Gautam PHD Dissertation 2013

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/272091899
FATE OF SALMONELLA INTRODUCED TO CANTALOUPE THROUGH NATURAL

FRUIT CRACKS AND FLOWERS, ALONE OR IN THE PRESENCE OF THE PLANT
PATHOGEN ERWINIA TRACHEIPHILA
Thesis · May 2013

DOI: 10.13140/2.1.4060.2401
CITATIONS READS
2 12,587
1 author:
Dhiraj Gautam
United States Department of Agriculture
7 PUBLICATIONS 66 CITATIONS
SEE PROFILE
Some of the authors of this publication are also working on these related projects:
Salmonella outbreak on cantaloupe, does it enter through cracked fruit surface or flower interior? View project
Bacteriocin producing lactic acid bacteria View project
All content following this page was uploaded by Dhiraj Gautam on 10 February 2015.
The user has requested enhancement of the downloaded file.

FATE OF SALMONELLA INTRODUCED TO
CANTALOUPE THROUGH NATURAL FRUIT
CRACKS AND FLOWERS, ALONE OR IN THE
PRESENCE OF THE PLANT PATHOGEN ERWINIA
TRACHEIPHILA
By
DHIRAJ GAUTAM
Bachelor of Science in Agriculture

Tribhuvan University
Rampur, Chitwan, Nepal
2000
Master of Science in Agriculture (Plant Pathology)

Tribhuvan University
Rampur, Chitwan, Nepal
2005
Submitted to the Faculty of the

Graduate College of the
Oklahoma State University
in partial fulfillment of
the requirements for
the Degree of
DOCTOR OF PHILOSOPHY
May, 2013
FATE OF SALMONELLA INTRODUCED TO
CANTALOUPE THROUGH NATURAL FRUIT
CRACKS AND FLOWERS, ALONE OR IN THE
PRESENCE OF THE PLANT PATHOGEN ERWINIA
TRACHEIPHILA
Dissertation Approved:
Dr. Jacqueline Fletcher
Dissertation Adviser
Dr. Li Maria Ma
Co-Dissertation Adviser
Dr. John Damicone
Dr. William McGlynn
ii
ACKNOWLEDGEMENTS
I would like to express my deep sense of appreciation on behalf of sincere
guidance, valuable suggestions, and constant help to my co-advisors Drs. Jacqueline
Fletcher and Li Maria Ma. I am also deeply indebted to member of my advisory
committee, Drs. John Damicone and William McGlynn.
Thank also goes to lab mates and faculty within NIMFFAB for providing homely
environment and helping with different lab activities. I’m thankful to Drs. S. Dobhal and
Mark Payton for help in multiplex PCR optimization and statistical analysis, respectively.
I am also thankful to Dr. Blagden, R. Thapa and S. Ranganathan for help in research.
My deepest gratitude goes to my parents, for their support, their love, and
encouragement. Especial thank to my wife Sandipa and my son Samyak for their moral
support, love and guidance. I would also like to thank Nepalese community under NSA
(Nepalese Student’s Association), OSU, Stillwater for making homely environment.
I would like to conclude by thanking Oklahoma Center for the Advancement of
Science and Technology (OCAST) and Department of Entomology and Plant Pathology
for providing necessary funds and facilities respectively, and OSU Microscopy Lab
personnel Dr. Charlotte Ownby and Ms. Lisa Whitworth for their kind support while
working with scanning electron microscopy and confocal laser scanning microscopy.
iii
Acknowledgements reflect the views of the author and are not endorsed by committee members
or Oklahoma State University.
Name: DHIRAJ GAUTAM
Date of Degree: MAY, 2013
Title of Study: FATE OF SALMONELLA INTRODUCED TO CANTALOUPE

THROUGH NATURAL FRUIT CRACKS AND FLOWERS, ALONE
OR IN THE PRESENCE OF THE PLANT PATHOGEN ERWINIA
TRACHEIPHILA
Major Field: PLANT PATHOLOGY
Abstract: Salmonella-tainted cantaloupe has been implicated in foodborne

illnesses. We know little about Salmonella ecology on cantaloupe flowers and fruits, and
chose to investigate whether it can enter edible tissues, and whether its interactions with
other microbes influence its fate. We assessed the survival and potential internalization
of S. enterica and the wilt bacterium, Erwinia tracheiphila, on cantaloupe after fruit
surface or flower inoculation. S. enterica, E. tracheiphila, or a mixture of the two (107
cfu/ml) were introduced onto natural rind cracks or into the flower whorl. Inoculated rind
and sub-rind mesocarp were sampled at 0, 9 and 24 days post-inoculation (DPI). Flower
samples were collected at 0 and 43 DPI, and interior mesocarp at 15 and 43 DPI. S.
enterica survived on 40% and 14% of cantaloupe rinds inoculated with both pathogens,
or S. enterica only, respectively. 58% of E. tracheiphila inoculated samples developed
watersoaked lesions on rinds. Unlike S. enterica, E. tracheiphila traversed some fruit
cracks and 31% of sub-rind mesocarps were positive at 24 DPI. At 0 and 43 DPI all
blossom samples receiving S. enterica alone, or the mixture, were positive for S. enterica.
At 43 DPI, the populations of S. enterica were significantly (P<0.05) higher than these at
0 DPI from 4.46 to 6.12 log cfu/ ml and 4.89 to 6.86 log cfu/ml, respectively. E.
tracheiphila was never detected after day 0. A mesocarp sample from one fruit, flower-
inoculated with S. enterica only, was positive for this bacterium. The results suggest that
S. enterica can survive on the rind until fruit maturity. E. tracheiphila can traverse the
cracked rind, causing watersoaking of interior tissues; the leakage of cell contents can
enhance S. enterica survival on the fruit surface. Fruit contamination after flower
inoculation with S. enterica was a rare event under our conditions, but flowers can harbor
the bacteria until fruit maturity, thereby becoming a potential reservoir. Use of
agricultural practices minimizing fruit contact with potentially contaminated substrates
could reduce the risk of Salmonella contamination.
iv
TABLE OF CONTENTS
Chapter Page
I. INTRODUCTION ......................................................................................................1
Literature Cited ........................................................................................................5
II. REVIEW OF LITERATURE..................................................................................10
History, Origin and Nutritive Value of Cantaloupe ...............................................10

Cantaloupe Production in the United States ..........................................................11
Growth Conditions .................................................................................................11
Temperature .....................................................................................................11
Soil ...................................................................................................................12
Irrigation ..........................................................................................................12
Fertilizer Requirements ....................................................................................13
Pollination and Fruit Development ........................................................................13
Pollination and Fruit Set ..................................................................................13
Rind Development ...........................................................................................14
Varieties and Performance .....................................................................................14
Problems Related to Fresh Produce Consumption.................................................15
Outbreaks of Salmonellosis .............................................................................15
Pre-harvest Contamination...............................................................................16
Post-harvest Contamination .............................................................................17
Association of Human Pathogens with Fresh Produce ..........................................17
Affinity of Salmonella to Fresh Produce .........................................................17
Salmonella Internalization ...............................................................................18
Salmonella Behavior on Cantaloupe Rind .............................................................19
Interaction of Salmonella with Other Microflora on Fruit Rind ............................19
Soft Rotting Bacteria........................................................................................19
Storage and Pathogenic Fungi .........................................................................20
Use of Sanitizers in Produce Processing ................................................................20
Bacterial wilt, insect vectors, and Enterobacteriaceae ..........................................22
Literature Cited ......................................................................................................25
v
Chapter Page
III. SURFACE SURVIVAL AND INTERNALIZATION OF SALMONELLA ENTERICA

THROUGH NATURAL CRACKS ON DEVELOPING CANTALOUE FRUITS,
ALONE OR IN THE PRESENCE OF MELON WILT PATHOGEN ERWINIA
TRACHEIPHILA ....................................................................................................37
Abstract ..................................................................................................................37
Introduction ............................................................................................................38
Materials and Methods ...........................................................................................41
Results ....................................................................................................................47
Discussion ..............................................................................................................51
IV. SALMONELLA ENTERICA COLONIZATION OF CANTALOUPE FLOWERS

AND FRUIT FOLLOWING FLOWER INOCULATION ALONE OR WITH
ERWINIA TRACHEIPHILA ...................................................................................77
Abstract ..................................................................................................................77
Introduction ............................................................................................................78
Materials and Methods ...........................................................................................79
Results ....................................................................................................................84
Discussion ..............................................................................................................85
APPENDICES .............................................................................................................99
A: Cantaloupe cultivar selection ..................................................................................99
B: Evaluation of pathogenicity on cantaloupe plants of a parental, and a GFPuv tagged
derivative, of E. tracheiphila ...............................................................................101
C: Internalization of Erwinia tracheiphila into cantaloupe fruits through flower
inoculation............................................................................................................103
D: Internalization of Erwinia tracheiphila into cantaloupe fruits through rind cracking
and its interaction with Salmonella enterica ........................................................105
Literature Cited ..........................................................................................................108
Figure 1: Three types of flowers produced by cantaloupe plants A. Male flower, B.
Complete flower (with male and female part) and C. Female flower .................109
Figure 2: Hand pollination of cantaloupe flowers. A. Separating petals from the male
flower to collect pollen; B. Collecting pollen with a fine artist’s brush; C. Pollen
collected on brush, ready for pollination; D. Brushing stigma of a complete flower; E.
Complete flower after pollination; and F. Observing pollen adhering to stigma with a
hand lens. .............................................................................................................110
vi
Chapter Page
Figure 3: Cantaloupe varieties Sugarcube, Caravelle, and Cruizer at the time of cracking
(A, B, C and D, respectively), during netting and towards fruit maturity (D, E, and F,
respectively). Arrow head on pictures shows reddish orange exudates on cracks
suggesting opening into the fruit..........................................................................111
Figure 4: Reproductive parameters of three different cantaloupe varieties [Sugarcube
(n=16), Cruiser (n=6) and Caravelle (n=5)] in the greenhouse during summer of 2010.
The bars show the standard error for each category. ...........................................112
Figure 5: Inoculation of cantaloupe plant with GFPuv tagged E. tracheiphila. A. Site of
E. tracheiphila inoculation, B. Wilting of plant after E. tracheiphila inoculation
(arrow showing site of inoculation), and C. Recovery of E. tracheiphila from stem
samples of wilted plant (green fluorescing bacteria on arrow heads), incubated on
ampicillin-amended nutrient agar and observed under UV light. ........................113
Figure 6: Evidence of Erwinia tracheiphila entry into cantaloupe plants following flower
interior introduction. A. Watersoaked lesions appear on developing fruits and
peduncles collapse; B. Wilted vine; C. Bacteria stream from the freshly cut stem; D.
Impaired netting on mature fruit; E. Internal tissue of symptomatic fruit showing
presence of E. tracheiphila on nutrient agar plate; F. A normal fruit; G. PCR results
showing 68-bp amplicon, from tissue with watersoaked lesion…………….….114
Figure 7: Cantaloupe fruit rind surface inoculated with a mixture of S. enterica and E.
tracheiphila at the time of natural fruit cracking and sampled at fruit maturity (40
DPI). A. E. tracheiphila lesion, on the fruit rind, just before rind layer extraction, B.
Sub-rind mesocarp with E. tracheiphila lesion, suggesting bacterial traversal through
the outer rind, C. Black colonies of S. enterica, recovered from fruit rind, observed on
XLD plate, and D. Recovery of E. tracheiphila from fruit with watersoaked lesion,
observed under UV light on ampicillin amended nutrient agar.. .........................115
Figure 8: Interaction of Salmonella enterica Poona, alone or in the presence of E.
tracheiphila, on the natural fruit cracks, sampled over time. Fruit crack inoculated
with S. enterica only and sampled 7 days post inoculation (DPI) (A) and 19 DPI (B).
Fruit crack inoculated with a mixture of S. enterica + E. tracheiphila and sampled at
7 DPI (C) and 19 DPI (D)... .................................................................................116
Table 1: Mean percentage of fruits positive for Salmonella on fruit rind and sub-rind
mesocarp, immediately below the rind layer, of fruit rind initially inoculated with
Salmonella only or Salmonella + E. tracheiphila, sampled at 7 and 19 days post
inoculation (DPI)……………………………………………………………….117
vii
LIST OF TABLES
Table Page
Table III-1: Recovery of S. enterica Poona and E. tracheiphila, at time intervals

following inoculation, singly or together, onto cantaloupe fruit rind surfaces. ...….71
Table III-2: Recovery of S. enterica from cantaloupe fruit inoculated with a mixture of S.
enterica and E. tracheiphila, data sorted by the development of E. tracheiphila-incited
watersoaked lesions…………………………….………………………………….75
Table III-3: Percent of sub-rind mesocarp and inner mesocarp samples positive, by
colony count and PCR, for S. enterica or E. tracheiphila from fruits inoculated with
either S. enterica, E. tracheiphila or a mixture of these pathogens, sampled at different
days post inoculation (DPI)…………………………………………………..…....76
Table IV-1: Mean recovery of S. enterica Poona from flowers after inoculation with S.
enterica alone or S. enterica + E. tracheiphila at 0 and 43 days post inoculation
(DPI)..………………………………………………………………………….......98
viii
LIST OF FIGURES
Figure Page
Figure III-1: Illustration for fruit sampling on a single replication with 8 total plants,
fruits of which inoculated with pathogens and designed to sample 3 plants, at 0 and 9
DPI and 5 plants, at 24 DPI under pathogen treatment (E. tracheiphila or S. enterica or
mixture of these two pathogens) in a single replication. Total plants in a single
replication for control (0.1% peptone) were in the combination of 1 and 2 as above.
Rind, sub-rind mesocarp and inner mesocarp were sampled as illustrated in figure for
pathogen treatments. .................................................................................................67
Figure III-2: Newly formed natural cracks on cantaloupe fruit rind areas (2 x 2 cm)
inoculated with in 10-15 droplets of 20 µl pathogen(s) suspensions or 0.1% peptone and
spread with a sterile bristled brush. Arrow head indicates cracks older than those in the
area being inoculated. ...............................................................................................68
Figure III-3: Reddish orange exudate (arrow) observed on the natural cracks of 10-12
day-old cantaloupe fruit rind. These cracks are naturally healed by deposition of corky
material, forming the characteristic netting on cantaloupes. ....................................69
Figure III-4: Cantaloupe rind inoculation with E. tracheiphila (Et- green fluorescing with
GFPuv), alone or together with S. enterica (SP- red fluorescing with DsRedExpress),
pathogens were spread onto the rind surface with a soft brush and sampled at 0, 9 or 24
DPI. (A) Percentage of cantaloupe fruit showing watersoaked symptoms based on
visual inspection, no significant difference between day 9 and 24 at any level of Et or
SP + Et (Fisher’s Exact one-tailed P=0.64 and P=0.53, respectively), (B and C)
Cantaloupe rind with watersoaked lesion observed under natural light, and under UV
light, respectively. C shows green fluorescing E. tracheiphila on the cracks and beneath
the cuticle in a watersoaked area. Scale bars represent 2 cm. ..................................70
Figure III-5: Confocal laser scanning microscope images showing the presence of
inoculated, fluorescently tagged bacteria on cantaloupe rind surfaces. Rind epidermal
cells appear as a beehive pattern, and bacteria are indicated with arrows (panels C and
D). (A) Fruit rind surface inoculated with S. enterica Poona (labeled with
DsRedExpress) and sampled at 0 DPI, (B) Fruit rind surface inoculated with a mixture
of S. enterica Poona + E. tracheiphila (labeled with GFPuv) and sampled at 0 DPI (C)
Fruit rind surface inoculated with E. tracheiphila and sampled at 0 DPI and (D)
Longitudinal section of rind containing watersoaked lesion and sampled at 24 DPI; E.
tracheiphila in the intercellular spaces (arrow) (inoculated with mixture of S. enterica
plus E. tracheiphila). The scale bars represent 5µm. ...............................................72
ix
Figure Page
Figure III-6: Fruits positive for S. enterica Poona (SP) from rinds of cantaloupe
inoculated with S. enterica Poona alone (SP), or S. enterica + E. tracheiphila (SP + Et),
at 0, 9 or 24 Days post inoculation (DPI). Similar letters above bars of the same
treatment do not significantly differ at p < 0.05) according Fischer’s Exact test- one
tailde. Overall p-value for comparison of proportions among levels of DPI given
treatments are <0.001 and 0.0039 for SP and SP + Et, respectively. ........................73
Figure III-7: Scanning electron micrographs of cantaloupe rind surface at fruit maturity
(24 days post inoculation). (A) Rind inoculated with 0.1% peptone; (B) Masses of
bacteria seen near a trichome scar on a rind that had a watersoaked lesion, inoculated
with E. tracheiphila; (C) Crack on rind inoculated with 0.1% peptone; and (D) Crack
on rind inoculated with mixed S. enterica + E. tracheiphila line the fruit crack that had
a waterloaked lesion. All observations were made at 5,000X; scale bar shows 20µm.
..................................................................................................................................74
Figure IV-1: Illustration for fruit sampling from a single replication composed of 5
plants, flowers of which were inoculated with pathogens at the base of the floral whorl.
Two plants each were sampled at 0 (for flowers) and 15 DPI (for inner mesocarp), and
3 plants receiving pathogen treatment E. tracheiphila alone, S. enterica alone, or a
mixture of these two pathogens) were sampled at 43 DPI. Inner mesocarps and flowers
(along with a small piece of attached rind) were sampled at 24 DPI. Control plants
with 0.1% peptone inoculation were 1 and 2 for 0 and 15 DPI, and 43 DPI sampling,
respectively, in each replication……………………………………………..…...…96
Figure IV-2. Fruit mesocarp samples excised at 43 DPI from fruits that developed from
flowers previously inoculated with S. enterica or a mixed culture of S. enterica + E.
tracheiphila. Each sample included edible mesocarp, seeds and placenta. Samples (ca.
25 g) were assayed by direct plating, enrichment and PCR techniques..………...…97
x
CHAPTER I
INTRODUCTION
Contamination of fresh vegetables and fruits by human pathogens such as
Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Campylobacter
jejuni occurs repeatedly partly because of the successful adaptation of these pathogens to
environments associated with food production, processing, and storage. Fresh produce
includes a variety of unprocessed fruits and an increasing number of vegetables that
previously were consumed predominantly after processing. As consumption of fresh
produce has increased, so have incidents of foodborne illness (5, 31, 32). The number of
such outbreaks doubled between 1973 to1987 (4) and continues to occur due to fresh
produce consumption in the United States. Many health-conscious consumers, wishing to
maximize the nutritional content of their food, recognize that less processing often means
that more nutrients remain.
Cantaloupes, and then tomatoes, are the most popular raw produce types
worldwide, and cantaloupe was the second most implicated type in Salmonella outbreaks
(1, 6, 12). Among 54% of human illness outbreaks associated with the consumption of
fresh produce in which the pathogen was identified, 60% were caused by bacteria, and of
these Salmonella caused 48% (32). Salmonella serovars implicated include Chester in
1
1990 (28), Saphra in 1997 (32), Oranienburg in 1998 (18), and Poona in 2000, 2001 and
2002 (1). Although plants have not generally been considered a niche for human
pathogens, this paradigm is now being reconsidered. Uptake of Salmonella after artificial
inoculation has been reported to occur in several plant species (2, 16, 20). Salmonella
was taken up by tomato hypocotyls cotyledons, and stems after inoculation onto
previously wounded roots of seedlings grown in a hydroponic system (16). Sources of
Salmonella in field contaminations can include irrigation water (13, 24, 25), insect
vectors [particularly houseflies (17) and other flies (33)], soil and crop debris (3).
Salmonella survives for as long as 405 days in sterilized manure-amended soils (35).
Very little information is available on the mechanisms of human pathogen
internalization in fresh produce (20). Pathogens might enter the plant/fruit through natural
openings, such as stomata, lenticels and nectarthodes. Cantaloupe fruit is smooth and
hairy until about 10 days after pollination, when the rind begins to crack because of fruit
expansion. This process continues for 10-15 days, but the cracks are soon healed by
corky growth, which becomes the netting for netted melon types. The cracks are openings
through which microflora from sources such as manure, irrigation water or soil might
enter. However, pathogen internalization through the cracks has not been documented.
The presence of other plant resident microorganisms, including plant pathogens,
can be beneficial for the growth and colonization of Salmonella (3, 34). The relationship
between any two microbes on the plant surface varies with the plant species, the
microbial species, and the conditions, and it could be negative, positive or neutral to the
participants. The more positive the relationship becomes, the more difficult it is to
remove the microorganisms from the plant surface (19). Barak and Liang (3) showed that
2
at the 3-5 leaf and pre-bloom stages of tomato plants, S. enterica populations were
significantly higher after co-inoculation with Xanthomonas campestris pv. vesicatoria
than when the human pathogens were inoculated alone. A synergistic relationship of
Salmonella spp. with storage fungi was observed during the storage of market vegetables
(34), when co-inoculation of tomato fruits, potato tubers and onion bulbs with Salmonella
Typhimurium and either Botrytis or Rhizopus resulted in increased populations of
Salmonella compared to those on control fruits inoculated with Salmonella alone. A
similar study by Brandl et al. (7) showed possible synergism between S. enterica and
Aspergillus niger, attributed to cellulose-chitin interactions. Similarly, co-inoculation
with Cladosporium cladosporioides greatly enhanced the ability of S. enterica to
penetrate (3-4 cm inside the rind) mesocarp tissues of cantaloupe fruit (29).
E. tracheiphila, an important pathogen of most cucurbits including cantaloupe,
causes bacterial wilt disease (10, 11, 23). It is naturally transmitted by two cucumber
beetles (striped: Acalymma vittatum. F. and spotted: Diabrotica undecimpunctata
hawoardi Barber) (11, 23, 27). It overwinters in adult beetles (11, 14, 26) and
transmission occurs when these insects feed on plants and their frass contaminates fresh
feeding wounds (8, 9, 21-23, 27) on leaves, stems, or flower nectaries (30). To date, no
other means of transmission has been reported. E. tracheiphila eventually enters the
xylem vessels multiplies, and produces exopolysaccharides, thereby blocking water flow
and causing wilting (30).
Our brief report from a preliminary experiment suggests that, following flower
inoculation, E. tracheiphila is able to colonize cantaloupe fruit and traverse to vines,
causing wilting (15). We wanted to investigate whether S. enterica could survive and
3
colonize fruit rinds and flowers, and whether they could gain access to the edible fruit
mesocarp from those locations. We also wanted to understand whether E. tracheiphila
influences S. enterica survival or internalization on cantaloupe fruits or flowers. The
output of this work will aid our understanding of the relationship between human and
plant pathogens on flower and fruit surfaces and will help to identify strategies to reduce
fresh produce contamination by human pathogens.
The objectives of this research are to understand survival and internalization of
Salmonella on cantaloupe, with or without the influence of a plant pathogen:
1- To characterize the survival and internalization of S. enterica on or in
cantaloupe fruit when inoculated on the rind at the time of natural fruit cracking, alone or
in the presence of the plant pathogen, E. tracheiphila.
2- To investigate the survival and internalization, of S. enterica when
introduced into flower interiors, alone or in the presence of the plant pathogen E.
tracheiphila.
4
LITERATURE CITED
1. Anderson, S. M., L. Verchick, R. Sowadsky, B. Sun, R. Civen, J. C. Mohle-
Boetani, S. B. Werner, M. Starr, S. Abbott, M. Gutierrez, M. Palumbo, J.
Farrar, P. Shillam, E. Umland, M. Tanuz, M. Sewell, J. Cato, W. Keene, M.
Goldoft, J. Hofmann, J. Kobayashi, P. Waller, C. Braden, G. Djomand, M.
Reller, and W. Chege. 2002. Multistate outbreaks of Salmonella serotype Poona
infections associated with eating cantaloupe from Mexico - United States and
Canada, 2000-2002. MMWR Morb. and Mort. Wkly. Rep. 51:1044-1047.
2. Barak, J. D., L. C. Kramer, and L.-y. Hao. 2011. Colonization of tomato plants
by Salmonella enterica is cultivar dependent, and Type 1 trichomes are preferred
colonization sites. Appl. Environ. Microbiol. 77:498-504.
3. Barak, J. D., and A. S. Liang. 2008. Role of soil, crop debris, and a plant
pathogen in Salmonella enterica contamination of tomato plants. PLoS ONE
3:e1657.
4. Bean, N. H., J. S. Goulding, M. T. Daniels, and F. J. Angulo. 1997.
Surveillance for foodborne disease outbreaks - United States, 1988-1992. J. Food
Prot. 60:1265-1286.
5. Beuchat, L. R., J. H. Ryu, B. B. Adler, and M. D. Harrison. 2006. Death of
Salmonella, Escherichia coli O157 : H7, and Listeria monocytogenes in shelf-
stable, dairy-based, pourable salad dressings. J. Food Prot. 69:801-814.
6. Bowen, A., A. Fry, G. Richards, and L. Beuchat. 2006. Infections associated
with cantaloupe consumption: a public health concern. Epidemiol. Infect.
134:675-685.
5
7. Brandl, M. T., M. Q. Carter, C. T. Parker, M. R. Chapman, S. Huynh, and
Y. Zhou. 2011. Salmonella biofilm formation on Aspergillus niger involves
cellulose - chitin interactions. PLoS ONE 6:e25553.
8. Brewer, M. J., R. N. Story, and V. L. Wright. 1987. Development of summer
squash seedlings damaged by striped and spotted cucumber beetles (Coleoptera,
Chriysomelidae). J. Econ. Entomol. 80:1004-1009.
9. Brust, G. E. 1997. Interaction of Erwinia tracheiphila and muskmelon plants.
Environ. Entomol. 26:849-854.
10. Brust, G. E. 1997. Seasonal variation in percentage of striped cucumber beetles
(Coleoptera: Chrysomelidae) that vector Erwinia tracheiphila. Environ. Entomol.
26:580-584.
11. Fleischer, S. J., D. de Mackiewicz, F. E. Gildow, and F. L. Lukezic. 1999.
Serological estimates of the seasonal dynamics of Erwinia tracheiphila in
Acalymma vittata (Coleoptera : Chrysomelidae). Environ. Entomol. 28:470-476.
12. Francis, B. J., J. V. Altamirano, and M. G. Stobierski. 1991. Multistate
outbreak of Salmonella Poona infections-United States and Canada, 1991.
MMWR Morb. and Mort. Wkly. Rep. 40:549-552.
13. Gagliardi, J. V., P. D. Millner, G. Lester, and D. Ingram. 2003. On-farm and
postharvest processing sources of bacterial contamination to melon rinds. J. Food
Prot. 66:82-87.
14. Garcia-Salazar, C., F. E. Gildow, S. J. Fleischer, D. Cox-Foster, and F. L.
Lukezic. 2000. Alimentary canal of adult Acalymma vittata (Coleoptera :
6
Chrysomelidae): Morphology and potential role in survival of Erwinia
tracheiphila (Enterobacteriaceae). Can. Entomol. 132:1-13.
15. Gautam, D., L. Ma, B. Bruton, and J. Fletcher. 2011. Erwinia tracheiphila
colonization of cantaloupe fruits through flower inoculation. Phytopathology
101:S59-S59.
16. Guo, X., M. W. van Iersel, C. Jinru, R. E. Brackett, and L. R. Beuchat. 2002.
Evidence of association of Salmonellae with tomato plants grown hydroponically
in inoculated nutrient solution. Appl. Environ. Microbiol. 68:3639-3643.
17. Holt, P. S., C. J. Geden, R. W. Moore, and R. K. Gast. 2007. Isolation of
Salmonella enterica serovar Enteritidis from houseflies (Musca domestica) found
in rooms containing Salmonella serovar Enteritidis-challenged hens. Appl.
Environ. Microbiol. 73:6030-6035.
18. IFT/FDA. 2003. Analysis and evaluation of preventive control measures for the
control and reduction/elimination of microbial hazards on fresh and fresh-cut
produce. J. Food Sci. 68:2384-2387.
19. James, G. A., L. Beaudette, and J. W. Costerton. 1995. Interspecies bacterial
interactions in biofilms. J. Ind. Microbiol. 15:257-262.
20. Kroupitski, Y., D. Golberg, E. Belausov, R. Pinto, D. Swartzberg, D. Granot,
and S. Sela. 2009. Internalization of Salmonella enterica in leaves is induced by
light and involves chemotaxis and penetration through open stomata. Appl.
7
21. Lam, W.-K. F. 2007. An alternative sampling technique for cucumber beetles
(Coleoptera : Chrysomelidae) and diurnal beetle activity on muskmelon. J. Econ.
Entomol. 100:823-829.
22. Lindow, S. E., and M. T. Brandl. 2003. Microbiology of the phyllosphere. Appl.
23. Mitchell, R. F., and L. M. Hanks. 2009. Insect frass as a pathway for
transmission of bacterial wilt of cucurbits. Environ. Entomol. 38:395-403.
24. Morales-Hernandez, L., A. M. Hernandez-Anguiano, C. Chaidez-Quiroz, G.
Rendon-Sanchez, and T. V. Suslow. 2009. Detection of Salmonella spp. on
cantaloupe melon production units and packaging facility. Agri. Tec. Mex.
35:135-145.
25. Pianetti, A., W. Baffone, F. Bruscolini, E. Barbieri, M. R. Biffi, L. Salvaggio,
and A. Albano. 1998. Presence of several pathogenic bacteria in the Metauro and
Foglia Rivers (Pesaro-Urbino, Italy). Water Res. 32:1515-1521.
26. Rand, F. V., and L. C. Cash. 1920. Some insect relations of Bacillus
tracheiphilus erw. sm. Phytopathology 10:133-140.
27. Rand, F. V., and E. M. A. Enlows. 1916. Transmission and control of bacterial
wilt of cucurbits. J. Agric. Res. 6:417-434.
28. Reis, A. A., S. Zaza, C. Langkop, R. V. Tauxe, and P. A. Blake. 1990. A
multistate outbreak of Salmonella Chester linked to imported cantaloupe, p. 238,
Program and Abstracts of the 30th Interscience Conference on Antimicrobial
Agents and Chemotherapy. Am. Soc. Microbiol., Washington, DC.
8
29. Richards, G. M., and L. R. Beuchat. 2005. Infection of cantaloupe rind with
Cladosporium cladosporioides and Penicillium expansum, and associated
migration of Salmonella Poona into edible tissues. Int. J. Food Microbiol. 103:1-
10.
30. Sasu, M. A., I. Seidl-Adams, K. Wall, J. A. Winsor, and A. G. Stephenson.
2010. Floral transmission of Erwinia tracheiphila by cucumber beetles in a wild
Cucurbita pepo. Environ. Entomol. 39:140-148.
31. Sewell, A. M., and J. M. Farber. 2001. Foodborne outbreaks in Canada linked to
produce. J. Food Prot. 64:1863-1877.
32. Sivapalasingam, S., C. R. Friedman, L. Cohen, and R. V. Tauxe. 2004. Fresh
produce: A growing cause of outbreaks of foodborne illness in the United States,
1973 through 1997. J. Food Prot. 67:2342-2353.
33. Talley, J. L., A. C. Wayadande, L. P. Wasala, A. C. Gerry, J. Fletcher, U.
DeSilva, and S. E. Gilliland. 2009. Association of Escherichia coli O157:H7
with filth flies (Muscidae and Calliphoridae) captured in leafy greens fields and
experimental transmission of E. coli O157:H7 to spinach leaves by house flies
(Diptera: Muscidae). J. Food Prot. 72:1547-1552.
34. Wells, J. M., and J. E. Butterfield. 1999. Incidence of Salmonella on fresh fruits
and vegetables affected by fungal rots or physical injury. Plant Dis. 83:722-726.
35. You, Y. W., S. C. Rankin, H. W. Aceto, C. E. Benson, J. D. Toth, and Z. X.
Dou. 2006. Survival of Salmonella enterica serovar Newport in manure and
manure-amended soils. Appl. Environ. Microbiol. 72:5777-5783.
9
CHAPTER II
REVIEW OF LITERATURE
I – History, origin and nutritive value of cantaloupe
Cantaloupe (Cucumis melo), also known as cantaloup, muskmelon, or rockmelon,
is in the family Cucurbitaceae, which includes nearly all melons and squashes. There are
two major varieties of cantaloupes. Cucumis melo var. cantalupensis (grown mainly in
Asia and Europe) is considered to be a true cantaloupe as it is rough and warty. Cucumis
melo var. reticulatus is grown largely in the United States, where “cantaloupe” has
become a generic name for all kinds of netted, musk-scented melons (64). Cantaloupe is a
rich source of nutrients including fiber, minerals, and almost all the vitamins for a normal
human health. In a market survey Eitenmiller et al. (25) found that levels of niacin,
riboflavin, thiamin, ascorbic acid, folacin and chromium (Cr) in cantaloupe fruit were
significantly higher during maximum availability periods than at other times.
The name of the fruit comes from the city of Cantalupo, near Tivoli, Italy, where
cultivation began in the sixteenth century (57). Christopher Columbus, on his second
voyage in 1494, introduced cantaloupes to the North America. Robinson and Decker-
Walters (60) suggested that Asia or Africa could be the origin of muskmelon. Evidence
10
based on genetic studies, attempts at crossing with other Cucumis species, and the
worldwide distribution of melon varieties suggests that Africa was the origin (39).
However, melon domestication started in Egypt over 3,000 years ago (55). Melon
dispersion may have occurred from Africa to the Middle East and Asia, where secondary
diversification and domestication development could have occurred (39).
II – Cantaloupe production in the United States
In the United States, California continues lead in melon production, accounting
for 43% of the harvested area, 49% of production, and 48% of the value (75). The total
United States cantaloupe production in 2011 was 8.55 x 105 metric tons, with a total area
of 2.87 x 104 ha. California is responsible for 5 x 105 metric tons of cantaloupe according
to the 2011 census (75). Cantaloupe is also produced in Oklahoma on 446 acres (76).
Althogh the per capita civilian utilization of cantaloupe has been decreasing since 2001
(75), the fruit remains popular nationwide.
III - Growth conditions
III –a -Temperature
Melons are warm-season annuals that are very sensitive to frost at any growth
stage. Seedlings planted in the greenhouse should not be transplanted to the field until the
soil temperature (3 inches beneath the soil surface) reaches 60o F. Growth is very slow
below 60oF (16oC) and the optimum temperature for growth ranges from 85o to 95oF (30o
to 35oC), although cantaloupe can tolerate temperatures in excess of 104oF (40oC).
Average base, optimum and upper critical growth chamber temperatures of 49.5oF, 93oF
and 113oF, respectively, were established for cultivars Gold Rush and Mission (7). In the
field, the crop is best grown on raised beds covered with black or silver plastic mulch to
11
protect the melons from rotting, a common problem when the fruits are in contact with
soil (James Motes, Oklahoma State University, Department of Horticulture, retired;
personal communication).
III –b -Soil
Soil texture can be used as an indicator for growers to decide whether to plant
early or late in the season (33). Sandy soils are suitable for early plantings because of
their more rapid heating. Loam and clay loam soils are preferred for mid-season
production because of their high water-holding capacity as they prolong the harvest
period, thus making fruit available throughout the season. Irrespective of soil texture,
cantaloupe can be grown on any soil provided that it is well drained.
III –c -Irrigation
Yield and income can be maximized with wise selection of cultivation techniques
and the appropriate amount of water for fruit growth and development (1). In spite of the
fact that furrow irrigation could increase the microbial contamination of fresh produce
including cantaloupe compared to sub-surface irrigation (66), furrow irrigation is
commonly used for its economy and simplicity (48). A total of 2-5 irrigations/season are
generally adequate (but frequency of irrigation also depends on rainfall amounts) after the
establishment of the crop and the last irrigation should be given 7-10 days before harvest.
Drip irrigation is gaining popularity as it is easy to do, uses water efficiently, and results
in less foliar and fruit disease than with overhead irrigation. Furthermore, drip irrigation
does not interfere with the activity of honeybees in pollination and fertilization. A
combination of drip irrigation and plastic mulch is the best for highest fruit yield (18, 42),
and reduces water requirements as well as insects, pathogens and weeds (18).
12
Mohamedien et al. (11) found perforated tunnels with polyethylene mulch treatment
resulted in taller plants, higher and earlier yields and thicker fruit flesh.
III-d –Fertilizer requirements
Cantaloupes are heavy users of soil nutrients. Average fertilizer application rates
are 90 to 168 kg ha-1 (80-150 pounds per acre) of nitrogen (N) and 45 to 225 kg/ha (40 to
200 poundsper acre) of P2O5 and potassium, depending on the nutrients available in the
soil (33). Higher doses of phosphorus promote fruiting and optimum amounts assure
sweetness. The peak period of nutrient absorption in cantaloupe production, 44 days after
transplanting, coincides with the period of highest fertilizer demand (4). Macronutrient
requirements of cantaloupe fruits are, in order, K> N> Ca> P> Mg> S, corresponding to
46.7, 29.5, 11.3, 4.7, 4.5, and 4.0 g kg-1 dry matter, respectively (67). In one study, N
accumulated in the vegetative parts such as leaf and stem whereas P and K accumulated
more in the fruit (67). Macronutrients, if given in adequate amounts, lead to optimum
plant development and fruit yield.
IV-Pollination and fruit development
IV-a -Pollination and fruit set
Cantaloupe plants produce male, hermaphrodite, and female flowers (the latter,
rarely) and they need insect activity for pollination and fruit set. Cantaloupes are
pollinated mostly by honeybees during the early hours of the day when the flowers are
open. Farmers maintain hives to assure high yields and large melon size. Pollination can
occur over a period of a week after flowering without adverse effect on harvest
productivity (24). Growth of pollen tubes within the stigma is favored by pollination of
newly opened flowers (77). Post-pollination, fruit setting can be inhibited by the presence
13
of other fruits on the same vine. Better fruit set results from insect pollination (70%) than
from hand pollination (40%) (45). Only 1-4 fruits per vine will mature (27, 37). Pollen
non-viability and self- or cross-sterility can be problematic in some cantaloupe varieties
(9). Artificial (i.e. hand) pollination, done by collecting pollen from male flowers and
rubbing it onto the stigma surfaces, is practiced for greenhouse grown cantaloupes.
IV-b -Rind development
The surface of the newly formed fruit is always smooth and hairy with a waxy
cuticle. Netting generally starts towards end of the fruit-expansion stage (38) but natural
surface cracking begins when the fruit is around 10-12 days old (Benny Bruton, USDA,
Lane, OK, retired; personal communication) usually near the blossom scar (38). Cracking
results from short periods of epidermal cell division. The cracks increase in number and
length as the fruits mature, and the fruit surfaces are covered with cracks by 21 days post-
anthesis (79). The familiar netting of cantaloupes is due to the deposition of a corky layer
derived from a sub-epidermal periderm, which has been characterized as an elaborate
system of lenticels. Netting gives roughness to the fruit surface, providing numerous
pockets that can serve as shelter to various microflora and create vulnerability to
microbial contamination. Netted rinds are difficult to sanitize (71, 74). As low as 150
bacteria cm-2 present on netted cantaloupe rind surface can contaminate the edible
mesocarp upon cutting (3, 47, 71, 77).
V –Varieties and performance
Some cantaloupe varieties grown commonly in the United States include
Ambrosia, Burpee Hybrid, Classic, Cordele, Gold Star, Imperial 4-50, Mainstream,
Magnum 45, Mission, Saticoy, Summet, and TAM-Uvalde. Varieties that perform well in
14
Oklahoma include Caravelle, Cruiser, Sugarcube, Rockstar, Athena, Ambrosia, Super 45
and PMR 45 (James Motes, Oklahoma State University, Department of Horticulture,
retired; personal communication). Most of the latter varieties are netted and weigh
between 2 lb to 6 lb. Sugar Cube, a new, compact, “personal-size” (4” diam) hybrid from
Seneca Vegetable Research (Flat Street, NY) has deep orange flesh, good taste, and
excellent storage life. This variety also is resistant to many diseases of melon (29). Edible
flesh ranges from pink to orange in color and the rind has pronounced netting. The shelf-
life of cantaloupe (either American or British type) compared to other melon types is
intermediate to poor (6- 12 days) among six different varieties (acidulous, cantalupensis,
inodorus, saccharinus, reticulatus and an unknown variety) tested (43). Moreover their
plant height, fruit weight and total soluble solids are also affected by growing conditions.
VI-a-Problems related to fresh produce consumption
VI-a-i-Outbreaks of salmonellosis
Outbreaks of human illness related to consumption of uncooked fresh produce,
contaminated with human pathogens in the form of raw fruits and vegetables or juice,
have led to food poisoning and death. From 1973 to 1997 in the United States, 190 fresh
produce-associated disease outbreaks were reported with 16,058 illnesses, 598
hospitalizations and eight deaths (65). Human pathogens associated with fresh produce
include bacteria, protozoa, and viruses. Salmonella was associated with 48% of the
bacterial disease outbreaks. Among three multistate outbreaks of Salmonella infections,
two were associated with consumption of cantaloupe and one with watermelon. Among
recent outbreaks related to fresh produce, cantaloupe was the second most implicated
produce type, after tomato (10, 26). Cantaloupe has been a common vehicle of
15
Salmonella contamination. S. enterica serovar Chester was named in a 1990 outbreak in
which 245 disease cases were registered in 30 United States (68). Because reported cases
usually only a fraction of the total number, actual numbers are likely much higher (49).
VI-a-ii-Pre-harvest contamination
Cantaloupe fruit contamination can take place at any point from field production
to consumption. Irrigation water and animal manure have been common sources of field
contamination by human pathogens. Among various types of irrigation, sub surface drip
irrigation may be safest for less contamination (70). Salmonella and hepatitis A virus can
survive even 14 days after the last irrigation in the field (70). In one field survey
conducted to assess microbial quality of fresh produce, Salmonella enterica serovar
Montevideo was detected in 0.8% of all produce studied, and in 3.3% of cantaloupes
(36). Salmonella colonized plant roots at higher populations than did Escherichia coli
(23). Dominance of this pathogen on alfalfa sprouts has also been reported (8), and S.
enterica was more capable of attachment to alfalfa sprouts than E. coli, even after several
washings. Salmonella survives in a variety of different agricultural environments
depending upon the availability of nutrients and a conducive soil pH (35). Moreover,
Salmonella can survive as a resident on the surface of fresh produce at the time of fruit
harvest. Recoveries of Salmonella from stomached produce were highest, although not
significantly so, and those from homogenized produce were lowest.
Salmonella survival on plant surfaces, and in soil, manure and irrigated water has
been well studied. Abiotic factors such as temperature, moisture and soil type may impact
bacterial longevity. Salmonella survived for 45 days in wet soil (30), 231 days in poultry
16
compost-amended soil (35), 150 days in almond orchard soil (22), 77 days in loamy sand
(19), 3 years in animal feces (53), and 405 days in manure-amended sterilized soil (81).
VI-a-iii-Post-harvest contamination
Fruits and their products post-harvest, can act as vehicles for human pathogens, if
not properly handled (46, 56). Fresh produce sampled in the packing shed can have
significantly higher levels of microbial contamination than that sampled on the farm (2),
suggesting improper postharvest handling. Seasonal differences can also affect produce
contamination, which was higher during the fall months, i.e. September, October, and
November, than at other times of the year. The type of fresh produce also influences the
risk of contamination; after artificial inoculation with human pathogens, cantaloupe
supported bacterial growth and multiplication for longer periods of time than did lettuce
and bell pepper (69).
VI-b-Association of human pathogens with fresh produce
VI-b-i-Affinity of Salmonella to fresh produce
Specific serovars of Salmonella enterica associate preferentially with specific
fruits or vegetables. For example, Salmonella Montevideo was the most persistent on
tomato, with higher recovery numbers on tomato fruit surfaces than were recovered with
serovars Poona and Michigan. Serovars Hartford and Enteritidis had little to no
attachment under these conditions (30). Serovar Chester was linked with an outbreak
related to contaminated cantaloupe in the United States in 1990 (68). Another three
outbreaks attributed to S. Poona have been epidemiologically linked to cantaloupes
grown and imported from Mexican farms (5, 26), where iguanas had been feeding on
melons in the field. Pet iguanas can be reservoirs of S. Poona infection in children (5).
17
Salmonella Saphra caused another outbreak of foodborne illness that was blamed on
imported cantaloupe from Mexico (51). Other serovars of Salmonella also establish
specific interactions with particular species of fresh produce (5, 26, 52).
VI-b-ii-Salmonella internalization
Associations of human pathogens with fresh produce have generally been
reported as surface contamination, but recent reports have suggested the possibility of
internal contamination (31, 32, 40). Internalization, or movement of the pathogen from
the surface to the interior of the plant, has significant implications for the effectiveness of
sanitizing procedures and the level of health risk. On artificially inoculated iceberg
lettuce leaves exposed to light, Salmonella cells clustered near open stomata, entered into
leaves via the stomatal openings, and remained close to photosynthetically active cells
(40). However, internalization did not occur when plants were kept in darkness and
discontinued photosynthesis, suggesting that Salmonella may be attracted to plant cells
that are activated by light (40). A positive effect of light on Salmonella motility was
noted.
Salmonella was borne internally in tomato, both after infiltration through the stem
scar at harvest (31) and in artificially inoculated tomato plants grown in a hydroponic
system (32). Among several tested serovars, Montevideo and Poona had the highest rates
of internalization. However, the percentage of fruit having contaminated pulp (55%) was
lower than that of fruit surface (82%) or stem scar (73%) contamination (31).
Though many reports of cantaloupe root and fruit surface contamination have
been published, there has been no report of Salmonella internalization in cantaloupe (23,
44). Therefore, one objective of this study was to address whether Salmonella Poona can
18
enter and colonize cantaloupe fruit interiors through natural flower openings, such as
nectarthodes, stigmas and pollen tubes, or through natural cracks on fruit surfaces.
VI-c-Salmonella behavior on cantaloupe rind
Biofilms are matrix-enclosed bacterial populations in which bacteria are in
contact with each other and with the substrate. Biofilms are formed by both plant
pathogens and human pathogens on plant surfaces, including the rind of cantaloupes (6).
Salmonella Poona RM 2350 and S. Michigan formed biofilms within two hours after
inoculation on to cantaloupe rinds at 20oC (6). Embedded in the biofilm’s extracellular
polymeric material was a fibrillar substance that may serve as a protective shield for these
human pathogens against the action of commercially available sanitizers. Salmonella
serovars Enteritidis, Virchow, Thompson, Typhimurium and Newport produced strong
biofilms on cantaloupe rinds while Hadar, Poona and Amager produced weak biofilms
(41).
Some bacterial genes associated with biofilm formation by Salmonella have been
identified. S. enterica Typhimurium genes mIrA and adrA are required for both cellulose
production and biofilm formation in LB (complex) medium, whereas STM1987 (GGDEF
domain, containing protein A, GcpA) is required for biofilm formation in medium devoid
of nutrients (28).
VI-d-Interaction of Salmonella with other microflora on fruit rind
VI-d-i-Soft rotting bacteria
The survival of human pathogens on fresh produce can be enhanced in the
presence of other plant resident human pathogens or plant pathogens. Among forty eight
different types of healthy and soft rotted vegetables and fruits tested for presence of
19
Salmonella, 33% and 30% of the enriched broth and wash samples, respectively, yielded
black colonies characteristics of Salmonella on XLD plates (80). Soft rot affected
specimens had a higher prevalence of Salmonella (59% in 533 samples from broth
enrichment and 66% in 401 samples from wash water) compared to healthy samples
(30% of 402 samples from broth enrichment and 33% in 781 samples from wash water).
VI-d-ii-Storage and pathogenic fungi
No significant difference was found between the populations of Salmonella
Typhimurium on healthy and injured cantaloupe fruit surfaces, but the Salmonella
recovery was higher in the presence of rotting fungi than on healthy fruit (26.4% vs.
20.2%) (80). Salmonella multiplied to greater titers on fruit surfaces in the presence of
Botrytis or Rhizopus, but to lower titers in the presence of Alternaria or Geotrichum, as
compared with the control. When Salmonella Typhimurium was co-inoculated with
Rhizopus sp. onto cantaloupe surfaces during cold storage, high CO2 concentration and
adverse temperatures decreased Salmonella populations slightly, but the presence of
Rhizopus did not affect Salmonella survival (61). However, co-inoculation with
Cladosporium cladosporioides greatly enhanced the ability of S. enterica to penetrate
mesocarp tissues of cantaloupe fruit compared to S. enterica inoculated alone (59). S.
enterica Poona grew 3-4 cm below the inoculated cantaloupe rind, following wounding,
and moved into the mesocarp when C. cladosporioides was present in the co-inoculation
treatment.
VI-e-Use of sanitizers in produce processing
Cantaloupes are generally washed to remove surface contaminants before being
packaged. In the United States, packaging procedures vary from state to state. For
20
example, Georgia grown cantaloupes are first moved to packing sheds, where they are
washed and then packed, whereas California grown cantaloupes are packed in the field
without disinfection. Salmonella populations on Georgia grown cantaloupes that were
washed in either cold or hot water were reduced by about 0.5-log (3). Even so,
Salmonella was detected in the rinstate of 1 out of 900 cantaloupe fruits. The use of
chlorinated water in packinghouse disinfection tanks did not completely eliminate fungi,
total aerobic bacteria and total coliform bacteria from cantaloupe rinds (47). Despite the
disinfection practices, Salmonella multiplied approximately ten fold, suggesting that it
can re-infest the fruit rind after disinfection (47).
Chlorine can be effective in controlling surface-resident foodborne pathogens; 8.0
mg/liter of ClO2 of gaseous chlorine dioxide reduced Salmonella on raspberry by as
much as 1.5 log CFU/g (72). Different combinations of sanitizing chemicals reduced
Salmonella populations on cantaloupe rind surfaces. A 2% commercial detergent
formulation (DECCO Apl Kleen 246) followed by 5% H2O2 at 50oC reduced Salmonella
in excess of 3 logs (62). Application of H2O2 as a sanitizer on the rind surface extended
the shelf life of cut cantaloupe, killing almost all the bacteria on the melon surface
without contaminating the cantaloupe flesh (62).
Uniform glow discharge plasma (OAUGDP) also has been effective in
inactivation of human pathogenic bacteria on apples, cantaloupe and lettuce (21).
Salmonella populations were reduced by >2 log on cantaloupe rind surfaces after one
minute exposure to OAUGDP. Chemical sanitizers such as chlorinated or ozonated water
or commercial detergents have been used to remove human pathogens from fresh fruits
and vegetables, but treated produce may become more vulnerable to human pathogens
21
after treatment (73). Chlorine (200 ppm), hydrogen peroxide (2.5%) and hot water (96oC)
removed Salmonella from cantaloupe surfaces, but after re-inoculation with Salmonella,
pathogen recovery was greater from hot water-treated cantaloupe than from untreated,
chlorine or hydrogen peroxide treated fruits (73). The increased probability of re-
contamination of sanitized produce compared to that for un-sanitized produce, which may
be due to the removal of competing microflora, suggests that sanitizing procedures may
have unintended consequences and should be carefully evaluated.
VI-f-Bacterial wilt, insect vectors, and Enterobacteriaceae
Muskmelon is susceptible to various economically important viral, bacterial,
mycoplasmal, and fungal diseases (82). Bacterial wilt, caused by Erwinia tracheiphila, is
an important disease, especially in warm climates. Most cantaloupe varieties are
susceptible to this disease, which can cause significant losses if the insect vector is
present. Muskmelon cvs. Legend and Superstar, among six cultivars tested, had some
resistance to E. tracheiphila, but placing inocula onto leaves prior to wounding and
creating larger wounds on the leaves led to higher infection rates even in the resistant
cultivars (13). Pumpkin seedlings were also susceptible to E. tracheiphila when
artificially inoculated on wounds at the cotyledon stage (12). It has been reported that this
pathogen is active only when it invades xylem vessels and is not capable of causing
disease epiphytically or through soil medium (58). But according to a recent study, E.
tracheiphila was able to internalize through male flowers easily in the absence of nectar
and caused 48% of plant wilting compared to only 12% plant wilting in the presence of
nectar (12%) (63). When ingested by xylem feeding cucumber beetles, the wilt bacteria
22
are carried to the guts, where they can overwinter and be passed into the frass, later being
deposited on floral organs from which they can access the plant system (50).
The striped cucumber beetle (Acalymma vittatum F.) is an important vector of E.
tracheiphila in cucurbit growing areas around the world. Although a single contaminated
beetle was not sufficient to transmit the wilt pathogen, significant wilt occurred at beetle
densities of 4 or 5 per plant (15). Feeding preferences of the striped cucumber beetle
influence the incidence of wilt among cantaloupe varieties grown in the field (16). The
beetle’s ability to transmit E. tracheiphila depends on the total feeding time (14). When
the insects fed continuously for 12 h, 24-48 h, or 72 h, only 0.05%, ≈2% and 5% of the
beetles, respectively, transmitted E. tracheiphila.
Relationships among insects, Enterobacteriaceae and cucurbits have been
explored. Squash bugs (Anasa tristis, De Geer) harbor and transmit Serratia marcescens,
the causal agent of cucurbit yellow vine disease, on watermelon, cantaloupe, and squash
(17). S. marcescens overwintered inside the squash bugs and transmitted the CYVD
pathogen the following season (17). S. marcescens was retained by the insects after 21
days of feeding (54), and continued to transmit after molting (78). Female bugs were
more efficient transmitters than males.
Salmonella can be transmitted also by other insects that visit agricultural fields.
Flies acquired Salmonella when confined in a room containing chickens challenged with
Salmonella enterica serovar Enteritidis (34). Salmonella also can be internally
transmitted from one bird to another by the lesser mealworm beetle (Alphitobius
diaperinus, Panzer) (20). Nearly a decade ago Salmonella uptake by tomato fruit after
artificial inoculation of its flower was observed (31). There is a need to determine
23
whether Salmonella can be acquired and transmitted by other insects during normal
activities such as landing, feeding, and oviposition.
24
LITERATURE CITED
1. Abou-Hadid, A. F., U. A. El-Behairy, M. A. Medany, and I. S. S. Benjamien.
1999. Water requirements for improved cantaloupe cultivation, p. 295-300. In S.
W. B., Y. Tuzel, B. J. Bailey, A. R. Smith, O. Tuncay (ed.), Acta Horticulturae,
vol. 1. ISH, Antyala, Turkey.
2. Ailes, E. C., J. S. Leon, L. A. Jaykus, L. M. Johnston, H. A. Clayton, S.
Blanding, D. G. Kleinbaum, L. C. Backer, and C. L. Moe. 2008. Microbial
concentrations on fresh produce are affected by postharvest processing,
importation, and season. J. Food Prot. 71:2389-2397.
3. Akins, E. D., M. A. Harrison, and W. Hurst. 2008. Washing practices on the
microflora on Georgia-grown cantaloupes. J. Food Prot. 71:46-51.
4. Alves Barreto Damasceno, A. P., J. F. de Medeiros, D. C. de Medeiros, I. G.
Costa e Melo, and D. d. C. Dantas. 2012. Growth and nutrient uptake of
cantaloupe melon type "Harper" fertigated with doses of N E K. Revista Caatinga
25:137-146.
Canada, 2000-2002. MMWR Morb. Mortal. Wkly. Rep. 51:1044-1047.
25
6. Annous, B. A., E. B. Solomon, P. H. Cooke, and A. Burke. 2005. Biofilm
formation by Salmonella spp. on cantaloupe melons. J. Food Saf. 25:276-287.
7. Baker, J. T., and V. R. Reddy. 2001. Temperature effects on phenological
development and yield of muskmelon. Ann. Bot. 87:605-613.
8. Barak, J. D., L. C. Whitehand, and A. O. Charkowski. 2002. Differences in
attachment of Salmonella enterica serovars and Escherichia coli O157 : H7 to
alfalfa sprouts. Appl. Environ. Microbiol. 68:4758-4763.
9. Beattie, G. A. 2011. Water relations in the interaction of foliar bacterial
pathogens with plants, p. 533-555. In N. K. VanAlfen, G. Bruening, and J. E.
Leach (ed.), Annu. Rev. Phytopathol., vol. 49.
134:675-685.
11. Mohamedien, S. E. A., M. S. E. Yousef, M. A. H. Mohamed, and A. Elfouly.
1993. Interaction between soil covers and some cantaloupe hybrids. Acta
Horticulturae 323:241-249.
12. Brust, G. E. 1997. Differential susceptibility of pumpkins to bacterial wilt related
to plant growth stage and cultivar. Crop Protect. 16:411-414.
13. Brust, G. E. 1997. Interaction of Erwinia tracheiphila and muskmelon plants.
Environ. Entomol. 26:849-854.
26:580-584.
26
15. Brust, G. E., and R. E. Foster. 1999. New economic threshold for striped
cucumber beetle (Coleoptera : Chrysomelidae) in cantaloupe in the midwest. J.
Econ. Entomol. 92:936-940.
16. Brust, G. E., and K. K. Rane. 1995. Differential occurrence of bacterial wilt in
muskmelon due to preferential striped cucumber beetle feeding. HortScience
30:1043-1045.
17. Bruton, B. D., F. Mitchell, J. Fletcher, S. D. Pair, A. Wayadande, U. Melcher,
J. Brady, B. Bextine, and T. W. Popham. 2003. Serratia marcescens, a phloem-
colonizing, squash bug-transmitted bacterium: Causal agent of cucurbit yellow
vine disease. Plant Dis. 87:937-944.
18. Cirvilleri, G., P. Bella, R. Rosa, and V. Catara. 2008. Internalization and
survival of Pseudomonas corrugata from flowers to fruits and seeds of tomato
plants In Pseudomonas syringae pathovars and related pathogens – Identification,
Epidemiology and Genomics, p. 73-79. In M. B. Fatmi, A. Collmer, N. S.
Iacobellis, J. W. Mansfield, J. Murillo, N. W. Schaad, and M. Ullrich (ed.).
Springer, The Netherlands.
19. Cote, C., and S. Quessy. 2005. Persistence of Escherichia coli and Salmonella in
surface soil following application of liquid hog manure for production of pickling
cucumbers. J. Food Prot. 68:900-905.
20. Crippen, T. L., C. L. Sheffield, S. V. Esquivel, R. E. Droleskey, and J. F.
Esquivel. 2009. The acquisition and internalization of Salmonella by the lesser
mealworm, Alphitobius diaperinus (Coleoptera: Tenebrionidae). Vector Borne
Zoonotic Dis. 9:65-71.
27
21. Critzer, F. J., K. Kelly-Wintenberg, S. L. South, and D. A. Golden. 2007.
Atmospheric plasma inactivation of foodborne pathogens on fresh produce
surfaces. J. Food Prot. 70:2290-2296.
22. Danyluk, M. D., M. Nozawa-Inoue, K. R. Hristova, K. M. Scow, B.
Lampinen, and L. J. Harris. 2008. Survival and growth of Salmonella
Enteritidis PT 30 in almond orchard soils. J. Appl. Microbiol. 104:1391-1399.
23. Duffy, B., S. Ravva, and L. Stanker. 2008. Cantaloupe cultivar differences as
opportunistic hosts for human pathogenic Escherichia coli O157:H7 and
Salmonella. European J. Hortic. Sci. 73:73-75.
24. Eischen, F. A., B. A. Underwood, and A. M. Collins. 1994. The effect of
delaying pollination on cantaloupe production. J. Apicult. Res. 33:180-184.
25. Eitenmiller, R. R., C. D. Johnson, W. D. Bryan, D. B. Warren, and S. E.
Gebhardt. 1985. Nutrient composition of cantaloupe and honeydew melons. J.
Food Sci. 50:136-138.
outbreak of Salmonella poona infections-United States and Canada, 1991.
MMWR Morb. Mortal. Wkly. Rep. 40:549-552.
27. Frazier, W. A. 1939. Fruiting of the powdery mildew resistant No. 45 cantaloupe
as affected by spacing. Proc. Am. Soc. Hortic. Sci. 37:5.
28. Garcia, B., C. Latasa, C. Solano, F. G. Portillo, C. Gamazo, and I. Lasa.
2004. Role of the GGDEF protein family in Salmonella cellulose biosynthesis and
biofilm formation. Mol. Microbiol. 54:264-277.
28
29. Grower, T. 2011. New variety guide, The Grower. Vance Publishing
Corporation, Lincolnshire, IL.
30. Guo, X., J. R. Chen, R. E. Brackett, and L. R. Beuchat. 2002. Survival of
Salmonella on tomatoes stored at high relative humidity, in soil, and on tomatoes
in contact with soil. J. Food Prot. 65:274-279.
31. Guo, X., C. Jinru, R. E. Brackett, and L. R. Beuchat. 2001. Survival of
Salmonellae on and in tomato plants from the time of inoculation at flowering and
early stages of fruit development through fruit ripening. Appl. Environ.
Microbiol. 67:67 (10) 4760-4764.
33. Hartz T., M. Cantwell, J. Mickler, S. Mueller, S. Stoddard, and T. Turini.
2008. Cantaloupe production in California. University of California, Division of
Agriculture and Natural Resources. Publication 7218.
35. Islam, M., J. Morgan, M. P. Doyle, S. C. Phatak, P. Millner, and X. P. Jiang.
2004. Fate of Salmonella enterica serovar Typhimurium on carrots and radishes
grown in fields treated with contaminated manure composts or irrigation water.
Appl. Environ. Microbiol. 70:2497-2502.
29
36. Johnston, L. M., L. A. Jaykus, D. Moll, M. C. Martinez, J. Anciso, B. Mora,
and C. L. Moe. 2005. A field study of the microbiological quality of fresh
37. Jones, H. A., and J. T. Rosa. 1928. Truck crop plants. McGraw-Hill Book Co.,
Inc., New York.
38. Keren-Keiserman, A., Z. Tanami, O. Shoseyov, and I. Ginzberg. 2004.
Differing rind characteristics of developing fruits of smooth and netted melons
(Cucumis melo). J. Hortic. Sci. Biotechnol. 79:107-113.
39. Kerje, T., and M. Grum. 2000. The origin of melon, Cucumis melo: a review of
the literature. Proc. Cucurbit. 2000:37-44.
41. Kroupitski, Y., R. Pinto, M. T. Brandl, E. Belausov, and S. Sela. 2009.
Interactions of Salmonella enterica with lettuce leaves. J. Appl. Microbiol.
106:1876-1885.
42. Lament, W. J. 1993. Plastic mulches for the production of vegetable crops. Hort.
Technol. 3:35-49.
43. Liu, L., F. Kakihara, and M. Kato. 2004. Characterization of six varieties of
Cucumis melo L. based on morphological and physiological characters, including
shelf-life of fruit. Euphytica 135:305-313.
30
44. Lopez-Velasco, G., A. Sbodio, A. Tomas-Callejas, P. Wei, K. H. Tan, and T.
V. Suslow. 2012. Assessment of root uptake and systemic vine-transport of
Salmonella enterica sv. Typhimurium by melon (Cucumis melo) during field
production. Int. J. Food Microbiol. 158:65-72.
45. Mann, L. K., and J. Robinson. 1950. Fertilization, seed development, and fruit
growth as related to fruit set in the cantaloupe (Cucumis melo). Am. J. Bot.
37:685-697.
46. Materon, L. A. 2003. Survival of Escherichia coli O157 : H7 applied to
cantaloupes and the effectiveness of chlorinated water and lactic acid as
disinfectants. World J. Microbiol. Biotechnol. 19:867-873.
47. Materon, L. A., M. Martinez-Garcia, and V. McDonald. 2007. Identification
of sources of microbial pathogens on cantaloupe rinds from pre-harvest to post-
harvest operations. World J. Microbiol. Biotechnol. 23:1281-1287.
48. Mayberry, K. S. 2000. Cantaloupes. UC Cooperative Extension-Imperial County
Vegetable Crops Guidelines.
49. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro, P.
M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the United
States. Emerg. Infect. Dis. 5:607-625.
51. Mohle-Boetani, J. C., R. Reporter, S. B. Werner, S. Abbott, J. Farrar, S. H.
Waterman, and D. J. Vugia. 1999. An outbreak of Salmonella serogroup saphra
due to cantaloupes from Mexico. J. Infect. Dis. 180:1361-1364.
31
52. Munnoch, S. A., K. Ward, S. Sheridan, G. J. Fitzsimmons, C. T. Shadbolt, J.
P. Piispanen, Q. Wang, T. J. Ward, T. L. M. Worgan, C. Oxenford, J. A.
Musto, J. McAnulty, and D. N. Durrheim. 2009. A multi-state outbreak of
Salmonella Saintpaul in Australia associated with cantaloupe consumption.
Epidemiol. Infect. 137:367-374.
53. Nicholson, F. A., M. L. Hutchison, K. A. Smith, C. W. Keevil, B. J.
Chambers, and A. Moore. 2000. A study on farm manure applications to
agricultural land and an assessment of the risks of pathogen transfer into the food
chain. Ministry of Agricultural Fisheries and Food, London, UK.
54. Pair, S. D., B. D. Bruton, F. Mitchell, J. Fletcher, A. Wayadande, and U.
Melcher. 2004. Overwintering squash bugs harbor and transmit the causal agent
of cucurbit yellow vine disease. J. Econ. Entomol. 97:74-78.
55. Pangalo, K. J. 1929. Critical review of the main literature on the taxonomy,
geography and origin of cultivated and partially wild melons. Trudy Prikl. Bot.
23:397-442.
56. Parish, M. E. 1998. Associated with a citrus-processing facility implicated in a
salmonellosis outbreak. J. Food Prot. 61:280-284.
57. Pereira, P. 2010, posting date. History of cantaloupe. http//www.buzzle.com.
[Online.]
wilt of cucurbits. J. Agricul. Res. 6:417-434.
32
10.
60. Robinson, R. W., and D. S. Decker-Walters. 1997. Cucurbits. Cucurbits.:viii +
226 pp.
61. Salgado, P. L., A. M. H. Anguiano, J. C. Garcia, G. M. Aguilera, and C. C.
Quiroz. 2009. Survival of Salmonella typhimurium on cantaloupe melon during
cold storage under controlled atmospheres. Revista Fitotecnia Mexicana 32:209-
215.
62. Sapers, G. M., R. L. Miller, V. Pilizota, and A. M. Mattrazzo. 2001.
Antimicrobial treatments for minimally processed cantaloupe melon. J. Food Sci.
66:345-349.
63. Sasu, M. A., K. L. Wall, and A. G. Stephenson. 2010. Antimicrobial nectar
inhibits a florally transmitted pathogen of a wild Curbita pepo (Cucurbitaceae).
Am. J. Bot. 97:1025-1030.
64. Simonne, A., E. Simonne, R. Boozer, and J. Pitts. 1998. A matter of taste:
Consumer preferences studies identitfy favorite small melon varieties. Highl.
Agricult. Res. 45:7-9.
66. Song, I., S. W. Stine, C. Y. Choi, and C. P. Gerba. 2006. Comparison of crop
contamination by microorganisms during subsurface drip and furrow irrigation. J.
Environ. Eng. 132:1243-1248.
33
67. Soto-Ortiz, R. 2008. Crop phenology, dry matter production, and nutrient uptake
and partitioning in cantaloupe (Cucumis melo L.) and chile (Capsicum annum L.).
The University of Arizona, Tucson.
68. Stephenson, A. G., B. Leyshon, S. E. Travers, C. N. Hayes, and J. A. Winsor.
2004. Interrelationships among inbreeding, herbivory, and disease on
reproduction in a wild gourd. Ecology 85:3023-3034.
69. Stine, S. W., I. Song, C. Y. Choi, and C. P. Gerba. 2005. Effect of relative
humidity on preharvest survival of bacterial and viral pathogens on the surface of
cantaloupe, lettuce, and bell peppers. J. Food Prot. 68:1352-1358.
70. Stine, S. W., I. H. Song, C. Y. Choi, and C. P. Gerba. 2005. Application of
microbial risk assessment to the development of standards for enteric pathogens
in water used to irrigate fresh produce. J. Food Prot. 68:913-918.
71. Suslow, T., and M. Cantwell. 2001. Recent findings on fresh-cut cantaloupe and
honeydew melon, p. 12, 20, 32-33, Fresh-Cut, vol. April 2001. Great American
Media Services, Sparta, MI.
72. Sy, K. V., K. H. McWatters, and L. R. Beuchat. 2005. Efficacy of gaseous
chlorine dioxide as a sanitizer for killing Salmonella, yeasts, and molds on
blueberries, strawberries, and raspberries. J. Food Prot. 68:1165-1175.
73. Ukuku, D. O. 2006. Effect of sanitizing treatments on removal of bacteria from
cantaloupe surface, and re-contamination with Salmonella. Food Microbiol.
23:289-293.
34
74. Ukuku, D. O., V. Pilizota, and G. M. Sapers. 2004. Effect of hot water and
hydrogen peroxide treatments on survival of Salmonella and microbial quality of
whole and fresh-cut cantaloupe. J. of Food Prot. 67:432-437.
75. USDA. 2011. Vegetables 2011 Summary. National Agricultural Statistics Service,
USA.
76. USDA, 2012. Vegetables, potatoes, and melons harvested for Sale: 2007 and
2002- State level data, vol. 1. USDA.
77. Velich, I., and L. ne. Satyko. 1974. Possibilities of increasing earliness in melon
by means of the genetics of sex and floral biology. Agrartudomanyi Kozlemenyek
33:459-472.
78. Wayadande, A., B. Bruton, J. Fletcher, S. Pair, and F. Mitchell. 2005.
Retention of cucurbit yellow vine disease bacterium Serratia marcescens through
transstadial molt of vector Anasa tristis (Hemiptera : Coreidae). Ann. Entomol.
Soc. Am. 98:770-774.
79. Webster, B. D., and M. E. Craig. 1976. Net morphogenesis and characteristics
of surface of muskmelon fruit. J. Am. Soc. Hortic. Sci. 101:412-415.
80. Wells, J. M., and J. E. Butterfield. 1997. Salmonella contamination associated
with bacterial soft rot of fresh fruits and vegetables in the marketplace. Plant Dis.
81:867-872.
81. You, Y. W., S. C. Rankin, H. W. Aceto, C. E. Benson, J. D. Toth, and Z. X.
Dou. 2006. Survival of Salmonella enterica serovar Newport in manure and
manure-amended soils. Appl. Environ. Microbiol. 72:5777-5783.
35
82. Zitter, T. A., D. L. Hopkins, and C. E. Thomas. 1996. Compendium of Cucubit
Diseases. APS Press, St. Paul, MN.
36
CHAPTER III
SURFACE SURVIVAL AND INTERNALIZATION OF SALMONELLA ENTERICA
THROUGH NATURAL CRACKS ON DEVELOPING CANTALOUPE FRUITS,
ALONE OR IN THE PRESENCE OF THE MELON WILT PATHOGEN ERWINIA
TRACHEIPHILA
Abstract
Outbreaks of foodborne illness attributed to the consumption of Salmonella-
tainted cantaloupe (Cucumis melo var. reticulatus) have occurred repeatedly. However,
we have limited understanding on the ecology of Salmonella on cantaloupe fruit surfaces.
In this study, we investigated the interactions between S. enterica Poona and Erwinia
tracheiphila on cantaloupe fruit surfaces. Cantaloupe fruits were inoculated, at their
natural cracking stage, with these two pathogens, either singly or in a mixture, at 20 µl of
107 cfu/ml and spread over 2 x 2 cm of the marked rind surface. Microbial and
microscopic analysis of the rind layer was performed at 0, 9 and 24 days post inoculation
(DPI). At 24 DPI (fruit maturity), S. enterica was still detected on 40% and 14% of fruits
inoculated with both pathogens or with S. enterica only, respectively (P = 0.11, Fisher’s
Exact Test, one tailed). Two of the rind samples, inoculated with the mixed culture
37
treatment, yielded countable S. enterica at fruit maturity (24DPI) E. tracheiphila, when
inoculated alone, internalized through the fruit cracks, causing watersoaking (61%) and
traversed to the underlying sub-rind mesocarp (31%) at 24 DPI. Salmonella can survive
on the cantaloupe surface until fruit maturity when introduced at the time of natural fruit
cracking and its survival was enhanced by the presence of E. tracheiphila. In this work,
S. enterica was not detected in the fruit interior, but since E. tracheiphila internalized
through natural cracks on developing fruits, the possibility that human pathogens might
also do so needs further investigation. Good agricultural practices that avoid fruit contact
with soil, use of contamination free water and measures that keep plants free of pathogen
attack could reduce the risk of Salmonella contamination and persistence on the fruit.
Introduction
The occurrence of human pathogens on fresh fruits and vegetables and the
incidence of foodborne illness have been increasing in the United States and around the
world (34, 63, 64). Salmonella enterica, causal agent of salmonellosis, is one of the most
common human pathogenic bacteria contaminating fresh produce world-wide (7). Among
recent Salmonella-associated disease outbreaks, cantaloupe (Cucumis melo var.
reticulatus) was the second most implicated produce type (3, 10, 25). The first
documented salmonellosis outbreak, caused by consumption of salad bar cantaloupes
contaminated with S. enterica Chester in 1990, involved 245 reported cases in 30 U.S.
states (58). Since reported cases are only a fraction of the actual number of people
sickened, hundreds of illnesses reported could actually indicate thousands or more (46).
Cantaloupe fruit is characterized by pronounced rind netting, which contains micro

38
pockets likely to shelter microflora and prevent effective sanitation (1, 45, 68, 69). As
few as 150 bacteria cm-2 on the netted rind surface can contaminate the edible mesocarp
upon slicing (68).
Cantaloupe fruit netting begins at the blossom scar (40) with natural cracking of
the rind on 10-12 day old fruits (47). The cracks lengthen and cover the whole fruit
surface at the end of the fruit-expansion stage (40). Stomata present on the fruit surface
become nonfunctional with time. Corky surface ridges, consisting of a thick cuticle (40)
containing lenticels, which function in gas exchange, form, sealing the cracks (47).
As the rind cracks begin to form, defensive compounds are produced by the plant
to reinforce structural and chemical barriers against the threat of pathogen attack (40).
Cantaloupe fruits usually develop on the soil surface, where the physical defensive
barriers may be compromised, providing a route of entry for saprophytes or plant- or
human-pathogenic microbes present in the agricultural environment. Rot is very common
in cantaloupes that develop on soil surfaces (James Motes, Oklahoma State University,
Department of Horticulture, retired; personal communication).
Human pathogens such as S. enterica can be brought into the agricultural field by
contaminated irrigation water (27, 49, 53), insect vectors (35), or soil and crop debris (5),
and contaminate the growing plants (17, 20, 30, 37, 52, 71). Bacterial uptake and
translocation by and within plant parts following artificial inoculation has been reported
in many plant species (5, 21, 32, 42). Although the ecology of S. enterica on plant
surfaces, outside of its mammalian hosts, is poorly understood, several groups have
shown that the presence of other plant resident microorganisms, such as soft rot bacteria
(72) and storage fungi (60, 62, 71), can promote the growth and colonization of plants by
39
S. enterica. Fruits having wounds or contaminated with other microflora were more likely
than healthy fruits to be colonized by this pathogen. Barak and Liang (5) reported
significantly higher S. enterica populations after it was co-inoculated with Xanthomonas
compestris pv. vesicatoria onto tomato plants at the 3-5 leaf and pre-bloom stages, than
when it was inoculated alone. Similar synergism was reported between species of
Rhizopus or Botrytis, both of which cause rots in vegetables, and S. enterica
Typhimurium (71). Brandl et al. (11) showed synergism (attachment and biofilm
formation) between S. enterica and Aspergillus niger, possibly due to cellulose-chitin
interaction. Pre-incubation of S. enterica with N-acetylglucosamine (a monomeric
component of chitin) or its cellulose-deficient mutant failed to attach to the fungus.
Similarly, co-inoculation of S. enterica with Cladosporium cladosporioides greatly
enhanced its ability to penetrate the mesocarp of cantaloupe fruit (60).
Limited information is available on the possible internalization of either plant or
human pathogens through openings created on the cantaloupe rind surface at the time of
cracking, and on the possible interactions between plant and human pathogens.
Therefore, the objective of this study was to investigate the survival and internalization of
the human pathogen, S. enterica Poona, and the plant pathogen, Erwinia tracheiphila
(cause of cucurbit bacterial wilt), on cantaloupe inoculated at the time of natural fruit
cracking. We investigated whether the presence of E. tracheiphila would influence
Salmonella’s capacity for long term survival on the fruit surface and on its internalization
into the edible fruit mesocarp. The results of this work will help to identify strategies to
limit contamination and internalization by human pathogens on this popular and
nutritious fruit.
40
Materials and Methods
Bacterial strains, labeling, storage and inoculum preparation. Salmonella
enterica Poona from our laboratory collection, a clinical isolate from 2001 cantaloupe
outbreak, was plasmid-labeled in our laboratory with pUC18T-mini-Tn7T-Gm-
dsRedExpress (fluorescing red) having gentamycin and ampicillin resistance genes
following the protocol of Choi and Schweizer (15). Erwinia tracheiphila (Et) strain
MCM1-1, isolated originally from Oklahoma cantaloupe by B. Bruton (USDA-ARS,
Lane, OK) and provided by M. Gleason (Iowa State University, IA) was transformed
with pGFPuv (Clontech Laboratories, Inc., CA) by electroporation as described in Ma et
al. (2) and colonies were selected after growing on ampicillin amended nutrient agar
plates. Plasmid stability tests were performed for both labeled pathogens by ten
successive transfers in Luria Bertani broth (LB) followed by plating on nutrient agar
plates (NAP) or LB agar plates for E. tracheiphila and S. enterica, respectively. E.
tracheiphila colonies were observed under UV light and S. enterica colonies were
observed normal light after 2 days, as they took time to develop fluorescence. Both
pathogens were stored in Luria Bertani (LB) broth aliquots, amended with 25% glycerol,
at -80oC. For use in experiments, S. enterica and E. tracheiphila were grown on LB agar
amended with gentamycin (LBgent.), and nutrient agar amended with ampicillin-
NAPamp.), at 37oC and 28oC, respectively, for 48 hr. Bacterial cells were harvested with a
sterile plastic loop and dispersed well in 0.1% peptone water to a final homogenous
suspension of ca. 2 x 107 cfu/ml, determined by optical density (OD) at 600 nm. To
prepare mixed strain inoculum, equal volumes of each bacterial suspension were mixed
41
to yield a final concentration of ca. 107 cfu/ml. The inoculum titer was determined by
plating appropriate dilutions (in 0.1% peptone water) on agar plates.
Plant management. Seeds of cantaloupe (Cucumis melo var. reticulatus), cv.
Sugarcube, were sown 1” deep in cells of polypropylene flats containing Redi-earth
potting mix (SUNGRO®, Bellevue, WA) and placed in a growth chamber (75oF, 60%
humidity,14h day/10 h night). Seedlings (21 days old, 2-3 leaf stage) were transplanted to
4.2 gal pots containing Metromix-300 potting mix (Sun Gro, WA) supplemented with
slow-release Osmocote fertilizer (19N, 6P and 12 K). Pots were transferred to the
greenhouse, where average temperature and humidity were 23oC and 52%, respectively.
Greenhouse temperatures were set at 24o C (day) and 18o C (night) with 14 h day/ 10 h
night periods.
A week after transplanting, vines were trailed up and tied onto a framework of
polyvinyl chloride (PVC) pipes to minimize plant-to-plant contact and to facilitate
sampling from identifiable plants. Pots were watered every other day. Pistillate flowers
were pollinated, using a fine artist’s paint brush, with pollen collected from 1-2 staminate
flowers of the same plant. Resulting young fruits were attached to the PVC frame so
that, after inoculation, they were free from contact with other plant parts or PVC frame.
Experimental design. Each cantaloupe plant was allowed to produce 2-3 fruits.
Fruits of 8 plants were inoculated with each of the three pathogen treatments (E.
tracheiphila or S. enterica or a mixture of the two pathogens) (24 plants), and three plants
were inoculated with 0.1 % peptone water as controls (24+3=27 plants per replication)
(Figure III-1). Fruits of three plants per treatment (9 plants) were sampled at 0 and 9 DPI,
and fruits of five plants per treatment (15 plants) were sampled at 24 DPI. With 27 plants
42
in each of three replications, a total of 81 plants were sampled in the experiment. Rind,
sub-rind mesocarp and inner mesocarp were sampled as illustrated (Figure III-1). Each
plant was allowed to produce one additional fruit that received no inoculation, to
investigate the systemic movement of the inoculated pathogens; only inner mesocarps
were sampled on these plants (Figure III-1). Each treatment consisted of three replicated
trials that were conducted from February to September of 2011.
Inoculation of fruit rind. Twelve-day-old fruit, having fresh natural cracks, were
inoculated with ca. 107 cfu/ml of bacterial suspension. A total of 20 µl of suspensions of
S. enterica, E. tracheiphila, a mixture of both bacteria, or 0.1% peptone (control), were
deposited in 10-15 droplets onto the rind within a 2 x 2 cm square drawn with an
indelible marker around a freshly formed crack on a single fruit/plant (Figure III-2). The
droplets were spread over the marked area using a soft, sterile plastic bristled brush.
Fruit sampling and microbiological analysis. Fruit were sampled immediately
after inoculation (0 DPI), at 9 DPI and at fruit maturity (when fruits easily detached from
peduncles, averaged as 24 DPI). Fruit sampled at 9 DPI and at maturity were checked,
after inoculation and before microbial analysis, for any change in the appearance of the
inoculation site. The marked squares were slightly larger at these sampling dates than at
the time of inoculation because of the fruit growth. Fruit rinds (2 x 2 cm2, 2-3 mm thick),
associated sub-rind mesocarp (~2 cm thick and 7-10 g weight) from the region
immediately underneath the inoculation site, and the inner mesocarp (including ca. 25%
seeds by weight) from the center of un-inoculated fruits were analyzed for the presence of
both pathogens. Rind layers and sub-rind mesocarp samples were excised aseptically
from the pathogen(s) or peptone inoculated 2 x 2 cm squares, whereas inner mesocarp
43
samples were excised from the whole non-inoculated fruit. A rind fragment 3 cm2 and 2-
3 mm thick was used for microbiological analysis (cultivation and enumeration of viable
microbes and PCR) and the remaining 1 cm2 was processed for analysis under CLSM and
SEM (Figure III-1). If the rind sample had any symptoms then that portion was included
in all microbial assays and electron microscopic examination. If no symptoms were
observed then the 1cm2 rind piece was excised from a corner of the 2 x 2 cm rind piece.
Rind pieces (3 cm2) were placed into sterile whirl-pack bags (7 oz., Nasco, WI)
containing 10 ml Universal Pre-enrichment Broth (UPB) (Becton, Dickinson and
Company, MD) and hand massaged from the outside with firm pressure for 2 min
followed by 1 min of vigorous hand shaking. Sub-rind mesocarp samples excised from
immediately below the inoculation site, and 25 g of inner mesocarp from the center of un-
inoculated fruit, were placed in a whirl-pak bags with filters (24 oz. and 55 oz. capacity,
respectively) and macerated with a rubber hammer. UPB was added at a ratio of 1: 9 (wt.:
vol.). A 100µl volume of each rind layer and mesocarp homogenate was plated (two
replicates) on NAPamp and XLD for enumeration of microbes present at high titers, and
250 µl volumes of the same aliquots were plated on each of 4 XLD and 4 NAPamp. plates
for enumeration of microbes present at low titers. XLD plates, specific for Salmonella
Poona, were incubated at 37oC for 24 h, and NAPamp, selective for GFPuv tagged E.
tracheiphila, were incubated at 28oC for 3-4 days. The remaining suspensions were
incubated at 28oC for 24 h, and then loopfuls of the enriched UPB were streaked onto
XLD and NAPamp plates and incubated at 37 or 28o C for 24 h or 3-4 days, respectively.
To enrich selectively for S. enterica, 100 µl of the overnight enrichment culture was
transferred to 10 ml of Rappaport Vasilliadis Broth (RV) (Becton, Dickinson and
44
Company) and incubated at 42o C for 48 hrs. A loopful of incubated RV broth was
streaked onto XLD plates and incubated for 18-24 h at 37oC to observe black colonies
that were presumptive of Salmonella Poona.
PCR confirmation of S. enterica and E. tracheiphila. One-ml aliquots of
overnight incubated rind and mesocarp samples were centrifuged (5800 x g for 10 min)
and the pellets stored at -20oC until the DNA was extracted for PCR. DNA was extracted
from the frozen pellets using a DNeasy Blood and Tissue Kit (QIAGEN Group, Austin,
TX). Pathogen presence was assessed by a multiplex PCR using Salmonella specific
primers (forward- 5’ GTGAAATTATCGCCACGTTCGGGCAA 3’ and reverse- 5’ TCA
TCGCACCGTCAAAGGAACC 3’) to amplify a 284-bp nucleotide sequence within the
invA gene (55) and E. tracheiphila specific primers ETC1 (5’GCACCAATTCCGCAGT
CAAG3’) and ETC2 (5’CGCAGGATGTTACGCTTAACG3’) to amplify a 426-bp
nucleotide sequence within the carbamoylphosphate synthetase gene (48). DNA
amplification was carried out in a 25 µl reaction consisting of 12 µl Gotaq® Green
Mastermix (Promega Corporation), 3 µl template DNA, 1 µl each primers (total 4 µl),
and 6 µl of nuclease free water. PCR was performed on Eppendorf thermal cycler
(Eppendorf, Hauppauge, NY) with cycling conditions including an initial denaturation at
94oC for 3 min, followed by 35 cycles at 94oC for 30 sec, 60oC for 20 sec, 72oC for 30
sec, and a final extension at 72oC for 3 min. Amplified products were run on 1.5% gel
made with 1x TAE buffer and electrophoresis run for a total of 1 hr. A total of 3
replications of the entire experiment were completed.
Confocal laser scanning microscopy (CLSM). To locate the inoculated
pathogens on the fruit rind, a 1 cm2 rind piece, out of 4 cm2 of the inoculated square, was
45
divided into two pieces (0.5 cm2 each) for analysis by scanning electron microscopy
(SEM) and CLSM. Although all samples were collected and processed for both types of
microscopy, for the latter, a total of 36 samples (one for each pathogen and control
treatment and DPI in a single replication) were processed. Tissues were fixed in 4%
paraformaldehyde for 1 h and washed 3X in distilled water. Fixed pieces were
longitudinally hand sectioned with a razor blade and placed onto a glass slide with a drop
of water and covered with coverslip. To visualize green fluorescence (GFPuv)- or red
fluorescence (DsRed) - expressing Erwinia and Salmonella, respectively, sections were
observed using a LEICA (Japan) TCS SP2 Laser Scanning Confocal Microscope with an
upright Leica DMRE microscope, equipped with an Argon ion laser at 458, 476, 488 and
514 nm; green HeNe at 543 nm; and red HeNe at 633 nm; the Coherent UV Laser was at
300-360 nm. GFPuv was found to excite with 488 nm light and the emission was
collected through a BA 505-525 filter. The wavelength of the lasers was first optimized
using positive control samples inoculated with both pathogens, before processing the
experimental samples.
Scanning electron microscopy (SEM). The remaining 0.5 cm2 of the rind pieces
of fruits sampled at 0, 9, or 24 DPI were processed for SEM. Tissues were fixed with 2%
gluteraldehyde in 0.2 M cacodylate buffer and stored at room temperature for 2 h, rinsed
3X with 0.1 M buffered wash (60 ml 0.2 M cacodylate buffer and 12.3 g sucrose
dissolved in 140 ml of dH2O) and then fixed for 1 h in 1% osmium tetraoxide at room
temperature. After another rinse they were dehydrated in ethanol [(30%, 50%, 70%, 80%,
90%, 95%, and 100% (3 X)] followed by critical-point drying 2X with HMDS
(hexamethyldisilazane) and sputter coating with Au/Pd for 2 min with a MED 010
46
sputtering device (Balzers Union, Blazers, Liechtenstein). Coated samples were
examined at different magnifications with a Quanta 600F scanning electron microscope
(FEI Corporation, Hillsboro, Oregon), operating at 15 to 20 kV.
Statistical analysis. All experiments, including fruits inoculated with E.
tracheiphila only, S. enterica only, a mixture of the two microbes, or 0.1% peptone water
as a control, were completed in triplicate. Mean and standard errors of log base 10
transformed colony counts of both bacteria were calculated using MS Excel and the
resulting data were analyzed using ANOVA procedures with SAS Version 9.2 (SAS
Institute, Cary, NC). Main effect means (DPI given treatment and treatment given DPI)
were reported and analyzed with planned contrasts. Percent data were analyzed with
contingency tables and Fisher’s Exact Test for the fruit detection part of the text. Graphs
were plotted using SigmaPlot 2002 for Windows Version 8.0 (SPSS Inc.). All tests are
considered significant at the P ≤ 0.05.
Results
Fruit appearance and symptom development. Newly formed, healthy
cantaloupe fruit were hairy and smooth-skinned, but at about 10-12 days of age, small
cracks appeared in the rind around the blossom end. Red-to-orange exudates seeping
from the newly formed rind cracks indicated the presence of a connection from the fruit
interior to the outside environment (Figure III-3). The cracks lengthened, branched and
intersected over time, gradually filled in and became raised as corky layers built up along
them.
47
After E. tracheiphila or E. tracheiphila + S. enterica inoculation of cantaloupe
fruit rind, small watersoaked lesions (Figure III-4 B) appeared at the inoculated site
within 4 - 7 days on 28 (58%) of the inoculated fruit. 61% of the fruits, sampled at 24
DPI with E. tracheiphila alone treatment, had watersoaked lesion. The watersoaked spots
ranged from barely noticeable lesions to a maximum of ca. 2 cm2 (half the area of the
inoculation site in a few fruits) over the next 20 days (data not shown). The percentage of
fruit that developed watersoaked lesions by 9 and 24 DPI in these two treatments did not
differ significantly (P<0.05) (Figure III-4 A). E. tracheiphila, tagged with GFPuv, was
observed (using UV light) as patches of green fluorescence between the rind cracks and
underneath the rind cuticle (Figure III-4 B and C). No lesions appeared on any fruits
receiving S. enterica alone or the control buffer.
S. enterica and E. tracheiphila survival on cantaloupe fruit rind.
Enumeration. After inoculation of S. enterica, E. tracheiphila, or a mixture of
both species onto cantaloupe fruit rind, bacterial recovery varied with the sampling time.
At 0 DPI, 3.62 log out of 5.60 log CFU/3 cm2 inoculated bacteria were recovered in the
S. enterica-only treatment and 3.69 log out of 5.63 log CFU/3 cm2 in the S. enterica + E.
tracheiphila inoculated treatment were recorded in Universal Pre-enrichment Broth
(Table III-1). S. enterica numbers recovered in both treatments were significantly
(<0.0001) lower (ca. 80% less) at 9 DPI than at 0 DPI, and by 24 DPI only 2 fruits (13%)
receiving the S. enterica + E. tracheiphila treatment still had detectable numbers of S.
enterica (Table III-1).
Unlike S. enterica, E. tracheiphila recovery was very low at 0 DPI. Only 1.58 log
cfu/3cm2 and 0.49 log cfu/3cm2 were recovered from fruit treated with E. tracheiphila
48
alone, or with E. tracheiphila + S. enterica, respectively, out of 5.64 - 5.71 log cfu/3cm2
inoculated (Table III-1). The latter recovery rate was approximately 70% less than that of
the E. tracheiphila-only treatment. No E. tracheiphila was detected on fruits sampled at 9
and 24 DPI in either treatment when watersoaked lesions were not present.
Microscopy. At 0 DPI S. enterica was observed by CLSM on rind samples that
had received both single and mixed culture inoculations (Figure III-5 A and B,
respectively). Only a few samples were visually positive (on the surface) for S. enterica
at 9 DPI, and none were positive at 24 DPI (data not shown). E. tracheiphila was
observed on the rind surface at 0 DPI (Figure III-5 C), and at 9 and 24 DPI when
watersoaked lesions were present (Table III-2). In internal longitudinal sections below the
watersoaked lesions (to a depth of 3 mm), E. tracheiphila was observed in the
intercellular spaces (Figure III-5 D).
S. enterica numbers on the rind surface at 0 and 9 DPI, as detected by CLSM
observation and culture enumeration, were indistinguishable (data not shown). Although
bacteria were not counted in CLSM, in some of the 0 DPI samples it was difficult to find
S. enterica. The number of S. enterica varied within same DPI samples and between
samples of 0 and 9 DPI, but this bacterium was never observed at 24 DPI. The number of
S. enterica PCR positive fruits was significantly higher (P>0.001) at 0 DPI than at 24 DPI
in both, single or multispecies inoculated samples (Table III-1, Figure III-6). S. enterica
was detected (by overnight enrichment culture and PCR) on 14% and 40% of fruit
inoculated with S. enterica, or with S. enterica + E. tracheiphila, respectively, at 24 DPI,
but these treatments were not significantly different (P = 0.11, one tailed Fisher’s Exact
Test) (Table III-2, Figure III-6). Among mixed culture inoculated fruits sampled at 24
49
DPI, S. enterica survived on more fruits (50% - 4 out of 8) having E. tracheiphila -
induced watersoaked lesions than on fruits without them (29% - 2 out of 7) (Table III-2).
Scanning electron micrographs of fruit having with watersoaked lesions,
inoculated with E. tracheiphila or E. tracheiphila + S. enterica, revealed bacterial masses
on the rind surface on or adjacent to the natural cracks (Figure.III-7 B) as well as deep
inside the cracks (Figure.III-7 D). Few fruits at maturity with watersoaked lesions, ≤ 0.5
cm2 lesion, showed inhibition of the watersoaked lesion with brownish margin and
looked like drying out (data not shown).
S. enterica colonization of cantaloupe fruit sub-rind mesocarp. Two types of
mesocarp samples, one immediately underneath the S. enterica or S. enterica + E.
tracheiphila inoculated rind and sampled at 0, 9 and 24 DPI (i.e. sub-rind mesocarp) and
the other from the central core of the fruit that received no rind inoculations and was
sampled only at 24 DPI (i.e. inner mesocarp), were examined. Neither microbial analysis
(cultivation) nor PCR detected S. enterica in the sub-rind mesocarp of 112 fruits sampled
in all DPI and treatments (Table III-3, some data not shown).
Assessment of systemic movement. Of the 131 total inner mesocarp samples,
taken from the central core of fruits that received no inoculation but were growing on the
same plants on which other fruit received either S. enterica or S. enterica + E.
tracheiphila, and sampled at all DPIs, were negative for S. enterica by both microbial
plating and PCR (Table III-2).
E. tracheiphila colonization of cantaloupe fruit sub-rind mesocarp. Some of
the sub-rind mesocarp of fruits that were inoculated with E. tracheiphila or E.
50
tracheiphila + S. enterica, and that later developed watersoaked lesions (sampled at 9
DPI and later), were positive for E. tracheiphila by microscopy, culture and PCR. On E.
tracheiphila only inoculated fruit, E. tracheiphila was detected in 10% and 31% of sub-
rind mesocarp sampled at 9 and 24 DPI, respectively (Table III-3). At 24 DPI, 27% of the
sub-rind samples that received E. tracheiphila + S. enterica and had watersoaked lesions
were positive for E. tracheiphila. All control fruits and those which did not develop
watersoaked lesions were negative for both the pathogens on sampled sub-rind mesocarp.
Discussion
Outbreaks of foodborne illness associated with Salmonella enterica contaminated
cantaloupe fruits underscore the importance of understanding the mechanisms of
microbial contamination and persistence in the fruit. Recent work by others has shown
that the presence of other microbial species, including plant pathogens, on the surfaces of
a number of plant species can enhance rates of human pathogen survival and
internalization. In this study we investigated the fate of Salmonella enterica Poona, alone
or in the presence of the cucurbit wilt causing bacterium, Erwinia tracheiphila, on
cantaloupe fruit surfaces.
In nature, striped and spotted cucumber beetles transmit E. tracheiphila while
feeding on plant parts (13), and even frass can be a source of contaminating bacteria as
beetles feed on flowers and released bacteria enter plant interiors and cause wilt
symptoms (48). The formation of tears or cracks during progressive changes in shape and
size of cantaloupe fruit (18) and their subsequent coverage by the accumulation of a
51
corky scar, are unique features that expose modified lenticels that serve in gas exchange
(70). Smooth surfaced melons also develop corky ridges if exposed to mechanical
injuries (40). Prior to the wound healing, however, the cracks may provide a ready
pathway for microbes on the surface to enter interior tissues.
After rind inoculation, alone or in a mixture with E. tracheiphila, S. enterica
could be detected on cantaloupe rind surfaces throughout the experiment, but its
population levels declined over the successive sampling periods (0, 9 and 24 DPI)
irrespective of the treatments. Others have shown that S. enterica can remain viable on
the Arabidopsis thaliana, lettuce, parsley, radish, and carrot phyllosphere for an extended
time (16, 36, 37). That S. enterica populations decline over time on agricultural produce
also has been reported elsewhere and is not surprising, as many factors determine
bacterial survival and the plant environment is generally not considered to be a natural
niche for human enteric pathogens (4, 5, 9, 41). Although most fruit receiving S. enterica
in our experiments tested positive only after enrichment, two fruit inoculated with the S.
enterica + E. tracheiphila mixture still had countable S. enterica through direct plating at
fruit maturity (24 DPI).
We found no evidence for invasion or colonization of the fruit mesocarp (sub-rind
or inner mesocarp) by S. enterica. Human enteric pathogens are documented plant
invaders under some conditions, having been reported to traverse lettuce stomata (42),
and to colonize tomato leaf trichomes (4), roots (32) and flowers (31). Infiltration into
cantaloupe fruit during low temperature storage (59) also has been found. The fact that
we never detected S. enterica in any mesocarp samples during our study suggest that
52
even in the presence of watersoaking this bacterium rarely, if ever, traverses the rind into
the edible portions of the fruit.
E. tracheiphila, which causes wilt in cantaloupe and many other cucurbit crops in
the eastern United States (12, 19, 24), is transmitted in nature by spotted and striped
cucumber beetles (29). Our original reason for including this treatment was the hope that
this plant pathogen might serve as a positive control so that, if S. enterica were not
detected on the cantaloupe rind or in interior tissues, we would know that the reason was
not a failure of our inoculation method. Introduction of this bacterium, in volumes and
titers unlikely to occur in the environment, directly onto cantaloupe rind surfaces, is far
from a natural phenomenon. However, our preliminary experiments had revealed that E.
tracheiphila could enter the fruit after introduction to the cracked areas (data not shown)
or through flower interiors and produce watersoaked lesions (28). Furthermore, Rojas and
Gleason (61) recently reported that E. tracheiphila can live as an epiphyte on muskmelon
leaves under a wide range of leaf wetness levels and temperatures, and they speculated
that this niche could serve as a source of E. tracheiphila inoculum for pathogen
dissemination. Their findings, combined with ours, suggest that E. tracheiphila may be a
normal resident on cucurbit plant surfaces in nature. If this is true, then its ability to
facilitate the survival of a human pathogen such as S. enterica becomes much more than
an academic question.
E. tracheiphila was detected on fruit rind soon after inoculation at 0 DPI, but only
in very low numbers, and it was never detected from the surfaces of healthy looking fruit
at 9 and 24 DPI. These low recovery rates for E. tracheiphila even at 0 DPI may be due
to the slow growth rate of this species, high viscosity of bacterium with significant
53
amount of polysaccharide production, the unusual plant niche for this bacterium, or rapid
loss in viability (13, 65, 66). Considerable research has been done to find the accurate
inoculation (33, 51, 54, 57, 66, 73, 74), isolation (54, 66), and storage (13, 22) techniques
for E. tracheiphila. Numerous methods of E. tracheiphila transmission in cucurbit plant
has been studied (56) but its internalization through cracks formed on fruit surface has
never been reported. However in our experiment, E. tracheiphila did traverse the rind, of
some fruit leading to the formation of watersoaked lesions that enlarged over time. We
detected E. tracheiphila in 31% of sub-rind mesocarp samples, that had lesions at 24 DPI,
and the increase in their numbers in that location from 9 DPI to 24 DPI suggests that they
either continue to move there over time or multiply there. That E. tracheiphila, deposited
artificially in high numbers on the cantaloupe rind, can colonize the rind surface, enter
the underlying mesocarp tissue through natural cracks, and cause watersoaked lesions is a
new finding. Such events might take place in nature, but be un-noticed if contaminated
beetles feed on these fruits or their frass contaminates the open wound as natural cracks
on fruit surface.
Introducing the human pathogen, S. enterica, and the plant pathogen, E.
tracheiphila, simultaneously led to some differences in the behavior of the individual
bacterial species. In this work, S. enterica persisted in greater numbers in the presence of
watersoaked lesions caused by E. tracheiphila than on non-symptomatic rinds. In nature,
human pathogens that come into contact with potential plant niches encounter numerous
microflora with which they may interact synergistically or antagonistically (8, 23, 38,
62). Microbial synergism between S. enterica and normal plant microflora, such as
certain storage fungi (71), and the plant pathogen Xanthomonas campestris pv.
54
vesicatoria, in the absence of plant disease (5), has been reported. Recently, Barak and
Schroeder (6), showed a positive correlation between bacterial speck lesion formation
and S. enterica survival on the tomato phyllosphere. Our test pathogens, i.e. S. enterica
and E. tracheiphila, might interact and colonize differently on other varieties of
cantaloupe fruit; a study with S. enterica and Escherichia coli O157:H7 showed variable
levels of root colonization depending on the cantaloupe variety (21). Both S. enterica and
E. coli, colonized the rhizosphere of ‘Burpee’s Ambrosia’ most and ‘Israel Old Original’
least among five cultivars tested. In the work reported here, it is likely that the leakage of
cellular contents into intercellular spaces after E. tracheiphila inoculation, which resulted
in watersoaking, provided nutrients and water supportive of S. enterica growth on the
rind surface, thereby extending the persistence of the human pathogen in what would
otherwise have been a less favorable environment.
We saw no indication that the presence of S. enterica influenced the behavior or
survival of E. trachiphila on the cantaloupe fruit. The apparent lack of interaction
between these species on rind surfaces is interesting because, in vitro, when S. enterica
and E. tracheiphila are streaked onto the same agar plate, there is clear inhibition of E.
tracheiphila (data not shown).
In this work there was no evidence for systemic movement of either pathogen in
the cantaloupe plant after rind inoculation. Lack of systemic movement of S. enterica was
expected, since we saw no internalization of this species. More interesting is that E.
tracheiphila, which was detected in the fruit mesocarp and which, in “typical” wilt
disease, moves systemically in the xylem, was not detected in un-inoculated fruit present
on the same plant that had inoculated fruit. The question of whether E. tracheiphila, after
55
traversing the fruit rind into the mesocarp, can find its way to the xylem and from there
move to other plant parts needs further investigation. In a preliminary experiment we
found evidence for systemic movement of E. tracheiphila to the fruit then to the vines,
resulting in plant wilting after flower interior inoculation (28). Twenty four days may not
be enough time for the plant pathogen to move through the vines and cause wilting.
Changes in fruit physiology during ripening, or the density of fruit tissues may restrict
systemic bacterial spread. The fact that E. tracheiphila numbers declined over time may
also reflect physiological incompatibility. Many storage and pathogenic fungi are active
on mature fruit from where they initiate postharvest decay (67, 75), but there are only few
bacterial diseases associated with fruits [Erwinia amylovora (26), Xanthomonas
axonopodis pv. citri (43, 44), Xyllela fastidiosa (14), etc.], and their primary location is
organs or tissues rather than fruits (39, 50).
Our results support the conclusion that survival of S. enterica on cantaloupe fruit
can be influenced by synergism with other microflora. As E. tracheiphila did internalize
in our study through the natural cracks, producing watersoaked lesions, the possibility of
S. enterica internalization also exists. Fruit cracking may be a route of internal
contamination in the field.
56
LITERATURE CITED
microflora on Georgia-grown cantaloupes. J. of Food Prot. 71:46-51.
2. Alves Barreto Damasceno, A. P., J. F. de Medeiros, D. C. de Medeiros, I. G.
Costa e Melo, and D. d. C. Dantas. 2012. Growth and nutrient uptake of
cantaloupe melon type "Harper" fertigated with doses of N E K. Revista Caatinga
25:137-146.
pathogen in Salmonella enterica contamination of tomato plants. PLoS One
3:e1657.
6. Barak, J. D., and B. K. Schroeder. 2012. Interrelationships of food safety and
plant pathology: the life cycle of human pathogens on plants. Ann. Rev.
Phytopathol. 50:241-66.
57
7. Bean, N. H., P. M. Griffin, J. S. Goulding, and C. B. Ivey. 1990. Foodborne
disease outbreaks, 5-year summary, 1983-1987. MMWR Morb. Mortal. Wkly.
Rep. 39:15-57.
8. Bennik, M. H. J., W. van Overbeek, E. J. Smid, and L. G. M. Gorris. 1999.
Biopreservation in modified atmosphere stored mungbean sprouts: the use of
vegetable-associated bacteriocinogenic lactic acid bacteria to control the growth
of Listeria monocytogenes. Lett. Appl. Microbiol. 28:226-232.
9. Bezanson, G., P. Delaquis, S. Bach, R. McKellar, E. Topp, A. Gill, B. Blais,
and M. Gilmour. 2012. Comparative examination of Escherichia coli O157:H7
survival on Romaine lettuce and in soil at two independent experimental sites. J.
Food Prot. 75:480-487.
134:675-685.
11. Brand, M. T., M. Q. Carter, C. T. Parker, M. R. Chapman, S. Huynh, and Y.
Zhou. 2011. Salmonella biofilm formation on Aspergillus niger involves
cellulose - chitin interactions. Plos One 6:e25553.
26:580-584.
13. Burkholder, W. H. 1960. Some observations on Erwinia tracheiphila, the causal
agent of cucurbit wilt. Phytopathology 50:179-180.
58
14. Burnett, A. B., and L. R. Beuchat. 2001. Comparison of sample preparation
methods for recovering Salmonella from raw fruits, vegetables, and herbs. J. Food
Prot. 64:1459-1465.
15. Choi, K. H., and H. P. Schweizer. 2006. Mini-Tn7 insertion in bacteria with
single attTn7 sites: example Pseudomonas aeruginosa. Nat. Protoc. 1:153-161.
16. Cooley, M. B., W. G. Miller, and R. E. Mandrell. 2003. Colonization of
Arabidopsis thaliana with Salmonella enterica and enterohemorrhagic
Escherichia coli O157:H7 and competition by Enterobacter asburiae. Appl.
17. Costerton, J. W. 1995. Overview of microbial biofilms. J. Ind. Microbiol.
15:137-140.
18. Cutter, E. G. 1969. Plant Anatomy: Experiment and Interpretation. Addison-
Wesley Publishing Co. Menlo Park, CA, USA.
19. de Mackiewicz, D., F. E. Gildow, M. Blua, S. J. Fleischer, and F. L. Lukezic.
1998. Herbaceous weeds are not ecologically important reservoirs of Erwinia
tracheiphila. Plant Dis. 82:521-529.
20. Deza, M. A., M. Araujo, and M. J. Garrido. 2003. Inactivation of Escherichia
coli O157 : H7, Salmonella enteritidis and Listeria monocytogenes on the surface
of tomatoes by neutral electrolyzed water. Lett. Appl. Microbiol. 37:482-487.
Salmonella. Eur. J. Hortic. Sci. 73:73-75.
59
22. Ferguson, W. E., and V. W. Nuttall. 1964. The preservation of Erwinia
tracheiphila by freeze-drying. Can. J. Bot. 42:333-335.
23. Fett, W. F. 2006. Inhibition of Salmonella enterica by plant-associated
pseudomonads in vitro and on sprouting alfalfa seed. J. Food Prot. 69:719-728.
24. Fleischer, S. J., D. de Mackiewicz, F. E. Gildow, and F. L. Lukezic. 1999.
Serological estimates of the seasonal dynamics of Erwinia tracheiphila in
Acalymma vittata (Coleoptera : Chrysomelidae). Environ. Entomol. 28:470-476.
26. Frazier, W. A. 1939. Fruiting of the powdery mildew resistant No. 45 cantaloupe
as affected by spacing. Proc. Am. Soc. Horticul. Sci. 37:831-835.
Protect. 66:82-87.
101:S59-S59.
29. Gould, G. E. 1944. The Biology and control of the striped cucumber beetle. Buil.
Ind. agric. Exp. Stn.:28 pp.
60
Microbiol. 67:4760-4764.
33. Harris, H. A. 1940. Comparative wilt induction by Erwinia tracheiphila and
Phytomonas stewarti. Phytopathology 30:625-638.
34. Hedberg, C. W., K. L. Macdonald, and M. T. Osterholm. 1994. Changing
epidemiology of food-borne disease: a Minnesota perspective. Clin. Infect. Dis.
18:671-682.
36. Islam, M., J. Morgan, M. P. Doyle, S. C. Phatak, P. Millner, and X. Jiang.
2004. Persistence of Salmonella enterica serovar typhimurium on lettuce and
parsley and in soils on which they were grown in fields treated with contaminated
manure composts or irrigation water. Foodborne Pathog. Dis. 1:27-35.
61
38. Janisiewicz, W. J., W. S. Conway, and B. Leverentz. 1999. Biological control
of postharvest decays of apple can prevent growth of Escherichia coli O157 : H7
in apple wounds. J. Food Prot. 62:1372-1375.
39. Jones, H. A., and J. T. Rosa. 1928. Truck crop plants. McGraw-Hill Book Co.,
Inc., New York.
40. Keren-Keiserman, A., Z. Tanami, O. Shoseyov, and I. Ginzberg. 2004.
Differing rind characteristics of developing fruits of smooth and netted melons
(Cucumis melo). J. Horticul. Sci. Biotechnol. 79:107-113.
41. Kisluk, G., and S. Yaron. 2012. Presence and Persistence of Salmonella enterica
Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated
Parsley. Appl. Environ. Microbiol. 78:4030-4036.
43. Lament, W. J. 1993. Plastic mulches for the production of vegetable crops. Hort.
Technol. 3:35-49.
44. Liu, L., F. Kakihara, and M. Kato. 2004. Characterization of six varieties of
Cucumis melo L. based on morphological and physiological characters, including
shelf-life of fruit. Euphytica 135:305-313.
62
47. Meissner, F. 1952. Die Korkbildung der Früchte von Aesculus-undCucumis-
Arten. Österreichische botanische Zeitschrift 99:606-624.
cantaloupe melon production units and packaging facility. Agric. Tec. Mex.
35:135-145.
50. Nunez-Palenius, H. G., M. Gomez-Lim, N. Ochoa-Alejo, R. Grumet, G.
Lester, and D. J. Cantliffe. 2008. Melon fruits: Genetic diversity, physiology,
and biotechnology features. Crit. Rev. Biotechnol. 28:13-55.
51. Nuttal, V. W., and J. J. Jasmin. 1958. The inheritance of resistance to bacterial
wilt, (Erwinia tracheiphila E.F. Smith, Holland) in cucumber. Can. J. Plant Sci.
38:401-404.
52. Pair, S. D., B. D. Bruton, F. Mitchell, J. Fletcher, A. Wayadande, and U.
Melcher. 2004. Overwintering squash bugs harbor and transmit the causal agent
of cucurbit yellow vine disease. J. Econ. Entomol. 97:74-78.
63
Foglia rivers (Pesaro-Urbino, Italy). Water Res. 32:1515-1521.
54. Prend, J., and C. A. John. 1961. Method of isolation of Erwinia tracheiphila
and an improved inoculation technique. Phytopathology 51:255-258.
55. Rahn, K., S. A. Degrandis, R. C. Clarke, S. A. McEwen, J. E. Galan, C.
Ginocchio, R. Curtiss, and C. L. Gyles. 1992. Amplification of an invA gene
sequence of Salmonella typhimurium by polymerase chain-reaction as a specific
as a specific method of detection of Salmonella. Mol. Cell. Probes 6:271-279.
wilt of cucurbits. J. Agric. Res. 6:417-434.
57. Reed, G. L., and W. R. Stevenson. 1982. Methods for inoculating muskmelon
with Erwinia tracheiphila. Plant Dis. 66:778-780.
59. Richards, G. M., and L. R. Beauchat. 2004. Attachment of Salmonella Poona to
cantaloupe rind and stem scar tissues as affected by temperature of fruit and
inoculum. J. Food Prot. 67:1359-1364.
64
10.
61. Rojas, E. S., and M. L. Gleason. 2012. Epiphytic survival of Erwinia
tracheiphila on muskmelon (Cucumis melo L.). Plant Dis. 96:62-66.
Quiroz. 2009. Survival of Salmonella Typhimurium on cantaloupe melon during
cold storage under controlled atmospheres. Rev. Fitotec. Mex. 32:209-215.
63. Sewell, A. M., and J. M. Farber. 2001. Foodborne outbreaks in Canada linked to
65. Smith, E. F. 1920. An introduction to bacterial diseases of plants. W.B. Sanders
Co., Philadelphia.
66. Smith, E. F. 1911. Wilt of cucurbits, vol. 2. Carnegie Institute of Washington,
Washington.
67. Solomon, E. B., B. A. Niemira, G. M. Sapers, and B. A. Annous. 2005.
Biofilrn formation, cellulose production, and curli biosynthesis by Salmonella
originating from produce, animal, and clinical sources. J. Food Prot. 68:906-912.
honeydew melon, p. 12, 20, 32-33, Fresh-Cut, vol. April 2001.
65
69. Ukuku, D. O., V. Pilizota, and G. M. Sapers. 2004. Effect of hot water and
hydrogen peroxide treatments on survival of Salmonella and microbial quality of
whole and fresh-cut cantaloupe. J. Food Prot. 67:432-437.
70. Webster, B. D., and M. E. Craig. 1976. Net morphogenesis and characteristics
of surface of muskmelon fruit. J. Am. Soc. Horticul. Sci. 101:412-415.
72. Wells, J. M., and J. E. Butterfield. 1997. Salmonella contamination associated
with bacterial soft rot of fresh fruits and vegetables in the marketplace. Plant Dis.
81:867-872.
73. Williams, L. E., and J. L. Lockwood. 1956. Control of bacterial wilt of
cucumber by antibiotic sprays. Plant Dis. Rep. 40:4.
74. Wilson, J. D., C. A. John, H. E. Wholer, and M. M. Hoover. 1956. Two
foreign cucumbers resistant to bacterial wilt and powdery mildew. Plant. Dis.
Rep. 40:437-438.
75. Xiao, C. L., and J. D. Rogers. 2004. A postharvest fruit rot in d'Anjou pears
caused by Sphaeropsis pyriputrescens sp nov. Plant Dis. 88:114-118.
66
Figure III-1: Fruit sampling in a single replication. Fruits of 8 plants were
inoculated with each of the three pathogen treatments (E. tracheiphila or S. enterica or
mixture of these two pathogens) (24 plants), and three plants served as controls (24+3=27
plants per replication). Fruits of three plants per treatment (9 plants) were sampled at 0
and 9 DPI, and fruits of five plants per treatment (15 plants) were sampled at 24 DPI.
Rind, sub-rind mesocarp and inner mesocarp were sampled as illustrated.
67
Figure III-2: Newly formed natural cracks on cantaloupe fruit rind areas (2 x 2
cm) inoculated with in 10-15 droplets of 20 µl pathogen(s) suspensions or 0.1% peptone
and spread with a sterile bristled brush. Arrow head indicates cracks older than those in
the area being inoculated.
68
Figure III-3: Reddish orange exudate (arrow) observed on the natural cracks of
10-12 day-old cantaloupe fruit rind. These cracks are naturally healed by deposition of
corky material, forming the characteristic netting on cantaloupes.
69
Figure III-4: Cantaloupe rind inoculation with E. tracheiphila (Et- green
fluorescing with GFPuv), alone or together with S. enterica (SP- red fluorescing with
DsRedExpress), pathogens were spread onto the rind surface with a soft brush and
sampled at 0, 9 or 24 DPI. (A) Percentage of cantaloupe fruit showing watersoaked
symptoms based on visual inspection, no significant difference between day 9 and 24 at
any level of Et or SP + Et (Fisher’s Exact one-tailed P=0.64 and P=0.53, respectively), (B
and C) Cantaloupe rind with watersoaked lesion observed under natural light, and under
UV light, respectively. C shows green fluorescing E. tracheiphila on the cracks and
beneath the cuticle in a watersoaked area. Scale bars represent 2 cm.
70
Table III-1: Recovery of S. enterica Poona and E. tracheiphila, at intervals following inoculation, singly or together, onto
cantaloupe fruit rind surfaces.
Pathogen Development of Pathogen recovery (Log CFU ± SE/3cm2)
Treatments assessed watersoaked lesion 0 DPI 9 DPI 24 DPI
Et Et + NA TNTC (6/10)¥ TNTC (8/13)
- 1.58a ± 0.30 (8/10) 0.00b ± 0.00 (4/10)* 0.00b ± 0.00 (5/13)
SP SP NA 3.62a ± 0.19 (9/9) 0.65b ± 0.27 (4/9) 0.00c ± 0.00 (0/14)
SP + Et Et + NA TNTC (6/10) TNTC (8/15)
- 0.49a ± 0.34 (2/10) 0.00b ± 0.00 (4/10) 0.00b ± 0.00 (0/15)
SP NA 3.69a ± 0.19 (8/10) 0.79b ± 0.28 (5/10) 0.27c ± 0.19 (2/15)
Control SP and Et NA 0.00 ± 0.00 (0, 3) 0.00 ± 0.00 (0/3) 0.00 ± 0.00 (0/6)
SE - standard error of mean, CFU – colony forming units, SP – Salmonella enterica Poona, Et – Erwinia tracheiphila
TNTC- Too numerous to count, NA- Not applicable since watersoaking did not occur immediately.
¥ Numbers in parenthesis following “TNTC” indicate # of fruits on which lesions developed /total fruit sampled for that treatment
* Numbers in parenthesis following pathogen recovery figures indicate # of fruit samples having detectable level of pathogen/total #
fruit sampled.
Means within the same treatment having the same letter are not statistically significant at the 0.05 level according to ANOVA.
71
Figure III-5: Confocal laser scanning microscope images showing the presence of
inoculated, fluorescently tagged bacteria on cantaloupe rind surfaces. Rind epidermal
cells appear as a beehive pattern, and bacteria are indicated with arrows (panels C and D).
(A) Fruit rind surface inoculated with S. enterica Poona (labeled with DsRedExpress) and
sampled at 0 day post inoculation (DPI), (B) Fruit rind surface inoculated with a mixture
of S. enterica Poona + E. tracheiphila (labeled with GFPuv) and sampled at 0 DPI (C)
Fruit rind surface inoculated with E. tracheiphila and sampled at 0 DPI and (D)
Longitudinal section of rind containing watersoaked lesion and sampled at 24 DPI; E.
tracheiphila in the intercellular spaces (arrow) (inoculated with mixture of S. enterica
plus E. tracheiphila). The scale bars represent 5µm.
72
0 DPI 9 DPI 24 DPI
SP positive fruit rinds (%)

a a a
100
ab
80
60
b
40
20 b
0
SP SP + Et
Fruit rind inoculated with pathogen(s)
Figure III-6: Fruits positive for S. enterica Poona (SP) from rinds of cantaloupe
inoculated with S. enterica Poona alone (SP), or S. enterica + E. tracheiphila (SP + Et), at
0, 9 or 24 days post inoculation (DPI). Similar letters above bars of the same treatment do
not significantly differ at p < 0.05) according Fischer’s Exact test- one tailed. Overall p-
value for comparison of proportions among levels of DPI given treatments are <0.001
and 0.0039 for SP and SP + Et, respectively.
73
Figure III-7: Scanning electron micrographs of cantaloupe rind surface at fruit
maturity (24 days post inoculation). (A) Rind inoculated with 0.1% peptone; (B) Masses
of bacteria seen near a trichome scar on a rind that had a watersoaked lesion, inoculated
with E. tracheiphila; (C) Crack on rind inoculated with 0.1% peptone; and (D) Crack on
rind inoculated with mixed S. enterica + E. tracheiphila line the fruit crack that had a
waterloaked lesion. All observations were made at 5,000X; scale bar shows 20µm.
74
Table III-2: Recovery of S. enterica from cantaloupe fruit inoculated with a
mixture of S. enterica and E. tracheiphila, data sorted by the development of E.
tracheiphila-incited watersoaked lesions.
% of fruits with lesions + % of fruits without
Days post-inoculation for S. enterica lesions + for S. enterica P- value
9 83.3 (5/6)* 75.0 (3/4) 0.67
24 50.0 (4/8) 28.5 (2/7) 0.38
Total 64.3 (9/14) 45.5 (5/11) 0.30
*Numbers in parenthesis following % pathogen recovery figures indicate # of fruit
samples positive by (colony counts) of pathogen/total # of fruit sampled.
Percent fruit values analyzed using Fisher’s Exact Test.
75
Table III-3: Percent of sub-rind mesocarp and inner mesocarp samples positive,
by colony count and PCR, for S. enterica or E. tracheiphila from fruits inoculated with
either S. enterica, E. tracheiphila or a mixture of these pathogens, sampled at different
days post inoculation (DPI).
Treatment on fruit rind

Samples for measurement Et SP Et + SP Control
9 DPI
Total # of fruits sampled 10 9 10 3
Sub-rind mesocarp*
Et + 10a 0a 0a 0a
SP + 0a 0a 0a 0a
24 DPI
Sub-rind mesocarp
Et + 31a 0b 27ab 0b
SP + 0a 0a 0a 0a
Inner mesocarp**
Et + 0 0 0 0
SP + 0 0 0 0
Et – E. tracheiphila, SP – S. enterica Poona,
*Sub-rind mesocarp- 7-10 g of mesocarp underlying the rind square of fruits inoculated
with pathogen(s) or with 0.1% peptone water.
**Inner mesocarp- Mesocarp excised from the center of un-inoculated fruits on the
same plants on which other fruit were treated with pathogen(s) or 0.1% peptone water
treatment.
Percentages in the same row with the same letter are not significantly different at the 0.05
level. Means were separated using Fisher’s Exact Test.
76
CHAPTER IV
SALMONELLA ENTERICA COLONIZATION OF CANTALOUPE FLOWERS
AND FRUIT FOLLOWING FLOWER INOCULATION ALONE OR WITH
ERWINIA TRACHEIPHILA
Abstract
Cantaloupe, which is vulnerable to Salmonella contamination, has been
implicated in numerous outbreaks of foodborne illness. However, little is known about
the mechanisms and pathways by which S. enterica colonizes the fruit. We hypothesized
that bacteria present within flower interiors, to which they could be introduced by insects,
could access the developing fruit through natural flower openings, such as nectaries and
stigmas. We further hypothesized that the presence of a plant pathogen, the cucurbit wilt
bacterium Erwinia tracheiphila, could influence the fate of Salmonella in this
environment. Hand pollinated cantaloupe flowers were inoculated at the bottom of the
floral whorl with 5 µl (ca. 107 cfu/ml) of S. enterica Poona, a clinical isolate from 2001
cantaloupe outbreak, E. tracheiphila MCM1-1, a mixture of these two pathogens, or
0.1% peptone water as a control treatment. Fruit mesocarp samples (25 g) were excised at
15and 43 days post inoculation (DPI). Whole flowers were sampled immediately (0 DPI)
77
and at fruit maturity (43 DPI) (consisted of dried floral remnants plus a 1 x 1 x 0.1-0.2 cm
of adjacent blossom-end rind). All flowers sampled at 0 and 43 DPI and inoculated with
either S. enterica or S. enterica + E. tracheiphila were positive for S. enterica, and at 43
DPI the populations of S. enterica were significantly (P<0.05) higher than these at 0 DPI
from 4.46 to 6.12 log cfu/ ml and 4.89 to 6.86 log cfu/ml, respectively. E. tracheiphila
was not recovered from any of the samples, regardless of treatment at 43 DPI and no
observations were made at 15 DPI. An interior mesocarp sample from just one fruit,
whose flower was inoculated with S. enterica only and sampled at 15 DPI, was positive
for S. enterica. Our data suggest that, following flower inoculation, internalization of
Salmonella into cantaloupe mesocarp is a rare event. However, dried floral remnants and
the blossom end on mature fruit could act as a reservoir for Salmonella if the pathogen
were introduced to the site at the flowering stage.
Introduction
Salmonella enterica is the human pathogen most common by implicated
infoodborne illnesses, and outbreaks have been increasingly linked with the consumption
of fresh fruits and vegetables (21). One million infections, 19,533 hospitalizations, and
378 deaths occur annually in the United States (40). Associated food recalls have resulted
in significant economic losses (2, 9, 15). The first reported multistate outbreak of
salmonellosis in the United States, in 1990, which was attributed to the consumption of S.
enterica Chester contaminated cantaloupe (Cucumis melo var. reticulatus), was reported
to affect 256 people (36), but the actual number of people involved was likely higher,
78
since many cases go unreported (29). Salmonellosis can be fatal for infants and
immunologically compromised people (7).
Human pathogens, such as Salmonella, can enter agricultural production fields
through agricultural inputs such as irrigation water (16, 32, 34), soil or animal manure
(5). Cantaloupe is particularly vulnerable because of its surface netting and uaual contact
with soil surface, where human pathogens may be present. Long term survival of human
pathogens in agricultural environments creates a risk for consumers of fresh produce (11,
12, 18, 25, 45). Those pathogens, once established as surface contaminants, are not easily
washed away, even when sanitizers are used (1, 28, 42, 44). Moreover, injuries on plant
surfaces can prolong human pathogen persistence, possibly due to leaking fluids or the
creation of protected niches (22, 45). Internalization of human pathogens in plants, and
enhancement of their colonization of plant surfaces in the presence of plant pathogens or
other microflora, have been demonstrated in lettuce, tomato and other fresh vegetables (4,
5, 13, 20, 26, 39, 45).
We hypothesized that S. enterica can internalize into the edible portion
(mesocarp) of cantaloupe fruit after introduction into the flower interior, either alone or
together with the melon wilt pathogen, Erwinia tracheiphila, and that S. enterica can
survive on inoculated flowers until the time of fruit maturity.
Materials and Methods
Bacterial strains, maintenance and inoculum preparation. S. enterica Poona,
a clinical isolate from 2001 cantaloupe outbreak, (2), and E. tracheiphila strain MCM1-1,
isolated originally from cantaloupe by B. Bruton, USDA-ARS, Lane, OK, and provided
79
by M. Gleason, Iowa State University, IA, were used in this study. Bacteria were stored
in Luria Bertani (LB) broth with 25% glycerol at -80oC. To prepare inoculum, S.
enterica and E. tracheiphila were grown for 24 h at 37oC and 28oC on LB and nutrient
agar, respectively. Cells of both pathogens were harvested with a sterile loop and
dispersed in 0.1% peptone. The final concentration of both pathogens, determined by
optical density and dilution plating, was adjusted to ca. 2 x 107 cfu/ml. For mixed species
inoculation, equal volumes of S. enterica and E. tracheiphila suspensions were mixed
with 0.1% peptone water to a final concentration of ca. ca. 107 cfu/ml. Suspensions were
used immediately after formulation and inoculation was completed in 1-2 h.
Plant management. Cantaloupe, cv. Sugarcube, seeds were sown about an inch
deep in cells of polypropylene flats containing Redi-earth potting mix (Sun Gro, WA)
and placed in a growth chamber (75oF, 60% humidity and 14/10 h day/night light).
Seedlings that were 21 days old and at the 2-3 leaf stage were transplanted in to 4.2
gallon plastic pots containing Metromix-300 potting mix (Sun Gro, WA) supplemented
with slow-release Osmocote fertilizer (19N, 6P and 12 K). Pots were then transferred to a
polypropylene tray in the greenhouse, where day and night temperatures were set at 24oC
and 18oC, respectively, with 14 h day/ 10 h night light.
A week after transplanting the vining plants were trailed up and tied onto a
framework of polyvinyl chloride (PVC) pipes, and pots were watered every other day.
Young fruit that formed also were supported on the PVC frame. The experiment, which
included three replications, was started in August 2011 and completed in January 2012.
The average temperature and humidity recorded inside the greenhouse were 23oC and
52%, respectively.
80
Flower pollination, inoculation and sampling. Hand pollination was performed
by collecting pollen, using a fine artist’s paint brush, from 1-2 staminate flowers and then
dabbing it onto the stigmas of pistillate flowers of the same plant; on the day they
opened. Flower whorls were inoculated with pathogen(s) or with 0.1% peptone
immediately after pollination. Cultured cell suspensions, adjusted to ca. 107 cfu/ml (5µl)
were introduced, using a thin pipette tip, to the base of the floral whorl.
Two types of flower samples were collected to determine pathogen(s) survival: at
day 0 samples were fresh, moist flowers and at day 43 samples consisted of the dried
floral remnants supplemented with a thin, 1x1x0.1-0.2 cm from the blossom-end rind to
which they were attached (Figure.IV-1). Two additional sample types: internal mesocarp
tissues of fruits, which developed after flower inoculation, and excised at 15 DPI and 43
DPI, and from fruits that were left un-inoculated to test for systemic pathogen movement.
Fruits were visually inspected for symptoms prior to sampling and analysis.
We hypothesized that S. enterica, inoculated in the interior of pollinated flowers,
might traverse into the fruit derived from the ovary of that flower through natural
openings such as nectarthodes, and from there could access the vascular tissue and move
systemically into other regions of the plant, such as another fruit. To test for systemic
movement, one un-inoculated fruit was left on each test plant for testing at fruit maturity.
Treatments consisted of S. enterica alone, E. tracheiphila alone, or a mixture of S.
enterica + E. tracheiphila, with a total of 5 plants per treatment (2 plants for sampling at
0 and 15 DPI and 3 plants for sampling at 43 DPI). For control treatments (0.1% peptone
water), 1 and 2 plants were sampled at 0 and 15 and 43 DPI, respectively. This is
81
explained clearly, with a flow diagram, in Figure IV-1. Each treatment was replicated
three times.
Microbiological analyses. Flower samples, fresh or dried with attached blossom
end rind ca. ≤ 1 g each, inoculated or not with pathogen(s), were collected in individual
whirl-pak bags (7 oz., Nasco Co., IL) macerated with a rubber hammer in 10 ml of
Universal Pre-enrichment Broth (UPB) (Becton, Dickinson and Company, MD), hand
shaken for 1 minute and processed for microbial analysis. Mesocarp samples were
excised aseptically by bisecting the fruits, cutting wedge-shaped triangles perpendicular
to the bisection, and then slicing and lifting a thin (2-4 mm thick) mesocarp layer that
included the core seeds (Figure IV-2). Mesocarp samples (ca. 25 g) in whirl-pak bags (55
oz. size, Nasco Co., IL) were weighed and macerated as above. UPB (225 ml) was added
to the bags followed by hand shaking for 1 minute. Flower and mesocarp suspensions
were plated on xylose lysine deoxycholate agar (XLD) plates (250 µl in quadruplicate
plates and 100µl in duplicate plates) to recover S. enterica. The presence or absence of E.
tracheiphila was assessed by PCR. Reported optimal growth temperatures of these two
pathogens differ (37o C for S. enterica and 28o C for E. tracheiphila), but in a preliminary
experiment we found no difference in S. enterica growth rates on LB broth at 28o C and
37o C, based on optical density (OD) at 600 nm (data not shown), so all the enriched
samples were incubated at 28o C for 24 hrs. The remaining flower and mesocarp
suspensions were incubated and processed for S. enterica detection following Food and
Drug Administration Bacteriological Analytical Manual (FDA, BAM) protocols (14).
Finally, 1 ml of overnight incubated mesocarp and flower suspensions (1 ml each) were
82
centrifuged at 5800 x g for 10 minutes and the pellets stored at -20oC until the DNA was
extracted for PCR.
PCR detection of S. enterica and E. tracheiphila. DNA was extracted from the
frozen pellets using a DNeasy Blood and Tissue Kit (QIAGEN Group, Austin, TX).
Pathogen presence was assessed by a multiplex PCR using Salmonella specific primers
(forward- 5’ GTGAAATTATCGCCACGTTCG GGCAA 3’ and reverse- 5’
TCATCGCACCGTCAAAGGAACC 3’) to amplify a 284-bp nucleotide sequence within
the invA gene (35), and E. tracheiphila specific primers ETC1(5’GCACCAATTCCGCA
GATCAAG3’) and ETC2 (5’CGCAGGATGTTACGCTTAACG3’) to amplify a 426-bp
nucleotide sequence within the carbamoylphosphate synthetase gene (30). DNA
amplification was carried out in a 25 µl reaction mix consisting of 12 µl Gotaq® Green
Mastermix (Promega Corporation), 3 µl template DNA, , 1 µl each primers (total 4 µl),
and6 µl of nuclease free water. PCR was performed on Eppendorf Thermal cycler
(Eppendorf North America, NY) with cycling conditions including an initial denaturation
at 94oC for 3 min, followed by 35 cycles at 94oC for 30 sec, 60oC for 20 sec, 72oC for 30
sec, and a final extension at 72oC for 3 min. Amplified products were run on 1.5% gel
made with 1x TAE buffer and electrophoresis run for a total of 1 hr. A total of 3
replications of the entire experiment were completed.
Statistical analysis. All experiments were completed in triplicate. Mean and
standard errors of log base 10 transformed count values were calculated using MS Excel
and the resulting data were analyzed using ANOVA procedures with SAS Version 9.2
(SAS Institute, Cary, NC). A two-factor factorial (treatment and DPI) in a randomized
complete block design was the assumed model.
83
Results
Fruit appearance after flower inoculation. After S. Poona, E. tracheiphila, a
mixture of the two bacteria, or peptone water were used to inoculate flowers, the range in
the fruit shape and size did not differ from those of controls. Flowers, that remained
attached to the fruit towards fruit maturity, became dry and brittle as fruits developed. All
fruits, irrespective of treatments, appeared healthy from beginning to fruit maturity.
Survival and growth of S. enterica and E. tracheiphila at flower inoculation
sites. Whole flowers (when available) from each treatment were collected and processed
for microbial content. E. tracheiphila populations were not enumerated, but multiplex
PCR was performed on DNA extracted from overnight enriched cultures. Except at 0
DPI, all samples were negative for E. tracheiphila. Immediately after flower inoculation
recovery, of S. enterica was ca. 5 log in both S. enterica and mixed-culture treatments
(Table IV-1); S. enterica recovery was significantly higher (P<0.05) at 43 DPI than at 0
DPI in both S. enterica-containing treatments. S. enterica recovery at 43 DPI was 39%
greater (6.12 log cfu/ml) in the S. enterica only treatment, and 45% greater (6.86 log
cfu/ml) in the S. enterica + E. tracheiphila treatment than at 0 DPI (Table IV-1). Rates of
S. enterica recovery did not differ between the two inoculation treatments at 0 or 43 DPI
(P>0.05). The identity of S. enterica was confirmed with multiplex PCR in these two
treatments.
S. enterica and E. tracheiphila internalization of fruit mesocarp. The
mesocarp tissue of fruits that developed from inoculated flowers was sampled at 15 and
43 DPI to assess pathogen internalization. Of 108 fruits, including controls, sampled, 15
received S. enterica alone or in a mixture with E. tracheiphila. The mesocarp of one of 6
84
fruits that developed after flower inoculation with S. enterica alone and sampled at 15
DPI was positive for S. enterica after overnight enrichment. All other mesocarp samples
were negative for S. enterica. We did not detect E. tracheiphila from any fruit mesocarp
throughout the experiment.
Discussion
Salmonella, a common human enteric pathogen, has been implicated as a
contaminant of cantaloupe fruit (3, 8, 31) and can be transferred into the edible mesocarp
at the time of cutting (42). Whether it can invade developing cantaloupe fruit in the field
is not known, although in a recent study S. enterica failed to enter cantaloupe plant roots
after soil inoculation (27). Recent reports of Salmonella internalization into edible parts
of the other plant species after artificial inoculation, either alone or in the presence of a
plant pathogen, has increased concern that, under certain conditions, it could occur in the
field (4, 5, 19, 25, 26, 37).
As numerous insects visit flowers and could transmit human pathogens (24, 43),
we were interested to know whether S. enterica can survive in inoculated flower interiors
and/or enter the cantaloupe plant through natural floral openings, such as nectarthodes or
stigmas, and also whether the presence of the cucurbit wilt pathogen, E. tracheiphila,
would influence that ability. Under the conditions of our study, the incidence of fruit
mesocarp colonization by S. enterica after flower inoculation was very low. S. enterica
did, however, survive on inoculated flowers until fruit maturity. Although we did not
detect, E. tracheiphila, at fruit maturity, it is possible that microbial community members
could have enhanced its survival.
85
Whether it was inoculated alone or together with E. tracheiphila, S. enterica was
not found in fruit mesocarps sampled 43 days after flower inoculation. One S. enterica
only-inoculated fruit, sampled at 15 DPI, was PCR positive, but only after enrichment
culture, suggesting that population levels were very low.
Most flowers, regardless of treatment, were wet the day after inoculation/
pollination, and this could be a normal phenomenon for plant to make conducive
environment for fertilization, and the presence of a film of water is often conducive to
bacterial entry (46). Barak et. al. (4) reported that the broken bases of type 1 trichomes
present on tomato leaves as a preferred site for S. enterica Poona colonization and the
occurrence of disease in those plants correlated with higher S. enterica populations
compared to those on healthy plants. Others have reported internalization of S. enterica in
other fresh produce (18-20, 26). Guo et al. (19) found that 25% of tomato fruits contained
S. enterica after flowers were brushed with a bacterial suspension. The fact that S.
enterica Poona was significantly more likely to internalize than four other Salmonella
serovars tested suggests the existence of serovar-specific traits that may influence
adaptation to the plant environment. Human pathogen internalization through other plant
parts also has been reported. S. enterica entered lettuce leaves through stomata (26),
tomato fruit through roots (20), and stems inoculations (19). Greater fruit colonization by
S. enterica occurred when tomato stems were inoculated prior to, rather than after fruit
set (19). Similarly, fruit internalization by microbes other than human pathogens through
unusual routes also has been reported. Pseudomonas corrugata (41) and E. carotovora
subsp. carotorova (6), respectively, entered tomato fruit after flowers were sprayed or
fruits were dipped in the pathogen inoculum. P. corrugata, which causes tomato pith
86
necrosis, usually infects through the rhizosphere, so the flower is an unusual route of
internalization for this pathogen. E. carotovora subsp. carotovora, which causes soft rot
of fruits and vegetables, is an important disease in the field and during storage.
Much of the previous research done to explore the possibility of human pathogen
internalization involved relatively high doses of pathogens that are unlikely to occur in
agricultural environments. When we used ca. 5 x 104 cfu/flower (ca. 107 cfu/ml) of S.
enterica, a titer that would be realistic for most microorganisms in natural environments
(23, 33), the bacteria survived and grew in the inoculated flowers. Although greenhouse
humidity was relatively low (52% on average, and occasionally as low as 10%) the
flower interior is likely to retain moisture, and nectar could serve as a source of nutrition.
All flowers receiving S. enterica inoculation sustained population increases evident at 43
DPI (P<0.05). It’s the population growth was greater when it was co-inoculated with E.
tracheiphila than when it was inoculated alone. However, the latter bacterium was
detected neither on surfaces nor in samples at 43 DPI. The decline in population of E.
tracheiphila in this study is consistent with that reported previously after cantaloupe
phyllosphere inoculation (38), although in the latter study it internalized in the fruit
mesocarp after flower inoculation, producing watersoaked lesions (17). As we did not
sample flowers between 0 and 43 DPI, we do not know the pattern of bacterial
multiplication in this period, but it is possible that E. tracheiphila modified the
environment such that it was more conducive for S. enterica survival and multiplication.
Our data are consistent with an interpretation of a synergistic relationship between this
human pathogen and other microflora; similar to that been reported by others for certain
phytobacteria (5) and storage and pathogenic fungi (10, 37, 45). We did not detect E.
87
tracheiphila on any of the flowers sampled at 43 DPI and only short-term survival of this
pathogen, under optimal conditions, has been reported on the cantaloupe phyllosphere
(38). Furthermore, we cannot say whether S. enterica survived on or in the blossom-end
rind that was combined with the flower sample. However, our data suggest that the
likelihood of S. enterica internalization in cantaloupe is low and might occur only in
special conditions that are unlikely to occur in the field.
Our work provides new information about the possibility of long-term Salmonella
survival on artificially inoculated blossoms, and internalization into the fruit after flower
inoculation. Further research is needed to better characterize the relationships between
Salmonella and members of the natural microbial community. Survival of S. enterica on
flower blossom could be a problem of having cross contamination if the pathogen is
brought to the flower.
88
LITERATURE CITED
microflora on Georgia-grown cantaloupes. J.Food Prot. 71:46-51.
3. Barak, J. D., B. Chue, and D. C. Mills. 2003. Recovery of surface bacteria from
and surface sanitization of cantaloupes. J. Food Prot. 66:1805-1810.
pathogen in Salmonella enterica contamination of tomato plants. PLoS One
3:e1657.
6. Bartz, J. A. 1982. Infiltration of tomatoes immersed at different temperatures to
different depths in suspensions of Erwinia carotovora subsp. carotovora. Plant
Dis. 66:302-305.
89
7. Beuchat, L. R. 2002. Ecological factors influencing survival and growth of
human pathogens on raw fruits and vegetables. Microbes and Infect. 4:413-423.
8. Beuchat, L. R. 1996. Pathogenic microorganisms associated with fresh produce.
J. Food Prot. 59:204-216.
134:675-685.
10. Brand, M. T., M. Q. Carter, C. T. Parker, M. R. Chapman, S. Huynh, and Y.
Zhou. 2011. Salmonella biofilm formation on Aspergillus niger involves
cellulose - chitin interactions. Plos One 6:e25553.
11. Costerton, J. W. 1995. Overview of microbial biofilms. J. Ind. Microbiol.
15:137-140.
12. Deza, M. A., M. Araujo, and M. J. Garrido. 2003. Inactivation of Escherichia
coli O157 : H7, Salmonella enteritidis and Listeria monocytogenes on the surface
of tomatoes by neutral electrolyzed water. Lett. Appl. Microbiol. 37:482-487.
Salmonella. Eur. J. Hortic. Sci. 73:73-75.
14. FDA. December 2007. Bacteriological Analytical Manual Online. Chapter 5.
http://www.cfsan.fda.gov/~ebam/bam-5.html accessed October 28, 2009.
90
Prot. 66:82-87.
101:S59-S59.
Microbiol. 67:4760-4764.
21. Hanning, I. B., J. D. Nutt, and S. C. Ricke. 2009. Salmonellosis outbreaks in
the United States due to fresh produce: Sources and potential intervention
measures. Foodborne Pathog. Dis. 6:635-648.
22. Harapas, D., R. Premier, B. Tomkins, P. Franz, and S. Ajlouni. 2010.
Persistence of Escherichia coli on injured vegetable plants. Int. J. Food Microbiol.
138:232-237.
91
23. Himathongkham, S., S. Bahari, H. Riemann, and D. Cliver. 1999. Survival of
Escherichia coli O157 : H7 and Salmonella Typhimurium in cow manure and
cow manure slurry. FEMS Microbiol. Lett. 178:251-257.
27. Lopez-Velasco, G., A. Sbodio, A. Tomas-Callejas, P. Wei, K. H. Tan, and T.
V. Suslow. 2012. Assessment of root uptake and systemic vine-transport of
Salmonella enterica sv. Typhimurium by melon (Cucumis melo) during field
production. Int. Food Microbiol. 158:65-72.
92
31. Mohle-Boetani, J. C., R. Reporter, S. B. Werner, S. Abbott, J. Farrar, S. H.
Waterman, and D. J. Vugia. 1999. An outbreak of Salmonella serogroup saphra
due to cantaloupes from Mexico. J. Infect. Dis. 180:1361-1364.
cantaloupe melon production units and packaging facility. Agric. Tec. Mex.
35:135-145.
33. Pell, A. N. 1997. Manure and microbes: Public and animal health problem? J.
Dairy Sci. 80:2673-2681.
Foglia Rivers (Pesaro-Urbino, Italy). Water Res. 32:1515-1521.
35. Rahn, K., S. A. Degrandis, R. C. Clarke, S. A. McEwen, J. E. Galan, C.
Ginocchio, R. Curtiss, and C. L. Gyles. 1992. Amplification of an invA gene
sequence of Salmonella typhimurium by polymerase chain-reaction as a specific
as a specific method of detection of Salmonella. Mol. Cell. Probes 6:271-279.
93
migration of Salmonella poona into edible tissues. Int. J. Food Microbiol. 103:1-
10.
38. Rojas, E. S., and M. L. Gleason. 2012. Epiphytic survival of Erwinia
tracheiphila on muskmelon (Cucumis melo L.). Plant Dis. 96:62-66.
Quiroz. 2009. Survival of Salmonella Typhimurium on cantaloupe melon during
cold storage under controlled atmospheres. Rev. Fitotec. Mex. 32:209-215.
40. Scallan, E., Hoekstra, A. R.M., F.J., R. V. Tauxe, Widdowson, R. M-A, S.L.,
J. L. Jones, and M. P. Giffin. 2011. Foodborne illness acquired in the United
States-major pathogens. Emerg. Infect. Dis. 17:7-15.
41. Seyfi, K., and M. Rashidi. 2007. Effect of drip irrigation and plastic mulch on
crop yield and yield components of cantaloupe. Int. J. Agr. Biol. 9:247-249.
honeydew melon, p. 12, 20, 32-33, Fresh-Cut, vol. April 2001.
43. Talley, J. L., A. C. Wayadande, L. P. Wasala, A. C. Gerry, J. Fletcher, U.
DeSilva, and S. E. Gilliland. 2009. Association of Escherichia coli O157:H7
with filth flies (Muscidae and Calliphoridae) captured in leafy greens fields and
experimental transmission of E. coli O157:H7 to spinach leaves by house flies
(Diptera: Muscidae). J. Food Prot. 72:1547-1552.
94
44. Ukuku, D. O., and G. M. Sapers. 2007. Effect of time before storage and storage
temperature on survival of Salmonella inoculated on fresh-cut melons. Food
Microbiol. 24:288-295.
46. Whitaker, T. W., and D. E. DPryor. 1946. Effect of plant growth regulators on
the set of fruit from hand-pollinated flowers in Cucumis melo L. Proc. Am. Soc.
Hort. Sci. 48:417-422.
95
Figure IV-1: Illustration for fruit sampling from a single replication composed of
5 plants, flowers of which were inoculated with pathogens at the base of the floral whorl.
Two plants each were sampled at 0 (for flowers) and 15 DPI (for inner mesocarp), and 3
plants receiving pathogen treatment E. tracheiphila alone, S. enterica alone, or a mixture
of these two pathogens) were sampled at 43 DPI. Inner mesocarps and flowers (along
with a small piece of attached rind) were sampled at 24 DPI. Control plants with 0.1%
peptone inoculation were 1 and 2 for 0 and 15 DPI, and 43 DPI sampling, respectively, in
each replication.
96
Figure IV-2: Fruit mesocarp samples excised at 43 DPI from fruits that developed
from flowers previously inoculated with S. enterica or a mixed culture of S. enterica + E.
tracheiphila. Each sample included edible mesocarp, seeds and placenta. Samples (ca. 25
g) were assayed by direct plating, enrichment and PCR techniques.
97
Table IV-1: Mean recovery of S. enterica Poona from flowers after inoculation
with S. enterica alone or S. enterica + E. tracheiphila at 0 and 43 days post inoculation
(DPI).
Number of flower samples S. enterica Poona recovery (Log10 cfu/ml¥)
Treatment 0 DPI 43DPI 0 DPI 43 DPI*
SP only 15 10 4.46b ± 0.03 6.12a ± 0.42
SP + Et 15 11 4.89b ± 0.02 6.86a ± 0.70
*Values in a row followed by the same letter are not significantly different at 0.05
according to ANOVA.
SP- S. enterica Poona, Et- E. tracheiphila,
¥ Volume of wash water i.e. Universal Pre-enrichment Broth (UPB)
98
APPENDICES
Preliminary Experiments
Prior to beginning of the main experiments described in the preceding chapters,
several preliminary studies were conducted to select an appropriate cantaloupe cultivar
and to establish optimum inoculation and sample processing techniques.
APPENDIX A
Cantaloupe cultivar selection
Objectives. The objectives of this study were 1) to understand the general
characteristics of cantaloupe plant growth, flowering and fruiting under the conditions of
our BSL-2 greenhouse, and 2) to compare the plant habit, days to fruit maturity, number
of fruits per plant, fruit weight, of three cantaloupe varieties, Sugarcube, Caravelle and
Cruizer, and select the one most suitable for our purposes.
Greenhouse conditions. The average temperature recorded throughout this study
was 23oC. Daylength was set at 14 h day/ 10 h night.
Plant form and growth. Although the leaves of most of varieties were bigger in
the greenhouse compared to their natural size in the field, cv. Sugarcube was the most
compact of the three tested, and therefore was the most amenable to vine trellising and
99
the easiest to keep vines of adjacent plants separate. Furthermore, fruits of cv. Sugarcube
were the smallest of the three, and less likely to fall when hanging on the supported
frame, as only peduncle were tied for fruit support. Therefore, cv. Sugarcube was
selected for our study.
Flowering. All three cantaloupe varieties produced three types of flowers i.e.
male (Fig. 1 A), complete (Fig. 1 B) and female (Fig. 1 C). Male flowers were produced
early during plantgrowth. They were first observed 10-15 days after transplanting and
continued to appear until plant death. Complete flowers, which appeared only after some
male flowers were present, were the most likely to produce fruit. The time from planting
to the appearance of the first complete flower ranged from 25-36 days (avg. 31) in
Sugarcube, 37-44 days (avg. 41) in Caravelle and 36-38 days (avg. 37) in Cruiser. Female
flowers were few in number, appeared near plant maturity, and seldom set fruit.
Pistillate flowers (mainly complete flowers) of cv. Sugarcube only were
pollinated, using a fine artist’s paint brush, with pollen collected from 1-2 male flowers
(Fig. 2 A- F). The pollen-laden brush was dabbed against the stigma tip several times for
successful pollination. In Sugarcube, out of 32 pollinated flowers only 4 (13%) flowers
produced fruits. Many small fruits aborted between 4-5 days, turning yellow and later
shriveling.
Fruiting and net formation. Fruits, when newly formed (7-10 days of age),
were light green in color and smooth surfaced but hairy. Rind cracking, a natural process
resulting from fruit expansion that precedes the deposition of callose netting, began
within 9-13 days of fruit formation. Cracks usually appeared first at the blossom end and
100
spread to cover the whole fruit within 10-15 days. Reddish or orange exudates observed
in the crevices showed that the wound briefly exposed interior tissue (Fig. 3 A- C).
Although we did not measure the crack depths, those of cv. Sugarcube were deep and
more widely separated than those of cvs. Cruiser and Caravelle. The cracks later become
filled with corky material that gradually build up to create the reticulation characteristic
of mature fruits (Fig. 3 D- F).
The number of fruits set on each plant varied with cultivar. Average fruit
numbers/plant in our experiments was 2-4 for Sugarcube, and 1-2 each for Caravelle and
Cruiser. Days frompollination to fruit maturity ranged from 37-45 days (avg. 39), 29-40
days (avg. 36), and 38-42 days (avg. 40) for cvs. Sugarcube, Caravelle, and Cruiser,
respectively. Overall, cv. Sugarcube matured the fastest, had the greatest fruit set and was
most manageable in the greenhouse due to its compact form (Fig. 4).
APPENDIX B
Evaluation of pathogenicity on cantaloupe plants of a parental, and a GFPuv tagged
derivative, of E. tracheiphila
Objectives.
1. To evaluate whether E. tracehiphila strain MCM1-1, which had been stored at -80oC
for several years, was still pathogenic to cantaloupe, and to become familiar with
symptoms produced on cantaloupe cv. Sugarcube.
101
This strain was collected originally from an Oklahoma cantaloupe plant by B.
Bruton (USDA ARS, Lane, OK), and was obtained from M. Gleason (Iowa State
University, Iowa). Stab inoculation was used to introduce the pathogen (107 cfu/ml @ 20
µl) onto the stem surface on the node of Sugarcube cantaloupe into the stem interior
tissues of plant. All the inoculated plants became wilted,followed by shriveling of stem
and then plant death..
2. To genetically modify E. tracheiphila strain of MCM1-1 to express the GFP gene, and
to test its pathogenicity on cv. Sugarcube.
We tagged E. tracheiphila so that the pathogen could be traced by confocal laser
scanning microscopy (CLSM) after fruit surface inoculation. An E. tracheiphila plasmid
was transformed with pGFPuv (Clontech Laboratories, Inc., CA, USA) by
electroporation as described in Ma et al. (1) and colonies were selected on ampicillin
amended nutrient agar (NA-amp) plates. For inoculation, E. tracheiphila was harvested
from NA-amp plate cultures after 24 hr. of incubation. In two sub-experiments,
cantaloupe plants (cv. Sugarcube) were greenhouse grown to a height of 2-3 ft. and, 10-
15 days after transplanting, were stab-inoculated (two spots per plant) with E.
tracheiphila by depositing 20 µl on the stem surface. The inoculated surface was pricked
at least 10 times with a syringe needle (Fig. 5 A) to create openings for bacterial entry.
Plant shoots, above the site of inoculation, started to wilt 4-5 days after inoculation (Fig.
5 B). Stems then shriveled at the point of inoculation. Symptomatic stem pieces of 2 – 3
cm were surface sterilized with 1% sodium hypochlorite (NaOCl) for 2 minutes,
aseptically excised, and plated on NA-amp (?) plates. Within 2-3 days of incubation at
28oC, colonies resembling E. tracheiphila (small colonies fluorescing green ) appeared,

102
and 2-3 randomly picked colonies were confirmed to be E. tracheiphila with PCR.
Colonies isolated from plants infected with GFPuv tagged E. tracheiphila appeared green
under UV light (Fig. 5 C); colonies from these plants also were verified by PCR using E.
tracheiphila specific primers (F- GGCGATCACGACACAGTTG T and R-
CAGTTTTTGGTCAGGGCATA CTC) yielding a product of 68-bp, the expected size.
The E. tracheiphila strain, parental as well as GFP tagged, was still pathogenic,
leading to wilting of the variety Sugarcube in our greenhouse condition.
APPENDIX C
Internalization of Erwinia tracheiphila into cantaloupe fruits through flower
inoculation
To study the ability of human pathogenic S. enterica to survive on, and to enter
and translocate, in cantaloupe plants, we needed to identify a positive control; i.e., a
pathogen that was known to have the capability to do these same functions. However, the
only serious bacterial pathogen of cantaloupe, the wilt-causing E. tracheiphila, is
normally transmitted from plant to plant by insects (cucumber beetles) and we did not
know what it would do when introduced onto natural cantaloupe rind cracks or into
flowers.
Objective. The objective of this study was to evaluate whether E. tracheiphila
was able to internalize into fruits after flower inoculation.
103
Methods. E. tracheiphila was inoculated in 5 µl volumes at concentrations of
107, 108, 109, and 1010 cfu/ml within the whorl of individual pistillate flowers.
Concentration of E. tracheiphila was confirmed by OD600 nm and by plating on nutrient
agar plates (NAP). Cultures were kept on ice until the time of inoculation, which was
completed within 1-2 h after inoculum formulation. Fruits were visually inspected during
their growth for symptoms. The presence of E. tracheiphila was confirmed by culturing
fruit sample (after sterilization with 1% NaOCl for 1 min) in NAP and cultures were
further verified by PCR using E. tracheiphila specific primers (F-
GGCGATCACGACACAGTTG T and R- CAGTTTTTGGTC AGGGCATAC TC).
Results. Neither the cantaloupe plants nor the fruits developed any wilting
symptoms. However, on one of 5 plants whose pistillate flowers were inoculated (109
cfu/ml) watersoaked lesions appeared on 2 out of 5 fruits (Fig. 6 A). Two out of three
plants inoculated with E. tracheiphila at108 cfu/ml showed wilting symptoms, but no
watersoaked lesions on fruits. The other E. tracheiphila inoculated plants, and all of the
control plants, showed no wilting.
Plants that had fruits with watersoaked lesions also showed vine wilting (Fig. 6 B)
and the peduncle that connected the vine and the fruit became shriveled and collapsed.
Presence of E. tracheiphila was confirmed by the ‘ooze test’ (observation of a cloudy
exudate emanating from a freshly cut stem, indicative of a slime-producing fungal or
bacterial wilt pathogen) (Fig. 6 C). Fruits that developed lesions also had impaired
netting (Fig. 6 D) and did not mature, and on some of them bacterial ooze also seeped out
from the lesions. The interior tissue (mesocarp) of fruits showing watersoaked lesions
were positive for the presence of inoculated bacteria by culturing (Fig. 6 E). On the other
104
hand, fruits that developed from un-inoculated plants (or flowers) appeared healthy and
had no lesions (Fig. 6 F). PCR using E. tracheiphila specific primers (F-
GGCGATCACGACACAGTTG T and R- CAGTTTTTGGTCAGGGCATAC TC)
yielded a product of 68bp (the expected size) confirming the pathogen’s presence inside
fruits with lesions and wilted vines (Fig. 6 G).
Conclusion. E. tracheiphila, at high concentration (109-1010 cfu/ml) is able to
traverse from the flower interior into the developing fruit, where it produces watersoaked
symptoms. The bacteria also able moved into the vines after traversing through the fruits,
where wilting occurred. In nature, only are the only known means for pathogen
transmission is via the feeding of cucumber beetles. There is a possibility of E.
tracheiphila internalization if insect frass falls within the flower whorl.
APPENDIX D
Internalization of Erwinia tracheiphila into cantaloupe fruits through rind cracking
and its interaction with Salmonella enterica
Objective. Continuing to explore the use of E. tracheiphila as a positive control
for Salmonella interactions with cantaloupe, an experiment was conducted to evaluate
whether E. tracheiphila could internalize through natural cracks formed on the fruit and
whether its presence affected Salmonella survival on those fruit surfaces.
Methods. Flowers on 8 plants were pollinated as described above and two
fruits/plant were allowed to set. Fruits at the age of 10-12 days were inoculated with 107
cfu/ml of 20µl of S. enterica or a mixture of S. enterica + E. tracheiphila. The rind of

105
each fruit was marked with four 2x2 cm squares all of which were inoculated with S.
enterica only, S. enterica + E. tracheiphila and 0.1% peptone water. Fruits were then
sampled at 7 or at ca. days post inoculation 19 DPI (at maturity). A few of the fruits
inoculated with S. enterica plus E. tracheiphila developed watersoaked lesions while
fruits inoculated with S. enterica alone, or with peptone water (controls), were apparently
healthy.
Results. At 7 DPI, Salmonella was detected on 100% (10 of 10) fruits previously
inoculated with S. enterica alone or S. enterica plus E. tracheiphila (Table 1). At 19 DPI
(fruit maturity) S. enterica survival varied with the treatments. Eighty percent of 5 fruits
sampled and 86% of 7 fruits sampled had recoverable bacteria after previous inoculation
with S. enterica only or a mixture of S. enterica + E. tracheiphila, respectively (Table 1).
Watersoaked lesions were observed on rinds co-inoculated with the two
pathogens and the sub-rind mesocarp immediately below the sampled rind also were
watersoaked (Fig. 7 A and B). Internal tissues (sub-rind mesocarp) of 2 fruits (out of 12)
co-inoculated with S. enterica andE. tracheiphila on their rind surface showed E.
tracheiphila lesions: one each at 7 DPI and at 19 DPI). Two fruit inner mesocarp yielded
Salmonella on XLD plates (Fig. 7 C).and E. tracheiphila also was observed on ampicillin
amended nutrient peptone agar on the same sample that was positive for S. enterica (Fig.
7 D). Salmonella identity was confirmed by PCR (using the invA primer pair). Fruits
receiving S. enterica-only treatments and control plants were apparently healthy and rind
and mesocarp samples from these plants were negative for both pathogens.
A total of 9 samples either (a) inoculated with S. enterica only, and sampled at 7
DPI (3 samples) or 19 DPI (1 sample) or (b) inoculated with a mixture of S. enterica plus
106
E. tracheiphila and sampled at 7 DPI (3 samples) or 19 DPI (1 sample) were processed
for SEM observation. Biofilm like structures, bacterial cells seen as clustering together
with some aggregated mass, were evident on samples inoculated with S. enterica only
(Fig. 8 A and B), especially at 7 DPI. No biofilms were observed on samples receiving
mixed culture (S. enterica + E. tracheiphila) inoculation (Fig. 8 C and D).
Discussion. E. tracheiphila may facilitate the internalization and surface survival
of S. enterica inoculated onto the cantaloupe fruit rind at the time of natural fruit
cracking. E. tracheiphila internalization into fruit and production of watersoaked lesions
suggest that the cracks provide an opening into the fruit interior. The fact that S. enterica
internalized into cantaloupe fruits only when co-inoculated with E. tracheiphila shows
that the presence of E. tracheiphila may enhance the fitness and invasiveness of S.
enterica. The biofilm like structures observed on the fruit surfaces, or in the cracks,
inoculated with the mixed bacteria inoculum, shows that the two pathogens may interact
with one another as well as with the host plant. Their ability to traverse into the sub-rind
mesocarp has implications for our ability to remove the microbes with sanitizers, and re-
emphasize the importance of good agricultural practices to maintain contamination free
agricultural products to produce safe and healthy cantaloupe fruit.
107
LITERATURE CITED
1. Ma, L., G. D. Zhang, and M. P. Doyle. 2011. Green fluorescent protein labeling
of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.
PLoS ONE 6. e18083
108
Figure 1. Three types of flowers produced by cantaloupe plants A. Male flower,
B. Complete flower (with male and female part) and C. Female flower.
109
Figure 2. Hand pollination of cantaloupe flowers. A. Separating petals from the
male flower to collect pollen; B. Collecting pollen with a fine artist’s brush; C. Pollen
collected on brush, ready for pollination; D. Brushing stigma of a complete flower; E.
Complete flower after pollination; and F. Observing pollen adhering to stigma with a
hand lens.
110
Figure 3. Cantaloupe varieties Sugarcube, Caravelle, and Cruizer at the time of
cracking (A, B, C and D, respectively), during netting and towards fruit maturity (D, E,
and F, respectively). Arrow head on pictures shows reddish orange exudates on cracks
suggesting opening into the fruit.
111
Figure 4. Reproductive parameters of three different cantaloupe varieties
[Sugarcube (n=16), Cruiser (n=6) and Caravelle (n=5)] in the greenhouse during summer
of 2010. The bars show the standard error for each category.
112
Figure 5. Inoculation of cantaloupe plant with GFPuv tagged E. tracheiphila. A.
Site of E. tracheiphila inoculation, B. Wilting of plant after E. tracheiphila inoculation
(arrow showing site of inoculation), and C. Recovery of E. tracheiphila from stem
samples of wilted plant (green fluorescing bacteria on arrow heads), incubated on
ampicillin-amended nutrient agar and observed under UV light.
113
Figure 6. Evidence of Erwinia tracheiphila entry into cantaloupe plants following flower
interior introduction. A. Watersoaked lesions appear on developing fruits and peduncles collapse;
B. Wilted vine; C. Bacteria stream from the freshly cut stem; D. Impaired netting on mature fruit;
E. Internal tissue of symptomatic fruit showing presence of E. tracheiphila on nutrient agar plate;
F. A normal fruit; G. PCR results showing 68 bp amplicon, from tissue with watersoaked lesion.
114
Figure 7. Cantaloupe fruit rind surface inoculated with a mixture of S. enterica
and E. tracheiphila at the time of natural fruit cracking and sampled at fruit maturity (40
DPI). A. E. tracheiphila lesion, on the fruit rind, just before rind layer extraction, B. Sub-
rind mesocarp with E. tracheiphila lesion, suggesting bacterial traversal through the outer
rind, C. Black colonies of S. enterica, recovered from fruit rind, observed on XLD plate,
and D. Recovery of E. tracheiphila from fruit with watersoaked lesion, observed under
UV light on ampicillin amended nutrient agar.
115
Figure 8. Interaction of Salmonella enterica Poona, alone or in the presence of E.
tracheiphila, on the natural fruit cracks, sampled over time. Fruit crack inoculated with S.
enterica only and sampled 7 days post inoculation (DPI) (A) and 19 DPI (B). Fruit crack
inoculated with a mixture of S. enterica + E. tracheiphila and sampled at 7 DPI (C) and
19 DPI (D).
116
Table 1. Mean percentage of fruits positive for Salmonella on fruit rind and sub-
rind mesocarp, immediately below the rind layer, of fruit rind initially inoculated with
Salmonella only or Salmonella + E. tracheiphila, sampled at 7 and 19 days post
inoculation (DPI).
Fruit inoculation with S.P. only Fruit inoculation with S.P. + Et
Sampling Total % S.P. recovery Total % S.P. recovery
Time Fruits Rind Sub-rind mesocarp Fruits Rind Sub-rind mesocarp
7 DPI 5 100 0 5 100 20
19 DPI 5 80 0 7 86 14
117
VITA
Dhiraj Gautam
Candidate for the Degree of
Doctor of Philosophy
Thesis: FATE OF SALMONELLA INTRODUCED TO CANTALOUPE THROUGH

NATURAL FRUIT CRACKS AND FLOWERS, ALONE OR IN THE
PRESENCE OF THE PLANT PATHOGEN ERWINIA TRACHEIPHILA
Major Field: Plant Pathology
Biographical:
Education:
Completed the requirements for the Doctor of Philosophy in Plant Pathology at

Oklahoma State University, Stillwater, Oklahoma in May, 2013.
Completed the requirements for the Master of Science in Agriculture (Plant

Pathology) at Tribhuvan University, Rampur, Chitwan, Nepal in March, 2005.
Completed the requirements for the Bachelor of Science in Agriculture at

Tribhuvan University, Rampur, Chitwan, Nepal in July, 2000.
Experience:
Graduate Research Assistant in Department of Entomology and Plant
Pathology, Oklahoma State University, from August, 2009 to December,
2012.
Assistant Professor at the Department of Plant Pathology, Tribhuvan
University, Chitwan, Nepal, from July, 2005 to March, 2009.
Acting Head of the Department of Plant Pathology, Tribhuvan University,
Chitwan, Nepal from 2008-2009.
Research Assistant at Tribhuvan University, Chitwan, Nepal, from 2002 to
2005
Professional Memberships:
American Phytopathological Society (APS)
International Association for Food Protection (IAFP)
View publication stats

Gautam PHD Dissertation 2013

Uploaded by

Copyright:

Available Formats

Gautam PHD Dissertation 2013

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Gautam PHD Dissertation 2013

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

FATE OF SALMONELLA INTRODUCED TO CANTALOUPE THROUGH NATURAL

Thesis · May 2013

Bacteriocin producing lactic acid bacteria View project

The user has requested enhancement of the downloaded file.

CANTALOUPE THROUGH NATURAL FRUIT

CRACKS AND FLOWERS, ALONE OR IN THE

PRESENCE OF THE PLANT PATHOGEN ERWINIA

Bachelor of Science in Agriculture

Master of Science in Agriculture (Plant Pathology)

Submitted to the Faculty of the

CANTALOUPE THROUGH NATURAL FRUIT

CRACKS AND FLOWERS, ALONE OR IN THE

PRESENCE OF THE PLANT PATHOGEN ERWINIA

Dr. Jacqueline Fletcher

Dr. John Damicone

Dr. William McGlynn

I would like to express my deep sense of appreciation on behalf of sincere

guidance, valuable suggestions, and constant help to my co-advisors Drs. Jacqueline

Fletcher and Li Maria Ma. I am also deeply indebted to member of my advisory

committee, Drs. John Damicone and William McGlynn.

(Nepalese Student’s Association), OSU, Stillwater for making homely environment.

I would like to conclude by thanking Oklahoma Center for the Advancement of

Date of Degree: MAY, 2013

Title of Study: FATE OF SALMONELLA INTRODUCED TO CANTALOUPE

Major Field: PLANT PATHOLOGY

Abstract: Salmonella-tainted cantaloupe has been implicated in foodborne

Literature Cited ........................................................................................................5

II. REVIEW OF LITERATURE..................................................................................10

History, Origin and Nutritive Value of Cantaloupe ...............................................10

III. SURFACE SURVIVAL AND INTERNALIZATION OF SALMONELLA ENTERICA

IV. SALMONELLA ENTERICA COLONIZATION OF CANTALOUPE FLOWERS

Table III-1: Recovery of S. enterica Poona and E. tracheiphila, at time intervals

Contamination of fresh vegetables and fruits by human pathogens such as

Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Campylobacter

includes a variety of unprocessed fruits and an increasing number of vegetables that

previously were consumed predominantly after processing. As consumption of fresh

produce consumption in the United States. Many health-conscious consumers, wishing to

that more nutrients remain.

previously wounded roots of seedlings grown in a hydroponic system (16). Sources of

Very little information is available on the mechanisms of human pathogen

The presence of other plant resident microorganisms, including plant pathogens,

significantly higher after co-inoculation with Xanthomonas campestris pv. vesicatoria

Typhimurium and either Botrytis or Rhizopus resulted in increased populations of

Salmonella compared to those on control fruits inoculated with Salmonella alone. A

Aspergillus niger, attributed to cellulose-chitin interactions. Similarly, co-inoculation

with Cladosporium cladosporioides greatly enhanced the ability of S. enterica to

E. tracheiphila, an important pathogen of most cucurbits including cantaloupe,

beetles (striped: Acalymma vittatum. F. and spotted: Diabrotica undecimpunctata

and causing wilting (30).

inoculation, E. tracheiphila is able to colonize cantaloupe fruit and traverse to vines,

mesocarp from those locations. We also wanted to understand whether E. tracheiphila

influences S. enterica survival or internalization on cantaloupe fruits or flowers. The

fresh produce contamination by human pathogens.

The objectives of this research are to understand survival and internalization of

Salmonella on cantaloupe, with or without the influence of a plant pathogen:

1- To characterize the survival and internalization of S. enterica on or in

in the presence of the plant pathogen, E. tracheiphila.

2- To investigate the survival and internalization, of S. enterica when