, Razi Vaccine and Serum Research Institute, Kerman Branch, Kerman, IR Iran

*Corresponding author: Mehdi Golchin, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, IR Iran. Tel/Fax: +98-343257447,
E-mail: golchin@uk.ac.ir

Received 2015 August 16; Revised 2015 September 6; Accepted 2015 September 22.

Abstract
Background: There are several protocols to extract DNA from Lactobacillus spp. In the case of L. casei it is harder because of its especial and
thick cell wall.
Objectives: In this study, nine DNA extraction protocols (by lysozyme treatment) were evaluated and compared in two categories
(traditional and kit-based protocols) and an improved method was presented.
Materials and Methods: DNA quantity and quality was determined by spectrophotometry, agarose gel electrophoresis and polymerase
chain reaction (PCR).
Results: The results revealed that the yield of extracted DNA differed by each protocol (5.8 - 17.1 μg/100 μL), but provided appropriate DNA
for PCR amplification. The modified protocol offered the best total DNA extraction method when both quality (DNA purity; 1.54 μg) and
quantity (DNA yield; 17.1 μg) were considered.
Conclusions: We suggest this protocol for effective and inexpensive DNA isolation from L. casei for downstream biological processes such
as PCR.

Keywords: DNA, Extraction, Modified Protocols, Lactobacillus casei

1. Background
Cell wall of Gram-positive bacteria has several distinc- of lysine (9). The peptide side chains are then cross-linked
tive structures and protects the protoplast from me- by a transpeptidase (1).
chanical damage and osmotic rupture or lysis. The mu- Abed evaluated five methods for the extraction and pu-
rein layer (a thick peptidoglycan layer) is the ubiquitous rification of DNA from cultured Lactobacillus colonies
component of the Gram-positive cell wall which provides isolated from dairy products. The results obtained in that
shape, stability and viability. This layer contains almost study confirmed that wizard genomic DNA purification
equal amounts of polysaccharides and peptides (1, 2) and kit with modifications was superior to other methods
is composed of a polymer of disaccharide (glycan) chains because it produced a higher DNA yield with the high-
of repeating N-acetylglucosamine and N-acetylmuramic est purity (10). Scornec et al. set up a rapid 96-well plate
acid residues (linked β1 → 4) and is cross-linked by short DNA extraction protocol for L. casei. They optimized the
chains of amino acids (peptide) (1). DNA extraction procedure based on silica membranes in
Undermining progress in Lactobacillus genetics has 96-column format to obtain genomic DNA from a large
been the difficulty in achieving cell lysis with lysozyme number of mutants (8). De et al. presented a simple, inex-
(3, 4) and developing reliable procedures for DNA isola- pensive and effective genomic DNA isolation procedure
tion (5). L. casei is a rod-shaped, Gram positive and highly for Lactobacillus isolates. They verified the quality of the
lysis-resistant bacterium (6, 7). In this species, because of isolated genomic DNA by restriction digestion and poly-
its special cell wall structure, genetic studies have several merase chain reaction (PCR) (11).
difficulties (8). Polysaccharide and peptidoglycan moi- In recent years, various molecular techniques have been
eties are the major surface components of this bacterium used for the lysis of L. casei by chemical and mechanical
(5, 7). The primary structure of its peptidoglycan has a protocols (12). In chemical methods, the peptidoglycan
common monomer GlcNAc–MurNAc–L-Ala–g-DGlu–L-Lys– can be lysed by cell wall hydrolase enzymes (e.g. lyso-
D-Ala with an asparagine attached to the ω-amino group zyme or mutanolysin). Mutanolysin is costly, not gener-

Copyright © 2016, Alborz University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCom-
mercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial us-
ages, provided the original work is properly cited.
 Alimolaei M et al.

ally available, and thus unsuitable for routine use in labo- cubated overnight at 37°C. Subsequently 50 μL of protein-
ratories. High resistance to lysozyme is also observed in ase K (20 mg/mL) was added and the tube was incubated
several lactobacilli species (1). for 30 minutes at 55°C. The suspension was centrifuged at
12000 rpm at room temperature for five minutes and the
2. Objectives pellet was gently resuspended in 950 μL of lysis solution
(10 mM Tris-HCl, PH 8.0, 1 mM EDTA, 0.1% (w/v) sodium do-
In the current study, we evaluated several different DNA
decyl (SDS)). Then, 15 μL of RNase A (20 mg/mL) was added
extraction protocols using lysozyme treatment and com-
to the lysate and incubated for 45 minutes at 37°C with
pared them with a new modified method.
gentle inversion. For protein precipitation, 300 μL of pro-
3. Materials and Methods
tein precipitation solution (6 mL of 5 M potassium acetate,
1.15 mL of glacial acetic acid and 2.85 mL of distilled water)
was added to the lysate mixture and vortexed at medium
3.1. Bacterial Strains and Growth Conditions speed for 20 seconds. The lysate was centrifuged at 12000
For the analysis of both plasmid and genomic DNA, a re- rpm for 20 minutes and the supernatant was transferred
combinant L. casei was constructed and used in this study. to a clean 1.5 mL microtube. One additional centrifugation
Briefly, beta toxin gene of Clostridium perfringens was syn- step at 12000 rpm for 10 minutes was performed to remove
thesized by Generay biotechnology company (China) and any residual protein. To precipitate DNA, 600 μL of cold
cloned in NaeI and BamHI restriction sites of pT1NX vec- isopropanol was added and the sample was centrifuged
tor obtained from BCCM/LMBP plasmid collection of uni- at 12000 rpm for 20 minutes; then, the pellet was washed
versity of Ghent, Belgium (http://bccm.belspo.be/about/ with 70% ethanol before air drying for 15 minutes. Finally,
lmbp.php). The modified vector was transformed to L. the pellet was resuspended in 100 μL of Tris-EDTA buffer (10
casei ATCC: 393 by a Gene PulserTM apparatus (Bio-Rad mM Tris Hcl, 1 mM EDTA, pH = 8.0) and kept at 65°C for 15
laboratories, Richmond, CA). This strain was grown stati- minutes and stored at −20°C till further analysis (14).
cally at 37°C for 24 hours in Lactobacillus de Man, Rogosa
and Sharpe (MRS) broth (Himedia, India) supplemented 3.3.3. P3 Protocol
with erythromycin (7.5 μg/mL), anaerobically. Wild-type L. In the third protocol, the pellet was washed thrice with
casei was grown in MRS broth without erythromycin, too. 2 mL of NaCl-EDTA (30 mM NaCl, 2 mM EDTA, pH = 8.0)
and resuspended in 100 µL of this buffer and then 100 µL
3.2. DNA Extraction of freshly prepared lysozyme solution (10 mg/mL in NaCl-
All the DNA manipulations were performed according EDTA) was added and mixed. This mixture was incubated
to standard procedures (13). In this study, eight DNA ex- at 37°C for one hour with periodic shaking. To remove
traction protocols in two categories (traditional and kit- RNA, 1 µL of RNase A solution (20 mg/mL) was also added
based protocols) and an improved method were tested. to the mixture before incubation. The volume of the mix-
After 24 hours of incubation at 37°C, cultures of L. casei (3 ture was then made up to 500 µL with additional NaCl-
mL) in the exponential phase of growth (approximately EDTA, 50 µL of a 10% SDS solution and 10 µL of proteinase
1.6 unit of OD600 nm) were centrifuged for three min- K solution (20 mg/mL). The contents were mixed thor-
utes at 12000 rpm. These bacterial pellets were used for oughly and incubated at 55°C for one hour. After incuba-
total DNA (genomic and plasmid) extraction. tion, 200 µL protein precipitation solution (same as the
P2 protocol) was added and vortexed at medium speed
for 20 seconds and kept on ice for five minutes. The lysate
3.3. Traditional Protocols
was centrifuged at 12000 rpm for three minutes and the
In this category, four protocols were used as follows. supernatant was transferred to a clean 1.5 mL tube. DNA
in the supernatant was precipitated with 600 µL of cold
3.3.1. P1 Protocol isopropanol and pelleted by centrifugation at 12000 rpm
This method, popularly known as boiling, was based on at room temperature for three minutes. The supernatant
Abdulla (14) with no relevant modification. One milliliter was discarded and the DNA pellet was washed once with
of dH2O was added to the pellet. After vortexing, the sam- freshly prepared 70% ethanol and air-dried. The final pel-
ple was boiled at 100°C for 15 minutes by placing in water let obtained was dissolved in 100 µL TE buffer (10 mM Tris
bath. The suspension was cooled immediately to −20°C for HCl, 1 mM EDTA, pH = 8.0) and kept at 65°C for 15 minutes
20 minutes and centrifuged at 13000 rpm for five minutes and stored frozen at −20°C till further analysis (11).
and the supernatant was kept frozen until used (14).
3.3.4. P4 Protocol
3.3.2. P2 Protocol In this protocol, firstly, the bacterial pellet was resus-
In this protocol, the cell pellet was suspended in 750 μL pended in 480 μL of 50 mM EDTA and gently vortexed.
of 50 mM EDTA. Then, a volume of 100 μL of lysozyme solu- Then, a volume of 120 μL lysozyme (20 mg/mL) was added
tion (50 mg/mL) was added to the cell suspension and in- to the cell suspension and incubated at 37°C for two hours

36 Int J Enteric Pathog. 2016;4(1):e32472

 Alimolaei M et al.

with periodic mixing. The suspension was centrifuged Figure 1. Schematic Representation of Modified DNA Extraction from
at 12000 rpm for three minutes in room temperature Lactobacillus casei
and the supernatant was removed. The pellet was gen- Modified Method for DNA extraction
tly resuspended in 600 μL genomic lysis buffer (10 mM Exponential phase culture
Tris-HCl, pH = 8.0, 1 mM EDTA, 0.1% (w/v) SDS) containing
6 μL proteinase K solution (20 mg/mL). The sample was Centrifugation

incubated at 60°C for one hour and after the incubation, Washing the cell pellet with Nacl-EDTA

200 µL protein precipitation solution (same as P2 proto-

col) was added and kept on ice for five minutes. After this Resuspending the cell pellet in lysis buffer : TE
step, the protocol continued as same as P3 protocol. tris-HCL 20mM, EDTA 2mM
Triton X-100 (1%)
Lysozyme (20 mg/ml) First Lysis step

3.4. Kit-Based Protocols 2 h, 37˚C

In this category, five kit-based protocols were performed Add proteinase K (20 mg/ml)

as described below. Add RNase A (final concentration 0.2mg/ml) Second Lysis step
1h, 55˚C

3.4.1. P5 Protocol
Add lysis solution (700µl)
This protocol was performed exactly based on DNA ex- Third Lysis step

traction kit (DN8115C, SinaClon, Iran) according to the

manufacturer’s instruction. Add precipitation solution (525µl)

3.4.2. P6 and P7 Protocols Washing the pellet with wash buffer

DNP™ KIT
In these protocols, the pellets were resuspended in 180 Protocol

μL of lysis buffer composed of TE (Tris-HCl 20 mM, EDTA

2 mM, pH = 8.0), lysozyme (20 mg/mL) and triton X-100 Add solvent buffer (100µl)

(1% v/v). After this step, in P6 protocol we used kit and

performed the protocol according to the manufacturer’s
instruction, but in P7 protocol we incubated the mixture Placing at 65˚C for 10 min
Obtain DNA
for two hours at 37°C and after the incubation, we fol-
lowed the kit protocol from the lysis step. The main protocol modifications are in red letters.

3.4.3. P8 Protocol 3.5. Evaluation of Quantity and Quality of Extracted

In this procedure, the pellet was washed once with 500 DNA
μL NaCl-EDTA (30 mM NaCl, 2 mM EDTA, pH = 8.0) and re- The presence and integrity of the extracted DNA from dif-
suspended in 100 µL NaCl-EDTA buffer and 100 µL of freshly ferent protocols were evaluated by agarose gel (0.7%) elec-
prepared lysozyme solution (25 mg/mL). To remove RNA, 1 trophoresis using horizontal electrophoresis system (Bio-
µL of RNase A solution (20 mg/mL) was also added and the Rad). The type of band pattern indicated the quality of DNA.
mixture was incubated at 37°C for two hours with periodic The extracted DNA from each protocol was also quanti-
shaking. The lysate was centrifuged at 13000 rpm for two fied by spectrophotometry using a BioPhotometer Plus
minutes and the supernatant was poured off. After this (Eppendorf, Germany) at 260 nm and 280 nm. The qual-
step, we used kit and performed the protocol from the lysis ity of DNA was determined by A260/A280 ratio value. The
step according to the manufacturer’s protocol. system software provides the DNA concentration (ng/
μL) and automatically calculates the absorption ratio of
3.4.4. P9 Protocol (Modified Method) 260/280 (A260/A280). The total DNA yield (in 100 μL of
In this new modified protocol, several modifications samples) was calculated as described by Sambrook (13):
were made. Three lysis steps were used in this protocol DNA yield (μg) = DNA concentration (ng/μL) × total sam-
(Figure 1). The pellet was washed once with 500 μL NaCl- ple volume (μL)
EDTA (30 mM NaCl, 2 mM EDTA, pH = 8.0) and resuspend-
3.6. Polymerase Chain Reaction Using Extracted
ed in 180 μL of lysis buffer composed of TE buffer (Tris-HCl
20 mM, EDTA 2 mM, pH = 8.0), lysozyme (20 mg/mL) and DNA
triton X-100 (1% v/v). The mixture was incubated for two To check the efficiency and applicability of the extracted
hours at 37°C. Then, proteinase K (20 mg/mL) and RNase A genomic and plasmid DNA, each DNA was tested by PCR.
(final concentration: 0.2 mg/mL) were added to the mix- The extracted total DNA samples were used as template for
ture and incubated for one hour at 55°C. After the incuba- selective amplification of DNA from the 16S rRNA gene of L.
tion, we continued according to the kit protocol, except casei and cloned beta toxin gene (cpb) of C. perfringens. The
for the buffer volumes which are indicated in Figure 1. primers used for different PCRs are listed in Table 1.

Int J Enteric Pathog. 2016;4(1):e32472 37

 Alimolaei M et al.

PCR reaction was performed using 5 μL of the extract- ly. The results revealed that DNA extraction with modified
ed DNA with 25 μL of ready-to-use PCR master mix 2x protocol produced acceptable DNA purity (1.54) and high-
(PR901638, SinaClon, Iran), 2.5 μL (20 pmol/μL) of each est DNA yield (17.1 μg) when compared with other proto-
primer and dH2O till 50 μL volume was reached. Ampli- cols (Table 2). The DNA yield varied significantly depend-
fication of DNA from the 16S rRNA gene of L. casei was ing on the category of DNA extraction used (traditional
performed as described previously (15). Amplicons of cpb and kit-based protocols). The DNA yields were lower with
were obtained with 35 cycles following an initial denatur- traditional protocols when compared to the kit-based
ation step at 95°C for 10 minutes. Each cycle involved de- protocols. In almost all DNA extraction protocols it was
naturation at 94°C for one minute, annealing at 52°C for possible to visualize the DNA. Agarose gel electrophoresis
one minute, synthesis at 72°C for one minute, and a final showed better results for kit-based protocols (Figure 2).
extension step at 72°C for 10 minutes. The PCR products
were then examined for clarity and intensity. The ampli- 4.2. Polymerase Chain Reaction Amplification of
fied products were electrophoresed in 1.7% agarose gel
DNA
and observed with gel documentation system.

4. Results
All nine protocols provided effective DNA for PCR ampli-
fication with the pairs of primers used. In all the samples,
a single band of 196 bp of target cloned beta toxin gene
4.1. Quantity and Quality of Extracted DNA was amplified and visualized on agarose gel (Figure 3). In
This study evaluated different DNA extraction methods addition, in all the protocols, the 16S rRNA gene was am-
of L. casei. In the nine protocols described in this work, plified (Figure 4). These results indicated that there was
total DNA was isolated from L. casei by the lysozyme treat- no difference for PCR amplification of the target genes
ment method and was estimated spectrophotometrical- between different protocols.

Table 1. Primers to Detect 16S rRNA and Clone Beta Toxin Genes
Gene Primer Primer Sequence (5' – 3') Amplicon Size, bp Reference
16SrRNA 290 (15)
Casei-F CCCACTGCTGCCTCCCGTAGGAGT
Casei-R TGCACTGAGATTCGACTTAA
cpb 196 (16)
CPB-F GCGAATATGCTGAATCATCTA
CPB-R GCAGGAACATTAGTATATCTTC

Table 2. Yield and Quality of DNA Extracted From Lactobacillus casei by Different Protocols
Protocols Traditional Protocols Kit-Based Protocols
P1 P2 P3 P4 P5 P6 P7 P8 P9
DNA Concentration, ng/μL 62 58 112 108 120 158 90 145 171
Total Yield of DNA, μg/100 μL 6.2 5.8 11.2 10.8 12.0 15.8 9.0 14.5 17.1
Quality of DNA (A260/A280 ratio) 1.23 1.81 1.92 1.56 1.50 1.48 1.44 1.45 1.54

Figure 2. Agarose Gel Electrophoresis Pattern of Extracted Total DNA Figure 3. Amplified Polymerase Chain Reaction Products From
From Lactobacillus casei Lactobacillus casei With the Primer Set of Beta Toxin Gene

Ten microliters of DNA samples were run in each lane of a 0.7% agarose Lanes 1 - 9, Amplified PCR products (196 bp) from nine extracted DNA
gel. Lanes P1 - P9, Nine DNA extraction protocols performed in this study. protocols, respectively; Lanes M, 50 bp DNA markers (Fermentas); Lane C,
Lane M: 1 kb DNA marker (Fermentas). negative control (wild-type L. casei).

38 Int J Enteric Pathog. 2016;4(1):e32472

 Alimolaei M et al.

costly, not generally available and thus unsuitable for

Figure 4. Results of 16s rRNA Polymerase Chain Reaction Amplification
for the Identification of Lactobacillus casei
routine use in laboratories. Lysozyme is the best known
among hydrolases as binds the bacterial surface and at-
tacks peptidoglycans (18). For this reason, this suitable
and economical hydrolase was used in our protocols. The
use of lysozyme alone is insufficient for the lysis of L. ca-
sei and results in lower yield of DNA (11). For this reason,
we tested and analyzed lysozyme treatment at various
time, temperature and chemical conditions to obtain a
higher yield of pure DNA. Lysozyme is especially effective
in disrupting bacterial cells when used in combination
Lanes 1 - 9, PCR products amplicons (290 bp) from nine extracted DNA with EDTA (10, 19), which was also confirmed in our ex-
protocols, respectively; Lanes M: 100 bp DNA markers (Fermentas); Lane
perience. As our results showed, the complete lysis of L.
C+, Positive control (wild-type L. casei); Lane C−, Negative control (dH2O).
casei was achieved in concurrent use of lysozyme, EDTA
and Triton X-100.

5. Discussion
The yield of DNA was significantly higher in the kit-
based protocols (ranged: 90 - 171 ng/μL) in comparison to
The use of reproducible and efficient strategies for DNA traditional procedures (ranged: 58 - 112 ng/μL). The high-
extraction is essential for most protocols in molecular bi- est yield of DNA was extracted from the modified proto-
ology analyses (10, 17). In this study, we tried to evaluate col (17.1 μg). This was due to concurrent use of lysozyme,
different methods to find the most efficient, economic EDTA, Triton X-100 and proteinase K in multiple lysis
and performable way associated with the acceptable pu- steps of the protocol.
rity of the extracted DNA from L. casei. Our findings indi- Another key issue in the sensitivity and usefulness of
cated that the use of the modified protocol for the extrac- biological analyses such as PCR is the quality of extracted
tion of genomic and plasmid DNA from recombinant L. DNA from bacterial isolates (10). In the present study, the
casei resulted in superior performance when compared purity of extracted DNA varied between 1.23 - 1.92 in dif-
to the other methods applied under similar conditions. ferent protocols. In the boiling method (P1 protocol), the
Previous studies have been performed to evaluate differ- lowest quality product was obtained (A260/A280 = 1.23).
ent DNA extraction methods in L. casei, but an efficient, This ratio was due to the high protein contamination and
suitable and economic method for L. casei extraction is can lead to an overestimation of the real concentration of
still required (8, 10, 11, 14). In our study, we sequentially DNA (20). P2 and P3 protocols had high-purity products
tested several traditional and kit-based methods to ex- (A260/A280 1.81 and 1.92, respectively). This may be due
tract DNA from L. casei and an improved method was de- to the use of high concentration of lysozyme (50 mg/mL)
signed for this purpose. In the traditional category, only for P2 protocol and the additional step of protein pre-
four protocols were evaluated, as described. We did not cipitation and RNase (20 mg/mL) for P3 protocol, which
perform other old protocols such as phenol-chloroform may have resulted in the removal of contaminants and
DNA extraction. The disadvantages of this method are the increased the purity, similar to the previously described
toxicity of phenol/chloroform, troubles of leftovers with investigations (10, 21). The purity of DNA in all kit-based
enzymes (PCR digestion, etc.) and being time-consum- protocols was ~1.50 which was lower than that of the tra-
ing. In kit-based protocols, DNA is extracted much faster, ditional protocols. This may be due to using a single tube
cheaper and easier than traditional methods. during protein precipitation and purification steps.
Several methods are used to isolate DNA from bacteria, The time taken for the isolation of DNA by the modified
but they often involve multiple time-consuming steps protocol was slightly longer than the other protocols,
(10). These methods can vary due to the efficiency of due to the incubation times required for multiple lysis
physical and chemical characteristics of samples (17). In steps. However, considering the yield, purity and econo-
the current work, we used one type of bacterium in the my of the presented method, it made it ideal. Hence, this
same cultivating condition and time. With this policy, the method can be an economical and efficient method for
effect of physical and chemical characteristics of culture the isolation of DNA from the difficult-to-lyse bacteria:
medium was eliminated. Lactobacillus (11).
The failure of complete lysis of L. casei is due to the in- In conclusion, the comparison of nine DNA extraction
herent nature and specific cell wall which contains a protocols from recombinant L. casei showed that the
high concentration of peptidoglycan (11). Cleavage of the modified protocol can be the best method for total DNA
covalent cross-links in the peptidoglycan by enzymes can extraction from this difficult-to-lyse bacterial cell. There-
help to disrupt the cell wall. Various enzymes such as ly- fore, we offer it for many purposes such as screening of L.
sozyme, mutanolysin and labiase have been discovered casei colonies after transformation. Overall, this univer-
over the years and utilized with varying success rates by sal protocol is an inexpensive, safe and effective DNA iso-
different researchers (11). Mutanolysin and labiase are lation procedure with acceptable quality and quantity.

Int J Enteric Pathog. 2016;4(1):e32472 39

 Alimolaei M et al.

Footnotes 10. Abed TA. Evaluation of methods for the extraction and purifica-
tion of DNA of cultured Lactobacillus colony isolated from dairy
Authors’ Contribution:Mehdi Golchin designed the products. Int J Appl Microbiol Biotechnol Res. 2013;1:20–5.
project and supervised the entire experiments and man- 11. De S, Kaur G, Roy A, Dogra G, Kaushik R, Yadav P, et al. A Simple
method for the efficient isolation of genomic DNA from lactoba-
uscript writing. Mojtaba Alimolaei performed the experi- cilli isolated from traditional indian fermented milk (dahi). In-
ments and data analysis and wrote the manuscript. dian J Microbiol. 2010;50(4):412–8. doi: 10.1007/s12088-011-0079-4.
Funding/Support:This work was supported by a grant [PubMed: 22282608]
12. Keer JT, Birch L. Molecular methods for the assessment of bac-
from Iran national science foundation (INSF) under grant
terial viability. J Microbiol Methods. 2003;53(2):175–83. [PubMed:
number 920238680. 12654489]

References
13. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. New York:
Cold spring harbor laboratory press; 1989.
1. Piuri M, Sanchez-Rivas C, Ruzal SM. Cell wall modifications 14. Abdulla AA. Optimization of DNA extraction of lactobacillus spp
during osmotic stress in Lactobacillus casei. J Appl Microbiol. for Identification by tuf B gene–based polymerase chain reac-
2005;98(1):84–95. doi: 10.1111/j.1365-2672.2004.02428.x. [PubMed: tion. J Biol Agric Healthcare. 2014;4(8):122–6.
15610420] 15. Ward LJ, Timmins MJ. Differentiation of Lactobacillus casei,
2. Delcour J, Ferain T, Deghorain M, Palumbo E, Hols P. The biosyn- Lactobacillus paracasei and Lactobacillus rhamnosus by poly-
thesis and functionality of the cell-wall of lactic acid bacteria. merase chain reaction. Lett Appl Microbiol. 1999;29(2):90–2.
Antonie Van Leeuwenhoek. 1999;76(1-4):159–84. [PubMed: 10532377] [PubMed: 10499296]
3. Chassy BM, Giuffrida A. Method for the lysis of Gram-positive, 16. van Asten AJ, van der Wiel CW, Nikolaou G, Houwers DJ, Grone
asporogenous bacteria with lysozyme. Appl Environ Microbiol. A. A multiplex PCR for toxin typing of Clostridium perfringens
1980;39(1):153–8. [PubMed: 6986847] isolates. Vet Microbiol. 2009;136(3-4):411–2. doi: 10.1016/j.vet-
4. Neujahr HY, Borstad B, Logardt IM. Factors affecting the re- mic.2008.11.024. [PubMed: 19157726]
sistance of Lactobacillus fermenti to lysozyme. J Bacteriol. 17. Leite DC, Balieiro FC, Pires CA, Madari BE, Rosado AS, Coutinho
1973;116(2):694–8. [PubMed: 4745431] HL, et al. Comparison of DNA extraction protocols for microbial
5. Klaenhammer T. A general method for plasmid isolation in lacto- communities from soil treated with biochar. Braz J Microbiol.
bacilli. Current Microbiol. 1984;10(1):23–8. doi: 10.1007/BF01576043. 2014;45(1):175–83. [PubMed: 24948928]
6. Mac Faddin JF. Biochemical tests for identification of medical bacte- 18. Touch V, Hayakawa S, Fukada K, Aratani Y, Sun Y. Preparation
ria. 3rd ed. USA: Lippincott Williams and Wilkins; 1976. of antimicrobial reduced lysozyme compatible in food ap-
7. Nagaoka M, Muto M, Nomoto K, Matuzaki T, Watanabe T, Yo- plications. J Agric Food Chem. 2003;51(17):5154–61. doi: 10.1021/
kokura T. Structure of polysaccharide-peptidoglycan complex jf021005d. [PubMed: 12903984]
from the cell wall of Lactobacillus casei YIT9018. J Biochem. 19. Moore E, Arnscheidt A, KrUger A, StrOmpl C, Mau M. Simplified
1990;108(4):568–71. [PubMed: 2292584] protocols for the preparation of genomic DNA from bacterial
8. Scornec H, Tichit M, Bouchier C, Pedron T, Cavin JF, Sansonetti PJ, cultures. Molecular microbial ecology manual. 2nd ed. Netherland:
et al. Rapid 96-well plates DNA extraction and sequencing pro- Kluwer Academic Publishers; 2004. pp. 3–18.
cedures to identify genome-wide transposon insertion sites in a 20. Oliveira CF, Paim TG, Reiter KC, Rieger A, D'Azevedo PA. Evalua-
difficult to lyse bacterium: Lactobacillus casei. J Microbiol Meth- tion of four different DNA extraction methods in coagulase-
ods. 2014;106:78–82. doi: 10.1016/j.mimet.2014.08.001. [PubMed: negative staphylococci clinical isolates. Rev Inst Med Trop Sao
25135488] Paulo. 2014;56(1):29–33. doi: 10.1590/S0036-46652014000100004.
9. de Ambrosini VM, Gonzalez S, Perdigon G, de Ruiz Holgado AP, Oli- [PubMed: 24553605]
ver G. Chemical composition of the cell wall of lactic acid bacteria 21. Rantakokko-Jalava K, Jalava J. Optimal DNA isolation method for
and related species. Chem Pharm Bull (Tokyo). 1996;44(12):2263–7. detection of bacteria in clinical specimens by broad-range PCR. J
[PubMed: 8996856] Clin Microbiol. 2002;40(11):4211–7. [PubMed: 12409400]

40 Int J Enteric Pathog. 2016;4(1):e32472