Li et al.

Plant Methods 2010, 6:1

http://www.plantmethods.com/content/6/1/1
PLANT METHODS

METHODOLOGY Open Access

Protocol: a rapid and economical procedure for

purification of plasmid or plant DNA with diverse
applications in plant biology
Jian-Feng Li1,2*, Li Li1,2, Jen Sheen1,2

Abstract
Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits
enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant
tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over
a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacter-
ium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon
dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restric-
tion digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid
DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol,
we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully
recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 μl water, lead-
ing to high DNA concentrations (>1 μg/μl) for efficient biolistic bombardment of Arabidopsis seedlings, polyethy-
lene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary
plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for
large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabi-
dopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient
and economical way to extract DNA for various purposes in plant research.

Introduction In plant research, transgenic plants are usually gener-

DNA extraction is a routine procedure in most plant ated using an Agrobacterium tumefaciens-mediated
laboratories. Molecular cloning involves DNA purifica- transformation procedure, where the bacteria carry an
tion from E. coli, from PCR and restriction digestion engineered binary plasmid harboring the gene of interest
mixtures, and from agarose gel slices containing DNA for integration into the plant genome. It is important to
fragments. Genomic DNA often needs to be extracted isolate the binary plasmid from A. tumefaciens cells to
from plant tissues to facilitate subsequent PCR, sequen- verify the correct construct prior to plant transformation
cing or DNA blot analysis. Although these DNA extrac- since the latter is a relatively lengthy process. However,
tions can be accomplished using commercial kits, each the extraction of the binary plasmid from A. tumefaciens
kit is only designed for single-purpose DNA extraction is notoriously tricky due to the low plasmid copy num-
and the cost of purchasing multiple kits can represent a ber in Agrobacterium and the recalcitrance of the bac-
significant research cost. Thus, there is a strong need teria strain to cell lysis [1]. To solve these problems,
for a simple and inexpensive protocol that could be lysozyme is often added to the cell lysis solution, while
adapted to the extraction and purification of DNA from the isolated DNA is usually re-transformed into E. coli
diverse sources. to propagate before subsequent restriction digestion ver-
ification [2]. A simple and reliable protocol for Agrobac-
terium plasmid purification has not been reported.
* Correspondence: jli@molbio.mgh.harvard.edu
1
Department of Genetics, Harvard Medical School, Boston, Massachusetts,
In an attempt to develop a simple DNA purification
USA method that could meet diverse research needs, we
© 2010 Li et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Li et al. Plant Methods 2010, 6:1 Page 2 of 8
http://www.plantmethods.com/content/6/1/1

explored the silica-based technique which relies on the Preparation of silica matrix
ability of DNA to bind to silica particles in the presence The procedure to prepare the size-fractionated silica par-
of chaotropic salt [3]. By using the cheap chemical com- ticles was modified from the previous study [7]. Briefly, 5
pound silicon dioxide as a DNA binding matrix, we g silicon dioxide (Sigma, S5631) was mixed with 50 ml
have been able to develop individual DNA purification sterile water in a 50 ml Falcon tube and settled for 2 h.
sub-protocols for plasmid miniprep from E. coli or A. The supernatant, containing fine silica particles with
tumefaciens, extraction of DNA fragments from PCR sizes below ca. 1 μm, was removed and the pellet was
mixtures, restriction digests or agarose gels, and extrac- resuspended in 50 ml sterile water and re-settled for
tion of genomic DNA from plant tissues. During our another 2 h. After discarding the supernatant, the packed
trial, we have extensively simplified and streamlined silica was resuspended in 50 ml sterile water to make a
these sub-protocols to optimize time and labor effi- final concentration of approximately 100 mg/ml. One mg
ciency, as well as minimize the effective chemicals to of the silicon dioxide is able to bind 3-4.5 μg DNA [7].
achieve maximal long-term saving without sacrificing The slurry can be stored at room temperature and will be
the quality of DNA products. stable for at least 12 months.
Sub-protocol 1 (For plasmid miniprep from E. coli or A.
Materials and methods tumefaciens)
Bacterial strain 1. Pellet the cells of 2 ml E. coli overnight culture
E. coli strain TOP10 or MC1061 and A. tumefaciens (OD600 = 2.0) growing at 37°C or A. tumefaciens
strain GV3101 were used in this study. overnight culture (OD600 = 2.0) growing at 28°C
Plant growth by centrifugation at 16,000 g for 30 sec.
Arabidopsis was grown in a cycle of 12 h light/23°C fol- 2. Resuspend the cell pellet in 100 μl Resuspension
lowed by 12 h dark/20°C. Tobacco was grown in a cycle solution (Solution A) by brief vortexing.
of 16 h light/28°C followed by 8 h dark/24°C. Greening 3. Add 100 μl Alkaline lysis solution (Solution B)
maize seedlings were grown at 25°C. and invert the microfuge tube for several times.
Plasmid construction 4. Let the tube sit for 2 min for E. coli or 5 min for
Standard molecular cloning protocols were followed for A. tumefaciens at room temperature.
PCR and plasmid construction. AtHXK1 and AtWRKY29 5. Add 100 μl Neutralization solution (Solution C)
with introns were amplified by PCR from Arabidopsis and invert the tube for a few times.
genomic DNA using the following primers: AtHXK1, 6. Centrifuge at 16,000 g for 5 min and transfer the
forward: CGAGCTAGCATGGGTAA AGTAGCTGTTG supernatant to a fresh tube containing 500 μl 6 M
GA and reverse: CGAGGATCCAGAGTCTTCAAGG- NaI solution (Solution D) and mix well by invert-
TAGAGAGA; AtWRKY29, forward: CGAGCTAG- ing the tube.
CATGGACGAAGGAGACCTAGAA and reverse: 7. Add 20 μl silica matrix, mix well and let the tube
CGAGGATCCGTAATTCCATAAATACCCACT. The sit at room temperature for 2 min.
PCR product of AtWRKY29 was digested with NheI/
BamHI and inserted between the NheI/BamHI sites of NOTE: Extending the incubation time to 5 min could
pAN-GFP vector to obtain the 35S-WRKY29g-GFP plas- slightly increase the yield.
mid. A 40-bp DNA fragment containing the MYC-tag
(EQKLISEEDL) coding sequence flanked by BamHI/ 8. Pellet the matrix by centrifugation for 10 sec at
NotI sites was then inserted between the BglII/NotI 16,000 g. Pour off the supernatant and gently tap
sites of the 35S-WRKY29g-GFP plasmid to achieve the the inverted tube against a Kimwipe to drain the
35S-WRKY29g-GFP-MYC plasmid. liquid.
Transient gene expression and microscopic examination 9. Wash the matrix by resuspending with 500 μl
Particle bombardment and fluorescent imaging were Washing solution (Solution E) and vigorously
carried out according to the procedure described pre- vortexing.
viously [4]. Arabidopsis and maize protoplast transfec- 10. Repeat step 8 and 9.
tion was performed as described earlier [5,6]. 11. Pellet the matrix by centrifugation for 10 sec at
Protocol 16,000 g and remove the supernatant by
All the procedures were carried out at room tempera- pipetting.
ture unless otherwise stated. The use of different solu- 12. Centrifuge for another 10 sec and carefully pip-
tions is summarized in Figure 1 and their recipes are ette off the residual liquid.
listed in Table 1. 13. Add 40 μl sterile water to resuspend the pellet by
brief vortexing and place the microfuge tube at
70°C for 2 min.
Li et al. Plant Methods 2010, 6:1 Page 3 of 8
http://www.plantmethods.com/content/6/1/1

Plasmid miniprep DNA fragment Plant genomic

purification DNA extraction
(Sub-protocol 1) (Sub-protocol 2) (Sub-protocol 3)

E. coli A. tumefaciens PCR / restriction Agarose gel Plant tissues

cells cells digestion mixture slice

Resuspension solution Grind Resuspension solution

(Solution A) (Solution A)

Alkaline lysis solution Heat 10% SDS (Solution F)

(Solution B) Heat
Phenol:chloroform:
Centrifuge Neutralization solution Centrifuge
isoamyl alcohol
(Solution C) 4°C
(Solution G)

NaI solution (Solution D) NaI solution (Solution D) NaI solution (Solution D)

DNA solution with chaotropic salt

Centrifuge Homemade silica resin

Centrifuge Washing solution (Solution E)

Centrifuge Sterile water

High-quality DNA

Figure 1 Overview flowchart of the silica protocol for multiple purpose DNA purification in plant research. All the procedures were
carried out at room temperature unless otherwise indicated. The heating treatment was conducted at 70°C.

14. Centrifuge at 16,000 g for 2 min and transfer 36- microfuge tube at 70°C for 3 min to dissolve the
38 μl supernatant containing the eluted plasmid gel.
DNA to a fresh tube. 2. Add 10 μl silica matrix to the blend, mix well and
incubate for 2 min at room temperature.
NOTE: The remaining 2-4 μl liquid should be aban-
doned due to a slight contamination by disturbed silica NOTE: Extending the incubation time to 5 min could
particles. For protection against DNase digestion or pH slightly increase DNA recovery rate.
fluctuations, TE buffer (10 mM Tris-Cl, pH8.0, 1 mM
EDTA) should be used to elute DNA. 3. Pellet the matrix by centrifugation for 10 sec at
16,000 g and remove the supernatant by pipetting.
Sub-protocol 2 (For DNA purification from solution or 4. Wash the matrix in 500 μl Washing solution
agarose gel slice) (Solution E) by vigorously vortexing.
1. Add 150 μl 6 M NaI (Solution D) to up to 50 μl 5. Repeat step 3 and 4.
PCR or restriction digestion mixture and mix well 6. Pellet the matrix by centrifugation for 10 sec at
by inverting the tube. In case of the agarose gel 16,000 g and discard the supernatant.
slice containing DNA fragments, add 300 μl Solu- 7. Centrifuge for another 10 sec and pipette off the
tion D for every 100 mg gel slice and heat the trace amount of liquid.
Li et al. Plant Methods 2010, 6:1 Page 4 of 8
http://www.plantmethods.com/content/6/1/1

Table 1 Seven solutions used in the silica protocol

Solution Name Solution Composition Storage Usage
Solution A 50 mM Tris-HCl, pH 7.5, 10 mM 4°C Plasmid miniprep, genomic DNA
(Resuspension solution) EDTA, 100 g/ml RNase A extraction
Solution B 0.2 M NaOH, 1% sodium dodecyl Room temp. Plasmid miniprep
(Alkaline lysis solution) sulfate (SDS)
Solution C 1.32 M KOAc, pH 4.8 Room temp. Plasmid miniprep
(Neutralization solution)
Solution D 6 M NaI 4°C Plasmid miniprep, PCR/Gel
(NaI solution) purification, genomic DNA
extraction
Solution E 50% ethanol, 10 mM Tris-HCl, pH Room temp. Plasmid miniprep, PCR/Gel
(Washing solution) 7.5, 100 mM NaCl, 1 mM EDTA purification, genomic DNA
extraction
Solution F 10% SDS Room temp. Genomic DNA extraction
Solution G Phenol:chloroform:isoamyl alcohol 4°C Genomic DNA extraction
(25:24:1, v/v)
Solution D is stored in darkness; Solution G is covered by water phase with b-mercaptoethanol

8. Resuspend the matrix in 5-30 μl sterile water and 11. Pellet the matrix by centrifugation at 16,000 g for
place the microfuge tube at 70°C for 2 min. 10 sec and remove the supernatant using a
9. Centrifuge at 16,000 g for 2 min and transfer the pipette.
DNA eluate into a fresh tube. 12. Centrifuge for another 10 sec and carefully pip-
ette off the residual liquid.
NOTE: For protection against DNase digestion or pH 13. Add 40 μl sterile water to resuspend the pellet by
fluctuations, TE buffer (10 mM Tris-Cl, pH8.0, 1 mM brief vortexing and place the microfuge tube at
EDTA) should be used to elute DNA. 70°C for 2 min.
14. Centrifuge at 16,000 g for 2 min and transfer 36-
Sub-protocol 3 (For plant genomic DNA extraction) 38 μl supernatant containing the eluted genomic
1. Place approximately 10 mg of plant material in a DNA to a fresh tube.
1.5 ml microfuge tube.
2. Add 200 μl Resuspension solution (Solution A) NOTE: The remaining 2-4 μl liquid should be aban-
and grind the tissue using a Micro-Grinder homo- doned due to a slight contamination by disturbed silica
genizer (Research Products International particles. For protection against DNase digestion or pH
Corporation). fluctuations, TE buffer (10 mM Tris-Cl, pH8.0, 1 mM
3. Add 30 μl 10% SDS (Solution F) to the homoge- EDTA) should be used to elute DNA.
nate and invert the tube for several times.
4. Incubate the tube at 70°C for 10 min. Comments
5. Add 250 μl Phenol:chloroform:isoamyl alcohol Plant genomic DNA purification by the silicon dioxide
(25:24:1, v/v; Solution G) and vortex the mixture matrix
vigorously for 30 sec. Following Sub-protocol 3, high quality genomic DNA
6. Centrifuge at 4°C at 16,000 g for 5 min and trans- could be obtained from 7-day-old Arabidopsis seedlings
fer the aqueous (upper) phase to a fresh tube con- (Table 2), 4-week-old Arabidopsis leaves (Figure 2A and
taining 500 μl 6 M NaI (Solution D) and mix well Table 2), 7-day-old Nicotiana benthamiana seedlings
by inverting the tube. (Figure 2B and Table 2) and 10-day-old maize leaves
7. Add 20 μl silica matrix and let the tube sit at (Figure 2C and Table 2). The entire procedure from
room temperature for 2 min. grinding tissue to eluting genomic DNA took around 35
8. Pellet the matrix by centrifugation at 16,000 g for min. Older plant tissues accumulate secondary metabo-
10 sec and remove the supernatant by pipetting. lites and polysaccharides, which often contaminate the
9. Wash the matrix by resuspending with 1 ml extracted genomic DNA due to co-precipitation with
Washing solution (Solution E) and vigorously nucleic acids during ethanol/isopropanol precipitation
vortexing. [8]. Since only nucleic acids selectively bind to silicon
10. Repeat step 8 and 9. dioxide, they are less likely to be a problem during
Li et al. Plant Methods 2010, 6:1 Page 5 of 8
http://www.plantmethods.com/content/6/1/1

Figure 2 High quality DNA purified by the silica protocol. Gel electrophoresis pictures of PCR products, plant genomic DNA and miniprep
DNA are shown. A, Genomic PCR products of AtHXK1 and AtWRKY29 gene and Arabidopsis genomic DNA purified by silica matrix. The PCR
products of AtHXK1 (A2 and A3) and AtWRKY29 (A4 and A5) were split into two aliquots with equal amount of DNA. One aliquot was directly
subject to electrophoresis (A2 and A4) while the other was purified by silica matrix before electrophoresis (A3 and A5). Genomic DNA (500 ng)
purified from 4-week-old Arabidopsis leaves by silica matrix was loaded in A6. B, Genomic DNA purified from 7-day-old tobacco seedlings by
silica matrix. C, Genomic DNA purified from 10-day-old maize leaves by silica matrix. D, Restriction digestion verification of plasmids minipreped
from E. coli and A. tumefaciens cells following the silica protocol. The 35S-WRKY29g-GFP-MYC plasmid (400 ng) minipreped from E. coli was
digested by NheI/BamHI (D2) or BamHI/NotI (D3) before electrophoresis. The binary plasmid VKH-NLS-YFP-GUS (200 ng, [12]) prepared from A.
tumefaciens was digested by SacI/HindIII (D4) before electrophoresis. A1, B1, C1 and D1 correspond to 1 kb DNA ladder with size of each
fragment indicated.

silica-mediated DNA purification. On the other hand, We have also tried to purify PCR or restriction digestion
RNA contamination is completely removed by RNase A products from agarose gel slice. In this case, a slightly
included in Resuspension solution (Solution A; Figure reduced DNA recovery rate (i.e., 68%, Table 2) was
2A, lane A6, Figure 2B and 2C). The Arabidopsis geno- obtained and an extra heating step was required to dis-
mic DNA prepared in this way could be immediately solve the agarose gel in NaI solution (Solution D),
used as PCR template (Figure 2A). which would take two more minutes when compared
with a direct DNA purification from solution.
PCR and gel purification by the silicon dioxide matrix Purification of small (< 50 bp) DNA fragments is
DNA in PCR mixtures or restriction digests could be rather challenging even when the commercial DNA pur-
easily purified by silica matrix according to Sub-protocol ification kit is used. This is because short DNA tends to
2. The DNA recovery rate was estimated to be 70-80% bind tightly to the column matrix and is difficult to
depending on the size of the DNA fragment (Figure 2A, elute, and is also difficult to precipitate during ethanol/
lane A2-5; Table 2). This procedure took about 8 min. isopropanol precipitation. To test whether Sub-protocol

Table 2 DNA yield or recovery rate during silica-mediated purification in this study
Material DNA Sub-protocol Input DNA productiona
Yield OD260/280
E. coli 35S-WRKY29g-GFP-MYC 1 2 ml culture OD600 = 2 6.2 ± 0.3 μg 1.91 ± 0.03
E. coli pCB302 1 2 ml culture OD600 = 2 2.6 ± 0.4 μg 1.93 ± 0.03
E. coli pBI101 1 2 ml culture OD600 = 2 2.4 ± 0.3 μg 1.92 ± 0.02
E. coli pPZP222 1 2 ml culture OD600 = 2 4.7 ± 0.4 μg 1.88 ± 0.02
A. tumefaciens VKH-NLS-YFP-GUS 1 2 ml culture OD600 = 2 0.4 ± 0.03 μg 1.95 ± 0.03
DNA solution AtWRKY29 gPCR 2 1 μg DNA 78 ± 6%b 1.81 ± 0.05
Agarose gel AtWRKY29 gPCR 2 0.5 μg DNA 68 ± 2%b 1.85 ± 0.02
Arabidopsis (s)c genomic DNA 3 10 mg tissue 1.7 ± 0.1 μg 1.90 ± 0.02
Arabidopsis (l)d genomic DNA 3 10 mg tissue 1.1 ± 0.1 μg 1.93 ± 0.02
tobacco (s)e genomic DNA 3 10 mg tissue 1.9 ± 0.2 μg 1.93 ± 0.01
maize (l)f genomic DNA 3 10 mg tissue 1.0 ± 0.1 μg 1.88 ± 0.03
a. Qualities and quantities of DNA products were measured by NanoDrop ND-1000 Spectrophotometer (Thermo Scientific) and each DNA purification was
repeated for at least 5 times.
b. DNA recovery rate (i.e., yield/input × 100%) is shown instead of DNA yield.
c. Severn-day-old Arabidopsis seedlings (s) were used
d. Four-week-old Arabidopsis leaves (l) were used
e. Seven-day-old tobacco seedlings (s) were used
f. Ten-day-old maize leaves (l) were used
Li et al. Plant Methods 2010, 6:1 Page 6 of 8
http://www.plantmethods.com/content/6/1/1

Figure 3 Miniprep DNA by the silica protocol allows a long read length in DNA sequencing. The 3’ end of each DNA sequencing result
beyond 700 bp is shown with individual nucleotide peaks clearly distinguishable. The alignment of the sequencing results of 35S-WRKY29g-GFP
plasmid (upper panel) and its derivative 35S-WRKY29g-GFP-MYC (lower panel) validated a successful insertion of a MYC-epitope tag coding
sequence between the BglII/NotI sites in the 35S-WRKY29g-GFP plasmid. The MYC-tag (EQKLISEEDL) coding sequence is labeled by a line on top.
The numbers underneath the DNA sequence were generated by the sequence reading software 4Peaks http://mekentosj.com/science/4peaks/ to
indicate the read length. Note that the BglII site of the 35S-WRKY29g-GFP plasmid was removed after ligation to the BamHI site in front of the
MYC-tag coding sequence.

2 is also suitable for purifying small DNA fragments also reflected the high quality of the DNA template
from agarose gel slice, a 40-bp DNA fragment composed generated by the silica protocol.
of the MYC-epitope tag coding sequence, BamHI and We assessed whether plasmid DNA prepared by the
NotI sites was resolved in a 2.5% agarose gel and was silica protocol could be directly used in transient gene
purified from the gel slice using silica matrix. The DNA expression assays such as particle bombardment [4] and
eluate was used in ligation with BglII and NotI double protoplast transfection [5,6]. The key for efficient transi-
digested 35S-WRKY29g-GFP plasmid leading to a suc- ent gene expression is high purity DNA at high concen-
cessful insertion of the short DNA fragment into the tration, which is particularly important for successful
plasmid (Figure 3). This result suggested that the silica PEG-mediated Arabidopsis protoplast transfection [5].
protocol enabled the purification of short DNA frag- Taking advantage of the heating step during DNA elu-
ments, which presumably benefited from the heating tion, we were able to effectively elute plasmid DNA
step during DNA elution that greatly facilitated the from silica matrix using only a small volume (e.g., 5 μl)
small DNA elution from the silica matrix. of water thus could maximize the DNA concentration
Alkaline lysis combined with silica matrix for plasmid in the eluate. We randomly selected 10 single colonies
miniprep from E. coli harboring the 35S-WRKY29g-GFP-MYC plasmid for
Plasmid miniprep from 2 ml E. coli cells following miniprep. The DNA concentration in the 5 μl eluate
Sub-protocol 1 takes approximately 15 min to obtain was ranging from 1.1 to 1.4 μg/μl. It is more difficult to
DNA. The yield of 35S-WRKY29g-GFP-MYC, a 6 kb obain the same concentrated DNA eluate when the
high copy number plasmid, was about 6.2 μg (Table commercial miniprep kit is used. To evaluate the low
2). To evaluate the miniprep yield of low copy number DNA transfection limit, we chose the miniprep DNA
or larger plasmids by the silica protocol, several binary with the lowest concentration (i.e., 1.1 μg/μl) for both
vectors frequently used in plant transformation were types of transient expression assays. Two μg (1.8 μl) of
tested. Low-copy binary vectors pCB302 (5 kb, [9]) this miniprep DNA was delivered into 7-day-old Arabi-
and pBI101 (12 kb, [10]) as well as high-copy binary dopsis seedlings by particle bombardment. Hundreds of
vector pPZP222 (8.7 kb, [11]) were minipreped and cells in the cotyledons were found to express the
the yields were 2.6 μg for pCB302, 2.4 μg for pBI101 WRKY29-GFP-MYC protein in the nucleus 12 h post
and 4.7 μg for pPZP222 (Table 2). In addition to high bombardment (Figure 4A). This transformation effi-
DNA yield, silica-mediated miniprep also offers great ciency is roughly the same as that obained by using
DNA quality (Table 2). The plasmid DNA prepared equal amount of kit-minipreped DNA in bombardment
herein could be readily digested by restriction (data not shown). This silica-minipreped DNA (2.2 μg
enzymes (Figure 2D) or used as PCR template (data in 2 μl) was also used to transfect 4,000 Arabidopsis
not shown). Importantly, the resultant DNA could mesophyll protoplasts and the expression of the
generally yield sequence read length beyond 700 bp WRKY29-GFP-MYC protein was detected in the
during DNA sequencing analysis (Figure 3), which nucleus of approximately 70% of the protoplasts 12 h
Li et al. Plant Methods 2010, 6:1 Page 7 of 8
http://www.plantmethods.com/content/6/1/1

impurities would lead to the failure of electroporation

[6]. Successful expression of the WRKY29-GFP-MYC
protein was observed in the nucleus of numerous maize
protoplasts 12 h after 15 μg of miniprep DNA was used
to transfect 10 6 maize protoplasts by electroporation
(Figure 4C). These data suggested that the miniprep
DNA purified by the silica protocol could be readily
used for efficient transient assays with no need for
further purification or concentration.
The silica method for plasmid miniprep from A.
tumefaciens
Plasmid miniprep from 2 ml A. tumefaciens cells con-
taining high-copy number binary plasmid VKH-NLS-
YFP-GUS [12] was conducted according to Sub-protocol
1. After Alkaline lysis solution (Solution B) was added
to the cell resuspension, we lengthened the incubation
period to 5 min to improve the cell lysis since Agrobac-
terium was more resistant to alkaline lysis than E. coli.
The DNA yield from A. tumefaciens cells by this proto-
col was about 400 ng (Table 2), which was sufficient for
restriction digestion analysis (Figure 2D, lane D4). Bin-
ary plasmids with different sizes or copy numbers had
similar yields when minipreped from A. tumefaciens
cells (data not shown). Thus, a quick confirmation of
the correct construct in Agrobacterium by restriction
digestion is feasible using the silica-prepared binary
plasmids. The routine re-transformation of the DNA
into E. coli for propagation [2] is unnecessary.
Advantages of the silicon dioxide matrix protocol
The silica matrix-based protocol described here offers
two major advantages over other DNA purification
methods. The first advantage is its low cost. Silicon
Figure 4 Miniprep DNA eluted from silica matrix at high dioxide itself is a very cheap chemical. The cost of silica
concentration allows efficient transient gene expression assays. matrix consumed in each DNA miniprep is less than
A, Cotyledon cells of Arabidopsis seedling expressing the WRKY29- one tenth of a U.S. cent and thus is fairly affordable. All
GFP-MYC protein in the nucleus. Miniprep DNA (2 μg in 1.8 μl) was solutions used in this protocol are made from common
bombarded into 7-day-old Arabidopsis seedlings and the
observation was made 12 h post biolistic bombardment. B,
and inexpensive chemicals except NaI (Sigma, 217638).
Arabidopsis mesophyll protoplasts expressing the WRKY29-GFP-MYC Even after accommodating the expense of NaI, the total
protein in the nucleus. Miniprep DNA (2.2 μg in 2 μl) was costs for each miniprep and each PCR/gel purification
introduced into 4,000 Arabidopsis mesophyll protoplasts by PEG- are 0.15 and 0.05 U.S. dollar, respectively. A second
mediated transfection and the observation was made 12 h after advantage of the silica protocol is its versatility. Instead
transfection. C, Maize mesophyll protoplasts expressing the WRKY29-
GFP-MYC protein in the nucleus. Fifteen μg of miniprep DNA was
of purchasing different commercial kits to meet different
used to transfect 106 maize protoplasts by electroporation and the DNA purification needs, one could utilize the same
observation was made 12 h after transfection. Scale bar = 20 μm. DNA binding matrix together with Solution A-G (Table
1) for all the DNA purification work in plant research.
Besides silicon dioxide, only Solutions D and E are used
after PEG-mediated transfection (Figure 4B). This trans- by all the DNA extraction applications. The former
fection efficiency is comparable to that achieved by facilitates DNA binding to silica matrix and the latter
using CsCl gradient maxipreped DNA in protoplast washes away nonspecifically bound impurities. Solution
transfection [5]. In addition, we also tested the miniprep A is shared by plasmid miniprep and plant genomic
DNA in transient gene expression using maize meso- DNA extraction, where the inclusion of RNase A
phyll protoplasts. In this case, plasmid DNA was intro- removes RNA contamination from DNA products.
duced into maize protoplasts by electroporation, where In addition, there are a few minor advantages in using
low quality DNA containing high salt or other silicon dioxide matrix instead of the column, the latter
Li et al. Plant Methods 2010, 6:1 Page 8 of 8
http://www.plantmethods.com/content/6/1/1

being used in most of the commercial DNA purification 3. Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM,
Noordaa van der J: Rapid and simple method for purification of nucleic
kits. First, the amount of silicon dioxide matrix used in acids. J Clin Microbiol 1990, 28:495-503.
each DNA purification could be flexible depending on 4. Li JF, Nebenfüh AN: Organelle targeting of myosin XI is mediated by two
the anticipated DNA amount in the material. Second, globular tail subdomains with separate cargo binding sites. J Biol Chem
2007, 282:20593-20602.
the silica matrix could be readily separated from the 5. Yoo SD, Cho YH, Sheen J: Arabidopsis mesophyll protoplasts: a versatile
supernatant by a quick centrifugation in less than 10 cell system for transient gene expression analysis. Nat Protoc 2007,
sec. Third, avoiding liquid retention by the column 2:1565-1572.
6. Sheen J: Molecular mechanisms underlying the differential expression of
matrix, DNA binding to the silicon dioxide matrix could maize pyruvate, orthophosphate dikinase genes. Plant cell 1991, 3:225-
be efficiently eluted with a very small volume (e.g., 5 μl) 245.
of water. Fourth, the matrix resuspension could be easily 7. Boyle JS, Lew AM: An inexpensive alternative to glassmilk for DNA
purification. Trends Genet 1995, 11(8).
heated to facilitate DNA elution, whereas the column is 8. Michiels A, Ende Van Den W, Tucker M, Van Riet L, Van Laere A: Extraction
inconvenient for heating treatment. Therefore, this silica of high-quality genomic DNA from latex-containing plants. Anal Biochem
protocol not only allows scarce and precious DNA frag- 2003, 315:85-89.
9. Xiang CB, Han P, Lutziger I, Wang K, Oliver DJ: A mini binary vector series
ments to be effectively recovered in a small volume of for plant transformation. Plant Mol Biol 1999, 40:711-717.
water thus maintaining an optimal concentration for 10. Hellens R, Mullineaux P: A guide to Agrobacterium binary Ti vectors. Plant
DNA ligation, but also allows the miniprep DNA to be Mol Biol 2000, 5:446-451.
11. Hajdukiewicz P, Svab Z, Maliga P: The small, versatile pPZP family of
eluted from the silicon dioxide matrix in sufficiently Agrobacterium binary vectors for plant transformation. Plant Mol Biol
high concentrations for efficient protoplast transfection. 1994, 25:989-994.
12. Li JF, Park E, von Arnim AG, Nebenfüh AN: The FAST technique: a
simplified Agrobacterium-based transformation method for transient
Conclusion gene expression analysis in seedlings of Arabidopsis and other plant
The silicon dioxide matrix-based DNA purification pro- species. Plant Methods 2009, 5:6.
tocol presented here allows fast, simple and economical
doi:10.1186/1746-4811-6-1
purification of high quality DNA for multiple purposes Cite this article as: Li et al.: Protocol: a rapid and economical procedure
in plant research. No specialized device such as column for purification of plasmid or plant DNA with diverse applications in
plant biology. Plant Methods 2010 6:1.
or vacuum apparatus and no additional time-consuming
and yield-reducing precipitation steps are required. In
principle, we envisage that the DNA preparation by the
silica protocol could be easily scaled up to generate a
large amount of pure DNA and is promising for high-
thoughput DNA purification applications.

Acknowledgements
We are grateful to Dr. Andreas Nebenfüh (University of Tennessee) for the
generous gifts of pAN-GFP and pPZP222 vectors. This work was sponsored
by NIH R01 grants GM070567 and GM060493 to J.S.

Author details
1
Department of Genetics, Harvard Medical School, Boston, Massachusetts,
USA. 2Department of Molecular Biology, Massachusetts General Hospital,
Boston, Massachusetts 02114-2790, USA.

Authors’ contributions
JFL designed the experiments. JFL and LL performed the experiments. JFL
and JS wrote the manuscript. All authors read and approved the final
manuscript.

Competing interests
The authors declare that they have no competing interests. Submit your next manuscript to BioMed Central
and take full advantage of:
Received: 4 January 2010
Accepted: 14 January 2010 Published: 14 January 2010 • Convenient online submission
• Thorough peer review
References
1. Chen X, Ding X, Song WY: Isolation of plasmid DNA rescued from single • No space constraints or color figure charges
colonies of Agrobacterium tumefaciens by means of rolling circle • Immediate publication on acceptance
amplification. Plant Mol Biol Rep 2003, 21:411-415.
• Inclusion in PubMed, CAS, Scopus and Google Scholar
2. Wise AA, Liu Z, Binns AN: Nucleic acid extraction from Agrobacterium
strains. Methods Mol Biol 2006, 343:67-76. • Research which is freely available for redistribution

Submit your manuscript at

www.biomedcentral.com/submit