Gen Itics

PRINCIPLES OF INHERITANCE & VARIATION
GENETIC BASIS OF INHERITANCE

Introduction :
Genetics : It is a branch of biology that deals with the study of heredity and variation.
Heredity : It involves transmission of characters from parents to offspring.
Clone : It is product of asexual reproduction. Clones are carbon copies of one another derived from a
common ancestor.
Variations : It means the differences (Morphological, Physiological to logical and behaviouristic) amongst
the individuals of the same species and the offspring of the same parents.
Mendelism :
Gregor johann Mendel is known as ‘Father of Genetics’ Mendel proposed that inheritance is controlled
by paired germinal units or factor,Now called genes.
Mendel was born in Silisia, a village in Heinzendorf (Austria) in 1822 to a poor family.
He passed graduation in 1840 and completed two year diploma in Philosophy.
Mendel joined on Augustinian monastry of st. Thomas at Brunn (Then in Austria; Now Brno in Czech) in
1843. In 1847, he was made a priest in the monastry.
Mendel performed hybridization experiment on garden pea (Pisum sativum) from 1856 to 1864. After 8
years of experimentation he read out the results of his observations of the Natural history society of Brunn
in 1865. ‘Natureforschender varien’ was a magazine of german language which was published by ‘Natural
history society of Brunn’. In this magazine, main research paper of Mendel “Versuche liber planzen
Hybriden” or Experiment in plant-hybridization” was published in 1866.
Mendel’s work remained unnoticed for 34 years due to following regions
(i) The scientific world was being rocked at that time by Darwin’s theory of evolution (Origin of Species,1859)
(ii) Limited circulation of the ‘Proceeding of Natural history society of Brunn’ in which it was published.
(iii) Mendel’s conclusion about heredity were ahead of his time. Mendel died in 1884 long before his work
came to be recognised.
Re-discovery of Mendel’s work :

It was in 1900 that three scientists independently rediscovered the principles of heredity already worked
out by Mendel. They were Eric von Tschermak of Austria, Hugo de Vries of Holland and Carl correns
of Germany.
* W. Bateson (1906) firstly used the term ‘Genetics’. He is known as ‘father of modern genetics’.
Muller established ‘Cytogenetics.
Reason’s for Mendel’s Success :

Many scientists worked on inheritance. (Kolreuter work on tobacco,Goss work on pea) But they were
not succeed. But Mendel get success because
1. Mendel firstly analyzed the work of former scientists and then prepared his stratiegy of experiment.
2. Mendel took one or two characters at one time for his breeding experiment.
3. Mendel selected the pea plant for experiment because
(i) Pea plant is Herbaceous and annual. It can be grown two or three time in a year. So the results obtain
very shortly.
(ii) Pea’s flowers are bisexual and self pollinated. So Emasculation and cross pollination can be applied in
pea flowers.
(iii) It can easily grow in garden.
(iv) Many contrasting characters are found in pea plant. Mendel selected 7 pairs of contrasting characters
of pea plant. These characters are as follow.
NEET_GENETIC BASIS OF INHERITANCE - 1

S.No. Character Dominant Recessive Chromosome
number
1 Plant height Tall (T) 6 -7 Dwarf (t) 3/4 – 1½ 4
2 Shape of pod Inflated or Full (F) Constricted (f) 4
Position of
3 Axillary (A) Terminal (a) 4
flower/pod
Colour of Voilet/Red (V or R) / White (v or r)/White
4 flower/colour Grey 1
of seed coat
5 Cotyledon colour Yellow (Y) Green (y) 1
6 Pod colour Green (G) Yellow (g) 5
7 Seed shape Round (R) Wrinkled (r) 7
4. Mendel kept a complete record of every cross and used statistical method and law of probability for
analyzing his results.
5. He took care to avoid contamination from foreign pollen grains brought by insects.
6. Mendel selected only pure breeding varieties of pea for his experiment and grew in separate row.
7. Mendel studied the inheritance of character till F3 generation.
Terminology :
1. Factor : Mendelian factor is a unit of inheritance, which passes from one generation to the next
through the gamete and controls the expression of a character in the organisms.In modern genetics,
It is called ‘Gene’ which consists of DNA and genes are responsible for the inheritance and expression
of a character.
2. Allele or Allelomorph : Contrasting forms of a gene which are found on the same locus in the two
homologous chromosomes & control the expression of a trait are called alleles. Ex : Tallness (T) and
dwarfness (t).
3. Phenotype : It represents the expression of external appearance like colour, shape etc. of an
individual.
Ex: Red colour, tallness or dwarfness etc.
4. Genotype : It indicates the genetic constitution of an individual. Ex: The genotype of hybrid tall pea
plants is Tt, pure tall TT and dwarf tt.
* Johannson (1911) firstly used the term ‘Phenotype ‘and’ Genotype’.
5. Homozygous : It is an individual which contains identical alleles of a gene or factor of a character on
its homologous chromosome Ex: TT and tt
6. Heterozygous : It is an individual which contains the two contrasting factor of a character or two
different alleles of a gene on its homologous chromosomes. Ex : Tt
7. Hybrid : The organism produced after crossing two genetically different individual is called hybrids.
8. Hybridization: The process of obtaining hybrids is called hybridization.
9. Reciprocal cross : If in one cross individual ‘A’ is used as male and ‘B’ as female and in the next cross
‘B’ is used as male and ‘A’ as female, It is called as reciprocal cross.
10. Homologous pair : Zygotic pair is called Homologous pair.
11. Back Cross : It is a cross between F1 hybrid and one of its parents. Back cross includes test cross.
12.1 Test cross : It is a cross between F1 hybrid and recessive parent to know whether an individual is
homozygous or heterozygous for dominant character.
12.2 Out cross : If cross is performed between F1 hybrid and dominant parent then it is called ‘Out cross’
All the offsprings obtain from this cross have dominant characters.
13. Genome : A complete set of chromosomes found in each nucleus of given species is called genome.
A single genome is present in haploid cell(n).
14. Gene Pool : Sum of all the genes and their alleles present in an interbreeding population is called
gene pool.
15. Phenocopy : When the different genotypes produce the same phenotypes due to different
environments, then one is called the phenocopy of the other Ex: All seeds irrespective of their

genotypes, germinating in dark develop yellow leaves. Phenocopy is not inheritable. The term
phenocopy was introduced by Goldschmidt in 1935.
16. Pure line : The term was coined by Johannson in 1900. It is a strain of genetically pure true breeding
individuals which have devised by a single self fertilized homozyous ancestor or indentical homozyous
ancestors.
17. Checker Board : It was firstly used by C. Punnett. The analysis of generation is represented in the form
of symbols of squares. Female gametes arrange vertically and male gametes arrange horizontally.
Technique of Mendel :
Monohybrid cross :
It is cross between two organisms of a species, that are
different in a pair of contrasting characters. Ex: height
of plant.
Firstly Mendel selected long and dwarf plants of garden
pea.
Mendel removed stamens of the.flower of tall plants in
bud condition. It is called ‘Emasculation’. A Bag tied
over the flower for the prevention of cross-pollination. This
is called ‘Bagging’.
Dwarf plant took as male plant and their flower covered
through bag.
On dehiscence or maturity, the pollen grains of dwarf plant
sprayed over the stigma of long plant and It again covered
through bag.
Seeds collected through long plant. After ward Mendel obtained F1 generation through the sowing of former.
This process called ‘Hybridization’ and F1 generation called ‘Hybrid’.
Mendel obtained only tall plants in F1 generation.
Mendel applied reciprocal cross but the results did not affect.
After this process, Mendel obtained F2 generation through the sowing of those seeds which obtained
from self pollination of F1 plants.
In F2 generation, Tall and dwarf plants obtained in 3 : 1 ratio. It is prooved that the character of tallness
in the plants of F1 generation does not pure.
Mendel used this technique for other six characters in their experiment and obtained same results.
The phenotypic ratio of F2 generation in Monohybrid cross is 3 : 1 and genotypic ratio is 1 : 2 : 1.
The plant possesses two factors of each character. The term ‘Factor’ was fIrstly used by Correns
Which was called determinor or element by Mendel.

Phenotypic ratio 3 : 1
(Tall) (Dwarf)
Genotypic ratio 1 : 2 : 1
TT Tt tt
(25%) (50%) (25%)
Conclusion of monohybrid cross :
(I) Principle of paired Factors : A plant possesses two factors of each character. Each trait is controlled
by a unit factor.
(II) Principle of Dominance : Out of the two factors or alleles representing the alternate form of a trait,
one is dominant and expresses it self in the hybrid of F1 generation. The other factor or allele is
recessive and does not show its effect. It is called the ‘Mendel’s law of dominance’. The factor of
dominant character is denoted by capital letter and the factor of recessive character is denoted by
small letter.
Exceptions of Principle of Dominance and Paired Factors :

1. Incomplete dominance :
Incomplete dominance was discovered by Carl correns (1903)in Mirabilis jalapa.
Incomplete dominance is the phenomenon where none of the two contrasting factor or alleles is dominant.
The expression of the character in a hybrid of F1 generation is intermediate (partial or mosaic). Mirabilis
jalapa is also known as 4’0' clock plant or Gulbansi
In Mirabilis jalapa, there are two types of flower colour in pure state, Red and White.When the two types of
plant are crossed. The hybrid of F1 generation have pink flower. If the latter are selfed, the plants of F2
generation are of three types- Red, Pink and White flowered in the ratio of 1: 2: I
The phenotypic and genotypic ratio is similar (1 : 2 : 1) due to incomplete dominance in F2 generation.
Analysis : It is cleared that factors of Red and White colour are found in F1 generation of Mirabilis but the
factor of Red colour does not completely express itself in the presence of factor of white colour.
Thus the pink colour apparently appears due to mixing of Red and White colour in Heterozygous F1
generation. Incomplete dominance can also be shown by checker board method.

Phenotypic ratio 1 : 2 : 1
Red Pink White
Genotypic ratio 1 : 2 : 1
RR Rr rr
(25%) (50%) (25%)
Incomplete dominance is also found in colour of flower in Snapdragon or Antirrhinum or Dog flower
and feather colour in Andulasian fowls.
Note: Incomplete dominance is not an example of blending inheritance because the parental types
reappear in the F2 generation. Some worker considered it as example of quantitaitve inheritance
where single gene pair involved.
2. Co-dominance :
In codominance the alleles are able to express themselves independently in F1 generation. Ex : (i) Skin
colour in Short Horned cattles.
There are two types of pure cattle, Red and White. On cross-breeding the individuals of F1 generation are
found to have roan colour.Here in a heterozygote of F1 generation both alleles express themselves
independently. The effect is produce due to juxtaposition of small patches of Red and White colour. It is also
known as mosaic inheritance. Both the alleles are co-dominant in F1 generation. On inbreeding the roan
hybrids produce three types of cattle-Red Roan and White in the ratio of 1:2:1.
Red Roan White
1 : 2 : 1
Genotypic ratio RR RW WW

Ex: (ii) Sickle cell Haemoglobin. The allele for sickle cell haemoglobin HbS is codominant with allele for
normal haemoglobin HbA.
Ex: (iii) AB Blood Group. Alleles of blood group A(IA) and blood group B (IB) are codominant & found over
the surface of erythrocytes. when they come together in an individual, they produce blood group AB.
Ex: (iv) MN Blood Group. It is found in humans. The erythrocytes carry two types of native antigens, M
and N, and an individual can be MM, MN, NN.
3. Multiple allele :
Bernstein (1924) : Discovered multiple alleles.
More than 2 alternative forms of a gene are called as multiple allele. Multiple alleles are located on same
locus of homologous chromosome. A diploid individual contains two alleles and gamete contains one allele
for a character. Ex: (i) Human Blood group - 3 alleles .
Table: Different aspects of blood group
Human beings have four blood groups or blood group phenotypes – A, B, AB and O.
A,B,O blood group are determined by allele lA, allele IB, allele I° respectively
lA = dominant
IB= dominant
I° = recessive
lA and IB are codominant.
n(n 1)
If n is the number of alleles of a gene then number of different possible genotype =
2
For eg- In human blood group number of alleles or n are 3. Thus the number of different possible genotype
3(3 1) 3 4
will be = 6 genotypes.
2 2
Ex: (ii) Coat colour in rabbit
Four alleles regulate coat colour in rabbit
Wild type = Full coloured = agouti = C.
Himalayan [white with black tip on extremities (like nose, tail and feet)] = ch
Chinchilla (mixed coloured and white hairs] = cch
Albino = Colourless = c
These alleles show a gradient in dominance C. > cch> ch > c
Possible genotypes -
Coloured = CC, Ccch, Cch Cc
Chinchilla = cchcch, cChch, cchc
Himalayan = ChCh, chc
Albino = cc.
4(4 1) 4 5
Number of possible genotypes = 10 genotypes .
2 2
4. Pleiotropy :
A gene regulates multiple phenotypic effect. Ex: sickle cell anaemia.
(III) Principle or law of segregation :
There is mixing of two factor in the hybrid of F1 generation. At the time of gamete formation in F1 generation,
The two factor separate or segregtate and pass into different gametes randomly. A gamete comes to have
one factor of a pair. The gamete fuse randomly during fertilization so that the factors come together in F 2
generation and express themselves freely. So the dwarf plants obtain in F2 generation.

Gametes are always pure for a character hence it is also called ‘law of purity of gametes’. (by Bateson)
Dihybrid cross :
It is a cross between two organisms of a species that are different in two pairs of contrasting characters.
Mendel selected the following two character for this purpose.

(i) Colour of cotyledon - Yellow and green
(ii) Shape of seed - Round and wrinkled
In which Yellow and Round traits are respectively dominant over green and wrinkle traits.
Mendel performed cross between pure breeding pea plants having yellow round seeds (YYRR) and pure
breeding Pea plants having green wrinkled seeds (yyrr).
All the plants of the F1 generation were yellow and round seeds (YyRr).
The factors of both characters will have independently segregated to each other during gamete formation.
Thus total four types of gametes(YR), (yR), (Yr), (yr) form in F1 generation
On selfing of F1 the resultant F2 generation show four types of plants
Yellow Round, Yellow wrinkled, Green Round, Green wrinkled
9/16 3/16 3/16 1/16
phenotypic ratio 9 : 3 : 3 : 1
Yellow Yellow Green Green
Round wrinkled Round wrinkled
Genotypic ratio 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1
YYRR YYRr YyRR YyRr YYrr Yyrr yyRR yyRr yyrr
Thus the Conclusion of dihybrid cross

Number of genotype in any cross is = 3n
Number of genotypes in dihybrid cross = 32 = 9
Yellow round and green wrinkled plants show parental combinations (9+1) while green round and yeIIow
wrinkled show new combinations (3 + 3 = 6). The ratio between parental combination and new combination
is 5 : 3. So 62.5%Parental combination and 37.5% new combination are obtained.
Law of Independent assortment :
Mendel concluded that the two factors of a character assort or separate independent of the factors of other
characters at the time of gamete formation and get randomly rearranged in the offsprings. It is called the
‘Law of Independent assortment’.

The occurence of four types of plants in the F2 generation of dihybrid cross shows that the inheritance of
cotyledon colour assorts independent to the inheritance of seed shape unless green round and yellow
wrinkled seeds do not obtain.
Objection :
This law is applicable to only those factors or genes which are either situated distantly on the same
chromosome or occur on different chromosomes.
Back cross :
It is a cross which is performed between F1 hybrid and one of its parents.
If cross is performed between F1 hybrid and dominant parent then it is called ‘Out cross’ All the offsprings
obtain from this cross have dominant characters. Thus F1 generation can be analized through this cross.
(i) Phenotypic ratio = 100% (Tall plants)

(ii) Genotypic ratio = 1 : 1
TT Tt
(Homozygous Tall) (Heterozygous Tall)
Test cross :
Cross is performed between F1 hybrid and recessive parent. It is a cross to know whether an individual is
homozygous or heterozygous for dominant character.
(i) Monohybrid test cross :
(i) Phenotypic ratio 1 : 1

Tall Dwarf

(ii) Genotypic ratio 1 : 1
Tt tt
(ii) Dihybrid test cross :
(i) Phenotypic ratio 1 : 1 : 1 : 1

Tall Dwarf Tall Dwarf
& Red &Red & White & White
(ii) Genotypic ratio 1 : 1 : 1 : 1

TtRr ttRr Ttrr ttrr
Importance of Mendelism :
1. It is useful in the field of plant breeding. Advanced features can be used in the development of improved
varieties of offspring through the hybridization method.
2. The knowledge of dominant and recessive characters is possible through mendelism.
3. Development of high productive varieties and disease resistance varieties is possible.
4. It is also useful for the development of improved varieties in animals.
Read & Digest
1. Isoalleles : They are alleles producing similar phenotypes. Isoalleles are distinguishable with change
in biochemicals, temperature, pH, humidity etc. Ex : IA1, IA2, IA3
2. Pseudoalleles : Closely placed genes producing related phenotypic effect which are distinguishable
only through a rare crossing over Ex : Dominant star and recsesive asteroid eye traits in
Drosophila.
3. Incomplete penetrance : It is the failure of an allelic combination to provide cent percent phenotypic
expression, e.g. polydactyly, diabetes mellitus.
4. Complete penetrance : 100% ability of an allelic combination to produce expected phenotype.
5. Trihybrid Cross : It is a cross involving three pairs of contrasting characters.
Post mendelian inheritance :
Gene Interaction :
It involves effect of alleles & non alleles on the normal phenotypic expression of genes. it is of two types
1. Intragenic 2. Intergenic
1. Intragenic :
It takes place between two alleles of a gene. Ex: incomplete dominance, codominance, multiple
alleles. It is interallelic.
2. Intergenic :
It is nonallelic interaction in which two or more independent genes present on same or different chromosomes
interact to produce a different expression. It involves following types
(i) Epistasis :

In this type of interaction one gene suppresses the expression of another nonallelic gene. The former is
called epistatic gene whereas the latter is called hypostatic gene.
Epistasis comprises three types.
(a) Dominant epistasis : In this type dominant gene of one locus suppresses the expression of another
gene of different locus. Ex: Fruit Colour in Cucurbita pepo (Summer squash)- A cross between a
pure breeding white summer squash (WWYY) with a pure breeding green summer squash wwyy produce
white fruits in the F1 generation. Dominant gene W is epistatic over Y & w & y genes so that phenotypic
ratio of F2 generation comes to have 12 white fruit, 3 yellow fruit, 1 green fruit.
Fig. Dominant epistasis : Inheritance of fruit colour in Cucurbita pepo
White Yellow green
Other Ex: Coat colour in Dogs (12 white : 3 Black : 1 Brown) and Grain colour in cholam (Sorghum
caudatum-12 Red : 3 Pearly : 1 Chalky).
(b) Recessive epistasis : In this type recessive homozygous genes of one locus suppresses the expres-
sion of another nonallelic gene Ex: Coat Colour in Mice.

Phenotypic ratio - 9 : 3 : 4
Agouti Black Albino
Agouti colour is formed by the occurence of Both C and A gene in either Homozygous or Heterozygous
condition. A nonallelic gene c is epistatic in homozygous state (cc) & suppresses the expression of A gene
thus albino mice are produced. Other Ex: Pigmentation in Onion Bulb. – 9 Red : 3 yellow : 4 White.
(c) Dominant Recessive Epistasis :

Here the dominant allele at one locus (I) and recessive allele at another locus (cc) give rise to the same
effect (I - C, I - cc, iicc).
Ex: Plumage Colour in Poultry :
Phenotypic ratio - 13 : 3
White Coloured

In the above cross recessive epistatic gene also produces the same phenotype as the dominant epistatic
gene.
(ii) Complementary Genes :
In this type, both nonallelic genes independently produce similar effect when they come together in the
dominant form they form a new trait.
Ex: Flower colour of Sweet Pea (Lathyrus odoratus) - Flower colour is purple if dominant alleles of two
nonallelic genes (C – P –) are present together . The colour of flower is white if the double dominant
condition is absent (ccP –, C– pp, ccpp).
Purple colour formation is two step reaction and the two genes cooperate to form the ultimate product.
Gene C Enz Gene P Oxidase

Raw material A Chromagen Anthocyani n
Phenotyic ratio - 9 : 7
Purple White
(iii) Supplementary Genes :

In this type dominant allele of one gene produces its effect independently where as dominant allele of the
second gene is without any independent phenotypic effect but is able to modify the expression of the first
gene & produce a new trait. Ex: seed coat colour in Lablab.

Phenotype ratio - 9 : 3 : 4
Chocolate Khaki Buff
In above example dominant K independently produces Khaki colour. The supplementary gene (L–) changes
the expression of pigment forming gene (K) therefore chocolate colour forms.
Other Ex: coat colour in mice- 9 agouti : 3 black : 4 albino
(iv) Duplicate Genes :

Two or more independent genes lie on different chromosomes produce same phenotype therefore either
them can form the same phenotype in homozygous or heterozygous state. Independent genes do not form
cumulative effect. Ex: Fruit shape in Shepherds’s Purse (Capsella bursa).

Phenotype ratio 15 : 1
Triangular Ovoid - Oblong
(v) Polymeric or Additive Genes :
In this type two independent dominant genes form same phenotyic effect in homozygous or heterozyous
condition. When they come togather then they produce a cumulative effect. Ex: Fruit Shape in Summer
Squash (Cucurbita pepo).
Phenotype ratio 9 : 6 : 1
Disc Spherical Long
(vi) Collaborative Supplementary Genes :

Two nonallelic genes produce their own phenotypic effect independently when present in the dominant state
but can also interact to form a new trait. Ex: Comb types in poultry.
Fig. Collaborative Supplementary Genes: Inheritance of Comb types in poultry

phenotypic ratio 9 : 3 : 3 : 1
Walnut pea Rose Single
P gene independently produces Pea comb. R gene independently produces rose comb.Both P and R
jointly form walnut comb. When none of these genes is present in the dominant state (pprr), single comb is
formed.
(vii) Qualitative and Quantitative Inheritance :
(a) Qualitative or Monogenic Inheritance :

In this types single dominant gene influences a complete trait. Occurence of two such dominant genes
does not alter the phenotype. These genes are called monogenes, Ex: RR for red colour in Pea.
(b) Quantitative Inheritance or Polygenic inheritance :

If the inheritance of character is controlled by two or more than two genes that is called polygenic inherit-
ance and these genes are called polygenes or multiple genes in which each dominant allele of a gene
produces a part of trait.
The full expression of trait takes place in the presence of all the dominant alleles of genes. It is called
cumulative effect.
It was firstly studied by Kolreuter in Tobacco. Francis galton studied polygenic inheritance of
human skin colour.
Nilson Ehle firstly gave the experimental proof of polygenic inheritance. They studied kernal colour
of wheat Ex: 1- Kernal colour of wheat.
5 Phenotypes form in the above example

Ex: 2. Skin colour of Human (Devenport 1913)

7 Phenotypes form in the above example
Lethal gene :
It was discovered by Cuenot In coat colour of mice
Some genes regulate specific characters in the organisms. they cause death of organism if they present in
homozygous dominant or homozygous recessive state.
If individual dies in embryonic state, it is called Absolute lethality Ex: coat colour in mice.
Thus Monohybrid phenotypic ratio is modified

2 : 1
Yellow Brown
Yellow body colour (Y) was dominant over normal brown colour (y) Gene of yellow body colour is lethal in
homozygous state so that in nature homozygous Yellow mice are never occured in population E. Baur
discovered lethal gene in Snapdragon (Antirrhinum majus).

Phenotypic ratio 2 : 1
Golden Green
Homozygous golden are never occured in nature.
If individual dies before reproductive matruity it is called Sublethality Ex: Sickle cell anaemia.
If death of individual takes place after sexual maturity it is called Delayed lethality.

CHROMOSOME BASIS OF INHERITANCE
Chromosome theory of Inheritance :
It was proposed by Sutton and Boveri independently in 1902 and expanded by Morgan, Sturtevant and
Bridges.
Main features of chromosome theory of inheritance are as follows
(1) Sperm and ovum are bridge between two generations.
(2) Both sperm and ovum contribute equally in heredity of offspring the sperm provides only nuclear part to
the zygote.
(3) Nucleus contains chromosomes therefore, chromosomes carry the hereditary characters.
(4) Each chromosome or chromosome pair plays definite role in the development of an individual. Loss of
a part / complete chromosome causes structural and functional deficiency in the organism.
(5) Both chromosomes appear in pair in the somatic or diploid cells.
(6) A gamete has only one chromosome as well as one mendelian factor out of homologous pair .
(7) Synapsis and random independent separation of chromosomes form the quantitative basis of independent
assortment of mendelian factors.
(8) Paired condition of chromosomes is retained during fertilization.
(9) Sex of certain organisms is determined by specific chromosomes called sex chromosomes.
Sex Determination :
On the basis of fertilization, Sex Determination is of three types.
(i) Progamic : Sex is determined before fertlization Ex: Drone in honey bee.
(ii) Syngamic : Determination of sex takes place during fertilization Ex: most of the animals and plants
(iii) Epigamic : Sex determination takes place after fertilization Ex: Female in honey bee.
Usually sex determination involves following types.
(A) Allosomic determination of sex : Chromosomes are of two types .
1. Autosomes or somatic chromosomes :
They control inheritance of somatic characters.
2. Sex chromosomes or Allosomes or Heterosomes :

In most of the animals and some plants, sex is determined by sex chromosomes or allosomes.
X-chromosome or X-body discovered by Henking in the testes of male bug. Sex chromosome
discovered by “Mc Clung” in Grasshopper.
Stevens discovered Y-chromosome. Wilson and stevens (1905) proposed chromosomal theory of sex
determination. Allosomic determination of sex involves following types.
(i) XX—XY type or Lygaeus type :
It was firstly described by Wilson & Stevens in Lygaeus insect.
NEET_Chromosomal Basis of Inheritance - 18

In this types female is homogametic and forms only one type of gamete whereas male is heterogametic
and produces two types of gametes Ex: human, Drosophila, dioecious plant like Coccinea, Melandrium.
Sex determination in plants (XX - XY type) :

Amongst angiosperms XY sex determiantion is found in Melandrium (Lychnis), Coccinia, salix, Elodea.
Sex determination in Melandrium album (Caryophyllaceae) studied by Warmke, (1946) and Westerguard,
(1958). Here X - chromosome is shorter then the Y- chromosome. The Y chromosome bears four regions
and X-chromosome contains two regions.
1. Female suppressor region : It suppresses the formation of female reproductive organs.
2. Male promoter region : It starts development of Anther.

3. Male fertility region : It proceeds further development of Anther.
4. Homologous region : It initiates disjunction & Pairing of X and Y chromosome during meiosis.
5. Differential region of X-chromosome : It promotes the development of female sex organs.
Pro. R. P. Roy discovered sex determination in Coccinea indica & gave the importance of Y- chromosome
in plants.
Point of remember
Sporophyte of Sphaerocarpus (Bryophyte) contains two sex chromosomes ( X and Y) and it produces
two kinds of meiospores.Some with X-chromosome and other with Y chromosome. Meiospore with X
chromosome germinates into female gametophyte and meiospore with Y chromosome germinates into
male gametophyte.
(ii) ZW – ZZ type :
Female is heterogametic and produces two types of ova while male is homogametic and produces one type
of sperms. Ex: Birds, Reptiles, Some fishes, Hen, Plant Fragaria eletier.
(iii) XX —X0 type or Protenor type :
Female is homogametic and male is heterogametic Actually male bears only one sex chromosome therefore
male produces two types of sperm A + X and A+ O . whereas female produces only one type of egg.
Ex: Squash bug - Anasa, Grass hopper, Cockroach, Ascaris and plants like Dioscorea sinuta &
Vallisneria spiralis.

(iv) Z0 – ZZ type :
Female is heterogametic in which one sex chromosome is missed. Male is homogametic. Ex : some
Moths and Butterflies.
(v) Haplo-diploidy type :

In animals such as honey bee female is diploid and male (drone) is haploid. Drone or male insects are
develop by unfertilized eggs through parthenogenesis. It is called arrhenotoky. Meiosis does not occur
during the formation of sperms. Females develop from fertilized eggs and are hence diploid. Queen Bee
takes all the sperms from the drone during nuptial flight and stores them in saminal vesicle. They do not
fertilise the eggs & develop into males or drones.
Hormonal theory for sex determination :

In some cattles cow, sheep, goat, dizygotic twins are common in which one foetus may be male and the
other female. Male foetus secretes male hormone before secretion of female hormones that suppresses
the development of ovaries in the female foetus, it is called Free martin (Twins) in which male is fertile and
female is sterile.
Gynandromorphs :
Some Drosophila individuals were found to possess half of the body of male and half of female they are
called Gynandromorphs. The latter is formed by loss of one X-chromosome at metaphase plate during first
zygotic division.
Genic balance theory :

It was proposed by Calvin Bridges (1926). He stated that sex is determined by the genic balance or ratio
between X-chromosomes and autosomes. It is applicable for Drosophila melanogaster in which
expression of maleness is not controlled by Y-chromosome.

S. NO. Chromosome X/A ratio Individual (sex)
Constitution
(i) 3A + XXX 3/3 =1·0 Triploid female
(ii) 2A + XX 2/2 = 1·0 Diploid female
(iii) 2A + XXY 2/2 = 1·0 Diploid female
(iv) 3A + XX 2/3 = 0· 67 Intersex
(v) 3A + XXY 2/3 = 0· 67 Intersex
(vi) 2A + XY ½ = 0·5 Diploid male
(vii) 2A + XXX 3/2 = 1·5 Super female
(viii) 3A + XY 1/3 = 0·34 Super male
(B) Environmental sex determination :
In some animals sex is influenced by environmental factors for example in Crepidula (Molluscs), larva gives
rise to female organism in isolation. If it is connected with female it gives rise to male similar concept has
been observed in Bonellia.
In Reptiles sex determination depends on the temperature of incubation of eggs. In Agama agama lizard
female offspring produce through those eggs that are incubated on 26 – 27ºC but they produce male
offspring if they are incubated on 29ºC.
In contrast - Tortoise (Graptemys) - low temperature (Less than 30ºC) promotes formation of male & higher
temperature (More than 30ºC) promotes female tortoise
In crocodile male offsprings produce on 33ºC whereas female offsprings produce on 31ºC.
(C) Nonallosomic :
In Bacteria sex determination is controlled by fertility factor located on a plasmid.

In several simple organisms, sex is determined by single gene. Ex: Chlamydomonas, two genes in Maize
- One gene for male inflorescence and second gene for female inflorescence .
Linkage :
Sutten and Bovari firstly stated about linkage in chromosomal theory of inheritance.
Bateson and Punnet worked on sweet pea (Lathyrus odoratus) and proposed coupling and repul-
sion hypothesis . They found that the factors for certain characters do not show independent assortment
thus linkage is exception of independent assortment. Therefore the dihybrid ratio is only 3 : 1 and
a test cross ratio of 1 : 1.
According to Morgan (Father of experimental genetics) :The genes of a chromosome have tendency
to inherit together and maintains the parental combination in successive generations these genes are
called linked genes and this phenomenon is called Linkage.
Morgan & Casttle (1911) proposed chromosomal theory of linkage

(i) Linked genes appear in the same chromosome.
(ii) Genes arrange in Linear fashion on chromosome.
(iii) The strength of linkage is inversely proportional to the distance between two genes.
(iv) Genes present on same chromosomes have tendency to mantain parental combinations except for
occasional crossovers.

Types of linkage :
(1) Complete Linkage (2) Incomplete Linkage

(1) Complete Linkage :
The gene situated on the same chromosome do not separate and are inherited together over the genera-
tions due to the absence of crossing over. It is rare Ex : Male Drosophila.
(2) Incomplete Linkage :
The linked genes do not always stay together because homologous non sister chromatids may exchange
segments of varying length with one another during meiosis. It is called crossing over.
The linked genes located in a chromosome have chances of separation by crossing over, are called
incompletely linked genes and the phenomenon of their inheritance is called incomplete linkage. Ex: Morgan
conducted two crosses in Drosophila.
(i) Crossing of yellow bodied (y) and white eyed (w) female with brown bodied (Y+) red eyed (W +) male
produced F1 to be brown bodied red eyed. After intercrossing of F1 generation Morgan found that F2 ratio
deviated significantly from expected 9 : 3 : 3 : 1 ratio. He observed 98.7% parental types and 1.3%
recombinants.
(ii) Second cross performed between white eyed (w w) and miniature winged (m m) female with wild type or
red eyed (w+ w +) normal winged (m+ m+) males. In F1 generation wild types form. Now F1 female fly test
crossed with white eyed and miniature winged male. He observed 62.8% parental types and 37. 2%
recombinants in offsprings.

Linkage Groups :
It is linearly arranged groups of linked genes which are normally inherited together except crossing over or
haploid no of homologous chromosomes.
Table
S.No. Organism Diploid no. of chromosomes (2n) no. of linkage group

1 Human beings 46 23
2 Maize 20 10
3 Pea 14 7
4 Drosophila 8 4
* Neurospora is haploid. It has 7 linkage groups (7 chromosomes), Mucor has 2 linkage groups
(2 chromosomes).

Sex Linkage or Sex-Linked Inheritance :
Inheritance of some traits is controlled by genes of sex chromosomes.These are called sex linked traits.
It was discoverd by Morgan.
Types of Sex Linked Inheritance :

It is of following types.
(i) Criss Cross Inheritance :
it is a type of sex linked inheritance where a parent passes the traits to the grand child of the same sex
through offspring of the opposite sex.
It is of two types
(a) Diagynic ( Diagenic) : Father to grandsons through daughter.
(b) Diandric : Mother to grand daughter through son.
(ii) Non Criss Cross Inheritance : It involves two types.
(a) Holandric : Direct from father to son or male to male
(b) Hologynic : Direct from mother to daughter or female to female.
(1) Sex Limited Traits :

These traits are expressed in a particular sex although their genes also occur in the other sex they require
sex hormones for their expression. Ex: moustaches and beards human males, breast in human fe-
males, milk secretion in human females.
(2) Sex Influenced Traits :

These traits are controlled by autosomeal genes & the expression of these genes in a particular sex
depends upon favourable conditions for example. The gene of pattern baldness acts as a dominant one in
human males because it can express itself due to availability of male hormones. It is unable to express in
the human females due to absence of hormones.
Genotype Ma le Female
BB Baldne ss Ba ldness
Bb Baldne ss Ba ldness Abse nt
bb Ba ldness Absent Ba ldness Absent
(3) X-linked genes :
In humans X-chromosome carries alleles of a number of human sex-linked disorders like red green colour
blindness, haemophilia, glucose-6-phosphate dehydrogenase deficiency syndrome, muscular dystrophy.
(a) Colour blindness :

It is recessive sex-linked trait in which patient is unable to distinguish red or green or blue colours. The
gene for the normal vision is dominant. whereas Colour blindness is recessive to normal vision. Green
colour blindness is called deuteronopia, red colour blindness is called protonopia whereas blue
colour blindness is called Tritonopia (Rare). Colour blindness can be checked by ishihara card.
The normal gene and its recessive allele are carried by X-chromosomes. In man Colour Blindness appears
in the presence of a single recessive gene (X CY) whereas in woman colour blindness occurs only when both
the sex chromosomes carry the recessive gene (XC XC). Colour blindness shows criss-cross inheritance.
Condition -1 female carrier & normal, male Normal.

Results : (i) All the Girls are normal (50% normal and carrier whereas 50% normal).
(ii) 50% Boy colour blind and 50% boy have normal vision.
Condition : 2 Carrier female, Colour blind male
Results : (i) 50% Girls are Colour blind & 50% normal and carrier Girls.
(ii) 50% Boy colour blind and 50% boy have normal vision.
Condition - 3 Colour blind female, normal male
Results : (i) All the Girls are normal and carrier.

(ii) All the Boys are colour blind.
Condition - 4 Normal female, Colour blind male

(ii) All the Boys are normal.
(iii) Occurence of Colour blindness is 0% in the offsprings.
Condition - 5 Colour blind female, Colour blind male
Results : (i) All Girls & Boys are Colour blind.

FOR AIIMS
(b) Haemophilia ( Bleeder’s disease) : It was discovered by John Otto, (1803). It is Sex linked disease
(recessive gene of Haemophilia lies on X- chromosome) in which the patient will continue to bleed even
from minor cut . Queen Victoria also infected this disease. hence it is called royal disease. It is of two
types.
(i) Haemophilia – A : In this type patient does not possess the natural phenomenon of blood clotting due
to absence of factor VIII (AHG or Anti Hemophilic Globulin ).
(ii) Haemophilia – B : It is due to lack of factor IX (Plasma thromboplastin factor).
It is found in human male only because single gene for the Heamophilia is able to express itself due
to presence of one X- chromosome only. This defect does not appear in the girl babies because of the
presence of the allele for the normal blood clotting present on the second X -chromosome (XX h). There-
fore, the girl babies remain carrier. A female becomes haemophiliac only when both its X-chromosomes
carry the gene (Xh Xh). However, such females normally die before birth because the combination of
these two recessive alleles is lethal.
Condition -1 female carrier & normal, male Normal

Results : (i) All the Girls are normal (50% normal and carrier whereas 50% normal)
(ii) 50% Boy Haemophilic and 50% boy have normal.
Condition - 2 Carrier female, Haemophilic male
Results : (i) 50% Girls are Haemophilic (died) & 50% normal and carrier Girls
(ii) 50% Boy Haemophilic and 50% boy have normal vision.
Condition - 3 Normal female, Haemophilic male.

(ii) All the Boys are normal.
(iii) Occurence of Haemophilia is 0% in the offsprings.
(4) Y- linked gene : The genes present on diffferential parts of Y-chromosome are passed directly from
father to son. These genes are called holandric genes. Ex: hypertrichosis (excessive hairs on ear
pinna), TDF (testis determining factor), keratoderma dissipatum (thickened skin of extremities),
porcupine skin, webbed toes in humans, masulatures (mac trait) in male guppy fish (Lebistes).
Point of Remember
Homologous part of Y- chromosome ( the part that synapses with X-chromosome) bears some similar
genes of X-chromosoeme. These are called X-Y linked genes, Ex: Xeroderma pigmentosum
(skin cancer), Epidermolysis bullosa (blistered skin) in humans,
Crossing over :
Exchange of segments of non sister chromatids between homologous chromosomes is called crossing
over.
The term crossing over was coined by Morgan. It occurs in the pachytene stage, of meiosis - I
The non sister chromatids in which exchange of segments have occurred are called recomobinants or
cross-overs while the other chromatids in which crossing over has not taken place are called non cross-
overs (parental chromatids).
Ex: Colour & shape of seed / grain in Maize (observed by Hutchinson)
Parental combinations were 48·2% + 48·2 % = 96·4%

New combinations were 1·8% + 1·8% = 3·6%
In the above cross four types of offsprings obtain in the ratio of 27 : 1 : 1 : 27 instead of 1 : 1 : 1 : 1 ratio
expected for independent assortment. Although two genes are linked in the same chromosome but 1.8%
nonsister chromatids of the homolgous chromosomes show crossing over.
Crossing over in tetrad stage :

Neurospora or pink mould is used to demonstrate that crossing over takes place at 4- stranded stage. If
crossing over does not occur, then ascospores demonstrate 4 + 4 arrangement. It is called First division
segregation.
If crossing over takes place in the two-strand stage (AB,ab) only two recombinants (Ab, aB) will be formed
& parental types are absent.
If crossing over occurs in 4-strand stage, two parental types (AB,ab) and two recombinants(Ab, aB) types
are formed.

In Neurospora it forms 4 types of ascospores two of one parental type, and two of other parental type, two
of one recombinant and another two of second recombinant type which show 2 : 2 : 2 : 2 or 2 : 4 : 2
arrangement in Neurospora crassa. Thus crossing over takes place in 4-strand stage instead of two strand
stage. It is called Second division segregation.
Factor affecting crossing over :

(i) Age : The frequency of crossing over is decreased due to increasing the age.
(ii) Distance : If the two genes locate at quite distance. The possibility of crossing over is increased.
(iii) Temperature : If temperature increases the possiblity of crossing over also increases.
(iv) X-rays : The treatment of X- rays also increases the possiblity of crossing over.
(v) Heterochromatin : Occurence of centromere and heterochromatic areas decrease the rate of cross
ing over.
(vi) Chemicals : The degree of crossing over in animals is changed by chemicals of food.
(vii) Sex : Little crossing over is observed in male Drosophila
(viii) Interference and Coincidence : One cross over decreases the occurence of frequency of another
crossing over. It is called interference. The ratio of observed double cross over and expected double
cross over is called coincidence.The latter is small when interference is high.
% observed double cross overs
Coefficient of coincidence = % expected double cross overs
Linkage Maps / Chromosome Maps :

The graphic representation of sequence and relative distance between genes in a chromosome is called
Linkage map. The first linkage map was developed by Sturtevant (1911) for Drosophila. The frequency of
crossing over between two genes is directly proportional to the distance between the two. Recombination
frequency or Cross-over value (COV) is measured by test cross. 1% crossing over between two linked
genes is known as 1 map unit or 1 centimorgan.
Number of recombinan ts
Recombination frequency = Total number of offsprings 100
or Cross-over value (COV)
Ex: 1 An individual with cd genes crossed with wild type + + On test crossing F1, the progeny was
+ c 105, + d 115, cd 880 and + + 900. Distance bewteen cd genes is.
Number of recombinan ts
Recombination frequency = Total number of offsprings 100
or Cross-over value (COV)
220
% cross over value = ×100 = 11 map unit
2000
FOR AIIMS
Ex: 2. The frequency of crossing over or recombination of three sex linked genes was found to be
(a) Sc and ec = 7·6% (sc = scute or certain bristles missing)
(b) ec and cv = 9·7% (ec = echinus or rough eyes)
(c) sc and cv = 17·3% (cv = cross veinless or absence of cross veins or wings)
Ans : sequence sc–ec–cv
Mutation :
Sudden inheritable change in an organism is called mutation.
Darwin coined the term sports and Bateson coined the term saltation or discontinuous variations for
them.
Mutation was discovered by Hugo de vries in Oenothera lamarckiana (Evening primerose). He ob-
served 834 mutations in 54343 plants of Oenothera.
Later workers found that ‘mutations’ observed by De Vries were actually chromosome aberration and
polyploids.
Types of mutations :
(I) On the basis of direction, mutation involves two types
(1) Forward mutation : Wild type – Mutant type

(2) Backward mutation : Mutant type – wild type.
(II) On the basis of dominance or recessiveness.

(1) Dominant mutation (2) Recessive mutaiton
(III) On the basis of tissue :

(1) Somatic : It takes place in somatic cell or Vegetative cell . It does not inherit in the next generation but
in plants, It can transmit next generation through vegetative propagation.
(2) Germinal : It occurs in germinal cell or reproductive cell. It transmits or inherits from generation to
generation.
(IV) On the basis of cytology mutation involves following types.
(A) Chromosomal Mutation (B) Genomatic Mutation (C) Gene Mutation
(A) Chromosomal mutation or chromosomal aberration :

(i) Structural changes & Numerical changes of chromosomes include in this category. Structural changes
of chromosomes involve following types.
(a) Intrachromosomal type :

(1) Deletion : A part of chromosome is lost from terminal part (Terminal deletion) or from intercalary part
(Intercalary deletion) Ex: (i) Deletion of a segment of short arm of Vth pair of chromosome in
human causes Cri du chat syndrome(cat cry syndrome) in child Ex: (ii) Notched wing in Droso-
phila.

(2) Inversion : In this type chromosome break at two intercalary places. The broken segment is inverted
up to 180º and rejoined at chromosome. It is called inversion. It is of two types.
(i) Paracentric inversion : Inversion without centromere.
(ii) Pericentric inversion : Inversion with centromere.
(b) Interchromosomal type :
(1) Duplication :
It occurs due to addition of a part of chromosome. Ex: Development of Bar eye in Drosophila. It
involves following types.
(i) Tendem duplication : When a chromosomal segement appears two time in a chromosome it is called
Tendem duplication.
(ii) Reverse tendem duplication : If the sequence of duplicate part is reverse it is called Reverse tendem
duplication.

(iii) Displaced Duplication : Duplicating segment is inserted away from the same chromosome.
(iv) Transposed Duplilcation : Duplicating segment is inserted in a nonhomologous segment.
(2) Translocation :
When the exchange of segments occur between two non homologous chromosomes. It is called
translocation.
It is of two types.
(a) Simple translocation : In which a segment of a chromosome transfers to the another nonhomologous
chromosome.
(b) Reciprocal translocation : In which a mutual exchange of chromosomal segments between two non
homologous chromosomes. Ex: Chronic myeloid leukemia is due to reciprocal translocation in between
9th and 22nd chromosomes.
(B) Genomatic Mutation : (Changes in chromosomal Number) It involves aneuploidy and Euploidy
(polyploidy).
(1) Aneuploidy : In which one or few chromosomes are either deficient or in excess in a species. It is of
two types.
(a) Hypoploidy : In which either one or few chromosomes are deficient. It involves two types.
(i) Monosomic (2 n – 1) : In which one chromosome is deficient. Ex: Turner’s syndrome (44 + X 0), It is
also found in Gossypium.
(ii) Nullisomic (2n – 2) : A pair of chromosome is deficient.
(b) Hyperploidy : In which one or few chromosomes are in excess. It is of two types.
(i) Trisomy (2n + 1) : One chromosome is additional in a pair of chromosome. it represents as 2n + 1.
Ex: Datura, In human Trisomy in 21st pair,Trisomy in 18th pair and Trisomy in 13th pair are respectively

called down’s syndrome. Edward syndrome and patau syndrome. Double trisomic has two different
chromosomes in triplicate (2n + 1 + 1).
(ii) Tetrasomic (2n + 2) : A pair of chromosome is additional or a chromosome is found fourtimes
Ex: Super female 44 + XXXX, Double tetrasomic (2n + 2 + 2).
(iii) Pentasomic (2n + 3) : A chromosome occurs five time Ex: superfemale (44 + XXXXX) rare.
Point of remember
(1) Double monosomic : In double monosomic one chromosome is deficent in each chromosome of
a pair. It represents as 2n – 1 – 1.
(2) Mixed Aneuploids : In which both hypoploidy and hyperploidy occur in two different pair of
chromosome. Ex: 2n + 1 A – 1B.
(3) Euploidy : In which chromosome number is exact multiple of genome Ex: monoploidy, diploidy,
polyploidy.
Polyploidy :
If an organism has more than two sets of chromosomes, It is called Polyploid this phenomenon is called
polyploidy.
On the basis of occurence of number of genome, polyploid is called triploid (3n), tetraploid (4n),
Pentaplaoid (5n), Hexaploid (6n) etc.
In nature, polyploidy appears due to the failure of chromosomes to separate at the time of anaphase either
due to nondisuction or due to no formation of spindle.
Polyploids with odd number of genomes (Ex: triploids, pentaploids) are sexually sterile. so that they
perform reproduction by vegetative propagation Ex: Banana, Pineapple.
Polyploidy involves three types :
(i) Autopolyploidy (ii) Allopolyploidy (iii) Autoallopolyploidy
(i) Autopolyploidy :
It is a numerical increase of the same genome such as Autotriploidy (AAA) Ex: Rice, Gram, Maize.
(ii) Allopolyploidy :
It is formed by hybridisation between two species followed by doubling of chromosomes such as (AABB)
Ex: Wheat, Tobacco, artificially produced two allopolyploids are Raphanobrassica and Triticale.
(iii) Autoallopolyploidy :
One genome is in more than diploid state such as (AAAABB) Ex: Helianthus tuberosus.
Point of remember
Polyploidy can be artificially induced by application of colchicine and granosan.
(C) Gene Mutations :

Sudden stable changes in the structure of gene or cistron due to change in nucleotide sequence and
nucleotide type are called gene Mutations.
Most of the gene mutations include change in single nucleotide. These are called point mutations. If
mutations takes place in more than one base pair is called gross mutation. Usually Gene mutations
appear during replication of DNA therefore It is called copy error mutation.
Seth Wright (1791) firstly recorded point mutation. He observed short legged lamb (ancon sheep).

Scientifically Thomas hunt Morgan observed actual mutation (gene mutation) when he found white eyed
mutant of male Drosophila among wild type red eyed Drosophila.
Type of gene mutations :

Gene mutations involve three types
(i) Substitution:It includes replacement of one type of nitrogenonus base by other. It is of two types
(a) Transition : In this type, one purine is replaced by another purine while one pyrimidine by another
pyrimidine.
(b) Transversion : Purine base is replaced by a pyrimidine base or vice versa.
(ii) Inversion : A deterioration of DNA by mutagen can change the base sequence of a cistron in the
reverse order.
(iii) Frame-shift Mutations : In this types the entire reading frame of base sequence shifts laterally either
in the forward direction due to insertion of one or more nucleotides or in the backward direction due to
deletion of one or more nucleotides. It is also called gibberish mutations. It is of two types
1. Deletion : One more nucleotides are eliminated from segment of DNA or gene.
2. Insertion : Addition of one or more nucleotides in the segment of DNA or gene.
On the basis of occurrence in nature, mutations two types.

1. Spontaneous Mutations : They occur naturally in the nature due to internal factors such as
(i) Background Radiations (ii) Tautomers (iii) Copy Error
(iv) Deamination of Cytosine
2. Induced Mutations : They are produced by the application of external factors and chemicals.The first
induced mutation produced by Muller (1927) in Drosophila through the use of X-rays.
Mutagens : Any type of physical or chemical factor that is used in the induction of mutation are called
mutagens. The latter are of two types.
(i) Physical mutagens : These are of two types
(a) High Energy Radiations : These are of two types
(1) Ionizing radiations : Ex: X-rays, gamma rays and cosmic rays , alpha particles, beta rays.
Ionizing radiations cause breaks in the chromosome, It causes abnormal cell divsions. Different types
of cancers are the result of radiations.
(2) Non-inoizing radiations : Ex: ultra-violet light. Thymine (pyrimidine) dimers show a major mutagenic
effect of UV rays that disturbs DNA double helix and thus DNA replication.
(ii) Chemical Mutagens : They are of several types.
(a) Base Analogues : They resemble the normal bases of DNA and, therefore, get incorporated into DNA
in place of them. The common mutagens of this type are 5-bromouracil and 5-flurouracil.
(b) Alkylating Agents : Nitrogen mustards Ex : RN (CH2Cl2) diethyl sulphate (DES), dimethyl nitrosamine
(DMN) and other alkylating agents cause methylation or ethylation of nitrogen bases.
(c) Nitrous Acid : It is a deaminating agent which changes cytosine to uracil, guanine to xanthine and
adenine to hypoxanthine. It disturbs replication and transcription.
(d) Acridines : They are derived heteroaromatic flat molecules from which a number of dyes and

pharmaceuticals are parepared. Ex: acriflavine, proflavine, acridine orange. Deletion or addition
of nucleotides cause frame shift mutation.
Point of remember
(1) Same-sense mutation or silent mutation : In this type the codon is changed but the It does not
alter the amino acid specificity Ex: (CCA CCC , GCC GCG)
(2) Mis-sense mutation : When the meaning of codon changes from one amino acid to another it is
called missense mutation Ex: human disorder called sickle cell anaemia is caused by a single
base substitution in a gene. This alteration results in the replacement of glutamic acid by
valine.
(3) Non sense mutation : In this types polypeptide synthesis is stopped due to formation of a terminat-
ing or nonsense codon, such as UAA, UAG, UGA .
Human Genetics :
Archibald Garrod, firsty studied human genetics. He studied black urine disease alkeptonuria and stated
that it is inherited by recessive gene. This was also the first study of inborn error of metabolism and
biochemical genetics, hence Garrod is also known as “Father of human genetics” or “Father of
biochemical genetics” .
Important techniques used to study human genetics are.
FOR AIIMS & AIPMT :

1. Pedigree Analysis :
A record of inheritance of certain genetic traits for two or more generations presented in the form a diagram
or family tree is called pedigree. Ex: Human, domesticated animals
Square represents the male . A circle represents the female .
Solid symbol shows the trait under study and a cross or shade of any type or , or
Words can also be used in place of symbols.
Parents are shown by horizontal line while their offsprings are connected to it by a vertical line.
Pedigree analysis is study of pedigree for the transmission of particular trait and finding the possibility of
absence or presence of that trait in homozygous or heterozygous state in a particular individual.
It is useful for the genetic counsellors to advice intending couples about the possibility of having children
with genetic defects like haemophilia, colourblindness, alkaptonuria, phenylketonuria, thalassemia, sickle
all anaemia, polydactyly & syndactyly.
Pedigree analysis employs two tools.
(i) Realised ratio of probability and chances of difference in realised ratio due to smallness of the progeny
(ii) Elimination of alterantives.

2. Study of Twins :
Birth of two babies simultaneously by woman. Twins are of following types.
(i) Dizygotic twins or fraternal twins : If twins develop from two separate fertilized eggs, they are called
dizygotic or fraternal twins.
(ii) Monzygotic twins : Twins develop from the same fertilized egg (zygote) due to splitting of zygote in to
two blastomeres. The former also called identical twins because they are genetically similar except
occasional mutation.
(iii) Siamese twins : Sometime breaking of young embryo is incomplete so that monzygotic twins are
joined in various regions.
3. Population Genetics :
The study of distribution of traits and frequency of gene distribution in the whole population is called population
genetics. It is based on principles of probability and statistical tools.
Hardy-Weinberg law :
The frequency of different genotype produced due to random mating will depend upon the gene frequency
and equillbirium is stablised after one single generation of random mating. Gene A = p ;Gene a = q ; p +
q = 1 or A + a = 1 ; and (A + a)2 = A2 + 2Aa + a2 = 1. 1 q2 p

The frequency of A p = the Frequency of homozygous dominant will be AA–p2
The frequency of a q = Frequency of homozygous recessive will be q2
The frequency of Aa = 2pq
Question : (1) Presence of recessive trait is 16% . The frequency of domimant allele in population
will be

Solution
q= .16 = 0.4. p = 1.0 – 0.4 = 0.6.
Question : (2) Frequency of an autosomal lethal gene is 0.4. The frequency of carrier in a
popoulation of 200 individual will be
Solution
Given q = 0.4 p = 1 – 0.4 = 0.6
frequency of carrier 2 pq = 2 x 0.6 × 0.4 = 0.48 or 48%
hence 96 out of 200.
4. Karyotype 5. Cell Culture
Human Genetic Disorders :
(A) Chromosmal Disorders :

(i) Sex Chromosomal Disorders :These are as follows.
(1) Klinefelter’s Syndrome :

It is found in man. Its patient contains 47 chromosomes and Its genotype is 44 + XXY. These persons are
sterile males having undeveloped testes. sparse body hair, mental retardation, and some female characters
like development of breasts (gynaecomastia). It is due to the presence of additional X-chromosome. It
has one barr body. One in every 500 male births is victim of this syndrome.
(2) Turner’s Syndrome :

It is found in woman. The patient has 45 chromosomes instead of 46. and its genotype is 44 + X 0. These
are sterile females having rudimentary ovaries, small uterus undeveloped breasts, short stature,abnormal
intelligence, webbed neck. menstrual cycle is abnormal or absent. One in every 3000 children is a victim of
this syndrome.
FOR AIIMS
* XO- Chromosomal abnormality in human beings causes turner’s syndrome. While in some
insects like grasshopper, XO type of sex chromosome determines male sex.
(3) Supermales (Jacob’s syndrome or criminal syndrome) :

The genotype of supermale is 44 + XYY & total number of chromosomes are 47 instead of 46. These males
are characterised by abnormal height, mental retardation and criminal bent of mind (Jacob’s syndromes)
supermales are more aggressive than normal males due to over secretion of male sex hormones.

(4) Superfemale :
The genotype of superfemale is either 44 + XXX (47 chromosomes) or 44 + XXXX (48 chromosomes)
or 44 + XXXXX (49 chromosomes). They have abnormal sexual development and mental retardation.
(ii) Autosomal Disorders : These are as follows.
(1) Down’s Syndrome (Mongolian Idiocy) :

It was discovered by Langdon Down. In this Syndrome 21-pair of chromosomes show trisomy (pres-
ence of an extra chromosome number 21.
It is caused by nondisjunction of 21st chromosome pair during anaphase. Thus the total number of chromo-
somes are 47 instead of 46 & genotype is 45 + XY in male & 45 + XX in female.
Symptoms of this syndrome are broad fore-head, rounded face, permanently open mouth with protruding
tongue, projecting lower lip, Mongolian type eye lid fold,verticalfold epicanthus on either side of nose,
stubby fingers,broad palm with characteristic palmer crease, Short neck , little intelligence, undeveloped
Gonads and genitalia.
(2) Edward’s Syndrome :

It is due to trisomy in 18th pair of chromosomes.The affected person keeps the fingers tightly clenched
against the palm of the hand. Other symptoms are small jaws, deformed ears, small mouth, nose and
fingers, small sternum and pelvis. The patient is mentally retarted and dies within 6 months after birth.
(3) Patau’s Syndrome :

It occurs due to trisomy in 13th pair of chromosomes. It is characterised by small head, abnormalities of
the face, eyes and forebrain, cleft lip and palate, deformed ears, small chin and the hands are often
clenched as edward’s syndrome. The average life span of the affected person is about 4 months.
(4) Cri du chat Syndrome or Cat Cry Syndrome :

It is due to deletion of half part in the short arm of the chromosome number 5. It was reported by
Lejeune (1963).The affected newborn cries like mewing of a cat hence it named Cri du chat (Cat Cry). Its
other symptoms are moon like face, Widely spaced eyes, small head, receding chin, congenital heart
disease.
(5) Myelogenous Leukemia :

It was firstly reported in Philadelphia in 1959 hence it is also called Philadelphia syndrome. It is due to
deletion of small part of long arm of chromosome 22 and its addition to chromosome 9 (reciprocal
translocation).

(b) Gene Related Disorders : They occur due to alternation or mutation in the single gene. These are as
follows.
(i) Gene Mutations in Autosomes : Two types involve in them.
(A) Recessive Traits. (B) Dominant Traits.
(A) Recessive Traits : Recessive autosomal genes in homologous condition are responsible for them.
(1) Phenylketonuria (PKU) :

It described by Folling (1934). It is an autosomal recessive metabolic disorder. Enzyme phenylala-
nine hydroxylase is absent due to abnormal autosomal recessive gene on chromosome 12 as a result
phenylalanine (amino acid) is not converted into tyrosine (amino acid) in liver. It is called
hyperphenylalaninemia. The latter is characterised by accumulation and excretion of phenylalanine,
phenylpyruvic acid and related compounds. Symptoms are mental retardation (IQ less than 20), decreased
pigmentation of hair and skin and eczema.
(2) Alkaptonuria :
It was first inborn metabolic disease explained by Garrod. It is an autosomal recessive, metabolic
disorder. Deficiency of an alkapton oxidase/homogentisate oxidase enzyme of liver is responsible for
it. as a result homogentisic acid/Alkapton accumulates in the tissues and is also excreted in the urine.
The latter turns black in the air due to oxidation of homogentisic acid & other symptoms are arthritis, bronz
pigmentation .
(3) Albinism :
Albinos lack dark pigment melanin in the skin, hair and iris. It is an autosomal, recessive genetic disor-
der. Synthesis of melanin pigment from dihydroxyphenyalanine is absent due to lack of
enzyme tyrosinase. Only homozygous individual (aa) is affected by this. It is due to recessive allele of
long arm of chromosome 11 but may also be caused by another recessive allele of P-gene on long arm
of chromosome 15.
(4) Cystic Fibrosis :

The disease is common in caucasian population. It occurs due to recessive allele of chromosome number
7. Symptoms of this disease are the failure of chloride ion transport mechanism followed by elevated
levels of sodium and chloride in the sweat. Thick mucus accumulates in lungs and respiratory path, It
causes blockage and secondary infection. This disorder was formerly called mucoviscoides. There is
impairment of pancreatic and liver functions in most of the cases of cystic fibrosis. Cardiac failure may
occur.
.
(5) Tay-Sach’s Disease (TSD)/ Infantile Amourotic Idiocy :
It is recessive autosomal disorder that occurs due to deficiency of enzyme -D-N- acetyl hexosamini-
dase after birth. Symptoms of this disease involve damaging brain and spinal cord. Mental retardation and
paralysis due to accumulation of lipid GM2 or Tay-Sach’s ganglioside. The child is dead at the age of
3–4 yrs.
(6) Sickle Cell Anaemia :

It occurs due to autosomal codominant (formerly considered recessive) allele Hbs present on chromo-
some 11.

It is caused by the formation of an abnormal haemoglobin-S. In which Glutamic acid, of 6th position in
-chain is replaced by Valine amino acid due to substitution of T by A in the second position of the triplet
codon (CTC) on chromosome 11.The codon CTC usually transcribed into GAG (coding for Glutamic
acid). but due to substitutions of T by A The new codon CAC is transcribed into GUG that codes Valine. It
is the major effect of allele.
Other secondary effects involve formation of sickle-shaped erythrocytes during oxygen deficiency. The
cells cannot pass through narrow capillaries resulting the latter become clogged. Spleen and brain get
damaged. The homozygotes having only haemoglobin-S (HbSHbS) usually die before reaching maturity due
to erythrocyte distortion but HbAHbS individuals survive.
(B) Dominant Traits :

(1) Huntington’s chorea :
It is due to dominant autosomal gene situated on chromosome 4, in which muscle and mental deterio-
ration occurs. gradual loss of motor control resulting in uncontrollable shaking and dance like movements,
slurring of speech, loss of memory and hallucinations after shrinks of brain between 20–30% size. Disease
may start at the age of 15– 40 yrs.
(2) Polydactyly : presence of extra fingers and toes.
(3) Achondroplasia : It is a type of dwarfism in which long bones do not grow.

(4) Brachydactyly : abnormal short fingers and toes.
Point of remember

(i) Alzheimer’s Disease : It is neuro-degenerative disease of brain that occurs due to accumulation
of amyloid protein plaques (amyloid- peptide protein) resulting degeneration of neurons takes
place in patient. two defective autosomal alleles,(one on the chromosome 21 and other on
chromosome 19) are involved. They produce disease after the age of 40. Symptoms involve
changes in personality, memory loss, trembling of hands followed by progressive increase
in dementia over next 5–10 yrs.
(ii)Thalassemia. It is a group of genetic disorders which result from defective synthesis of subunits of
haemoglobin. It represent quantitative inheritance. In -thalassemia, out of the four genes present
on 11th chromosomes, absence of two genes ( )-/ - or /--) produces microcytic and slight
hypochromic erythryocytes without significant anaemia but deficiency of three genes (--/ -) develops
microcytic hypochromic erythrocytes with marked haemolytic tendency. Death occurs in foetus in
case of deficiency of all the genes. In -thalassemia the two -genes present on 16th chromosomes
are defective. In -thalassemia minor (one defective -gene), the erythrocytes are microcytic with
higher RBC count but 15% lower haemoglobin than normal. In -thalassemia major, both the genes
are defective. There is severe anaemia with microcytic hypochromic RBCs.
Cytoplasmic inheritance :
It was discovered by Correns (1909) in Plastid inheritance in Mirabilis jalapa. The Inheritance of some
characters is controlled by cytogene of cytoplasm. It is called cytoplosmic inheritance.
The genes controlling cytoplasmic inheritance are called plasma genes or extra-nuclear genes or
plasmon that are found in mitochondria, plastids, plasmids, special particles like kappa particles, sigma
particles.
male gamete of higher plant has very minute or nil cytoplasm so male gametes only inherit karyogene
thus inheritance of cytogene takes place through female.
It is also called maternal inheritance because zygote receives most of its cytoplasm from the ovum. Thus
it is uniparental. If there is a reciprocal cross in this condition, then results may be affected.
Type of cytoplasmic Inheritance :
(1) Organellar genetics
(1) Organellar genetics :
In this type of inheritance essential organelles like chloroplast and mitochondria are involved Ex: (i) –
Plastid inheritance in Mirabilis jalapa - in which branch colour is example of cytoplasmic inheritance.
the colour of offspirng depends upon the ovum yielding branch and not the pollen yielding branch.
Ex: (ii) Petite form in yeast - It is an example of mitochondrial inheritance that occurs due to mutation.
Ex: (iii) Male Sterility in plants - In Maize, the gene of male sterility is found in mitochondria
Ex: (iv) Iojap inheritance in Maize
Ex: (v) Poky Neurospora
Ex: (vi) Albinism in plant
(2) Predetermination :
It is the effect of mother’s genes on the features of offspring through the cytoplasm of the egg without
involving plasmagenes. Ex: Shell coiling in Limnaea peregra (snail). It is a fresh water snail showing two
types of coiling-dextral (clockwise) & sinistral (anticlockwise). Dextral coiling is controlled by a dominant
nuclear gene called (D) while sinistral coiling is due to a recessive gene (d). The genes express their
effect through structures present in the cytoplasm or plasmagenes. Zygote receives whole of its cytoplasm
from the egg, the direction of shell coiling in the offspring is governed by plasmagenes of the mother
which in turn are formed in response to nuclear genes.
(3) Dauermodification :
It is phenotypic change due to chemicals and other environmental factors that persist for few generations
and are transmitted through egg cytoplasm.
Ex: (i) Inheritance of Kappa Particles (Caedobecter taeniospiralis bacteria) in paramecium (Reported
by Sonnebern)- In Paramecium aurelia 2 strains are reported i. e. when present in strength (minium
400) one sceretes toxic substance paramecin & called killer strain (KK) and other is called sensitive
strain (kk). The sensitive one is killed if it comes in contact with paramecin. It is also found that kappa

particles are present in cytoplasm of killer strain only.
Ex: (ii) Inheritance of Sigma particles in Drosophila - In Drosophila one strain shows more sensitivity
towards CO2. The sensitive strain is regulated by a heat labile substance present in cytoplasm of ovum
called sigma.
Read & Digest
1. Fairchild : It is first successful plant hybrid (fairchild’s Mule) that is formed by cross between
Dianthus (carnation) and centuria (Sweet William).
2. Pleiotropic mutation : Mutation in a gene which has more than one phenotypic expression will
affect a variety of characters, such mutation is called pleiotropic mutation Ex: In sweet pea a
single point mutation cause changes in seed coat colour from Grey to white and flower colour
from red to white.
3. Homeotic Mutation : A mutation that causes part to form another structure instead of forming its
normal structure.
4. Barr Body : It was discovered by Barr & Bertman in interphase stage of nerve cell of female
cats. According to Mary Lyon (1962) one of the two X-chromosomes of a normal female becomes
heterochromatic and appears as Barr body. It appears as drum stick (these are sex chromatin
present in the neutrophil of 3 to 5% cells of females and absent in the neutrophils of males) in
leucocytes of females. This inactivation of one of the two X-chromosomes of a normal female is
dosage compensation or ‘Lyon’s hypothesis’. The number of Barr bodies is always less than the
number of X- chromosome or X - 1.
Table
S.No Orga nism No. of X – Chrom osom e No. of Ba rr body (X –1)
1 Norm al fem a le XX 2–1= 1 (1 ba rr body)
2 Norm al m a le XY 1 –1 = 0 (No ba rr body)
3 Supe r fe m ale XXX 3 – 1 = 2 (tw o ba rr body)
4 Klinfelte r syndrom e XXY 2 –1 = 1 (1 barr body)
5 Turner syndrom e XO 1 –1 = 0 (No ba rr body)
6 Supe r m a le XYY 1 –1 = 0 (No ba rr body)
6. Deficiency of G-6PD : The enzyme glucose 6- phosphate dehydrogenase is present in RBC for
minor glycolysis. The absence of this enzyme is a sex linked recessive trait. The persons deficient
in this enzyme cannot have plasmodium in their RBC and hence cannot suffer from malaria. But if
such person are given antimalarial drugs, the RBCs, being fragile, can repture and cause severe
anaemia.
7. IQ (Intelligent Quotient) : It is the measurement of intelligence . It is governed by 11 sets of

genes. IQ is calculated as.
Mental age
IQ = Actual age × 100
13
Suppose a ten year child has mental age 13, his IQ will be
× 100 = 130.
10
8. Eugenics : Improvement of human race by the application of genetics is called Eugenics.
Francis Galton is called the ‘Father of eugenics’.
9. Euthenics : Improvement of the human race by improving the environmental conditions is called
Euthenics.
10. Euphenics : The symptomatic treatment of genetic diseases of man is called euphenics.
11. Taste Blindness of PTC : It was discovered by Fox (1932). It is a dominant genetic trait, PTC
(Phenylthiocarbamide) has sour taste. About 30% people lack the ability to taste PTC.
Genotype TT and Tt are taster of PTC. tt are nontasters (taste blind persons).

MOLECULAR BASIS OF INHERITANCE
Genetic Material :
It is the substance that controls the inheritance of traits from one generation to the next generation and is
also able to express its effect through the formation and functioning of the traits.
Properties of Genetic Material :

As a genetic material, A molecule must fulfill the following criteria.
(i) Hereditary information must be present in the coded form in the genetic material.
(ii) The genetic material should be able to replicate and then transmitted faithfully to the next generation.
(iii) The genetic material should also be capable of variations, i.e., mutations and recombinations. These
variations should be stable and inheritable.
(iv) The genetic material should be able to generate its own kind and also new kinds of molecules.
(v) Genetic material must be able to express its effect in the form of Mendelian characters.
These requirements are found in DNA thus, DNA is now recognized as genetic material.
DNA as genetic material :

(1) Direct evidences (2) Indirect evidences
(1) Direct evidences :
(i) Transformation :
It is the conversion in the genetic constitution of an organism by picking up genes present in the remains of
its dead relatives.
The transformation experiments conducted by Frederick Griffith in 1928. He used two strains of
bacterium Diplococcus pneumoniae (Streptococcus pneumoniae).
(a) Smooth (S) or capsulated type which have a capsule. These bacteria are of virulent strain and cause
pneumonia.
(b) Rough (R) or non-capsulated in which capsule is absent. These bacteria are of non virulent strain
and do not cause pneumonia.
The experiment described in following four parts.
(a) When S- type bacteria injected into mice. The latter died as a result of pneumonia caused by bacteria.
NEET_ Molecular basis of inheritance - 44

(b) When R- type bacteria injected into mice. The latter lived and pneumonia was not produced.
(c) S- type bacteria which normally cause disease were heat killed and then injected into the mice. The
mice lived and pneumonia was not caused.
(d) The mixed solution of Rough type bacteria (living) and smooth type heat-killed bacteria (both known not
to cause disease) injected into mice.Some mice died due to pneumonia and virulent smooth type living
bacteria could also be recovered from their bodies.
The fourth part of the experiment indicates that some R-type bacteria (non-virulent) were transformed into
S- type of bacteria (virulent). The phenomenon is called Griffith effect or transformation.
Later, Avery, Macleod and McCarty (l944) repeated the experiment in vitro to identify transforming
substance. They proved that this substance is in fact DNA.
They purified biochemicals from the killed S-type bacteria into three components – DNA, carbohydrate
and protein.
DNA fraction was further divided into two parts: one with deoxyribonuclease or DNase and the other without
it. The four components were then added to separate culture tubes containing R-type bacteria. After some
time they were then analysed for bacteria.
Only DNA of S-type can changed R-type of bacteria into S-type. Therefore, the character or gene of virulence
is located in DNA. Thus they proved that the chemical to be inherited is DNA and it forms the chemical or
molecular basis of heredity.
(ii) Multiplication of Bacteriophage (Transduction) :
The transfer of genetic material from one bacterium to another through bacteriophage is called transduction.
T2 is a Bacteriophage which infects E. coli.
32
Hershey and Chase (1952) used radioactive phosphorus P & radio-active sulphur 35S for their experiment
and proved that DNA is a genetic matarial.

Nucleic acids :
Nucleic acids were first discovered by a Swiss biochemist, Friedrich Miescher (1869) whocalled them
nuclein due to their acidic nature.
Chemical analysis of chromosomes shows presence of two nucleic acids-DNA (Deoxyribo nucleic acid)
and RNA (Ribo nucleic acid).
Nucleic acid is a macromolecule & consists of many (polymer) monomeric units, called nucleotides. Each
nucleotide is composed of a nucleoside and a phosphate group. Thus nucleotide is a phosphoric ester of
nucleoside.
Each nucleoside consists of sugar molecule and a nitrogenous base. The relationship can be shown as
given below.
Nucleic acid = many nucleotides
Nucleotide = nucleosides + phosphate
Nucleoside = sugar + nitrogenous base
Thus nucleotide = phosphate + sugar+ nitrogenous base
Nucleic acids bear different components that are briefly discussed below.
1. Phosphoric acid :
The acidic nature of nucleic acids is due to the presence of phosphoric acid. Sugar of nucleoside combines
with phosphoric acid by a phosphodiester bond formed at 5th or 3rd carbon of the sugar.
2. Sugar :
It is a five carbon (pentose) sugar. There are two types of pentose sugars-ribose and deoxyribose. Deoxyribose
sugar has one oxygen atom less at second carbon. Ribose sugar is present in RNA while deoxyribose
sugar occurs in DNA.
3. Nitrogenous bases :
They have two catagories.
(a) Pyrimidine : It includes cytosine, thymine and uracil. Pyrimidine bases are made of only one ring of
carbon.
(b) purine : It includes Adenine and guanine. Purine bases are made of two ring of carbon and nitrogen
bases of DNA contains adenine, guanine, cytosine and thymine. In RNA, uracil is present in place of
thymine.
Many nucleotide monomer units join one another to give rise to polynucleotide chain.
The two adjacent nucleotides are joined by formation of phosphodiester bond (a bond that involves two
ester bonds). A polynucleotide chain is often written as 5’p 3’OH. This indicates that it is a dinucleotide with
phosphate group (p) attached to the 5th carbon of terminal nucleotide and hydroxyl group (OH) is present at
3rd carbon of basal nucleotide.
Structure of DNA (Deoxyribonucleic acid) :

J.D. Watson and F.H.C. Crick (1953) proposed double helical structure of DNA based on the results of
M.H.F.Wilkins and co-workers. All these three persons were awarded Nobel Prize in 1962 for this work.
The following are some of the characteristic features of double helical structure of DNA.
(1) Each nucleotide consists of sugar, phosphate and a nitrogenous base. Many such nucleotides
are linked by phosphodiester bonds to form a polynucleotide chain or strand.
(2) Phospho diester bonds are formed between 5’carbon of sugar of one nucleotide and 3' carbon of sugar
of the next nucleotide.
(3) Nitrogenous base is attached to 1’ carbon of sugar. At this place purine base is attached by its 9'
position and pyrimidine by its 3' position.
(4) Polynucleotide strand is made of backbone of sugar and phosphate forming its long axis and bases at
right angles to it.
Chargaff (1950) made observations on the base and other contents of DNA. These observations or
generalizations are called Chargaffs rule.
(i) Purine and pyrimidine base pairs are in equal amount, that is, adenine + guanine =thymine + cytosine.
(ii) Molar amount of purine-adenine is always equal to the molar amount of pyrimidine thymine. Similarly,
guanine is equalled by cytosine.
(iii) Sugar deoxyribose and phosphate occur in equimolar proportions.
(iv) The ratio of A + T/G + C is constant for a species.
(5) Chargaffs rule states that in natural DNAs the base ratio AT is always close to unity and the GC ratio
also to always close to unity indicated that A always pairs with T and G pairs with C. A and T, G and C,
therefore,are complementary base pairs.
(6) Thus, if one DNA strand has A, the other would have T and if it has G, the other, would have C. Therefore,
if the base sequence of one strand is CAT TAG GAC, the base sequence of other strand would be GTA
ATC CTG. Hence, the two poly nucleotide strands are called complementary to one another.
(7) Two such complementary strands are joined with one another by hydrogen bonds between their
complementary nitrogenous bases. There are three hydrogen bonds between cytosine and guanine
and two hydrogen bonds between adenine and thymine.
(8) The two polynucleotide chains are helically coiled around the same axis in such a way that these can
separate from one another only by uncoiling. Helical coiling is supposed to be right handed. Such a
form of DNA is now called B-DNA
(9) The two chains or strands are antiparallel, i.e., they run in opposite directions in relation to their sugar
molecules. Their 5’p 3' OH phosphodiester linkages are in opposite directions
(10) Double standed DNA molecule has a diameter of 20Aº.
(11) The helix makes one complete turn every 34 Aº along its length.
(12) There are 10 nucleotides per turn of helix. Thus the distance between two neighbouring base
pairs is 3.4 Aº. Since the discovery of DNA structure, some other forms of DNA have also been
recognised. These forms have been classified considering (i) the number of base pairs per turn of helix
and (ii) the distance of base pairs along the helical axis. Accordingly, besides commonly known B-
DNA, other forms are A, C (sometimes D and E) and Z DNA. Some important similarities and differences
among different types of DNA are given in.

S.No. B Z A C D
1 Hand e dne s s of Right hande d Le ft hande d Right hande d Right hande d Right
he lix hande d
2 Pitch of he lix pe r 34 Å 46 Å 25 Å 30 Å 24 Å
turn
3 Diam e te r of he lix 20 Å 18 Å 23 Å 19 Å —
(thinne s t) (w ide s t)
4 Stability Stable and Uns table Uns table Uns table Uns table
Phys iologically
active form
5 Bas e pairs pe r 10 12 (6 dim e rs ) 11 9.33 8
turn of he lix
6 Dis tance 3.4Å 3.8 Å 2.5 Å 3.3 Å 3.03 Å
be tw e e n tw o
bas e pairs
7 Re pe ating u nit M ononucle otide Dinucle otide M ononucle otide M ononu cle otide M o nonucl
e oide
Packaging of DNA Helix :

The distance between two base pairs of DNA duplex is 0.34 nm. (0.34 ×10 –9m) and the length of DNA
duplex in a typical mammalian cell is calculate (by multiplying the total number of bp with distance between
two consecutive bp, that is, 6.6 ×109 bp × bp 0.34 nm/bp). It is about 2.2 metres.
DNA Packing in Prokaryotes :

In prokaryotes, such as, E. coli, though they do not have a defined nucleus, the DNA is not scattered
throughout the cell. DNA (being negatively charged) is held with some proteins (that have positive charges)
in a region known as ‘nucleoid’. The DNA in nucleoid is organised in large loops held by proteins.
DNA Packing in Eukaryotes :

It is much more complex. The DNA is folded with the help of positively charged basic proteins called
histones. The histones are of low molecular weight, acting as repressor of genes to prevent transcription.
These are rich in lysine and arginine. These are of 5 types (H1, H2a, H2b, H3, H4) depending upon the ratio
of lysine, arginine and histidine.
Histones are organised to form a unit of eight molecules known as histone octamer (octomer of histone-
Each of H2a, H2b, H3 and H4 - Oudet 1975). The negatively charged DNA (It has 13 4 turns of DNA
containing 146 nucleotides) is wrapped around the positively charged histone octomer to form a structure
called nucleosome or nu particle The nucleosomes are structural sub units of chromatin. A nucleosome
has a size of 110 × 60 Å is ellipsoidal and bead like. The fifth histone H1 is found on the part of DNA between
2 nucleosomes called linker DNA (size 145 Å with 70 bp). Nucleosome + DNA linker is collectively
called chromatosome.
Nucleosomes give beaded appearance to chromatin like
string on a bead. H1 Protein helps in grouping of
nucleosomes while nucleosomes help in packing of DNA.
A chain of nucleosomes is once again coiled with 6
nucleosomes per turn to form solenoid (Klug 1982). Each
solenoid has 1200 bp of DNA and 300 Å size. H1 is most
species specific, most divergent and act as marker
protein. It is called plugging protein. It is rich in lysine
and is non conservative. It is not found in pairs and not
form nucleosome. H3 and H4 are most conserved proteins.

Properties of Genetic Material (DNA versus RNA)
It became an established fact that it is DNA that acts as genetic material. However, it subsequently became
clear that in some viruses, RNA is the genetic material (for example, Tobacco Mosaic viruses, QB bacteriophage,
etc.).
A molecule that can act as a genetic material must fulfill the following criteria:
(i) It should be able to generate its replica (Replication).
(ii) It should chemically and structurally be stable.
(iii) It should provide the scope for slow changes (mutation) that are required for evolution.
(iv) It should be able to express itself in the form of ‘Mendelian Characters’.
If one examines each requirement one by one, because of rule of base pairing and complementarity, both the
nucleic acids (DNA and RNA) have the ability to direct their duplications. The other molecules in the living system,
such as proteins fail to fulfill first criteria itself. The genetic material should be stable enough not to change with
different stages of life cycle, age or with change in physiology of the organism. Stability as one of the properties of
genetic material was very evident in Griffith’s ‘transforming principle’ itself that heat, which killed the bacteria, at least
did not destroy some of the properties of genetic material. This now can easily be explained in light of the DNA that
the two strands being complementary if separated by heating come together, when appropriate conditions are pro-
vided. Further, 2'-OH group present at every nucleotide in RNA is a reactive group and makes RNA labile and easily
degradable. RNA is also now known to be catalytic, hence reactive. Therefore, DNA chemically is less reactive and
structurally more stable when compared to RNA. Therefore, among the two nucleic acids, the DNA is a better genetic
material. In fact, the presence of thymine at the place of uracil also confers additional stability to DNA.
Both DNA and RNA are able to mutate. In fact, RNA being unstable, mutate at a faster rate. Consequently,
viruses having RNA genome and having shorter life span mutate and evolve faster.
RNA can directly code for the synthesis of proteins, hence can easily express the characters. DNA, how-
ever, is dependent on RNA for synthesis of proteins. The protein synthesising machinery has evolved around RNA.
The above discussion indicate that both RNA and DNA can function as genetic material, but DNA being more stable
is preferred for storage of genetic information. For the transmission of genetic information, RNA is better.
RNA WORLD
RNA was the first genetic material. There is now enough evidence to suggest that essential life processes
(such as metabolism, translation, splicing, etc.), evolved around RNA. RNA used to act as a genetic material as
well as a catalyst (there are some important biochemical reactions in living systems that are catalysed by RNA
catalysts and not by protein enzymes). But, RNA being a catalyst was reactive and hence unstable. Therefore,
DNA has evolved from RNA with chemical modifications that make it more stable. DNA being double stranded and
having complementary strand further resists changes by evolving a process of repair.
Structure of RNA (Ribonucleic acid) :

RNA or ribonucleic acid is present in all the living cells. It is found in the cytoplasm as well as nucleus.
Sugar in RNA is ribose sugar. Phosphoric acid is similar to that present in DNA. Purine bases are adenine
and guanine but pyrimidine bases are cytosine and uracil (thymine being replaced by uracil).
Types of RNA :
RNA is generally involved in protein synthesis but in some viruses, it also serves as a genetic
material. Therefore two major types of RNA are as follows.
(a) Genetic RNA (b) Non-genetic RNA.
(a) Genetic RNA : H. Frankle-Conrat (1957) showed that RNA present in TMV (Tabacco Mosaic Virus)
is genetic material. RNA acts as a genetic material in most plant viruses.
(b) Non-genetic RNA : This type of RNA is present in cells where DNA is genetic material. Non-genetic
RNA is synthesized on DNA template. It is of following three types.
(i) Messenger RNA (mRNA) : It carries genetic information present in DNA. mRNA constitutes about 5-
10% of the total RNA present in the cell. The molecular weight varies from 25,000 to 1,00,000.
(ii) Ribosomal RNA (rRNA) : It is most stable type of RNA and is found associated with ribosomes. It
forms about 80% of the total cell RNA. The molecular weight varies from 35,000 to 10,00,000.

FOR AIIMS
(iii) Transfer RNA (tRNA) : It is also known as soluble RNA (sRNA).
These are the smallest molecules which carry amino acids to the site of protein synthesis.There are
approximately 80 bases. These constitute about 10-15% of the total cell RNA. The molecular weight of
tRNA varies from 23,000 to 30,000.
Structure of t-RNA :
Two dimentional clover leaf model of t-RNA was proposed by Holley, (1965). tRNA molecule appears
like a clover leaf being folded with three or more double helical regions, each having loop.
(i) Anticodons loop : It has 7 bases out of which three bases form anticodon (nodoc) for recognising and
attaching to the codon of mRNA.
(ii) AA-Binding Site : It is amino acid binding site. The site lies at the 3’ end opposite the anticodon and
has CCA–OH group. The 5’ end bears G. Amino acid or AA-binding site and anticodon are the two
recognition sites of tRNA .
(iii) T C Loop : It has 7 bases out of which (Pseudouridine) and rT (ribothymidine) are unusual
bases.The loop is the site for attaching to ribosome.
(iv) DHU Loop : The loop contains 8– 12 bases. It is largest loop and has dihydroxyuridine. It is binding
site for aminoacyl synthetase enzyme.
(v) Extra Arm : It is a variable side arm or loop which lies between T C loop and anticodon. It is not
present in all tRNAs. The exact role of arm is not known. The three dimensional structure of this
tRNA was, however, found to be characteristic L-shaped by Kim (1973).

S.No DNA RNA
1 It usually occurs inside nucleus and some cell Very little RNA occurs inside nucleus.
organelles. Most of it is found in the cytoplasm.
2 DNA is the genetic material. RNA is not the genetic material except in
certain viruses, e.g. Reovirus.
3 It is double stranded with the exception RNA is single stranded except in certain viruses,
of some viruses (e.g. psi × 174) double stranded Reovirus.
4 DNA contains over a million nucleotides. Depending upon the type, RNA contains
70-12000 nucleotides.
5 DNA is of only two types; intra-nuclear and There are at least three types of RNAs– mRNA,
extra-nuclear. rRNA and tRNA.
6 It contains deoxyribose sugar. It contains ribose sugar.
7 Nitrogen base thymine occurs in DNA alongwith Thymine is replaced by uracil in RNA The other
three others–adenine, cytosine and guanine. three are similar – adenine, cytosine and
guanine.
8 It replicates to form new DNA molecules. It cannot normally replicate itself. RNA
DNA transcribes genetic information to RNA. translates the transcribed message for
forming polypeptides.
9 DNA control metabolism and genetics. It only controls metabolism under
including variation. instruction from DNA.
10 Purine and pyrimdine bases are in equal number. There is no proportionality between number of
purine and pyrimidine bases.
Replication of DNA :
The synthesis of DNA from DNA is called Replication.
It usually occurs during S-phase of cell cycle.
DNA performs two types of functions
(A) Autocatalytic : DNA synthesizes new DNA by replication,
(B) Heterocatalyic : DNA helps in the synthesis of other substances like RNA, protein.
According to Delbruck, DNA replication is of three types.
(1) Dispersive : Old structure undergoes fragmentation. Fragments synthesise complementary structures,
both of which assemble randomly to form two replicase.
(2) Conservative : A New structure is formed over the template of old structure (conserved)
(3) Semiconservative : One half is parent structure and one half new structure in each replica. It was
firstly suggested by watson and crick (1953).
Taylor (1957) discovered semiconservative nature of DNA replication by the use H3 radioactive thymidine
in broad been (Vicia faba).
Meselson and stahl (1958) proved that DNA replication is semiconservative. They performed an
experiment on E. coli.
They cultured E. coli bacteria in culture medium containing N15H4Cl (Heavy isotope of N as N15) for several
generations.
Now they introduced labelled Bacteria in another culture medium contain N14 H4 Cl (Normal N14).
Now they used density gradient centrifugation method with CsCl2 (ceasium chloride) to examine DNA
of its offsprings.
They found that DNA was intermediate type in first generation in which one strand was heavy (containing
N15) and other strand was light (containing N14).
Second generation of bacteria contained two types of DNA, 50% light (N14N14) and 50% intermediate
(N 15N 14).
In third generation of bacteria contained 25% intermediate (N15N14) and 75% light (N14N14) in 1 : 3
ratio and fourth generation bacteria contained 12.5% N15N14 and 87.5% N14N14 DNA in 1 : 7 ratio.
Figure : Semi-conservative replication of DNA (Results of experiment of Meselson & Stahl)
Mechanism of DNA Replication :

(1) Origin of Replication :
It starts at a particular place called origin of replication or Ori. In prokaryotes replication starts at one
point & entire DNA strand takes part in replication thus it contains single replicon while in Eukaryotes
several replicons present.
DNA replicaton is bidirectional, semidiscontinuous and semiconservative in eucaryotes .
(2) Activation of Deoxyribonucleotides :

The phosphorylated nucleotides (deAMP, deGMP, deCMP , deTMP) are found in inactivated form. they
react with ATP in the presence of phosphorylase enzyme & converted in to active deATP, deGTP, deCTP
, deTTP.
(3) Exposure of DNA helix :
Helicase enzyme acts over the ori site of DNA template and unwinds the two strands of DNA.
SSB (single stranded binding) Protein prevents the recoiling of uncoiled DNA strands.
Topoisomerase cause nicking of one strand of DNA (for removing coils) and resealing the same. Along
with Topoisomerase, bacteria possess another enzyme called DNA Gyrase which can introduce negative
supercoils.
Whole of the DNA does not open in one stretch due to very high energy requirement but the point of
separation proceeds slowly from one end to other . It gives the appearance of Y-shaped structure called
replication fork.
(4) RNA Primer :

It is small strand of RNA (5–10 nucleotide). It is synthesized at 5’end of new strand with help of enzyme
Primase. Formation of RNA primer constitutes the initiation phase of synthesis because without the
presence of RNA primer, DNA polymerase can not add nucleotides.

Point of remember
In eukaryotes, the function of primase is carried out by enzyme DNA polymerase.
(5) DNA Polymerase :

Prokaryotes possess three types of DNA synthesising enzymes called DNA polymerases III, II and I
they add nucleotides in 5’ 3’ direction on 3’ 5’ strand. DNA replication is mainly performed by DNA
polymerase III. DNA polymerase I is major repair enzyme where as polymerase II is minor repair enzyme.
In eukaryotes five types of DNA polymerases ( have been reported. out of them
are major enzymes. According to sugino et al, DNA polymerase acts at both the leading and lagging
strands and initiates DNA synthesis along with primase activity while DNA polymerase are involved in
elongation of the leading and lagging strands respectively.
(6) Base Pairing :
Two separated strands of DNA in the replication fork function as template.
Deoxyribnucleoside triphosphates come to lie opposite the nitrogen bases of exposed DNA
templates – deTTP opposite-A, deCTP opposite G, deATP opposite T and deGTP opposite C.
With the help of pyrophosphatase enzyme the two extra phosphates present on the dexyribonucleotides
separate. Energy is released in this process that is utillized for base pairing.
Energy is used in establishing hydrogen bonds between the free nucleotides and nitrogen bases of
templates.
(7) Chain formation :
It requires DNA polymerase III in prokaryotes and polymerase δ/ in eukaryotes. DNA polymerase
III is a complex enzyme having seven subunits ( ).
In the presence of Mg++, ATP/ GTP, TPP and DNA polymerase -III, the adjacent nucleotides attached to
nitrogen bases of each template DNA strand establish phosphodiester bonds and get linked to form

replicated DNA strand. Two strands of DNA run antiparalled to each other.
Replication on one DNA template is continuous in 5’ 3’ direction due to opening of its 3’ end this newly
formed strand is called leading strand.
On the second DNA template the replication of DNA is discontinuous due to opening of small stretch of
fork at a time. Small fragments deposite with the help of RNA primer. these fragements are called okazaki
fragements (1000 - 2000 nucleotides in prokaryotes and 100–200 in eukaryotes).
After deposition of each okazaki fragment RNA primer is released and gap is filled by the activity of DNA
polymerase thus the new strand is formed called Lagging strand.
After deposition of bases DNA Ligase enzyme seals these bases.
Thus one strand grows continuously while the other strand is formed discontinuously hence DNA replication
is semidiscontiuous.
(8) Proof reading and DNA repair:

Sometimes wrong base is deposited in the strand. DNA poymerase III is able to check this error and
removes the wrong base. It allows addition of proper base but DNA polymerase III can not distinguish
uracil from thymine such an error is corrected by number of enzymes.
DNA polymerase I removes the wrong base and attaches the correct base in the strand in Prokaryotes
where as DNA polymerase in eukaryotes.
One gene–One enzyme hypothesis :
Archibald garrod (1909) : He stated that diseases inherited from parents are inborn error of metabolism.These
are due to defect in a single enzyme that catalyzes a particular reaction.
Beadle and Tatum, (1948) Proposed One gene–One enzyme hypothesis. They conducted experiments
on the nutrition of pink mould (Neurospora crassa). This fungus grows on simple nutrient medium and
has the ability to synthesize all its cellular components. Such an organism is called prototroph.
An organism that is unable to synthesize a particular cellular component such as an amino acid or coenzyme
is called auxotroph.

Beadle and tatum produced arginine (an amino acid) auxotrophs (mutants of Neurospora unable to
synthesize arginine).
Arginine synthesis passes through the following path-
Ammonia + Sugar Enz A Ornithine Enz B Citrulline Enz C Arginine
They found that any step of this metabolic chain could be blocked by a mutation in a specific enzyme
catalyzing the reaction, each enzyme representing a different gene product. Thus Beadle and Tatum
reached a conclusion that each gene regulates the synthesis of a single enzyme. This laid the foundation
of biochemical genetics. Beadle and tatum were awarded Nobel Prize in 1958.
One gene–one polypeptide Hypothesis :
Yanofsky et al (1965) : proposed one gene–one polypeptide hypothesis He stated that a structural gene
regulates the synthesis of a single polypeptide. Haemoglobin is composed of two and two polypeptides
synthesised by two separate genes.
One gene–one Function Hypothesis :

A gene or cistron (It is a part of DNA composed of stretch of deoxyribonucleotides that codes for a
biochemical controlling other cistrons, rRNA, tRNA or polypeptide through mRNA) performs one function,
structural or regulatory.
Transcription :
Synthesis of RNA from DNA is called transcription.
One of the two strands of DNA takes part in transcription. According to Lewin (2000) transcription takes
place at anti sense strand or – strand.
Transcription Unit : The part of DNA which takes part in transcription is called transcription unit. The
latter has three components.
(i) Promoter (ii) Structural gene (iii) Terminator
Promoter is situated upstream of structural gene at 5’ end of coding strand where as terminator at downstream
of structural gene at 3’ end of coding strand. Promoter bears different parts for attachment to various
transcription factors. In most of the cases, the promoter contains AT rich regions called TATA box.The
latter has groove for the attachment of specific protein. TATA box is also called Pribnow box.

Structural gene is a part of strand of DNA having 3’ 5’ polarity on which transcription proceeds only in
5’ 3’ direction of new strand. This strand of DNA is called template strand or master strand or
antisense, or (–) strand. The other strand is nontemplate strand that does not take part in transcription
is also also called sense or coding strand or plus (+) strand.
Mechanism of Transcription :
It takes place in G1 and G2 phases of interphase of cell cycle in the nucleus in eukaryotes where as in
prokaryotes it occurs in the cytoplasm.
Single RNA polymerase enzyme performs transcription in Prokaryotes. The former consists of ’
’, and factors.Out of them (sigma) factor recognizes the site of transcription on the promoter
region of DNA template and resting part of enzyme is called core enzyme.
In Eukaryotes, Three types of RNA polymerase involve in the synthesis of three different types of RNA.
(i) RNA polymerase : I - synthesizes - r - RNA (28S, 18S, 5·8S).
(ii) RNA polymerase : II - synthesizes - Precursor of m - RNA and Sn RNA.
(iii) RNA polymerase : III - synthesizes - t - RNA, 5S RNA & Sn RNA.
Ribonucleoside mono Phosphates - UMP, AMP, CMP and GMP react with ATP in the presence of enzyme
phosphorylase to form active UTP, ATP, CTP and GTP.
Cistron : Prokaryotes bear polycistronic RNA and Eukaryotes bear monocistronic RNA.
Helicase enzyme performs uncoiling of DNA strands. SSB prevents their recoiling.
Sigma factor binds on TATA box on the promoter region of master strand.
UTP comes to lie opposite to the A, GTP opposite C, CTP opposite to G, ATP opposite to T. At this time
pyrophosphatase separates two groups from each Ribonucleoside triphosphate resulting they are converted
into UMP, GMP, CMP, AMP during deposition on master strand.
Core enzyme proceeds transcription from promotor region towards terminator region. Sigma factor is
released.
When the chain of RNA reaches at terminator region, rho factor factor) prevents its synthesis by
ATPase activity resulting newly synthesized RNA becomes separated. Which is called Primary transcript
or Hn RNA (Heterogenous RNA).

After separation of RNA, Both strands of DNA are again coiled for duplex formation.
Processing of Hn RNA or Primary Transcript :

It involves following methods.
(i) Cleavage : Ribonuclease – P enzyme cleaves 5–7 bases of primary transcript & the latter may form
t–RNA precursors.
(ii) Splicing : In eukaryotic primary transcript, Introns have no information about protein synthesis.
SnRNA (Small nuclear RNA) combines with some peptides to form small nuclear Ribonucleo protein or
snurp. The latter combines with some peptides to form spliceosome.
Spliceosomes cut the introns of primary transcript and the exons of primary transcripts are joined by RNA
ligase & thus active m–RNA is formed.
(iii) Terminal addition :

It involves addition of some nucleotides at the terminal part of Primary transcript for example – CCA
sequence is added on 3’ end of t-RNA, Poly A is added on 3’ end of hn–RNA in tailing or polyadinylation,
In capping, 7– methyl guanosine (formed by modification of GTP) is added on 5’ end of hn–RNA.
(iv) Nucleotide modification :

Nucleotides are methylated, ethylated or deaminated Ex: Inosine, methylcytosine, Methylguanosine,
dihydrouracil, Pseudouracil.
point of remember
(1) Ochoa (1967) firstly performed In vitro synthesis of RNA.
(2) Kornberg firstly performed In vitro synthesis of DNA polymerase .
Genetic code :
It represents relationship of sequence of Amino acids in polypeptide and sequences of nucleotides of
mRNA/DNA.
Genetic code was discovered by Nirenberg and Matthaei.
Crick (1961) stated that deletion or addition of one or two bases in DNA disturbs the DNA functioning.
Nirenberg and Matthaei argued that single codon can specify four aminoacids (41 = 4) Double codon
can specify 42 = 16 aminoacids that are not sufficient for the coding of essential 20 amino acid. Triplet
codon can specify 43 = 64 aminoacids. That are sufficient for 20 amino acids.
George gamow gave concept of Triplet codon. He also coined the term Genetic code.
Features of genetic code :
(i) Triplet codon : Genetic code is Triplet codon composed of three adjacent nitrogen bases.
Codon - A sequence of three nucleotides specifying an amino acid
(ii) Start signal or Initiation codon : It is mostly AUG (Methionine codon). But in prokaryotes it can
be GUG and UUG (Lewin 2000), In all cases they specify Methionine. GUG and UUG specify different
amino acids inside the polypeptide chain (GUG - Valine, UUG- Leucine).
(iii) Stop signal or Termination codon : Polypeptide chain termination is signalled by three termination
codon UAA (ochre), UAG (Amber) and UGA (opal). they do not specify any amino acid and hence
are called non sense codons.

(iv) Non ambiguous codon : Normally one codon specifies only one amino acid and not any other.
(v) Non overlapping code : A nitrogen base is a constituent of only one codon.
(vi) Universal code : A codon specifies the same amino acid in all organisms from virus to human.
(vii) Commaless : There are no pauses so that genetic code reads continuously. If a nucleotide is deleted
or added, the whole genetic code will read differently.
(viii) Colinearity : The sequence of codons of DNA/mRNA correspond to the sequence of amino acids in
a polypeptide.
(ix) Related codons : Amino acids with similar properties have related codons Ex: aromatic amino acids
tryptophan (UGG), Phenylalanine (UUC, UUU), and tyrosine (UAC, UAU).
(x) Degeneracy of codons : Since there are 64 triplet codons and only 20 amino acids, the incorporation
of some amino acids is influenced by more than one codon only Tryptophan (UGG) and Methionine
(AUG) are specified by single codons. All other amino acids are specified by 2–6 codons. The latter
are called degenerated codons.
Wobble hypothesis (crick, 1966) : In degenerated codons the first two nitrogen bases are similar while the
third one is different. The third nitrogen base has no effect on coding actually 5’ end base of t-RNA
anticodon is able to wobble and get paired with even noncomplementary base of m-RNA
Ex: CCA, CCC, CCG, and CCU all specify amino acid proline.
Central dogma :
It is the unidirectional flow of information that proceeds from DNA to mRNA and then decoding information
present in m-RNA in the formation of polypetptide chain or protein (translation).
DNA transcript ion mRNA translatio n Polypeptide

(Protein)

The concept of central dogma was proposed by crick in 1958.
Commoner (1968) propounded concept of circular flow of information (from DNA RNA Protein
RNA DNA).
Reverse transcription :
Temin and Baltimore (1970) reported that retroviruses operate a central dogma reverse
(Inverse flow of information). RNA of these viruses first synthesises DNA through reverse transcriptase
or RNA dependent DNA polymerase. This DNA synthesized on RNA template is called c-DNA or
Retroposon.
RNA c-DNA RNA Protein

Protein synthesis :
Mechanism of Protein Synthesis (Translation) : According to the coded information of m-RNA the
formation of polypeptide over ribosome is called translation.
It involves following steps

(1) Activation of Amino acid : Specific Amino acid reacts with ATP in the presence of Amino acyl t-RNA
synthetase enzyme to form Amino acyle adenylate enzyme complex.
AA + ATP + E Mg2 AA ~ AMP – E + PPi

amino amino Pyrophosphate
acid acyl
tRNA synthetase
Now this complex combines with t-RNA to form Amino acyle t-RNA complex (Charging or Aminoacylation
of tRNA) That is also called charged t-RNA. Enzyme & AMP are released.
AA ~ AMP – E + t RNA AA -t RNA + AMP + E.
(2) Synthesis of polypeptide chain : It involves following steps.
(i) Initiation of polypeptide chain :

In prokaryotes IF3, IF2, IF1, - Initiation factors are required for initiation of polypeptide chain, whereas
in eukaryotes eIF2, eIF3, eIF1,eIF4A, eIF4B, eIF4C, eIF4D, eIf5, eIF6 are required..
m-RNA is fused with P-site of small subunit 40S of ribosome (30 S in procaryote) in the presence of eIF2
to form 40 S mRNA complex (30 S mRNA complex forms in the presence of IF3).
Now 40 S mRNA complex attracts Amino acyl t- RNA Complex both fuse to form 40 S m RNA + t RNAmmet
complex (30 S m RNA + t RNAfmet complex in prokaryotes in the presence of IF2 & GTP) in the
presence of eIF3 and GTP.
Now this complex is fused with large subunit 60 S of ribosome (50S in prokaryotes) on RER to form 80 S
mRNA t- RNA complex in the presence of eIF1, eIF4A, eIF4B, eIF4C, (70 s m RNA tRNA complex in the
presence of IF1).
The 0·001M concentration. of Mg++ ions is required for the formation of intact ribosome.
At this time P site and complex are covered by Ribosome now its A site is exposed at the front of next
codon of mRNA.
(ii) Elongation of Polypeptide chain :

Now Amino acyl t RNA complex reaches on A side due to stimulation of Elongation factors (eEF1 in
eucaryotes and EF TU / EF TS in Procaryotes).
Now Peptidyl transferase (Ribozyme) enzyme stimulates the fusion of Amino acids of both complexes.
In this process - COOH (carboxylic group) group of amino acid of complex of P-site and – NH2 group
(Amino group) of amino acid of complex of A-site are fused to form CO – NH bond or peptide bond
in the presence of peptidyl transferase and GTP.
After this process t- RNA of P site breaks and slips away and the dipeptide complex moves on A- site due
to translocase enzyme (EF-G in prokaryotes and eEF2 in eukaryotes). Ribosome or m-RNA rotates
slightly this movement is called translocation. As a result dipeptide complex is shifted on p-site and the A-
site is again exposed at the front of next codon of mRNA.
This process repeats again & again as result a long polypeptide chain is formed
(iii) Termination of polypeptide chain :

When termination codons UAA or UAG or UGA is exposed on m-RNA. It has no information about AA t-
RNA complex therefore elongation of polypeptide chain is stopped.
GTP based releasing factors require for the activation of termination codons. RF (eRF1) in eukaryotes and
RF1 (specific for UAG and UAA) and RF2 (specific for UAA and UGA) in prokaryotes.
Important Point : An mRNA also has some additional sequences that are not translated and are referred as
untranslated regions (UTR). The UTRs are present at both 5' -end (before start codon) and at 3' -end (after
stop codon). They are required for efficient translation process.
Types of Genes :
(1) House Keeping Genes (Constitutive Genes) : These genes are constantly expressing
themselves in a cell because their products are required for the normal cellular activities, Ex: genes for
glycolysis.
(2) Non-constitutive Genes : (Luxury Genes) : The genes are not always expressing themselves in a
cell. They are switched on or off according to the requirement of cellular activities Ex: gene for
nitrate reductase in plants, lactose system in Escherichia coli. Non-constitutive genes are of further
two types, inducible and repressible.

(3) Pseudogenes : They have homology to functional genes but are unable to produce functional products
due to intervening nonsense codons, insertions, deletions and inactivation of promoter
regions, Ex: several of snRNA genes.
(4) Split Genes : They discovered by Sharp and Roberts (1977). Split genes possess extra or
nonessential regions interspersed with essential or coding parts. The noessential parts are called
introns or spacer DNA or interveining sequences (IVS). Essential coding parts are called exons.
(5) Transposons (Jumping Genes ) : They are segments of DNA that can jump or move from one place in
the genome to another, Transposons were first descovered by Mc Clintock (1951) in case of Maize.
The term transposon coined by Hedges and Jacob (1974).
(6) Overlapping Genes : In X 174, genes E, B and K overlap other genes.
(7) Processed Genes: These are eukaryotic genes that lack introns. Processed genes have been formed
probably due to reverse transcription by retroviruses. Processed genes are generally nonfunc
tional due to lack of promoters.
Regulation of Gene Expression :

Regulation over the functioning of genes is called regulation of gene expression. It can be exerted at four
levels.
(i) Transcriptional level during formation of primary transcript.
(ii) Processing like splicing, terminal additions or modifications.
(iii) Transport of RNAs from nucleus to cytoplasm.

(iv) Translation level.
Genes expression is of three types (1) Inducible (2) constitutive (3) repressible.
(1) Inducible : In this types the Gene is switched on in response to the presence of substrate (Inducer).
(2) Constitutive : Genes and their enzymes remain operational throughout.
(3) Repressible : It is of two types
(a) Positive Control : The product of regulatory gene initiates expression of genes under of its control.
(b) Negative control : The product of a regulatory gene switches off the expression of genes under its
control.
Operon Model :
An operon is a segment of DNA that functions as single regulated unit comprising a regulator gene, a
promoter gene, an operator gene, one or more structural genes, a repressor and an inducer or corepressor,
these systems are common in prokaryotes.
First operon lac–Operon was discovered by Jacob and Monod (1961) in E.coli.
Operons involve two types.
(1) Inducible operon model (2) Repressible operon model.
Inducible Operon Model :

It is found in catabolic pathway Ex: Lactose operon or Lac operon. Lac operon consists of following
components.
(i) Structural genes : They actually control the synthesis of m-RNA through transcription. They determine
primary structure of polypeptide chain. In Lac operon three structural gene z, y, a take part in the
formation of polycistronic mRNA that regulates the synthesis of galactosidase, permease and
transacetylase enzymes. -galactosidase hydrolyses lactose in glucose & galactose. Permease
allows the entry of Lactose in the cell. Transacetylase performs metabolism of toxic thiogalactosides.
(ii) Operator gene : It controls the activity of structural genes. When repressor of regulator gene binds to
the operator gene. the latter becomes switched off.
(iii) Promoter gene : It acts as initiation signal. It bears RNA polymerase enzyme. When operator gene
is functional, its RNA polymerase travels on structural gene and perform transcription.
(iv) Regulator gene : It regulates the synthesis of repressor . It is also called inhibitor gene or i gene.
(v) Repressor : It is proteinaceous substance formed by Regulator gene. It has two allosteric sites, one
for the attachment of operator gene and other for the attachment of inducer.
(vi) Inducer : It is chemical substance (Hormone, enzyme etc). When inducer is present in the medium,
inducer combines with repressor resulting some conformational changes occur in the repressor in such
a way that it becomes unable to bind on operator gene. therefore the latter continuously operative.
when inducer is completely consumed. Repressor is again activated. In lac-operon lactose acts as
inducer (Actual allolactose acts as inducer) & substrate.

(viii) CAP (catoabolic Activator Protein) : It exerts positive control on Lac operon but in its absence
RNA polymerase is unable to recognize Promoter gene.
Repressible Operon Model :

Repressible operon System is found in anabolic pathways. Ex:Tryptophan or trp operon of E.coli
Trp operon consists of the following components.
(i) Structural Genes : The genes are connected to transcription of mRNAs. Tryptophan operon has five
structural genes trp E, D, C, B, A. They form enzymes for five steps of tryptophan synthesis.
(ii) Operator Gene : It regulates the activity of structural genes usually. Aporepressor produced by regulator
gene is unable to completely block operator gene.
(iii) Promoter Gene : It acts as initiation signal. It bears RNA polymerase enzyme. When operator gene
is functional, its RNA polymerase travels on structural gene and perform transcription.
(iv) Other Regulatory Components : It involves two components that lie between operator gene and
structural gene E.
(a) Leader sequence (L) : It is controller of attenuator.
(b) Attenuator (A) : It helps in reducing tryptophan synthesis when it is available in sufficient amount
without switching off the operon.
(v) Regulator Gene : It produces proteinaceous component (such as Aporepressor) for possible blocking
the activity of operator gene.
(vi) Aporepressor : It is a proteinaceous substance formed by regulator gene. Independently it is unable

to block the activity of operator gene. for this purpose It requires a corepressor.
(vii) Corepressor : It is a nonproteinaceous component of repressor that may be an end product of reactions.
In trp operon, when end product Tryptophan is accumulated in sufficient amount its some molecules
act as corepressor. the latter combines with aporepressor. and forms repressor that block the operator
gene resulting structural genes become switched off. The phenomenon is called feed-back repression
that exerts a negative control.
Gene expression in eukaryotes :
In eukaryotes, functionally related genes may not be clusered together constituting an operon. The most

popular model is ‘Gene battery model’ proposed by Britten and Davidson in 1969. A set of structural
genes is controlled by one sensor site that is termed as battery.
Eukaryotes seem to have specific genes that enhance or slow down the expression of certain genes. They
According to Gene-battery model there are four classes of sequences.
(i) Producer gene : It is comparable to structural gene of prokaryotic operon.
(ii) Receptor site : It is comparable to operater gene of bacterial operon and one such receptor site is
assumed to be present adjacent to each producer gene.
(iii) Integrator gene : Integrator gene is comparable to regulator gene and is responsible for synthesis of
an activator or RNA. It activates the receptor site.
(iv) Sensor site : A sensor site regulates the activity to integrator gene. Activator gene can be transcribed
only when the sensor site is activated. These are called enhancer genes and silencer genes respectively.
Human Genome project (HGP) :

HGP is a mega project started by U.S. Department of Energy and national Institute of Health for
sequencing human genomein 1990. Welcome Trust (UK) joined the project as a major partner. Later on
japan, France, Germany, China and some other countries also joined it.
Aims of HGP :
(i) To determine the sequence of 3.2 billion base pairs of human genome
(ii) To Identify all the genes of human genome and determined their functions
(iii) To Identify those genes that are responsible for genetic disorders.
(iv) To Store this information in data bases.
(v) The project may result in many ethical, legal and social issue which must be addressed and solved.
Methodology : Two approaches have been recognized for analysing the human genome.
(i) ESTs or expressed sequence tags : To Identify all the genes that are expresed as RNA.
(ii) Sequence annotation : Sequencing both coding and noncoding regions of whole genome and
assigning the different regions with functions. The project was completed for sequencing in 2003.
However, chromosome I was last to be sequenced in May 2006.
Salient features of human Genome :

(1) Human genome contains 30,000 genes which are much lower than previous estimate of 80,000 –
10,0000.

(2) Human genome contains 3.1647 billion nucleotide base.
(3) Less than 2% of the genome shows structural genes that code for proteins.
(4) Average gene size is 3000 base pairs but size vary greatly, with the largest known human gene being
dystrophin at 2·4 million bases.
(5) Chromosome I contains 2968 genes (maximum gene) while Y-chromosome bears 231 genes
(minimum genes) in human chromosome.
(6) 99.9% of the nucleotide bases are exactly similar in all human beings.
(7) About 1.4 million locations have been reported where single nucleotide differences or SNPs
(snips) or single nucleotide polymorphism are found. They have the potential to helping and
finding chromosomal locations for disease associated sequences and tracing human history.
(8) Repeated sequences makeup very large portion of the human genome.
(9) Repeated sequences are stretches of DNA sequnces that are repeated hundred to thousand times.
They are thought to have no direct coding functions but they shed light on chromosome structure.
dynamics & evolution. Many non human organisms like, Bacteria (E. coli), yeast, Caenorhabditis
elegans, Drosophila, plants (Rice and Arabidopsis) etc have also been sequenced.
DNA Fingerprinting (DNA Profiling) :

Historical Aspect :
Sir Alec jeffreys (1984) discovered the DNA fingerprinting technique. Dr. K. kashyap and Dr. Lalji Singh
started the fingerprinting technology in India.

What is DNA-fingerprinting : It is a technique to identify a person on the basis of his//her DNA specificity.
Principle of DNA Fingerprinting : Jeffreys observed that DNA of each individual contains some noncistronic
hyper-variable repeat minisatellite sequences. These repeat minisatellite sequences are called variable
number of tandem repeats or VNTRs (These are also called minisatellites). The numbers of repeat
show very high degree of polymorphism. As a result the size of VNTR varies in size from 0.1 to 20 kb.
These sequence show high degree of polymorphism and form the basis of DNA fingerprinting. Since DNA
from every tissue (such as blood, hair-follicle, skin, bone, saliva, sperm etc.), from an individual show the
same degree of polymorphism.
What is DNA polymorphism ?

DNA Polymorphism (variation at genetic level) arises due to mutations OR if an inheritable mutation is
observed in a population at high frequency, it is referred to as DNA polymorphism (frequency greater than
0.01)
The latter are similar only in monozygotic twins and vary in number from person to person. These repeats
are inherited in the offsprings by their parents.These are used as genetic markers in a personal identity
test. One half of VNTR alleles of the offspring resemble that of the mother and other half that of the father.
* Inheritable mutation is observed in a population at high frequency, it is referred to as DNA
polymorphism.
Technique of DNA fingerprinting :
(i) The DNA is isolated from the nuclei of white blood cells or spermatozoa or the hair follicle cells.
(ii) Restriction endonuclease enzyme performs digestion of DNA molecules. The former cuts DNA in to
fragements. The fragments of DNA also contain the VNTRs.

(iii) Gel electrophoresis is used to separate these fragments according to their size.
(iv) VNTRs are multiplied through PCR technique. The VNTRs are treated with alkaline chemicals to split
them into single stranded DNAs.
(v) SS DNA fragments of the gel are shifted onto a nylon paper/nitrocellulose membrane by southern
blotting technique.
(vi) Radioactive SS-DNA-probes are used for hybridization with VNTR on the nylon membrane.
(vii) Now the nylon membrane is exposed at the front of X-ray film and mark the places where the
radioactive DNA probes have bound to the DNA fragements. These places are marked as dark bands
when X-ray film is developed. This is known as autoradiography.
(viii) The dark bands on X-ray film show the DNA fingerprints.
Applications of DNA Fingerprinting :

(i) It is very useful in the detection of crime and illegal pursuits.
(ii) Paternity maternity disputes can be solved by DNA fingerprinting.
(iii) It can be used to study the breeding patterns of animals facing the danger of extinction.
(iv) It provides information about relationship of man with apes.

(v) It determining population and genetic diversities.
Figure : Schematic representation of DNA fingerprinting : Few representative chromosomes have been
shown to contain different copy number of VNTR. For the sake of understanding different colour schemes
have been used to trace the origin of each band in the gel. The two alleles (paternal and maternal) of a
chromosome also contain different copy numbers of VNTR. It is clear that the banding pattern of DNA from
crime scene matches with individual B, and not with A.

Read & Digest
(i) Palindromic DNA : DNA duplex have areas where sequence of nucleotides is the same but
opposite in the two strands.
(ii) Repetitive DNA : Type of DNA containing multiple copies of indetical squences of nitrogen bases.
Repeated sequences account for more than 50% of the human genome. Repetitive DNA is inert in
the synthesis of RNA, i.e it is heritable but does not transcribe and translate into any protein.
(iii) Satellite DNA : It is a part of repetitive DNA that has long repetitive nucleotide sequences in tanden
that forms a separate fraction on density ultracentrifugation. satellite DNA is of two types.
(a) Microsatellite sequences 1– 6 bp repeat units flanked by conserved sequences.
(b) Minisatellite sequences 11– 60 bp flanked by conserved restriction sites. these are hypervariable
and are specific for each individual. They are used in DNA finger printing.
(iv) Antisense Therapy : Excess of anti-mRNA or antisense RNAs will not allow the pathogenic genes
to express themselves. It is used for curing AIDS, cancers and other diseases.
(v) Artificial Gene : Khorana et al (1968) synthesised first artificial gene It was alanine It was alanine
-t-RNA gene with 77 base pairs. It was non functional in living system. in 1979 he prepared
tyrosine-tRNA gene with 207 base pairs. It was functional.
(vi) Seymour Benzer : He stated that gene involves three units (1) cistron, (2) recon (3) muton
(vii) Ribozymes : These are RNA molecules showing catalytic activity. Cech et al discovered in ciliated
protozoan - Tetrahymena thermophila.
(viii) snRNA (Small Nuclear RNA) : Small sized RNA that is found in nucleus. Each RNA is combined
with 7–8 molecules of proteins and form small nuclear ribonucleoprotein or snRNP (snurp). The
latter takes part in splicing (U1 and U2), rRNA processing (U3) and mRNA processing (U7).
(ix) scRNA (small Cytoplasmic RNA) : Small sized RNA that lies freely in the cytoplasm. SRP or
signal recognition particle is formed by the fusion between 7S small cytoplasmic RNA and 6 protein
molecules. The former helps in taking and binding a ribosome to endoplasmic reticulum for producing
secretory proteins.
(x) Denaturation and Renaturation : In the presence of higher temperature (Tm 82–90ºC) or low or
high pH, the H-bonds between nitrogen bases of two strands of DNA can break . It is called
denaturation. The DNA strands separated by melting at Tm 82–90ºC can reassociate and form
duplex on cooling to temperature at 65ºC. It is called renaturation or annealing.
(xi) Hotspots : At these place of DNA/chromosomes where frequency of mutation and recombination
are very much increased.
(xii) Cryptogram : A method of expressing in a standard form of a collection of data used in
classification
(xiii) Punctuation Codons : They are four in number, Three represent termination of polypeptide
synthesis, viz UAA, UAG and UGA. AUG is initiation codon.
(xiv) C-Value : Total amount of DNA present in single genome.

Type (I) : Very Short Answer Type Questions : [01 Mark Each]
1. A diploid organism is heterologous for four loci. How many types of gametes can be produced?
2. Name the scientists who rediscovered Mendel's principles of inheritance?
3. Define DNA fingerprinting.
4. What are variable Number of Tandem Repeats or VNTRs?
Type (II) : Short Answer Type Questions : [02 Marks Each]
5. When a cross is made between tall plant with yellow seeds (TtYy) and a tall plant with green seeds (Ttyy).
What proportion of phenotype in an offspring could be (a) tall green (b) dwarf green
6. A child has blood group O. If father is of group A and mother of blood gorup B, work out the genotypes of
the parents and find out the expected genotypes of other offspring.
7. If the sequence of coding strand in a transcription unit is written as follows :
5' – ATGCATGCATGCATGCATGCATGCATGC – 3', Write down the sequence of m-RNA.
8. Explain (in one or two lines) the functions of the following
(a) Promoter (b) tRNA (c) Exons.
Type (III) : Long Answer Type Questions: [03 Mark Each]
9. How did Hershey and Chase differentiate between DNA and protein in their experiment while Proving that
DNA is the genetic material.
10. Why is the Human Genome project called a mega project
11. Consider DNA molecules which contain most of its nitrogen in the form of N15 (heavy isotope). Such
molecules are allowed to replicate in an environment, where the nitrogen source is N 14. What will be the
proportion of the DNA molecules that will contain some N15 after : (a) one round of replication : and (b) two
rounds of replication?
Type (IV) : Very Long Answer Type Questions: [05 Mark each]
12. Describe the process of DNA replication.
OR
In the above diagram, choose the correct combination of labelling in transcription.
NEET_GENETICS - 68
OBJECTIVE QUESTIONS

INTRODUCTION, MENDELISM, TERMINOLOGY
1. Different forms of a gene are called
(1) Heterozygotes (2) Alleles
(3) Complementary genes (4) Supplementary genes
2. The word “Genetics” coined by
(1) Mendel (2) Johannsen (3) Bateson (4) Morgan
3. Mendel’s conclusion first published in
(1) Journal of plant breeding (2) Journal of genetics & plant breeding
(3) Nature forschender verien (4) None
4. When a plant have two alleles of contrasting characters it is called
(1) Homozygous (2) Dioecious (3) Heterozygous (4) Monoecious
5. The year 1900 AD is highly significant for geneticists due to the
(1) Discovery of genes (2) Principle of Linkage
(3) Mendelian rediscovery (4) Chromosome theory of heredity
6. Who rediscovered the results of mendel’s experiments
(1) Devries, Tschermak, Correns (2) Devries, Tschermak, Morga
(3) Tschermak, Morgan, Correns (4) Tschermak, Bateson, Punnet,
7. An individual with two identical alleles of a pair of genetic factors is called
(1) Heteromorphic (2) Heterozygote (3) Homomorphic (4) Homozygote
8. How many character of pea pod were chosen by mendel
(1) 7 (2) 2 (3) 4 (4) 3
9. How many characters of pea were chosen by mendel.
(1) Three (2) Two (3) One (4) Seven
10. An organism with two identical alleles is called
(1) Dominant (2) Hybird (3) Heterozygous (4) Homozygous
11. Genotype is
(1) Genetic composition of an organism (2) Genetic composition of plastids
(3) Genetic composition of germ cells (4) None of the above
12. Genetic constitution of an individual is represented by
(1) Genome (2) Genotype (3) Phenotype (4) Karyotype
13. Genes do not occur in pairs in
(1) Zygote (2) Somatic cell (3) Endosperm cell (4) Gametes
14. One of the following did not constitute the seven contrasting pairs of characters selected by mendel
(1) Height of the plants (2) Shape of the leaves (3) Shape of pod (4) Colour of pod
NEET_GENETICS - 69
15. In Medelian genetics one of the following character is the dominant.
(1) Green colour of pods (2) Green colour of seeds
(3) Terminal flowers (4) Wrinkled seeds
16. Group of genes present in an ecosystem is called
(1) Genotype (2) Genepool (3) Genome (4) Phenotype
17. How many genome types are present in a typical green plants cell
(1) Two (2) Three (3) More than five (4) More than ten
18. When the genotype of an organism is improved by the addition of foreign genes the process is called
(1) Biotechnology (2) Tissue culture (3) Genetic engineering (4) Genetic diversity
19. Who is concerned with law of inheritance
(1) Bateson (2) Mendel (3) Punnett (4) H. Khorana
20. Mendel was not able to say anything about recombination and crossing over because
(1) He did not have a large strong microscope
(2) He chose only pure types
(3) Traits he chose were not linked and present on different chromosomes or were far apart
(4) traits he chose had no genes.
21. During breeding the removal of anthers from a flower is called
(1) Anthesis (2) Pollination (3) Emasculation (4) Vasectomy
22. Pea plants were more suitable than cattle for Mendel’s eperiment because :-
(1) There were no breeding records of cattles
(2) pea plants can be self-fertilised
(3) Cattles are not easy to mantain
(4) All pea plants have 2X chromosmes and fewer genetic traits
23. Organisms with two or more than two types of genotypes in their tissues are called
(1) Wobble (2) Heterozygous (3) Heterosis (4) Chimera
MONOHYBRID CROSS, DIHYBRID CROSS, BACK CROSS, TEST CROSS,

INCOMPLETE DOMINANCE, CODOMINACE
24. Phenotypic ratio 3 :1 proves
(1) Dominance (2) Segregation (3) Crossing-over (4) Indepenent assortment
25. What is the ratio of one pair of contrasting characters in F2 of a dihybrid corss
(1) 5: 3 (2) 3:1 (3) 9: 3 : 3 : 1 (4) 1: 2: 2: 4 : 1: 2 : 1 : 2 : 1
26. What is ratio of homozyous plants for both dominant characters in F2 of a dihybrid cross
(1) 1/16 (2) 3/16 (3) 4/16 (4) 9/16
27. Types of genotypes in F2 generation of dihybrid cross are
(1) 4 (2) 16 (3) 8 (4) 9
28. A pure tall plant can be differentiated from a hybrid tall plant
(1) By measuring length of plant (2) By spraying gibberallins
(3) If all plants are tall after self-pollination (4) If all plants are dwarf after self-pollination
NEET_GENETICS - 70
29. Genotypic ratio in F2 progeny of dihybrid cross is
(1) 1 : 2 : 1 (2) 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1
(3) 12 : 3 : 1 (4) 15 : 1
30. When a heterozygous dominant is crossed with homozygous recessive than ratio of progeny will be.
(1) 1 : 2 (2) 2 : 1 (3) 3 : 1 (4) 1 : 1
31. Independent assortment can be proved by
(1) Back cross (2) Test cross (3) Monohybrid cross (4) Dihybrid cross
32. If a cross is made between Aa TT and aatt where A stands for red dominant and T for tall dominant, what
will be the percentage of red tall plants.
(1) 25% (2) 50% (3) 75% (4) 100%
33. Crossing AABB & aabb, the ratio of AaBb would be in F2 generation.
(1) 1 / 16 (2) 2 / 16 (3) 8 / 16 (4) 4 / 16
34. In a dihybrid cross between AABB and aabb the ratio of AABB, AABb, aaBb, aabb in F2 generation is
(1) 9 : 3 : 3 : 1 (2) 1 : 1: 1 : 1 (3) 1 : 2 : 2 : 1 (4) 1 : 1: 2 : 2
35. The cross between recessive to it’s hybrid or it’s F1 plant is called.
36. How many types & in what ratio the gametes are produced by a dihybrid heterozygous.
(1) 4 types in the ratio of 9 : 3 : 3 :1 (2) 2 types in the ratio of 1 : 2 : 1
(3) 3 type in the ratio of 1 : 2 : 1 (4) 4 types in the ratio of 1 : 1 : 1 : 1
37. 120 Plants are produced on crossing pure red and pure white flowered pea plants, the ratio is
(1) 90 Red : 30 White (2) 30 Red : 90 White (3) 60 Red : 60 White (4) All Red
38. In snapdragon, when a red flower plant is crossed with a white flower ones, The resultant hybrid plant
have pink coloured flower if plant of F1 generation is crossed with a white flower ones, the progeny will be.
(1) 10% Red. (2) The Red flower & White flower ratio in 3 : 1
(3) The pink flower & White flower ratio in 1 : 1 (4) The pink, Red and White flower ratio in 1 : 2 : 1
39. A Heterogamous tall plants produces tall and dwarf plants after selfing. This conforms the Mendel’s law
called as
(1) law of dominance (2) Law of segregation
(3) Law of purity of gametes (4) Law of independent assortment
40. Mendel formulated the law of purity of gametes on the basis of
(1) Di hybhrid cross (2) Monohybrid cross (3) Back cross (4) Test cross
41. Medel’s law of segregation is based on separation of alleles during.
(1) Gamete formation (2) Seed formation (3) Pollination (4) Embryonic development
42. A cross between black and white birds results in blue birds in F1 generation and then cross between blue
in F1 generation would result in
(1) 3 blue : 1 white (2) 1 blue : 1 black : 1 white
(3) 9 blue : 3 back : 3 white (4) 1 black : 1 white : 2 blue
43. What is the ratio of a progeny of cross between F1 heterozygous and recessive
(1) 3 : 1 (2) 1 : 2 : 1 (3) 1: 1 (4) 2 : 1
NEET_GENETICS - 71
44. Mendel enunciated how many principles of inheritance
(1) One (2) Two (3) Three (4) Four
45. On crossing red & white flowered plants the ratio of red and white flowered plants in F2 generation was
60 : 20, then on selfing of the heterozygous red flowered plants, the ratio of red & whit flowered offsprings
would be
(1) 72 : 24 (2) 40 : 60 (3) 52 : 48 (4) 84 : 16
46. Mendelian monohybrid ratio is
(1) 1 : 2 : 1 (2) 3 : 1 (3) 9 : 3 : 1 (4) 9 : 3 : 4
47. In monohybrid cross what is the ratio of homozygous dominant and homozyguos recessive individuals in
F2– generation
(1) 1 : 2 : 1 (2) 2 : 1 / 1 : 2 (3) 3 : 1 / 1 : 3 (4) 1 : 1
48. When two hybrids Ttrr & Rrtt are crossed the phenotypic ratio of offspring shall be
(1) 3 : 1 (2) 1 : 1: 1 : 1 (3) 1 : 1 (4) 9 : 3 : 3 : 1
49. How many plants are dihybrid in F2 generation of dihybrid cross
(1) One (2) Two (3) Four (4) Sixteen
50. An offspring of two homozygous parents differing from one another by alleles at only one gene locus is
known as
(1) Back cross (2) Monohybrid (3) Dihybrid (4) Trihybrid
51. A useful process for determining whether an individual is homozygous or heterozyous is
(1) Cross-breeding (2) Self fertilization (3) Back-crossing (4) Test cross
52. When AABBcc is crossed with AaBbCc then the ratio of hybrid for all the three genes is
(1) 1/8 (2) 1/4 (3) 1/16 (4) 1/32
53. If selfing occurs in the plant having genotype RrYy, then ratio of given genotype will be :- RRYY, RrYY
RRYy, RrYy
(1) 1 : 2 : 2 : 4 (2) 1 : 2 : 2 : 1 (3) 1 : 1 : 1 : 1 (4) 2 : 2 : 2 : 1
54. The number of different types of gametes that can be produced by anyndividual with the Pp Ss Tt is.
(1) 2 (2) 4 (3) 6 (4) 8
55. The cross used to test whether an individual is homozygous (pure) or heterozygous (hybrid) is called.
56. In Antirrhinum, when a cross is made between red and white flowered plants all resultant flowers will be.
(1) Red (2) Pink
(3) White (4) Red and white in equal number
57. In case of incomplete dominance in F2 generation
(1) the genotypic ratio is 3 : 1 (2) the phenotypic rato is 3 : 1
(3) The genotypic ratio = phenotypic ratio (4) the genotypic riatio phenotypic ratio
58. When a tall and red flowered plant crossed with a dwarf and white flowered plant, phenotype in the
progeny dwarf and white, What will be the genotype of tall and red flowered plant
(1) TTRR (2) TtRR (3) TrRr (4) TTRr
NEET_GENETICS - 72
59. In incomplete dominance, phenotypic ratio in F2 progeny is
(1) 1 : 2 : 1 (2) 1 : 1 : 1 : 1 (3) 3 : 1 : 1 (4) 2 : 1 : 1
60. Mendel didn’t give imagine of
(1) incomplete dominance (2) segregation of alleles
(3) dominance and recessiveness of alleles (4) linkage
61. How many types are of gametes will form during selfing of AaBbCc.
(1) 2 (2) 4 (3) 8 (4) 16
62. Frequency of a perfect heterozygous cross between AABBCC X AaBbCc is
(1) 1/8 (2) 2/8 (3) 3/8 (4) 4/8
63. Phenotypic dihybrid ratio in F2 generation is
(1) 1 : 3 (2) 9 : 3 : 3 : 3 : 1 (3) 1 : 1 : 1 : 1 (4) 1 : 2 :1
64. Pure line breed shows
(1) homozygosity (2) heterozygosity
(3) homozygosity with only dominant genes (4) heterozygosity and linkage
65. AABbCc genotype forms how many types of gametes
(1) 4 (2) 8 (3) 2 (4) 6
66. Independent assortment of genes does not takes place when.
(1) Genes are located on homologous chromosomes
(2) Genes are linked and located on same chromosome
(3) Genes are located on non–homologous chromosomes
(4) All the above
67. ABC dominant genes a are required for production of purple colour of flower in a plant
A purple plant with genotype AABBCC crossed with a colourless plant with genotype aabbcc produces
purple colour in F1 hybrid. On selfing of F1 – what proportion of coloured offspring in F2
27 1 9 37
(1) (2) (3) (4)
64 64 64 64
68. Gene recombinations are due to

(1) mutations (2) linkages
(3) independent assortment (4) none of above
69. What is ratio of homozyous and heterozygous individuals in F2 of a monohybrid cross
(1) 1 : 1 (2) 3 : 1 (3) 2 :1 (4) 1 : 2
MULTIPLE ALLELE, PLEOTROPIC GENE, GENE INTERACTION, POLYGENIC INHERITANCE

70. The phenomenon in which an allele of one gene suppresses the expression of an allele of another gene is
known as
(1) Dominance (2) Inactivation (3) Epistasis (4) Suppression
71. Ratio 9 : 7 is due to

(1) Supplementary genes (2) Lethal genes
(3) Complementary genes (4) Epistatic gene
NEET_GENETICS - 73
72. If one parent has blood group A and the other parent has blood group B. The offspring have which blood
group
(1) AB (2) O (3) BO (4) A, B, AB, O
73. Polygenic genes show
(1) Identical phenotype (2) Identical biochemistry
(3) Different phenotype (4) Identical genotype
74. A man of A blood group marries a woman of AB blood group which type of progeny would indicate that
man is heterozygous A.
(1) AB (2) A (3) O (4) B
75. Inheritance of skin colour in human beings is an example of
(1) Complementary gene (2) Monogenic inheritance
(3) Polygenic inheritance (4) Mendelian inhertance
76. When two independently assorting dominant genes interact with each other to produce particular pheno-
type but when they present alone they did not produce phenotype they are called
(1) Complementary gene (2) Supplementary gene
(3) Duplicate gene (4) Inhibitory gene
77. Genetic recombinations occur through
(1) Mitiosis & Fertilisation (2) Mitosis & Meiosis
(3) Meiosis & Fertilisation (4) None of the above
78. Disease resistant varieties can be produced by
(1) Crossing a plant with variety (2) Treating with colchicine
(3) Crossing with hormones (4) Treating with low temperature
79. The genes for same trait present on non-homologous chromosomes are
(1) Alleles (2) Linked genes (3) Multiple alleles (4) None of these
80. A child’s blood group is ‘O’ His parents blood group can not be
(1) B & O (2) A & O (3) AB (4) A & B
81. In a dihybrid cross, F2 ratio of 15:1 is due to
(1) Supplementary genes (2) Dominant epistasis
(3) Duplicate genes (4) Recessive epistasis
82. Marriages between close relatives should be avoided because it includes more
(1) Recessive alleles to come together (2) Mutations
(3) Multiple births (4) Blood group abnormalities
83. A child of O blood group, has B-blood group father, the genotype of father would be
(1) I0IO (2) IBIB (3) IAIB (4) IBI0
84. A hybrid is generally more vigorous than either of the parents, this is due to
(1) Homozygosity (2) Heterozygosity
(3) Superior genes in hybrid (4) Mixing of cytoplasm
NEET_GENETICS - 74
85. Epistatic gene differs from dominant gene in
(1) Epistatic gene is non-allelic
(2) Epistatic gene never express itself independently
(3) Epistatic and hypostatic genes are present at different loci
(4) All the above.
86. A dihybrid ratio of 1:4:6:4:1 is obtained instead of 9 : 3 : 3: 1. This is an example of
(1) Complementary gene (2) Supplementary gene
(3) Polygenic inheritance (4) Incomplete dominance
87. A gene that shows it’s effect on more than one characters is
(1) Polygene (2) Pleotropic gene (3) Multifactor gene (4) Multiple gene
88. Appearance of walnut-comb animals in poultry on a cross between pure pea-comb and Rosecomb ani-
mals due to
(1) Duplicate genes (2) Complementary gene
(3) Additive gene (4) Collaborative supplementary gene
89. Polygenic inheritance was first noted by
(1) Davenport (2) Galton (3) Mendel (4) Kolreuter
90. If dominant C and P genes are essential for the development of purple colour in sweet pea flowers, what
would be the ratio of white and purple colour in a cross between CcPp × Ccpp
(1) 5 : 3 (2) 9 : 7 (3) 2 : 6 (4) 6 : 2
91. Blood grouping in humans is controlled by
(1) 4 alleles in which IA is dominant (2) 3 alleles is which IA and IB are codominant
(3) 2 alleles in which none is dominant (4) 3 alleles is which IA is recessive
92. The technique of the production of monoclonal antibodies was initially developed by.
(1) Stewards & skoog (2) Lister & Koch (3) Arber & Haberlandt (4) Kohler & milstein
93. The phenomenon in which an allele of one gene suppresses the activity of an allele of another gene, is
known as.
(1) Suppression (2) Inactivation (3) Epistasis (4) Dominance
94. Lethal genes are those which.
(1) cause death of the individual in which they are present
(2) cause death of homozygous infant being formed
(3) cause death of heterozygous infant being formed
(4) None of the above
95. In a cross between two plants, the phenotypic ratio of F2 generation found to be 9 : 3 : 4 is due to.
(1) complementary genes (2) suplementary gene
(3) dominant epistatic gene (4) holandric gene
96. When the two genetic loci produce identical phenotypes in cis and trans position, they are called.
(1) pseudoalleles (2) different genes (3) multiple alleles (4) the parts of same gene
97. Inheritance of ABO blood groups illustrates.
(1) Polyploidy (2) multiple allelism (3) euploidy (4) incomplete dominance
NEET_GENETICS - 75
98. Recessive characters are expressed.
(1) Only when they are present on X- chromosomes of female
(2) Only when they are present on X- chromosomes of male
(3) On any autosome
(4) On both the chromosomes of female
99. Biologically, marriage is prohibited between.
(1) Rh+ boy and Rh+ girl (2) Rh+ boy and Rh– girl
(3) Rh – boy and Rh – girl (4) Rh– boy and Rh+ girl
100. Which type of DNA is found in bacteria.
(1) Straight DNA (2) Helical DNA
(3) Membrane bound DNA (4) Circular free DNA
101. The polygenic genes show
(1) Different genotype (2) Different phenotype
(3) Different genotype & phenotype (4) None of these
102. If a trait is passed from man to all of his sons only.
(1) Gene for that trait is dominant (2) Gene is located on any chromosome
(3) Both above (4) None of the above
103. If two individuals with heterozygous A and B blood marries, then possibility of genotypes in their progeny
are
(1) Only I0 Iº (2) Only IA IB (3) IA I0 and IB I0 (4) All the above
104. Pleiotropy is the term in which a gene influences more than one trait. Its example is
(1) Sickle cell anaemia (2) Haemophilia (3) Colour blindness (4) Only 1 and 2
105. In sweet pea genes C and P are necessary for colour in flowers. The flowers are white in the absence of
one or both the genes. What will be the percentage of coloured flowers in the offspring of the cross Ccpp
× ccPp
(1) 25% (2) 50% (3) 75% (4) 100%
106. Genes for colourblindness are located on
(1) X-chromosome (2) Y-chromosome (3) both (4) None of the above
107. The inheritance of two recessive alleles for sickle cell anaemia is.
(1) Epistatic (2) lethal (3) Both above (4) Pleiotropic
108. In Lathyrus odoratus, the cross between two purple flowered plants forms a pink flowered progeny. This is
due to
(1) Incomplete dominance (2) Co-dominance
(3) Complementary gene interaction (4) Segregation
109. Heterosis in plants is obtained by
(1) Crossing in unrelated parents (2) Treatment by mutagens
(3) Colchicine induction (4) Inbreeding
110. Syndactyly is
(1) Split fingers (2) Fused fingers (3) Split toes (4) Fused toes
NEET_GENETICS - 76
111. Epistasis is due to the
(1) Interaction of two genes of separate loci (2) Interaction of two same genes
(3) Action of polygenes (4) Action of multiple alleles
112. If a couple has 5 girls, the percentage probability of 6th child to be girl is
(1) 25 (2) 100 (3) 10 (4) 50
113. Gene which suppresses other gene’s activity but does not lie on the same locus is called
(1) Epistatic (2) Supplementary (3) Hypostatic (4) Codominant
114. When one gene expresses itself in more than two stage then it is called.
(1) Multiple Alleles (2) Homozygous (3) Heterozygous (4) Complementary gene
115. The ratio of recessive epistasis is
(1) 9 : 3 : 4 (2) 13 : 3 (3) 12 : 3 : 1 (4) 15 : 1
116. An example of the quantitative trait in man is
(1) Hair colour (2) Colour of eye (3) Skin colour (4) Shape of nose
117. Match the type of gene interaction in column ‘A’ with phenotypic ratio (F2) in column ‘B’
A B
(p) Incomplete dominance (i) 15 : 1
(Monohybrid)
(q) Supplimentary gene action (ii) 1 : 2 : 1
(dihybrid)
(r) Duplicate gene (iii) 9 : 6 : 1
(s) Additive gene effect (iv) 9 : 3 : 4
(1) p–i, q–ii, r–iii s–iv (2) p–i q–ii, r–iv s–iii
(3) p–iv, q–iii, r–ii s–i (4) p–ii q–iv, r–i s–iii
118. What is true for monoclonal antibodies
(1) These antibodies obtained from one parent and for one antigen.
(2) These obtained from different parents and for one antigen
(3) These obtained from one parent and for many antigens
(4) These obtained from many parents and for many antigen
119. Ratio of complementary genes is
(1) 9 : 3 : 4 (2) 12 : 3 : 1 (3) 9 : 3 : 3 : 4 (4) 9 : 7
120. Shull gave the term......
(1) Heterosis (2) Gene (3) Epistasis (4) Genetics
121. In Drosophila formation of gynandromorph and their cytological explaination provide best evidence that
(1) X– Chromosome plays important role in sex determination
(2) X–Chromosome does not play any role in sex determination
(3) Y–Chromosome does not play any role in sex determination
(4) Y–Chromosome required for maleness.
122. A normal woman whose father albino, marries an albino man, what proportion of normal and albino are
expected among their offspring
(1) All normal (2) 2 normal : 1 Albino (3) All albino (4) 1 normal : 1 Albino
NEET_GENETICS - 77
123. What would be the nature of children if a colour blind woman marries a normal man
(1) Colourblind daughter & normal sons (2) Colourblind sons and carrier daughters
(3) Normal sons & carrier daughters (4) Normal sons & Normal daughters
124. A colourblind man marries a normal lady (whose father was colour blind) If it produces two sons & two
daughters, how many of them would be suffer
(1) Both sons (2) Both daughters
(3) One son & one daughter (4) Both sons & both daughters
125. Albinism in corn is due to
(1) Pathogenic effect (2) Deficiency of light
(3) Deficiency of minerals (4) lethal gene effect
126. A Colourblind daughter is born when
(1) Father is colourblind, mother is normal (2) Mother is colourblind, father is normal
(3) Mother is carrier, father is normal (4) Mother is carrier, father is colourblind
127. What shall be the ratio of heterozygous, homozygous and hemizygous in offspring of a colour blind
husband & a carrier wife
(1) 1 : 1 : 3 (2) 1 : 1 : 1 (3) 2 : 1 : 1 (4) 1 : 2 : 1
128. Which of the following is not a sex linked characters
(1) Haemophilia (2) Colour blindness (3) Hypertrichosis (4) Baldness
129. A gene located on Y-chromosome and therefore, transmitted from father to son is known as
(1) Supplementary gene (2) Complementary gene
(3) Duplicate gene (4) Holandric gene
130. Baldness in man is a
(1) Autosomal character (2) Sex linked character
(3) Sex influenced character (4) 1 and 3 both
131. A colourblind man marries a daughter of colourblind father, then in the offsprings
(1) All sons are colourblind (2) All daughters are colourblind
(3) Half sons are colourblind (4) No daughter is colourblind
132. A woman with normal vision marries a man with normal vision and gives birth to a colourblind son Her
husband dies and marries a colourblind man what is the probability of her children having the abnormality
(1) 50% colourblind sons and 50 colourblind daughters
(2) All sons colourblind & daughter carrier
(3) All daughter colurblind & sons normal
(4) 50% sons colourblind and all daughters normal
133. A single recessive trait which can express its effect should occur on
(1) Any autosome (2) Any-chromosome
(3) X-chromosome of female (4) X-chromosome of male
134. Sex-linked characters are generally
(1) Lethal (2) Recessive (3) Dominant (4) Not inherited
135. What ratio is expected in offspring if father is colour blind and mother’s father was colour blind
(1) 50% daughter - colour blind (2) All the sons are colour blind
(3) All the daughters colour blind (4) All the sons are normal
NEET_GENETICS - 78
136. If father shows normal genotype and mother shows a carrier trait for haemophelia
(1) All the female offsprings will be carrier
(2) A male offspring has 50% chances of active disease
(3) Female offspring has probability of 50% to active disease
(4) All the female offspring will be colourblind
137. In Drosophila, the sex is determined by
(1) The ratio of number of XX–chromosomes to the sets of autosomes
(2) X and Y chromosomes
(3) The ratio of pairs of X-chromosomes to the pairs of autosomes
(4) Whether the egg is fertilized or develops parthenogenetically
138. No. of Bar Body in XXXXX female
(1) 1 (2) 2 (3) 3 (4) 4
139. Which chromosomes set is found in male grass hopper
(1) 2A + XY (2) 2A + XO (3) 2A + YY (4) 2A + XX
140. In free martin condition
(1) Female is sterile and male is normal (2) Male sterile and female is normal
(3) Both male & female are sterile (4) Both male & female normal
141. Which of the following genotype represent intersex Drosophila
(1) 2 A + XXX (2) 3A + XXX (3) 3A + XXY (4) 2A + XY
142. If X/A Ratio of two Drosophila is 0.6 and 0.33 respectively what would be their sex
(1) Female & male (2) Super female & super male
(3) Inter female & super male (4) Inter sex and super female
143. In Drosophila sex index of super female is
(1) 1 (2) 0.5 (3) 1.5 (4) 0.67
144. Which scientist discovered sex determination in Melandrium album
(1) H.E. Warmke (2) Pro. RP.roy (3) C.B Bridges (4) Wilson & Stevens
145. Which of the following bear homogametic male
(1) Plants (2) Man (3) Insect (4) Birds
146. In plants sex determination due to
(1) X – chromosome (2) Y– chromosome (3) A – chromosome (4) B– Chromosome
147. Albinsim in humans is controlled by a recessive gene ‘a’ If both parents were contained carrier (Aa) for
albinism. What is the chances of 1 normal and 3 albino in family of four
(1) 12/256 (2) 81/256 (3) 108/256 (4) 54/256
148. Predict from the following chart
(1) Character is dominant and carried by chromosome

(2) Character is carried by Y chromosome
(3) Character is sex linked recessive
(4) Character is autosomal recessive
NEET_GENETICS - 79
149. In a Random mating poplulation of 28, 800 individuals percentage of dominant homozygous individuals is
49 find out the percentage to heterozygous individual
(1) 21% (2) 42% (3) 32% (4) 9%
150. In humans, gene producing the disease phenylketonuria also produces a number of abnormal phenotypic
traits, which are collectively called syndrome. This gene results mental retardation, widely spaced incrisors
pigmented patches on the skin and excessive sweating such types of genes are called
(1) Polygene (2) Pleotropic gene (3) Lethal gene (4) Supplimentary gene
151. A child is with an extra chromosome in each of its cell, this condition is the result of
(1) Synapsis (2) Crossing-over (3) Non-disjuntion (4) Disjunction
152. A family has five girls and no son, the probability of the occurence of son in 5th child is
(1) 1 / 2 (2) 1 / 5 (3) 1 (4) 1 / 8
153. If a cross is made between two individuals each having genotype Bb, two offspring are obtained. out of
these one has dominant trait what is the probability that the second offspring will exhibit recessive trait
(1) 1 / 4 (2) 100 (3) Zero (4) 3 / 4
154. Which is a dominant trait
(1) Colour blindness (2) Albinism (3) Haemophilia (4) Rh factor
155. If a normal woman marries an albino man and their offsprings are half albino, half normal the woman is
(1) Homozygous normal (2) Heterozgous dominant
(3) Homozygous recessive (4) Homozygous dominant
156. Albinism is a congential disorder resulting from the lack of enzyme
(1) Tyrosinase (2) Catalase (3) Fructokinase (4) Xanthine-oxidase
157. The Drosophila individuals having chromosomal constitution as 2A + XXY and 2 A + XY are respectively
(1) Males only (2) Female and male (3) Male and female (4) Females only
158. Gibberish mutations are
(1) Silent mutations (2) Inversions (3) Deletions (4) Frame – shift mutations
159. A Drosophila indvidual having chromosomal constituion as 3A + XXY is
(1) Super female (2) Intersex (3) Normal male (4) Normal female
160. Skin colour in rodents is controlled by four alleles, the possible genotypes are
(1) Four (2) Six (3) Eight (4) Ten
161. Patau’s syndrome in human being is caused due to
(1) Trisomy of 18th autosome (2) Trisomy of 13th autosome
(3) Monosomy of 5th autosome (4) Monosomy of 22th autosome
162. Which of the following is not associated with Barr– body
(1) Dosage compensation (2) Faculatative heterochromatin
(3) Lyon’s shypothesis (4) None of these
163. Which of the following is not an example of environmental sex determination
(1) Crocodiles (2) Frog (3) Turtles (4) Snakes
164. If gene frequency for PTC non tasters is 0.4 then what will be the number of heterozygous tasters in
population of 500
(1) 48 (2) 480 (3) 240 (4) 180
NEET_GENETICS - 80
165. A man with a certain disease marries a normal woman. They have 8 children (3) daughters and 5 sons). All
the daughters suffer from their father’s disease but none of the sons are affected. Which of the following
mode of inheritance do you suggest for this disease :
(1) Sex – linked dominant (2) Sex – limited recessive
(3) Sex – linked recessive (4) Autosomal dominant
166. If transition occurs in the second and third nucleotides of the DNA segement reading ATG CTC GA, what
shall be the new sequence
(1) AAG CTC GA (2) ACA GTC GA (3) ACA CAC GA (4) ACA CTC GA
167. A man is heterozygous for autosomal genes A and B and is also hemizygous for hemophilic gene h. What
proportion of his sperms will be abh
(1) 1 / 16 (2) 1 / 4 (3) 1 / 8 (4) 1 / 32
LINKAGE, CROSSING OVER

168. In Drosophila crossing over occurs in female but not in male. Gene A and B are 10 map unit apart on
AB AB
chromosome. A female Drosophila with genotype and male Drosophila with genotype How many
ab ab
type of gametes are produced by female and male Drosophila respectively

(1) 4 types : 2 types (2) 2 types : 2 types (3) 4 types : 4 types (4) 4 types : one types
169. In a cross between individuals homozygous for (a, b) and wild type (++) 700 out of 1000 individuals were
of parental type. Then the distance between a and b is
(1) 70 map unit (2) 35 map unit (3) 30 map unit (4) 15 map unit
170. In maize coloured endosperm (C) is dominant over colourless (c) and full endosperm (R) is dominant over
shrunken (r). When a dihybrid of F1 generation was test crossed it produced four phenotypes in the
following percentage
Coloured and Full = 45%
Coloured – Shrunken = 5%
Colourless – Full = 4%
Colourless – Shrunken = 46%
From these data what would be distance between the two non allelic genes
(1) 48 unit (2) 9 unit (3) 4 unit (4) 12 unit
171. Which of the following show linkage group in coupling phase
(1) (2) (3) (4)
172. In Neurospora arrangement of Ascospores in Ascus is 2a+ : 4A : 2a+ showing

(1) No crossing over
(2) First division segregation
(3) second division segregation or presence of crossing over
(4) Some meiosis
NEET_GENETICS - 81
173. In a random mating population frequency of dominant allele is 0.7 What will be the frequency of recessive
phenotype
(1) 0.49 (2) 0.09 (3) 0.3 (4) 0.21
174. Symbol used in pedigree analysis, represents
(1) Five offspring with unspecified sex (2) Five diseased offspring
(3) Five unaffected offspring (4) Five affected offsprings
175. Variations are :
(1) Degree by which progeny differs from their parents
(2) Degree by which progeny similar to their parents
(3) Process by which characters are passed on from parent to progeny
(4) True breeding lines
176. Mendel found that the F1 always resembled either one of the parents and that the trait of the other parent
was not seen in them. This is due to :
(1) Segregation (2) Dominance (3) Partial dominance (4) Unit factor
177. Multiple alleles can be found only when :
(1) Population studies are made (2) Individual study is made
(3) Mutation is absent (4) Dominance is present
178. In Morgan’s experiment, what will be percentage of recombination in case of body colour and eye colour?
(1) 37.2% (2) 1.3% (3) 98.7% (4) 68.2%
179. Given pedigree represents inheritance of myotonic dystrophy which is an autosomal dominant disorder.
What will be genotype of parents
(1) Mother - aa Father - AA (2) Mother - AA Father - aa

(3) Mother - Aa Father - aa (4) Mother - aa Father - aa
180. Which of the following characters of Drosophila is not suitable for genetical studies ?
(a) They could be grown on simple synthetic medium in laboratory
(b) They complete their life cycle in about 2-weeks
(c) Single mating produces few number of progeny flies.
(d) They have many types of hereditary variations that can be seen with low power microscope.
(e) Male & Female flies are not easily distinguishable
(1) a, b, c (2) a, b, c, d, e (3) d and e (4) c and e
181. If there are four possible allelic forms for the gene controlling ABO blood group then what will be the number
of possible genotypes ?
(1) 6 (2) 10 (3) 12 (4) 14
NEET_GENETICS - 82
182. Which of the following structure was discovered by Henking
(1) y-body (2) Bar body (3) x-body (4) nu-body
183. Chromosomal aberrations are commonly observed in
(1) Germinal cells (2) Cancer cells
(3) Nail base cells (4) Gametes
OBJECTIVE QUESTIONS
1. Study the following pedigree. The transmission of the trait indicates (INBO - 2009)
(1) Autosomal dominance (2) Maternal imprinting

(3) paternal imprinting (4) Mitochondrial inheritance
2. In Grasshopper, rosy body colour is caused by a recessive mutation. The wild -type body colour is green.
If the gene for body colour is on the X-chromosome, what kind of progeny would be obtained from a
mating between a rosy female and a wild -type male (INBO - 2010)
(1) All the daughters will be green and all the sons will be rosy
(2) 50% daughters will be green and 50% sons will be rosy
(3) All offspring will be green irrespective of sex
(4) All offspering will be rosy irrespective of sex
3. Following is a pedigree with marriage between first cousins (INBO - 2010)
Choose the correct diagram representing the inheritance of alleles in the pedigree.
(1) (2) (3) (4)
NEET_GENETICS - 83
4. The enviroment in which a species lives exerts selective pressure on its individuals. In a patch of forest,
many different species of butterflies exist. Among these, two butterfly species, A and B exhibit two different
colour patterns and both are very distasteful to their predators. There also exist two more butterfly species,
C and D, that exhibit very similar colour patterns as that of A and B, respectively, but are highly palatable.
The frequency distribution of these butterflies is shown in the two graphs below. (INBO - 2010)
(i) In one situation, butterflies of species A become much more common than species B. What is the most
likely effect of this on species C and D after many generations
(1) (2)
(3) (4)
(ii) In another situation, number of butterflies of species C suddenly came down in one generation. what is
the most likely effect of this on species A and B after many generations
(1) (2)
(3) (4)
NEET_GENETICS - 84
5. A man and a women who both appear normal have a child together, who has sickle cell anaemia. Sickle cell
anaemia is an autosomal recessive trait. The woman becomes pregnant again and is told that she is
carrying fraternal twins. What is the probability that both of the couple’s twins will develop sickle cell
anaemia (8th CBO)
(1) 1/16 (2) 1/4 (3) 1/2 (4) 9/16
6. The pedigree and the corresponding autoradiograph of restriction map of a family with two children is
shown below. The genotype of child 1 is (4th NSEB)
(1) Aa (2) aa (3) AA (4) Can’t be determined

7. In Drosophila, the following crossing over percentages were found. (IBO)
Gene Gene Crossing over %
bi ec 1.4
bi fa 3.9
wi ec 4.0
wi fa 1.5
What is not order of these genes
(1) bi - ec - fa - wi (2) bi - ec - wi -fa (3) ec - bi - fa - wi (4) ec - bi - wi -fa
8. How many different Genotypes can be expected in the F2 of the crossing : AABB X aa bb when (IBO)
I the genes are completely coupled and II the genes inherit independently.
I II
A 3 4
B 3 9
C 4 9
D 4 16
E 9 16
(1) A (2) B (3) C (4) D
9. A pedigree is shown below for a disease that is autosomal dominant. The genetic make up of the first
generation is. (2th NSEB)
(1) AA, Aa (2) Aa, aa (3) Aa, AA (4) Aa, Aa
NEET_GENETICS - 85
10. If the blood group of father is ‘A’ and that of mother is ‘B’ . The blood group of their child could be -
[KVPY_2007_SB]
(A) A or B or AB (B) AB only (C) A or B or AB or O (D) A or B only
11. Sickle cell anemia is caused by : [KVPY_2009_SB]
(A) complete absence of the haemoglobin gene (B) point mutation of the haemoglobin gene
(C) increased affinity of haemoglobin for oxygen (D) transcription of the haemoglobin protein
12. The probability of having a girl child with blood group O when the parents have blood group A and B is :
[KVPY_2009_SB]
(A) 0% (B) at least 50% (C) at most 25% (D) exactly 75 %
13. Gregor Mendel showed that unit factors exist in pairs and exhibit as dominant-recessive relationship. These
unit factors, in modern terminology, are called : [KVPY_2009_SB]
(A) genes (B) alleles (C) Ioci (D) determinants
14. Male offsprings of which of the following couples have the highest chance of haemophilia ?
(A) Haemophiliac father and normal non-carrier mother [KVPY_2009_SB]
(B) Haemophiliac father and normal carrier mother

(C) Normal father and normal carrier mother
(D) Normal father and haemophiliac mother
AIIMS CORNER
1. If there is complete linkage in F2 generation (AIIMS-1999)
(1) Parental types and recombinants appear in equal ratio
(2) Recombinants are less than parental types
(3) Recombinants are more than parental types
(4) There will be only parental types
2 “Gametes are never hybrid” . It is a statement of law of (A.I.I.M.S. - 2000)
(1) Dominance (2) Segregation
(3) Independent assortment (4) Random fertilisation
3. Mendel could not find recombination and crossing over because (A.I.I.M.S - 2000)
(1) Traits he chose were either present on diferent chromsomes or were far apart
(2) Traits chosen by him were not influenced by genes
(3) He did not have high power microscope
(4) He selected only pure types.
4. Albinism and phenylketonuria are disorders due to (AIIMS - 2000)
(1) Recessive autosomal genes (2) Dominant atuosomal genes
(3) Dominant sex genes (4) Recessive sex genes
5. Strength of linkage is related inversely to distance between . (AIIMS - 2001)
(1) Genes (2) Chromatids (3) Chromosomes (4) Telomeres
NEET_GENETICS - 86
6. Pure line is connected with development of (AIIMS - 2002)
(1) Homozygosity (2) Heterozygosity
(3) Homozygosity and self assortment (4) Heterozygosity and linkage.
7. How many type of gametes are found in F1 progeny of cross between AABBCC and aabbcc (AIIMS - 2004)
(1) 3 (2) 8 (3) 27 (4) 64
8. Given in the figure is chromosome mutation. It is (AIIMS - 2004)
(1) Duplication (2) Inversion (3) Deletion (4) Reciprocal translocation

9. Given ahead is a pedigree chart of a family with five children, It shows the inheritance of attached ear-lobes
as opposed to the free ones. The squares represent the male and circles the female individuals.
Which one of the following conclusions drawn is correct. (AIIMS- 2004)
(1) Parents are homozygous dominant (2) Parents are heterozygous

(3) Parents are homozygous recessive (4) Trait is Y- linked
10. Given below is a pedigree chart with symbols for sex-linked trait in humans.
The trait of the above pedigree chart is

(1) Recessive Y-linked (2) Recessive X- linked (3) Dominant Y- linked (4) Dominant X-linked
NEET_GENETICS - 87
11. Cri-du-chat syndrome is due to chromosomal change involving (AIIMS - 2005)
(1) Duplication (2) Inversion (3) Deletion (4) Translocation
12. Given below is a highly simplified representation of the human sex chromosomes from a karyotype. The
genes a and b could be of (AIIMS- 2006)
(1) Colour blindness and body height (2) Attached earlobe and Rhesus blood group
(3) Haemophilia and red green colour blindness (4) Phenylketonuria and haemophilia
13. Genes present in the cytoplasm of eukaryotic cells are found in (AIIMS- 2006)
(1) Mitochondria and inherited via egg cytoplasm (2) Lysosomes and peroxisomes
(3) Golgi body and ER (4) Plastids and inherited via male gametes.
14. Which represents correct hexaploid nature of Wheat (AIIMS- 2006)
Monosomic haploid Nullisomic Trisomic
(1) 12 28 42 43
(2) 7 28 40 42
(3) 21 7 42 43
(4) 41 21 40 43
15. Which pair of features represents polygenic inheritance? (AIIMS - 2006)
(1) Human eye colour and sickle cell anaemia
(2) Hair pigment of mouse and tongue rolling in humans
(3) ABO blood groups in humans and flower colour of Mirabilis jalapa
(4) Human height and skin colour.
16. Mating of an organism to double recessive for determining homozygosity or heterozygosity is called
(AIIMS - 2006)
(1) Reciprocal cross (2) Back cross (3) Dihybrid cross (4) Test cross
17. Down’s syndrome is caused by an extra copy of chromosome number 21. What percentage of offspring
produced by an affected mother and a normal father would be affected by this disorder (AIIMS- 2007)
(1) 25% (2) 50% (3) 75% (4) 100%
18. Drosophila flies with XXY genotype are females, but human beings with such genotype are abnormal
males. It shows that (AIIMS- 2007)
(1) Y-chromosome is essential for sex determination of drosophila
(2) Y-chromosome is female determining in Drosophila
(3) Y-chromosome is male determining in human beings
(4) Y-chromosome has no role in sex detrmination either in Drosophila or human beings
NEET_GENETICS - 88
19. In a given plant, red colour (R) of fruits is dominant over white fruit (r) ; and tallness (T) is dominant over
dwarfness (t). If a plant with genotype RRTt is crossed with a plant of genotypes rrtt, what will be the
percentage of tall plants with red fruits in the next generation? (AIIMS- 2007)
(1) 100% (2) 75% (3) 50% (4) 25%
20. Grain colour in wheat is determined by three pairs of polygenes. Following the cross AABBCC (dark
colour) X aa bb cc (light colour), in F2 generation what proportion of progeny is likely to resemble either
parent? (AIIMS - 2007)
(1) One third (2) Half (3) Less than 5 percent (4) None of the above
21. Which of the following pair of features is a good example of polygenic inheritance (AIIMS- 2008)
(1) Hair pigment of mouse and tongue rolling in humans
(2) Human height and skin colour
(3) Human eye colour and sickle cell anaemia
(4) ABO blood group in humans and flower colour of Mirabilis jalapa.
22. A normal woman whose father was colour blind, is married to a normal man. The sons would be
(AIIMS- 2008)
(1) 75% colourblind (2) 50% colourblind (3) All colourblind (4) All normal
ASSERTION / REASONING
In each of the following questions a statement of Assertion (A) is given followed by a corresponding statement of
Reason (R) just below it. Of the statements, mark the correct answer as
(1) If both assertion and resaon are true and reason is the correct explanation of assertion
(2) If both assertion and reason are true but reason is not the correct explanation of assertion
(3) If assertion is true but reason is false
(4) If both assertion and reason are false.
23. Assertion: Cytoplasmic inheritance occurs only due to plasmagenes

Reason : Plasmagenes are restricted to only two cell organelles i.e., mitochondria and chloroplast
(1) (2) (3) (4)
24. Assertion: Complementary genes are nonallelic genes
Reason : Complementary genes interact to produce a completely new traits
(1) (2) (3) (4)
25. Assertion : The strength of linkage will be more when the distance between two genes is greater
Reason : Crossing over will be relatively less frequent
(1) (2) (3) (4)
26. Assertion : Phenylketonuria is a recessive hereditary disease caused by body’s failure to oxidise an
amino acid phenylanine to tyrosine, because of a defective enzyme
Reason : It results the presence of phenylalanine acid in urine
(1) (2) (3) (4)
27. Assertion : Persons suffering from haemophilia fail to produce blood clotting factor VIII.
Reason : Prothrombin producing platelets in such persons are found in very low concentration.
(1) (2) (3) (4)
NEET_GENETICS - 89
28. Assertion : In humans, the gamete contributed by the male determines whether the child produced will be
male or female
Reason : Sex in humans is a polygenic trait depending upon a cumulative effect of some genes on X-
chromosome and some on Y-chromosome
(1) (2) (3) (4)
29. Assertion : A gamete carry either of the traits but not both (AIIMS -2009)
Reason : This is mendel's second law of independent assortment
(1) (2) (3) (4)
30. Assertion : Haemophilia is a recessive sex linked disease. (AIIMS -2007)
Reason : Haemophilia occurs due to mutation of a structural gene on chromosome 15
(1) (2) (3) (4)
31. Assertion : A polytene chromosomes have a high amount of DNA. (AIIMS -2006)
Reason : Polytene chromosomes are formed by repeated replication of chromosomal DNA without separaton
of chromatids.
(1) (2) (3) (4)
PART- 1
1. In Drosophila, during organ differentiation, one organ can be replaced by another like wings by legs.
Genes responsible for it are (AIPMT- 2000)
(1) Plastid genes (2) Homeotic genes
(3) Complementary genes (4) Supplementary genes
2. Which is correct about traits chosen by Mendel ? (AIPMT - 2000)
(1) Terminal pod is dominant (2) Constricted pod is dominant
(3) Green coloured pod is dominant (4) Tall plants are recessive.
3. Tallness (T–) is dominant over dwarfness (tt) while red flower colour (R–) is dominant over white colour (rr).
A plant with genotype TtRr is crossed with plant of genotype ttrr. Percentage of progeny having tall plants
with red flowers is (AIPMT - 2000)
(1) 25% (2) 50% (3) 75% (4) 100%
4. Most favourite and ideal material for researches in genetics is (AMU - 2000, AIPMT - 2003)
(1) Housefly (2) Mosquito (3) Frog (4) Fruitfly.
5. Independent assortment is absent in case of (AIPMT - 2001)
(1) Genes located on the same chromosome
(2) Genes located on homologous chromosomes
(3) Genes located on nonhomologous chromosomes
(4) All the above.
NEET_GENETICS - 90
6. In Pea, wrinkling of seeds is due to nonformation of starch because of the absence of an enzyme
(1) Amylase (2) Invertase (3) Branching enzyme (4) Diastase (AIPMT - 2001)
7. In complementary genes, the dihybrid ratio of 9 : 3 : 3 : 1 is modified to (AIPMT - 2001)
(1) 9 : 7 (2) 12 : 3 : 1 (3) 15 : 1 (4) 13 : 3.
8. Pleiotropic effect is found in (AMU - 2001, AIPMT - 2001)
(1) Human skin colour (2) Night blindness (3) haemophilia (4) Sickle cell anaemia
9. Which one of the following traits of Garden Pea studied by Mendel was a recessive feature (AIPMT - 2003)
(1) Axial flower position (2) Green seeds colour (3) Green pod colour (4) Round seed shape.
10. Two crosses between the same pair of genotypes/phenotypes in which the sources of gametes are re-
versed in one cross are called (AIPMT- 2003)
(1) Test cross (2) Reverse cross (3) Dihybrid cross (4) Reciprocal cross
11. When a cluster of genes show linkage behaviour, they (AIPMT - 2003)
(1) Do not show chromosome map (2) Induce cell division
(3) Do not show independent assortment (4) Show recombination during meiosis
12. Self fertilising trihybrid plants form (AIPMT- 2004)
(1) Eight different gametes and 64 different zygotes
(2) Four different gametes and sixteen different zygotes
(3) Eight different gametes and sixteen different zygotes
(4) Eight different gametes and thirty two different zygotes
13. In a plant, red fruit (R) is dominant over yellow fruit (r) and tallness (T) dominant over shortness (t). A plant
with RRTt genotype is crossed with plant of rrtt genotype. The progeny is (AIPMT - 2004)
(1) All red fruit, tall 25% (2) All red fruit, tall 50%
(3) All red fruit and tall 75% (4) All red fruit and tall.
14. For finding the different types of gametes produced by genotype AaBb, it should be crossed with
genotype (AIPMT - 2005)
(1) AABB (2) aabb (3) AaBb (4) aaBB.
15. Phenotype of an organism is the result to (AIPMT - 2006)
(1) Mutations and linkages (2) Genotype and environment interactions
(3) Cytoplasmic effects and nutrition (4) Environmental changes and sexaul dimorphism.
16. In Mendel’s experiments with Garden Pea, round seed shape (RR) was dominant over wrinkled seeds (rr),
yellow cotyledons (YY) was dominant over green cotyledons (yy) What are expected phenotypes in F 2
generation of RRYY x rryy ? (AIPMT- 2006)
(1) Only wrinkled seeds with green cotyledons
(2) Only wrinkled seeds with yellow cotyledons
(3) Only round seeds with green cotyledons
(4) Round seeds with yellow cotyledons and wrinkled seeds with green cotyedons.
17. Test cross involves (AIPMT- 2006, MH - 2007)
(1) Crossing between two genotypes with dominant trait
(2) Crossing between two genotypes with recessive trait
(3) Crossing the F1 hybrid with double recessive genotype
(4) Crossing between two F1 hybrids.
NEET_GENETICS - 91
18. Genotype of hybrid is known by crossing (AIPMT- 2007)
(1) F2 progeny with female parent (2) F1 × F1
(3) Crossing F1 with recessive parent (4) F2 with recessive parent.
19. In pea, yellow seed colour is dominant over green colour . Heterozygous yellow seeded plant is crossed
with green seeded plant. The ratio of yellow & green seeded offspring will be (AIPMT- 2007)
(1) 9 : 1 (2) 1 : 3 (3) 3 : 1 (4) 50 : 50
20. A human male produce diallelic sperms in equal proportion AB, Ab, aB and ab. The genotype of the person
would be (AIPMT- 2007)
(1) Aa Bb (2) Aa BB (3) AA Bb (4) AA BB.
21. The most popularly known blood grouping is the ABO grouping. It is named ABO and not ABC, because”
O” in it refers to having: (AIPMT- 2009)
(1) No anitgens A and B on RBCs
(2) Other antigens besides A and B on RBCs
(3) Overdominance of this types on the genes for A and B types
(4) One antibody only - either anti- A or anit B on the RBCs
22. Which one of the following cannot be explained on the basis of Mendel’s Law of Dominance
(AIPMT- 2010)
(1) Out of one pair of factors one is dominant and the other recessive
(2) Alleles do not show any blending and both the characters recover as such in F 2 generation
(3) Factors occur in pairs
(4) The discrete unit controlling a particular character is called a factor
23. ABO blood groups in humans are controlled by the gene I. It has three alleles -IA,IB and i. Since there are
three different alleles, six different genotypes are possible. How many phenotypes can occur.
(AIPMT- 2010)
(1) One (2) Four (3) Two (4) Three
24. A person with unknown blood group under ABO system, has suffered much blood loss in an accident and
needs immediate blood transfusion. His one friend who has a valid certificate of his own blood type. offers
blood donation without delay. What would have been the type of blood group of the donor friend.
(AIPMT- 2011)
(1) Type B (2) Type AB (3) Type O (4) Type A
25. F2 generation in a Mendelian cross showed that both genotypic and phenotypic ratios are same as 1 : 2 : 1
It represents a case of : (AIPMT Pre. 2012)
(1) Co-dominance
(2) Dihybrid cross
(3) Monohybrid cross with complete dominance
(4) Monohybrid cross with incomplete dominance
26. A test cross is carried out to : (AIPMT Mains 2012)
(1) Determine the genotype of a plant at F2.
(2) Predict whether two traits are linked.
(3) Assess the number of alleles of a gene.
(4) Determine whether two species or varieties will breed successfully.
NEET_GENETICS - 92
27. The idea of mutations was brought forth by : (AIPMT Mains 2012)
(1) Hugo do Vries, who worked on evening primrose
(2) Gregor Mendel, who worked on Pisum sativum
(3) Hardy Weinberg, who worked on allele frequencies in a population
(4) Charles Darwin, who observed a wide variety of organisms during sea voyage
28. A diploid cell is treated with colchicine. It becomes (AIPMT- 2002)
(1) Diploid (2) Monoploid (3) Triploid (4) Tetraploid
29. Which is correct match (AIPMT- 2002)
(1) Parkinson’s disease – X and Y chromosomes (2) Haemophilia – Y-chromosome
(3) Down’s syndrome – 21st chromosome (4) Sickle cell anemia – chromosome
30. A diseased man marries a normal woman. The couple has 3 daughters and 5 sons. The daughters are
diseased while the sons are normal. The gene of the disease is (AIPMT - 2002)
(1) Sex-linked recessive (2) Sex linked dominant
(3) Autosomal character (4) Sex limited character.
31. Linkage map of X-chromosome of fruitfly has 66 map units with yellow body gene(y) at one end bobbed
hair (b) at the other. The recombination frequency between y an b gene would be (AIPMT- 2003)
(1) 66% (2) > 50% (3) 50% (4) 100%
32. Pattern baldness, moustaches and beard in human males are examples of (AIPMT- 2003)
(1) Sex- linked traits (2) Sex differentiating traits
(3) Sex limited traits (4) Sex determining traits
33. A harmful condition which is also a potential saviour form a mosquito borne infectious disease
(AIPMT- 2003)
(1) Thalassemia (2) Sickle cell anaemia (3) Leukemia (4) Pernicious anaemia
34. Genetic map is one that (AIPMT- 2003)
(1) Establishes sites of the gene on a chromosome
(2) Establishes the various stages in gene evolution
(3) Shows the stages during cell division
(4) Shows distribution of various species in a region
35. One of the genes present exclusively on the X-chromosome in humans is concerned with (AIPMT - 2003)
(1) Baldness (2) Red-green colourblindness
(3) Facial hair / moustaches in males (4) Night blindness
36. Lack of independent assortment between two genes A and B would be due to
(AIPMT- 2004, MPPMT - 2007)
(1) Crossing over (2) Linkage (3) Repulsion (4) Recombination.
37. Recessive gene present on one X- chromosome of humans will be (AIPMT- 2004, MPPMT - 2007)
(1) Lethal (2) Sublethal (3) Expressed in males (4) Expressed in females.
38. A mutation at a gene locus changes a character due to change in (AIPMT- 2004)
(1) DNA replication (2) Protein synthesis pattern
(3) RNA transcription pattern (4) Protein structure
NEET_GENETICS - 93
39. A normal woman whose father was colour blind is married to normal visioned man. Their sons would be
(AIPMT- 2004)
(1) 75% colour blind (2) 50% colour blind (3) 100% colour blind (4) All normal.
40. Most likely reason for development of resistance in insects against pesticides is (AIPMT- 2004)
(1) Genetic recombination (2) Acquired heritable changes
(3) Random mutation (4) Directed mutations
41. A normal couple has seven children (2 daughers and 5 sons). Three of the sons suffer from a hereditary
disorder but none of the daughters is affected. Which is the inheritance type (AIPMT - 2005)
(1) Sex-limited recessive (2) Autosomal dominant
(3) Sex-linked dominant (4) Sex-linked recessive.
42. A woman with 47 chromosome due to presence of additional 21 chromosome is chracterised by
(AIPMT- 2005)
(1) Super female (2) Turner’s syndrome (3) Down’s syndrome (4) Triploidy
43. Frequency of A allele is 0·6 and that of a allele is 0·4. What would be frequency of heterozygotes in
random mating population ? (AIPMT- 2005)
(1) 0·36 (2) 0·16 (3) 0·24 (4) 0·48
44. Which one is not a heriditary disease (AIPMT- 2005)
(1) Cystic fibrosis (2) Cretinism (3) Thalassaemia (4) Haemophilia
45. A woman with normal vision but with colourblind father marries a colourblind man. The fourth child of the
couple is a boy. This boy (AIPMT- 2005)
(1) May or may not be colourblind
(2) Must be colourblind
(3) Must have normal vision
(4) Will be partially colourblind due to being heterozygous
46. Sickle cell anaemia has not been elimainated from African population as (AIPMT - 2006)
(1) It is controlled by dominant genes (2) It is controlled by recessive genes
(3) It is not a fatal disease (4) It provides immunity against malaria
47. Which of the following is the most suitable medium for culture of Drosophila melanogaster
(AIPMT- 2006)
(1) Cow dung (2) Moist bread (3) Agar agar (4) Ripe Banana
48. Cri-du-chat syndrome in humans is caused by (AIPMT- 2006)
(1) Trisomy of 21st chromosome
(2) Loss of half of short arm of chromosome 5
(3) Loss of half of long arm of chromosome 5
(4) Fertilization of an XX egg by a normal Y- bearing sperm.
49. Both sickle cell anaemia and Huntington’s chorea are (AIPMT - 2006)
(1) Virus related diseases (2) Bacteria related diseases
(3) Congential disorders (4) Pollution induced disorders
50. R and Y genes of Maize lie very close to each other. When RRYY and rryy genotype are hybridised, F 2
generation will show (AIPMT- 2007)
(1) Sagregation in 9: 3 : 3 : 1 ratio (2) Sagregation is 3 : 1 ratio
(3) Higher number of parental types (4) Higher number of recombinant types
NEET_GENETICS - 94
51. Telomeres with repetitive DNA sequences (AIPMT- 2007)
(1) Act as replicons (2) Are transcription initiators
(3) Help in chromosome pairing (4) Prevent chromosome loss.
52. Which one of the following conditions in humans is correctly matched with its chromosomal abnormality /
linkage ? (AIPMT- 2008)
(1) Erythroblastosis foetalis – X- linked
(2) Down’s syndrome – 44 autosomes + XO
(3) Klinefelter’s syndrome – 44 autosomes + XXY
(4) Colour blindness – Y-linked
53. Point mutation involves (AIPMT- 2009)
(1) Deletion (2) Insertion
(3) Change in single base pair (4) Duplication
54. Study the pedigree chart given below (AIPMT- 2009)
What does it show:

(1) Inheritance of a recessive sex-linked disease like haemophilia
(2) Inheritance of a sex-linked inborn error of metabolism like phenylketonuria
(3) Inheritance of condition like phenylketonuria as an autosomal recessive trait
(4) The pedigree chart is wrong as this is not possible
55. Which one of the following symbols and its representation, used in human pedigree analysis is correct.
(AIPMT- 2010)
(1) =Unaffected male (2) =Unaffected female
(3) =Male affected (4) =Mating between relatives
56. Which one of the following conditions correctly describes the manner of determining the sex in the given
example (AIPMT- 2011)
(1) Homozygous sex chromosomes (ZZ) determine female sex in Birds .
(2) XO type of sex chromosomes determine male sex in grasshopper
(3) XO condition in human as found in Turner Syndrome, determines female sex.
(4) Homozygous sex chromosomes (XX) produce male in Drosophila.
NEET_GENETICS - 95
57. A certain road accident patient with unknown blood group needs immediate blood transfusion. His one
doctor friend at once offers his blood. What was the blood group of the donor ? (AIPMT Pre. 2012)
(1) Blood group B (2) Blood group AB (3) Blood group O (4) Blood group A
58. A normal– visioned man whose father was colour– blind, marries a woman whose father was also colour–
blind. They have their first child as a daughter. what are the chance that this child would be colour– blind ?
(AIPMT Pre. 2012)
(1) 100% (2) zero percent (3) 25% (4) 50 %
59. Represented below is the inheritance pattern of a certain type of traits in humans. Which one of the
following conditions could be an example of this pattern ? (AIPMT Mains. 2012)
(1) Phenylketonuria (2) Sickle cell anaemia

(3) Haemophilia (4) Thalassemia
60. Which one of the following is a wrong statement regarding mutations ? (AIPMT Mains. 2012)
(1) Deletion and insertion of base pairs cause frame-shift mutations
(2) Cancer cells commonly show chromosomal aberrations
(3) UV and Gamma rays are mutagens
(4) Change in a single base pair of DNA does not cause mutation
1. Sickle cell anaemia is an example of (AFMC - 1999)

(1) Epistasis (2) Codominance (3) Pleiotropy (4) Incomplete dominance
2. Organisms phenotypically similar but genetically different are (A.P.M. E.E - 1999)
(1) Heterozygous (2) Homozygous (3) Monozygous (4) Multizyous.
3. Hybrid vigour is due to (DPMT - 1999)
(1) Mixing of traits of male and female (2) Homozygosity in gamete state
(3) Superiority of genes (4) Heterozygosity.
4. Albinism is due to nonsynthesis of of melanin on account absence of (BHU- 1999)
(1) Melanase (2) Luciferase (3) Tyrosinase (4) Lysine.
5. Out of two alleles of the same gene, one finds morphological expression . The phenomenon is -
(AMU - 1999)
(1) Epistasis (2) Codominance (3) Dominance (4) Incomplete dominace
6. In Cucurbita, W is epistatic over Y and y gene normally responsible for yellow and green colour fruits. It
produces white fruits. What is the ratio of fruits in the progeny of cross Ww Yy × wwYy ? (AMU - 1999)
(1) 9 white : 7 yellow : 0 green (2) 3 white : 4 yellow : 1 green
(3) 4 white : 3 yellow : 1 green (4) 2 white : 1 yellow : 1 green.
NEET_GENETICS - 96
7. A recessive trait in Garden Pea is (Karnataka - 1999)
(1) Wrinkled seeds (2) Tall stem (3) Round seeds (4) Coloured seed coat.
8. Mendel is called father of (M.P.P.M.T. - 1999)
(1) Taxonomy (2) Genetics (3) Palaeobotany (4) Modern Physiology.
9. Dihybrid test cross ratio is (Karnataka - 2000, AIIMS - 2000 2001, Kerala - 2002, Orissa- 2005)
(1) 9 : 3 : 3 : 1 (2) 1 : 1 : 1 : 1 (3) 3 : 1 (4) 1 : 1
10. 23 pairs of chromosomes can give rise to combinations (Kerala - 2000)
(1) 8·6 million (2) 7·6 million (3) 6·6 million (4) 5·6 million
11. Heterozygous tall plant is selfed. It produces both tall and dwarf plants. This confirms Mendel’s law
(RPMT - 2000)
(1) Law of dominance (2) Law of segregation
(3) Law of independent assortment (4) Incomplete dominance.
12. Which one is a dominant trait out of the characters chosen by Mendel (Manipal 2000)
(1) Pod Colour – Yellow (2) Seed Colour – White
(3) Flower Position – Axile (4) Plant height – Dwarf
13. R is dominant red flower trait while r is recessive white flower trait. Heterozygous red flowered plant is
crossed with homozygous red flowered plant. 64 offspring are produced. Number of white flowered plants
is (DPMT - 2000)
(1) 64 (2) 32 (3) 16 (4) 0
14. Ultimate source of variation is (DPMT -2000)
(1) Fertilization (2) Mitosis (3) Meiosis (4) Mutations.
15. Source of mendelian recombinations is (DPMT - 2001)
(1) Linkage (2) Independent assortment
(3) Mutations (4) Dominant traits.
16. 1 : 2 : 1 phenotypic and genotypic ratios occur in case of (DPMT - 2001)
(1) Blending inheritance (2) Psuedoalleles
(3) Multiple alleles (4) Complementary genes
17. Correct reason of Mendel’s success was (BHU- 2001)
(1) He repeated each experiment several times
(2) Traits chosen by him had genes far apart so that linkage was absent
(3) He kept record of all experiments
(4) He used statistical techniques.
18. Number of genotypes found in F2 progeny of a dihybrid cross is (MPPMT - 2001)
(1) 9 (2) 6 (3) 3 (4) 1
19. Heterozygous tall (Tt ) is crossed with homozygous tall (TT). Percentage of heteozygous tall in the progeny
would be (AMU - 2001)
(1) 25% (2) 50% (3) 75% (4) 100%
20. Tt × tt is (Har PMT - 2001)
(1) Test cross (2) Back cross (3) Hybridisation (4) Reciprocal cross.
NEET_GENETICS - 97
21. In sickle cell anaemia, there is change in amino acid in chain at position (Har PMT - 2001)
(1) VI (2) VII (3) IX (4) X
22. How many types of gametes are formed by Pea plant having YYRRtt genotype (B.V. - 2001)
(1) 2 (2) 4 (3) 8 (4) None of the above
23. Blood group of a couple are AB and O. The possible blood group of children would be (Kerala - 2002)
(1) O group only (2) AB blood group (3) A or B (4) AB and O
24. In Mirabilis jalapa, RR, Rr and rr determine red, pink and white colour respectively.When F 1 hybrid of RR
and rr was crossed with dominant parent, the ratio produced is. (RPMT -2002)
(1) All red (2) 1 Red : 1 Pink (3) All white (4) 2 Pink : 2 white
25. Alleles are (CPMT - 2002, Pb. PMT - 2005)
(1) Alternate forms of gene (2) Pairs of sex chromosomes
(3) Homologus chromosomes (4) None of the above
26. In quantitative inheritance F2 ratio obtained in a dihybrid cross is (DPMT - 2002)
(1) 1 : 4 : 6 : 4 : 1 (2) 15 : 1 (3) 12 : 3 : 1 (4) 9 : 7
27. Complete dominance does not occur in (JIPMER - 2002)
(1) Mirabilis jalapa (2) Oenothera lamarckiana
(3) Pisum sativum (4) Lathyrus odoratus
28. Out of a population of 800 individuals in F2 generation of a cross between yellow round and green wrinkled
Pea plant, what would be number of yellow and wrinkled seeded plants (Manipal - 2002)
(1) 800 (2) 400 (3) 200 (4) 150.
29. Three children in a family have blood types O, AB and B respectively . What are the genotypes of their
parents (Karnataka - 2003)
(1) IAi and IBi (2) IAIB and ii (3) IBIB and IAIA (4) IAIA and IBi
30. Pink flowered progeny of red and white flowered parents of Antirrhinum majus is produced due to
(AIEEE- 2003)
(1) Dominance (2) Epistasis (3) Codominance (4) Incomplete dominance.
31. Multiple alleles control inheritance of (AMU - 2003)
(1) Colour blindness (2) Sickle cell anaemia (3) Blood groups (4) Phenylketonuria.
32. Phenotypic and genotypic ratio in F2 generation in incomplete dominance is (AMU - 2003)
(1) 1 : 2 : 1 and 1 : 2 : 1 (2) 3 : 1 and 1 : 2 : 1
(3) 9 : 6 and 3 : 1 (4) 9 : 3 : 3 : 1 and 1 : 2 : 1 : 4 : 1 : 1 : 2 : 1 : 2 : 1
33. Mendel’s work was got republished in ‘Flora’ by (AMU - 2003)
(1) De Vries (2) Tschermak (3) Correns (4) All the above.
34. Mendel’s work was published in (BV- 2003)
(1) 1866 (2) 1884 (3) 1900 (4) 1901
35. Which one is an interaction of genes (CET Chd - 2003)
(1) Recessiveness (2) Dominance (3) Epistasis (4) Pleiotropy.
36. A hybrid formed by the cross between pure tall green seeded and pure dwarf yellow seeded Pea plant is
crossed with pure dwarf green seeded plants. Number of phenotypes would be (B.V. 2003)
(1) 2 (2) 4 (3) 6 (4) 8.
NEET_GENETICS - 98
37. A person with blood groups A possesses (AFMC - 2004)
(1) Antigen A and antibody B (2) Antigen B and antibody a
(3) Antigen A and antibody b (4) No antigen and no antibody.
38. B-blood group man marries A blood group woman. The first child has B-blood group. Genotype of the child
is (CPMT - 2004)
(1) IAIO (2) IBIO (3) IAIB (4) IBIB
39. Children of a father with ‘O’ blood group and mother of AB blood group could have blood group
(Manipal - 2004)
(1) O (2) AB (3) O or AB (4) A or B.
40. Height in humans is (CPMT - 2005)
(1) Somatogenic variation (2) Discontinuous variation
(3) Contiuous variation (4) Both 1 and 3.
41. Multiple alleles represents. (Manipal - 2005)
(1) More than two alternate forms of gene found at same locus
(2) More than two alternate forms of a gene found at different loci
(3) Occurrence of one gene in two chromosomes
(4) None of the above.
42. Number of genotypes produced when individuals of genotype ‘YyRrTt’ are crossed with each other
(Wardha - 2005)
(1) 4 (2) 45 (3) 28 (4) 27
43. Independent assortment can be deduced from (RPMT - 2005)
(1) Monohybrid cross (2) Test cross (3) Back cross (4) Dihybird cros
44. Which trait was not incorporated by Mendel for his experiments ? (RPMT - 2005)
(1) Colour of Pea seed (2) Colour of Pea flower (3) Colour of Pea plant (4) Colour of Pea pod
45. Incomplete dominance was discovered by (RPMT - 2005)
(1) Correns (2) Mendel (3) Johannsen (4) Bateson.
46. Which blood group can safely be transfused in emergency when there is no time to analyse the blood
group of recipient ? (Orissa - 2005)
(1) O and Rh — (2) O and Rh + (3) B and Rh— (4) AB and Rh +

47. Grain colour of wheat is determined by three pairs of polygenes. What proportion of F 2 progeny will
resemble either parents following a cross of AABBCC (dark colour) with aabbcc (light colour).
(AIIMS - 2005)
(1) None (2) Half (3) Less than 5% (4) One third
48. In Pisum sativum there are 14 chromosomes. How many pairs with different chromosomal composition can
be prepared. (BHU - 2005)
(1) 214 (2) 27 (3) 7 (4) 14
49. Pure tall plant is crossed to dwarf plant F1 generation has only tall plants while F2 generation has both tall
and dwarf in ratio of 3 : 1. The phenomenon is due to (BHU - 2005)
(1) Dominance (2) Codominance
(3) Incomplete dominance (4) Heredity.
NEET_GENETICS - 99
50. A baby of blood group A cannot belong to parents of blood group (APMEE - 2005)
(1) Husband O, wife AB (2) Husband A, wife B (3) Husband B, wife O (4) Husband AB, wife A
51. Cross between homozygous black rough (BBRR) guinea pig and homozgous white smooth guinea pig
(bbrr) produced black and rough animals in F1 generation. Presuming the genes to be present ondifferent
chromosomes, the percentage of F2 individuals which are heterozygous for both the gene pairs would be
(Manipur - 2005)
(1) 25% (2) 35% (3) 50% (4) 75%
52. A test cross is performed (AMUPMDC - 2006)
(1) By selfing of F2 generation plants
(2) By selfing of F1 generation plants
(3) To determine whether F1 plants are Homozygous or Heterozygous
(4) Between homozygous plants
53. Possible blood groups of children born to parents having A and AB groups are
(AMUPMDC - 2006, BHU - 2007)
(1) O, A (2) A,B, AB (3) O,A,B (4) O,A,B, AB.
54. When pure long plant having white flower is crossed with pure dwarf plant having red flower, the dwarf
progeny in F2 generation will be (RPMT - 2006)
(1) 1 / 16 (2) 2 / 16 (3) 4 / 16 (4) 9 / 16
55. Which of the following is correct for dihybrid cross ? (RPMT - 2006)
(1) 1 YYRR, 2YyRR, 2yyRr, 4 YyRr (2) 1 YYRR, 3YyRR, 2yyRr, 3 YyRr
(3) 3 YYRR, 3YyRR, 2yyRr, 4YyRr (4) 3 YYRR, 1YyRR, 2yyRr, 3 YyRr
56. Match the genetic phenomena with their respective ratios (Kerala - 2007)
a. Inhibitory gene ratio 1. 9:3:4
b. Complementary gene ratio 2. 1:1:1:1
c. Recessive test cross ratio 3. 12 : 3 : 1
d. Dihybrid test cross ratio 4. 13 : 3
e. Dominant epistasis ratio 5. 9:7
(1) a – 5, b – 4, c – 3, d –2, e – 1 (2) a – 4, b – 5, c – 1, d –2, e – 3
(3) a – 1, b – 2, c – 4, d –3, e – 5 (4) a – 2, b – 1, c – 4, d –5, e – 3
57. A tall pea plant with round seeds (TTRR) is crossed with a dwarf wrinkle seeded plant (ttrr). F 1 has tall plants
with rounded seeds. What is the proportion of dwarf plants with wrinkled seeds in F2 generation
(Kerala - 2007)
(1) Zero (2) 1/2 (3) 1/4 (4) 1/16
58. The number of phenotypes in ABO blood groups is (Kerala - 2007)
(1) 1 (2) 4 (3) 6 (4) 8
59. Mendel’s experimental material was (JKCMEE - 2007, Orissa- 2007)
(1) Drosophila melanogaster (2) Homo sapiens
(3) Pisum sativum (4) Antirrhinum majus.
60. The offspring of AA bb × aa BB is crossed with, aabb. The genotypic ratio of progeny will be (CPMT - 2007)
(1) 9 : 3 : 3 : 1 (2) 1 : 2 : 1 (3) 1 : 1 : 1 : 1 (4) 4 : 1
NEET_GENETICS - 100
61. The term genetics was proposed by (MPPMT- 2007)
(1) Johannsen (2) Morgan (3) Mendel (4) Bateson
62. When heterozygous red flowered plant is crossed with white flowered plant the progeny will show ratio of
(DPMT - 2007)
(1) 350 red : 350 white (2) 450 red : 250 white (3) 380 red : 220 white (4) None of the above.
63. Which one of the following characters studied by Mendel in graden pea was found to be dominant ?
(AFMC- 2007)
(1) Green seed colour (2) Terminal flower (3) Green pod colour (4) Wrinkled seed
64. Which of the following is a test cross (DPMT- 2008)
(1) Ww × ww (2) WW × ww (3) Ww × Ww (4) ww × ww
65. Which of the following is the best suited for codominance (DPMT- 2008)
(1) Both are recessive (2) Both are dominant (3) One is recessive (4) One is dominant
66. The gene which masks the effect of another gene is called. (DPMT- 2008)
(1) Epistatic (2) Multiple allele (3) Lethal gene (4) Complementary gene
67. In F2 generation quantitative inheritance ratio 1 : 4 : 6 : 4 : 1 is obtained instead of (DPMT- 2008)
(1) 9: 3 : 3 : 1 (2) 8 : 6 : 4 : 1 (3) 7 : 4 : 1 : 4 (4) 6 : 6 : 4 : 7
68. Incomplete dominance is shown by (DPMT- 2008)
(1) Helianthus (2) China rose (3) Primrose (4) Mirabilis
69. A dihybrid test cross yielding a result of 1 : 1 : 1 : 1 ratio is indicative of (KCET- 2008)
(1) Homozygous condition of the F1 dihybrid
(2) 4 different types of gametes produced by the F1 dihybrid
(3) 4 different types of gametes produced by the F1 parent
(4) 4 different types of F1 generation dihybrids.
70. How many combination of gametes will be produced by an organism with AaBBCc genotypes?
(C.O.M.E.D-K’s.- 2008)
(1) 3 (2) 4 (3) 9 (4) 6
71. The phenomenon of a single gene regulating several phenotypes is called (KPMT- 2008)
(1) Multiple allelism (2) Epistasis
(3) Incomplete dominance (4) Pleotropism
72. Inheritance of blood group is (KPMT- 2008)
(a) Codominance (b) Incomplete dominance
(c) Multiple allelism (d) Multiple gene
(1) a, b (2) b, d (3) a, c (4) b, c
73. When a dihybrid cross is fit into a punnett square with 16 boxes, the maximum number of different
phenotypes available are (KPMT- 2008)
(1) 8 (2) 4 (3) 2 (4) 16
74. Universal donor is (BHU 2009)
(1) O Rh + (2) O Rh – (3) AB Rh + (4) AB Rh –
75. Genes are made up of (BHU 2009)
(1) Histones (2) Hydrocarbons (3) Polynucleotides (4) Lipoproteins
NEET_GENETICS - 101
76. Cross over frequency is proportional to (AFMC-1999)
(1) Phenotypic recombinant frequency (2) Genotypic recombinant frequency
(3) Haploid number of chromosomes (4) Diploid number of chromosomes
77. A woman has a child with Klinefelter’s syndrome. Number of barr bodies present in the child is
(HPMT - 2000)
(1) One (2) Two (3) Three (4) None
78. Number of Nucleosomes found in helical coil of 30 nm chromatin fibre is (RPMT - 2000)
(1) 6 (2) 10 (3) 12 (4) 15
79. Presence of recessive trait is 16%. The frequency of dominant allele in populations is (DPMT - 2001)
(1) 0·6 (2) 0·32 (3) 0·84 (4) 0·92
80. A disease sometimes found in persons above 40 which is characterised by poor CNS coordination,
forgetfullness and tremor of hands is (Manipal - 2001)
(1) Epilepsy (2) Alzheimer’s disease (3) Migraine (4) Schizophrenia
81. A boy with normal brother and colourblind sister has his parents (Uttarakhand - 2001)
(1) Father normal, mother colourblind (2) Both normal
(3) Both colourblind (4) Father colourblind, mother normal
82. Deficiency of VIII factor leads to (H.PMT - 2001)
(1) Haemophilia A (2) Haemophilia B (3) Haemophilia C (4) Haemophilia D
83. Polydactyly in man is due to (JKCMEE - 2002)
(1) Autosomal recessive allele (2) Autosomal dominant allele
(3) Sex linked recessive allele (4) Sex linked dominant allele
84. As per Lyon’s hypothesis, one of the two X- chromosomes undergoes heterochromatisation and is called
(AMU- 2002)
(1) Barr body (2) karyotypic body (3) Genotypic body (4) Phenotypic body
85. Which one brings about point mutation? (AMU - 2002)
(1) 5-methyl cytosine (2) Guanine (3) Adenine (4) 5- Bromouracil
86. Frequency of recessive allele is 0·2 What is the frequency of homozygous dominant (APMEE - 2002)
(1) 0·64 (2) 0·32 (3) 0·8 (4) 0·064
87. One of the following is holandric inheritance (APMEE - 2002)
(1) Haemphilia (2) Epidermolysis (3) Webbed toes (4) Turner’s syndrome
88. Edward’s syndrome characterised by mental deficiency is caused by trisomy of chromosome
(MPPMT- 2002)
(1) 5 (2) 9 (3) 15 (4) 18
89. Three genes a b c show crossing over 20% between b and c and 8% between a and c. Sequence of
genes will be (AIPMT- 2002)
(1) b a c (2) a b c (3) a c b (4) None of the above
90. The ‘Christmas disease’ patient lacks antihaemophilic (Karnataka - 2003)
(1) Homogentisic acid oxidase (2) Factor VIII
(3) Factor XI (4) Factor IX.
91. Ishiara charts are used by opthalamologists for detecting (BHU - 2003)
(1) Eye infection (2) Night blindness (3) Colour blindness (4) Finger prints.
NEET_GENETICS - 102
92. Haemophilia does not occur in women because (BHU - 2003)
(1) It is autosomal recessive (2) Women have to be homozygous which is fatal
(3) They have only one X-chromosome (4) They are more resistant to this disorder.
93. Albinism is due to herditary deficiency of enzyme (BHU - 2003)
(1) Amylase (2) Carbonic anhydrase
(3) Acetyl choline esterase (4) Tyrosinase
94. In Melandrium, sex determination is of (Kerala - 2003)
(1) XX – XO (2) ZZ – ZW (3) XX – XY (4) XY – XO
95. Presence of one Barr body in WBC indicates that the person is (Kerala - 2003)
(1) Colour blind (2) Normal male (3) Normal female (4) Haemophilic
96. Mode of inheritance of haemophilia resembles that of (AIEEE - 2003)
(1) Myopia (2) Skin colour (3) Colour blindness (4) Night blindness
97. Tay Sach’s disease is due to (AMU - 2003)
(1) Sex-linked recessive gene (2) Sex -linked dominant gene
(3) Autosomal dominant gene (4) Autosomal recessive gene
98. Chromsomal doubling for producing polyploid plants is carried out by (CMC - 2003)
(1) PEG (2) NAA (3) EMS (4) Colchicine
99. A man and woman, both having colour blind fathers, marry, Probability of their first daughter being colour
blind is (Wardha - 2003)
(1) 100% (2) 50% (3) 25% (4) 0%
100. Number of linkage groups in Pisum sativum is (DPMT - 2003)
(1) 4 (2) 5 (3) 7 (4) 10.
101. The male has a mutation in his mitochondria. During segregation, the mutation is found in (AIPMT- 2003)
(1) None of the progeny (2) One third of progeny
(3) Half of progeny (4) Whole of progeny
102. Amino acid substituted in sickle cell anaemia is (Kerala- 2004)
(1) Glutamic acid for valine in alpha chain (2) Glutamic acid for valine in beta chain
(3) Valine for gutamic acid in alpha chain (4) Valine for glutamic acid in beta chain
103. Monosomic trisomy is (Kerala- 2004)
(1) 2 N – 1 + 1 (2) 2N –1 –1 (3) 2N –1 (4) 2N + 1 + 1.
104. Number of Barr bodies in human female suffering from Down’s syndrome would be (AIEEE - 2004)
(1) 3 (2) 1 (3) 2 (4) zero
105. A double stranded DNA having 100,000 bp will have a length of (AIEEE - 2004)
(1) 10,000 nm (2) 105 nm (3) 3·4 × 104nm (4) 200,000 nm
106. Sex determination in Drosophila melanogaster is based on (AIEEE - 2004)
(1) XY mechanism
(2) Genic balance between X-chromosome and atuosomes
(3) Pseudoalleles
(4) Environment-chromosome interaction
107. Total number of base pairs found in human genome is (AIEEE- 2004)
(1) 3·5 million (2) 35000 (3) 35 billion (4) 3·1 billion
NEET_GENETICS - 103
108. Gynaecomastia proceeds (Karnataka - 2004 COMED-K’s - 2006)
(1) Turner’s syndrome (2) Klinefelter’s syndrome
(3) Down’s syndrome (4) SARS
109. Colchicine brings about (JKCMEE - 2004)
(1) Gene mutation (2) Chromosome aberration
(3) Quick replication (4) Duplication of chromosomes.
110. Percentage of recombination between A and B is 9%, A and C 17% and B and C is 26%. The arrangement
of genes would be (Orissa - 2004)
(1) A – B – C (2) A – C – B (3) B – C – A (4) B – A – C
111. Mongolism is (MPPMT - 2004)
(1) Turner’s syndrome (2) Klinefelter’s syndrome
(3) Down’s syndrome (4) Hypothalmic syndrome
112. Albinism is a result of inability of the system to convert amino acid (Manipal - 2004)
(1) Alanine (2) Tryptophan (3) Lysine (4) Phenylalanine
113. Diagrammatic representation of chromosomes is (Manipal - 2004)
(1) Karyotype (2) Idiogram (3) Chromosome map (4) Phenogram.
114. Sex-linked traits of a man are usually present on (MPPMT - 2004)
(1) X-chromosome (2) Autosomes
(3) Short arm (p) of Y-chromosome (4) Long arm (q) of Y- chromosome
115. One centimorgan is equal to recombination frequency of (DPMT - 2004)
(1) 1 (2) 0·1 (3) 10 (4) 0·01
116. Barr body is observed in (Kerala - 2005)
(1) Basophils of male (2) Neutrophils of female
(3) Basophils of female (4) Eosinophils
117. Which is incorrectly paired? (Kerala - 2005)
(1) sry gene–X chromosome (2) 2n - 2 – Nullisome
(3) Nucleoid – prokaryote (4) Polytene chromosome – Drosophila
118. Transposons are (BHU - 2005)
(1) House keeping genes (2) Transporting genes
(3) Jumping genes (4) Stationary genes
119. When two genetic loci produce identical phenotypes in cis and trans position, they are (Pb. PMT - 2005)
(1) Pseudoalleles (2) Multiple alleles (3) Part of same gene (4) Different genes
120. Melanurea (black urine) is caused by abnormal catabolism of (Pb. PMT - 2005)
(1) Alanine (2) Tyrosine (3) Proline (4) Tryptophan
121. Which is functional unit of inheritance (H. PMT - 2005)
(1) Cistron (2) Intron (3) Chromosome (4) Gene
122. Which is not an X-linked recessive disease (AMU - 2005)
(1) - Thalassemia
(2) Haemophilia
(3) Colour blindness
(4) Glucose 6-phophate dehydrogenase deficiency
NEET_GENETICS - 104
123. The condition of sickle cell anaemia is due to (Manipur- 2005)
(1) Chromosomal mutation (2) Silent mutation
(3) Point mutation (4) Frame-shift mutation
124. Accumulation of protein, amyloid - peptide, in human brain causes (Kerala - 2006)
(1) Addison’s disease (2) Huntington’s disease
(3) Alzheimer’s disease (4) Parkinson’s disease
(5) Motor neuron disease.
125. Lampbrush chromosomes occur inside (B.V.- 2006)
(1) Nucleus of man (2) Oocytes of Frog
(3) Salivary glands of Silkmoth (4) Salivary glands of Drosophila
126. Down’s syndrome is due to nondisjunction of (Orissa- 2006)
(1) X-chromosome (2) Y-chromosome
(3) Autosome (4) Second chromosome of Drosophila
127. The gene for cystic fibrosis is located over chromosome (HPPMT- 2006)
(1) 4 (2) 7 (3) 11 (4) 12
128. Drosopohila is metamale with chromosomal formulation (Kerala- 2006)
(1) 2A + 3X (2) 3A + 3X (3) 4A + 3X (4) 3A + XY
129. Match the columns (Kerala- 2006)
S.no. I II
1. Sickle cell anaemia a 7th chromosome
2. Phenylketonuria b 4th chromosome
3. Cystic fibrosis c 11th chromosome
4. Huntington’s disease d X-chromosome
5. Colour blindness e 12th chromosome
(1) 1 – a, 2 – c, 3 – d, 4– b, 5 – e (2) 1 – c, 2 – e, 3 – a, 4– b, 5 – d
(3) 1 – b, 2 – c, 3 – d, 4– e, 5 – a (4) 1 – b, 2 – a, 3 – c, 4– e, 5 – d
(5) 1 – d, 2 – e, 3 – c, 4– b, 5 – a
130. Down’s syndrome and Turner’s syndrome are due to respectively (Kerala- 2007)
(1) Monosomic and nullisomic conditions (2) Trisomic and monosomic conditions
(3) Trisomic and tertrasomic conditions (4) Trisomic and tetrasomic conditions
131. Number of chromosomes in male grasshopper is (M.H.- 2007)
(1) 8 (2) 45 (3) 46 (4) 23
132. Epicanthus skin fold above the eyes and transverse palmer crease are typical symptoms of
(COMED-K’s- 2007)
(1) Cri-du-chat (2) Klinefelter’s syndrome
(3) Down’s syndrome (4) Turner’s syndrome
133. Longest chromosomes occur in (JKCMEE- 2007)
(1) Lilium (2) Zea mays (3) Allium (4) Trillium
134. Sex chromosomes of birds are (CPMT- 2007)
(1) ZZ– ZW (2) ZZ – WW (3) XX – XY (4) XO – XX
NEET_GENETICS - 105
135. Number of linkage groups in Escherichia coli is (DPMT- 2007)
(1) 1 (2) 2 (3) 4 (4) 5.
136. Genes when close together on a chromosome it is called. (DPMT- 2008)
(1) Mutation (2) Linkage (3) Translation (4) Transcription
137. In human beings 45 chromosomes/single X/XO abnormality causes (DPMT- 2008)
(1) Down’s syndrome (2) Turner’s syndrome
(3) Klinefelter’s syndrome (4) Edward’s syndrome
138. A normal woman whose father was colourblind person is married to a normal man. Her sons would likely to
be (DPMT- 2008)
(1) 75% colour blind (2) 50% colour blind (3) All normal (4) All colourblind
139. The absence of which clotting factor leads to haemophia A (W.B- 2008)
(1) Factor VII (2) Factor VIII (3) Factor IX (4) Factor X
140. Sex chromosomes of a female bird are represented by (KPMT- 2008)
(1) ZW (2) XY (3) XO (4) XX
141. Match the human genetic disorder with the causative abnormal chomosome (KPMT- 2008)
(a) Sickle cell anaemia 1. Sex linked (X-chromosome)
(b) Colour blindness 2. Autosomal chromosome 7
(c) Phenylketonuria 3. Autosomal chromosome 11
(d) Cystic fibrosis 4. Autosomal chromosome 4
(e) Huntington’s disease 5. Autosomal chromosome 12
(1) a-3, b-5, c-1, d-2, e-4 (2) a-5, b-1, c-2, d-3, e-4
(3) a-4, b-1, c-5, d-2, e-3 (4) a-3, b-1, c-5, d-2, e-4
142. Gynaecomastia is a symptom of (KPMT- 2008)
(1) Down’s syndrome (2) Klinefelter’s syndrome
(3) Turner’s syndrome (4) Alzheimer’s disease
(5) Phenylketonuria.
143. Both sickle cell anaemia and Huntingtion’s chorea are (AFMC- 2008)
(1) Congenital disorders (2) Pollutant induced disorders
(3) Bacteria-related diseases (4) Virus-related disorders.
144. In gynandromorphs, (BCECE 2009)
(1) Some cells of body contain XX and some cells with genotype XY
(2) All cells have XX genotype
(3) All cells have XY genotype
(4) All cells with genotype XXY
145. Genes exhibiting multiple effects are known as (BHU 2009)
(1) Complementary genes (2) Pleiotropic genes
(3) Cistrons (4) Pseudogenes
146. Polyploid means occurrence of (CPMT 2009)
(1) haploid sets of chromosomes (2) Diploid sets of chromosomes
(3) more than diploid sets of chromosomes (4) All of the above
147. XO chromosomal abnormality in humans causes of (CPMT 2009)
(1) Turner's syndrome (2) Down's syndrome (3) Darwin's syndrome (4) Klinefelter's syndrome
NEET_GENETICS - 106
OBJECTIVE QUESTIONS
NUCLEIC ACIDS (DNA, RNA, THE SEARCH FOR GENETIC MATERIAL AND CHARGAFFS RULE )
1. A DNA molecule makes complete turn after every
(1) 3.4 Å (2) 20Å (3) 10 base (4) 340º
2. The diameter of Z– DNA molecule is
(1) 18 Å (2) 34 Å (3) 45 Å (4) 3.4 Å
3. Who amongst the following discovered genetic nature of RNA ?
(1) Fredrich Miescher (2) Hershey and Chase (3) Griffith (4) H. Fraenkel-Conrat
4. The terms like cistron, muton and recon were coined by
(1) Johannsen (2) Waldeyer (3) Benzer (4) Mathaei
5. DNA was first discovered by
(1) Beadle and Tatum (2) Watson and Crick (3) Friedrich Miescher (4) A. Kornberg
6. The two stands of DNA are
(1) Similar in nature and complementary (2) Antiplarallel and complementary
(3) Always single stranded (4) Rarely double stranded
7. The similarity between DNA & RNA is that both
(1) are double stranded (2) have simillar sugars
(3) are polymers (4) have similar pyrimidines
8. In which of the following, double stranded RNA is present ?
(1) bacteria (2) chloroplast (3) mitochondria (4) reovirus
9. Distance between the two base pairs of DNA is
(1) 3·4 Å (2) 34 Å (3) 340 Å (4) 3400 Å
10. In the experiments on the chemistry of DNA Chargaff estimated the base composition of human sperms
and found that adenine constituted 31% and guanine 19%. The quantity of cytosine in DNA of a human
somatic cell is likely to be
(1) 19% (2) 38% (3) 31% (4) 62%
11. Who proved that DNA is the basic genetic material ?
(1) J. D Watson (2) H.G. Khorana (3) Alfred Griffith (4) Hershey & Chase
12. In a given sample of nucleic acid G + A content is not equal to C + T. This indicates that sample is
(1) GC rich (2) AT rich
(3) single-stranded DNA (4) double-stranded DNA
13. To prove that DNA is the genetic material, Griffith used
(1) Neurospora crassa (2) Drosophila melanogaster
(3) Diplococcus pneumoniae (4) Escherichia coli
NEET_GENETICS - 107
14. In rous sarcoma virus, the flow of information is
(1) DNA RNA Proteins (2) DNA Proteins RNA
(3) RNA DNA RNA proteins (4) RNA DNA proteins
15. Nucleic acid was artificially synthesized in vitro by–
(1) Ochoa and Kornberg (2) Nirnberg and Ochoa
(3) Nirenberg and Ochoa (4) Kornberg and Nirenberg
16. One of the following cannot have pyrimidine uracil in its composition .Identify it.
(1) Genetic code (2) Gene (3) Cryptogram (4) Non-sense codons
17. Central dogma is proposed by
(1) Mulder (2) Temin (3) Beri comoner (4) Crick
18. Histone proteins are rich in
(1) Tryptophan, Lysine (2) Arginine, Lysine (3) Histidine, Arginine (4) Histidine, Tryptophan
19. Bacterial DNA is associated with
(1) few polyamines of basic proteins (2) histone proteins
(3) no proteins (4) acidic proteins

20. Regarding to features of double helix struture of DNA which of the following is wrong
(1) Two polynucleotide chains have antiparallel polarity
(2) The bases in two strands are paired through phosphodiester bonds
(3) Adenine form two hydrogen bonds with thymine
(4) The pitch of the helix is 3.4 nm
21.
The above diagrams of clover leaf life structure of tRNA represent its
(1) Primary structure (2) Secondary structure
(3) Tertiary structure (4) Quaternary structure
22. Which was first genetic material?
(1) RNA (2) DNA (3) Protein (4) Both (1) and (2)
23. Which RNA occurs abundantly in a cell?
(1) r RNA (2) t RNA (4) m RNA (3) Primer RNA
24. The length of DNA molecule greatly exceeds the dimensions of the nucleus in the eukaryotic cells. How is
this DNA accomodated ?
(1) Super coiling in nucleosomes (2) DNase digestion
(3) Through elimination of repetitive DNA (4) Deletion of non-essential genes
NEET_GENETICS - 108
25. Radioactive (35S) was detected in?
(1) Supernatant (2) Sediment (3) Both 1 and 2 (4) None of these
26. Which of the following is not a criteria for determination of genetic material
(1) Ability of replication
(2) Chemically and structurally stable
(3) It should be non mutable
(4) Ability to expres itself in form of Mendelian characters
DNA REPLICATION, TRANSCRIPTION, GENETIC CODE AND TRANSLATION

27. DNA replication is aided by
(1) DNA polymerase only (2) DNA ligase only
(3) Both DNA polymerase and ligase (4) RNA polymerase
28. A DNA strand on which new strand is produced is called
(1) complementary (2) template (3) primer (4) elongating
29. In DNA replication, primer strand is formed by
(1) A small piece of deoxyribonucleotide polymer (2) A small piece of ribonucleotide polymer
(3) Deoxyribonucleotides + pyrophosphates (4) DNA replicase + nucleotide + ATP
30. The experimental system used in the studies on the discovery of replication of DNA has been
(1) Drosophila melanogaster (2) Pneumococcus
(3) Escherichia coli (4) Neurospora crassa
31. The enzyme which catalyses the formation of RNA from DNA template is known as
(1) reverse transcriptase (2) RNA polymerase
(3) DNA polymerase (4) nuclease
32. Ligase - an ezyme is used for
(1) joining bits of DNA (2) splitting DNA thread into small bits
(3) denaturation (4) none of the above
33. If the base sequence of the strand of DNA is CAT ATC CAT GAC ACT what will be the base sequence of
complementary RNA strand ?
(1) GUA UAG GUA CUG UGA (2) GUT TAG GTA GTC TGA
(3) GUA UAG GTA CUG UGA (4) GTA TAG GTA CTG TGA
34. A DNA molecule in which both strands have redioactive thymidine is allowed to duplicate in an environment
containing non-radioactive thymidine. What will be the correct number of DNA molecules that contain
some radioactive thymidine after three duplication ?
(1) Threre will be four such molecules (2) All eight molecules will be such
(3) There wil be only one such molecule (4) There will be only two such strands
35. A DNA molecule in E. coli is heavy (fully labelled with 15N). It is allowed to replicate in a medium containing
N14 After one generation of replication, the two daughter molecules will
(1) differ in density from one another but will resemble the parent molecule
(2) have the same density as that of the parent DNA
(3) Differ in density from one another and also differ from that of parent DNA
(4) be similar in density but will resemble their parent DNA
NEET_GENETICS - 109
36. The protein which helps to unwind DNA double helix during replication is
(1) DNA polymerase (2) DNA gyrase (3) helicase (4) DNA topoisomerase
37. Small fragments of DNA synthesized during replication of DNA are called
(1) nucleotides (2) genes (3) Okazaki fragements (4) single stranded DNA
38. Replication of DNA in eukaryotes commences from
(1) one end of the chromatid extending to the other end
(2) both ends of the chromatid simultaneously
(3) the centromere to either ends of the chromatids
(4) several sites along the DNA of the chromatid simultaneously
39. The strand of DNA which is synthesized continuously during replication is called
(1) leading strand (2) lagging strand (3) sense strand (4) antisense strand
40. DNA polymerase enzyme was discovered by
(1) Kornberg (2) Nirenberg (3) Khorana (4) Ochoa
41. There are 64 codons in genetic code dictionary because
(1) There are 64 types of tRNA found in the cell
(2) There are 44 meaningless and 20 codons for amino acids
(3) There are 64 amino acids to be coded
(4) Genetic code is triplet
42. The DNA chain acting as template for mRNA synthesis has the following order of bases AGCTTCGA. What
will be the order of bases in mRNA ?
(1) TCGT AAGCT (2) UCTG AAG CU (3) UCG UAG CT (4) UCG AAG CU
43. The first codon discovered by Nirenberg and Mathaei was
(1) GGG (2) CCC (3) UUU (4) AAA
44. A codon is said to be degenerate because
(1) It degenerates soon after coding
(2) more than one amino acid can be coded by a single codon
(3) the same amino acid can have many codons
(4) all the above
45. Which of the following serves as a termination codon ?
(1) AUG (2) CGC (3) UAG (4) GUG
46. In the genetic code dictionary, how many codons are used to code for all the 20 essential amino acids ?
(1) 20 (2) 64 (3) 61 (4) 60
47. Which of the following is Pribnow box ?
(1) 5’ AATAAT3’ (2) 5’ ATATTA3’ (3) 5’ TATAAT3’ (4) 5TAATTA3’
48. Which one of the following codons codes for the same information as UGC
(1) UGU (2) UGA (3) UAG (4) UGC
49. During elongation occuring in translation, the enzyme which catalyses the synthesis of peptide bond is
(1) Peptidyl transferase (2) Peptidyl synthetase
(3) Protease (4) Amino acyl synthetase
NEET_GENETICS - 110
50. An antibiotic which inhibits translation in eukaryotes is
(1) Chloromycetin (2) Penicillin (3) Puromycin (4) Tetracycline
51. During elongation of polypeptide chain (in translation), the sigma factor is
(1) Regain and performs speical function (2) Functionless
(3) Used during closing of chain (4) Released to take part again
52. Ligase is an enzyme required for -
(1) Renaturation of DNA (2) Proof reading
(3) Joining DNA bits (4) Breaking of DNA
53. DNA replication is
(1) Semiconservative and semi discontinous (2) Semiconservative and discontinous
(3) Conservative (4) Conservative and discontinous
54. Which of the following can have the base thymine in its compostion
(1) Codogene (2) Codon (3) Nodoc (4) Anticodon
55. Identify the characteristic which is not applicable to the genetic code
(1) Non-Polar (2) Non-overlapping (3) Commaless (4) Universal
56. In DNA replication, the role of RNA primer is to–
(1) Activate the DNA template
(2) Synthesize DNA nucleotides for the formation of new strand
(3) Initiate the formation of new strand on the template
(4) Perform all these functions
57. Codogene is
(1) The synonym for genetic code
(2) A triplet present on the nontemplate strand of DNA
(3) The initial codon in the genetic code
(4) The gene which provides code for the synthesis of a protein.
58. At the end of the process of DNA replication the newly formed lagging strand is also continuous due to the
(1) Okazaki fragements (2) Semiconservative method of replication
(3) DNA ligases (4) Double-stranded nature of DNA
59. Termination of the translation process occurs at the
(1) 5’ end of the DNA template (2) 3’ end of the mRNA
(3) 3’ end of t-RNA (4) 5’ end of mRNA
60. The amino acid valine is recognised by the triplets GUU, GUC, GUA and GUG and this character of the
code is referred to as
(1) Degeneracy (2) Universality (3) Non-ambiguity (4) Commalessness
61. The wobble concept was proposed by
(1) Watson and Crick (2) Nirenberg and Lederberg
(3) Nirenberg and Matthaei (4) Crick
62. The m-RNA, AUGCAGGAUCGU recognises four amino acid and this character of the code referred to as
(1) Degeneracy (2) Universality (3) Non-amibiguity (4) Commalessness
NEET_GENETICS - 111
63. Sigma factor is component of
(1) RNA polymerase (2) Dissociation factor (3) DNA ligase (4) DNA polymerase
64. After reaching into cytoplasm the m-RNA attaches itself to
(1) 40S particle (2) ER (3) 70 ribosomes (4) 60S particle
65. Functional unit of gene that specifies synthesis of one polypeptides is
(1) Recon (2) Cistron (3) Codon (4) Muton
66. The terms cistron, recon and muton were proposed by
(1) Lederberg (2) Benzer (3) Johannsen (4) Morgan
67. The amino acids with a single code are
(1) Phenylalanine and glycine (2) Methionine and Tryptophan
(3) Glutamic acid and Arginine (4) Proline and Glycine
68. Given below sequence of the processed m–RNA ready for translation:
5’AUG CUA UACCUCCUUUAUCUGUGA–3’ How many different t–RNA molecule require to translate this
m–RNA–
(1) 8 (2) 7 (3) 6 (4) 5
69. How much duration of time required for replication of 4.6 x 106bp in E.coli?
(1) 83 minutes (2) 38 minutes (3) 2 minutes (4) 3 hrs
70. Which of the following is exclusive property of transcription found in RNA-polymerase
(1) Initiation (2) Elongation (3) Termination (4) Processing
71. Which of the following mutation forms the genetic basis of proof that codon is a triplet and it is read in a
contiguous manner
(1) Chromosomal structural mutations (2) Chromosomal numerical mutations

(3) Substitutional mutation (4) Frame shift insertion or deletion mutation
REGULATION OF GENE EXPRESSION, HGP AND DNA FINGERPRINTING.

72. Which one of the following pairs of terms/names mean one and the same thing ?
(1) Gene pool - genome (2) Codon - gene
(3) cistron - triplet (4) DNA fingerprinting - DNA profiling
73. Operon hypothesis proposed by
(1) Watson and Crick (2) Jacob and Monod (3) Bateson (4) Garrod
74. Gene battery model proposed by
(1) Jacob and Monond (2) Bateson
(3) Briten and Davidson (4) None
75. Inducer of lac operon is
(1) Permease (2) Transacetylase (3) Galactosidase (4) Lactose
76. According to Operon concept a regulator gene forms
(1) A general inhibitor (2) A small peptide (3) A repressor (4) An inducer
77. Due to high degree of polymorphism, size of VNTR varies from
(1) 0.1—2kb (2) 0.1—20 kb (3) 0.01 — 20 kb (4) 0.1 — 200 kb
NEET_GENETICS - 112
78. Which suspect would you charge with the crime
Crime scene sample
Victim Suspect 1 Suspect 2
(1) Both suspect 1 and 2 (2) Only suspect 1

(3) Only suspect 2 (4) Neither suspect 1 nor suspect 2
OBJECTIVE QUESTIONS
oLrqfu"B iz'u ¼OBJECTIVEQUESTIONS½
1. In a double-stranded DNA coding for a protein, according to principle, how many codons in reading
frames are possible? [KVPY_2008_SB]
(1) 1 (2) 2 (3) 3 (4) 6
2. Restriction endonucleases are enzymes that cleave DNA molecules into smaller fragments. Which type of
bond do they act on? [KVPY_2010_SB]
(1) N-glycosidic Bond (2) Phosphodiester bond
(3) Hydrogen bond (4) Disulfide bond
3. If the sequence of base in DNA is 5'- ATGTATCTCAAT- 3', then the sequence of bases in its transcript
will be : [KVPY_2011_SB]
(A) 5' - TACATAGAGTTA - 3' (B) 5' - UACAUAGAGUUA - 3'
(C) 5' - AUGUAUCUCAAU - 3' (D) 5' - AUUGAGAUACAU - 3'
4. According to the original model of DNA as proposed by Watson & Crick 1953, DNA is a
(A) left handed helix [KVPY_2011_SB]
(B) helix that makes a full turn every 70 nm.
(C) helix where one turn of DNA contains 20 basepairs
(D) two stranded helix where each strand has opposite polarity.
5. The length of one complete turn of a DNA double helix is [KVPY_2011_SB]
(A) 3 4 A (B) 34 nm (C) 3.4 A (D) 3.4 m
NEET_GENETICS - 113
AIIMS CORNER
1. Proteins are synthesised by the process (AIIMS-1999)
(1) Transcription (2) Translation (3) Transduction (4) Translocation
2. Correct sequence of code transfer during polypeptide formation is (AIIMS-1999)

(1) DNA, mRNA, tRNA and amino acids (2) DNA, tRNA, rDNA and mRNA
(3) mRNA, tRNA, DNA and amino acids (4) rRNA, DNA, mRNA and tRNA.
3. A point mutation comprising substitution of purine with pyrimidine is (AIIMS - 2002, DPMT- 2005)
(1) Transition (2) Transversion ( 3) Deletion (4) Translocation.
4. Frame shift mutation occurs when (AIIMS - 2002)
(1) Base is deleted or added (2) Base is added
(3) Base is deleted (4) Anticodons are not present.
5. Which is important for transcription (AIIMS - 2002)
(1) CAAT Box (2) Promoter (3) DNA polymerase (4) DNA methylase
6. What is true of tRNA (AIIMS - 2003)
(1) It binds with an amino acid at its 3’ end
(2) It has five double stranded regions
(3) It has a codon at one end which recognises anticodon of mRNA
(4) It looks like clover leaf in 3-dimensional structure
7. Which one represents the correct manner of DNA replication (AIIMS - 2003)
(1) (2) (3) (4)
8. Which one of the following codons codes for the same information as UGC (AIIMS - 2003)
(1) UGU (2) UGA (3) UAG (4) UGG
9. cDNA is copied from mRNA molecule with the help of (AIIMS - 2005 CPMT - 2005)
(1) Restriction enzyme (2) Reverse transcriptase
(3) DNA polymerase (4) Adenosine deaminase.
10. E.coli about to replicate was placed in a medium containing radioactive thymidine for five minutes. Then it
was made to replicate in a normal medium. Which of the following observation will be correct.
(AIIMS - 2007)
(1) Each strand half radioactive (2) Both the strands of DNA will be radioactive
(3) One strand radioactive (4) None is radioactive
NEET_GENETICS - 114
11. During translation initiation in prokaryotes, a GTP molecule is needed in (AIIMS - 2007)
(1) Association of 50 S subunit of ribosome with initiation complex
(2) formation of formyl-met-RNA
(3) Association of 30S m-RNA with formyl-met-tRNA
(4) Binding of 30S subuit of ribosome with mRNA
12. The telomeres of eukaryotic chromosomes consists of short sequences of (AIIMS - 2007)
(1) Cytosine rich repeats (2) Thymine rich repeats
(3) Adenine rich repeats (4) Guanine rich repeats
13. Match the following (AIIMS - 2007)
(a) tRNA 1. Linking of amino acids
(b) mRNA 2. Transfer of gentic Information
(c) rRNA 3. Nucleolar organising region
(d) Peptidyl transferse 4. Transfer of amino acid from cytoplasm to ribosome
14. What would happen if a gene encoding a polypeptide of 50 amino acids has UAC at 25th position mutated
to UAA (AIIMS - 2007)
(1) A polypeptide of 25 amino acids will be formed
(4) Two plypeptides of 24 and 25 amino acids will be formed.
15. The total number of nitrogenous bases in human genome is estimated to be about (AIIMS - 2008)
(1) 3·5 million (2) 35 million (3) 35 thousand (4) 3·1 billion
16. Which one of the following pairs is correctly matched with regard to the codon and the amino acid coded
by it ? (AIIMS- 2008)
(1) UUA-valine (2) AUG-cysteine (3) CCC-alanine (4) AAA-lysine
ASSERTION / REASONING
In each of the following questions a statement of Assertion (A) is given followed by a corresponding statement of
Reason (R) just below it. Of the statements, mark the correct answer as
(1) If both assertion and resaon are true and reason is the correct explanation of assertion
(2) If both assertion and reason are true but reason is not the correct explanation of assertion
(3) If assertion is true but reason is false
(4) If both assertion and reason are false.
17. Assertion : No lac mRNA is made in the presence of glucose.
Reason : In the presence of glucose and lactose, activity of lac operon is not needed.
(1) (2) (3) (4)
18. Assertion : Synthesis of tryptophan is self regulatory.
Reason : Tryptophan work both as co-repressor and through feedback inhibition.
(1) (2) (3) (4)
19. Assertion : DNA ligase joins two DNA chains.
Reason : DNA ligase catalyzes the formation of phosphodiester bonds between two chains.
(1) (2) (3) (4)
NEET_GENETICS - 115
20. Assertion : DNA polymerase III is responsible for DNA replication
Reason : DNA synthesis cannot proceed on both strands.
(1) (2) (3) (4)
21. Assertion : DNA polymerase I acts as proof-reader.
Reason : DNA polymerase I removes mismatached nucleotides.
(1) (2) (3) (4)
22. Assertion : Okazaki segments are formed on leading strand.
Reason : Direction of DNA replication is 3' 5' on leading strand.
(1) (2) (3) (4)
23. Assertion : DNA replication is unirepliconic in prokaryotes whereas it is multirepliconic in eukaryotes.
Reason : In prokaryotes there is a single origin of replication where in eukaryotes there are a number of
origins of replication.
(1) (2) (3) (4)
24. Assertion : An mRNA has both intiation codon and termination codon
Reason : It specifies only a single polypeptide or number of them
(1) (2) (3) (4)
25. Assertion : mRNA attaches to ribosome through its 3’end
Reason : The mRNA has F-capsular nucleotide and bases of lagging sequence
(1) (2) (3) (4)
26. Assertion : Repression occurs at transcription level.
Reason : When repressor binds to the operator, transcription occurs
(1) (2) (3) (4)
PART- 1
1. In operon model, regulator gene function as (AIPMT-1999)

(1) Repressor (2) Regulator (3) Inhibitor (4) All the above
2. Pneumococcus experiment proves that (AIPMT-1999)
(1) DNA is genetic material
(2) Bacteria undergo binary fission
(3) Bacteria do not reproduce sexually
(4) At times RNA controls production of DNA and proteins.
3. Length of one coil of B-DNA helix is (AIPMT- 2000, 2006, RPMT- 2006)
(1) 0·34 nm (2) 3·4 nm (3) 10 nm (4) 20 nm
4. Three dimensional shape of tRNA is (AIPMT- 2000)
(1) L-shaped (2) Clover leaf-like (3) X-shaped (4) Y- shaped
NEET_GENETICS - 116
5. Similarity between DNA and RNA is that both have (AIPMT- 2000, Karnataka-2006)
(1) Similar sugars (2) Similar mode of replication
(3) Similar pyrimidines (4) Polymers of nucleotides.
6. Three dimensional shape of tRNA is (AIPMT- 2000)
(1) L-shaped (2) Clover leaf-like (3) X-shaped (4) Y- shaped
7. Similarity between DNA and RNA is that both have (AIPMT- 2000, Karnataka-2006)
(1) Similar sugars (2) Similar mode of replication
(3) Similar pyrimidines (4) Polymers of nucleotides.
8. Enzyme that catalyses union of DNA fragments is (Kerala- 2000, AIPMT- 2002)
(1) Ligase (2) Polymerase (3) Helicase (4) Endonuclease
9. Types of RNA polymerases operative in eukaryotes are (AIPMT - 2001)
(1) Four (2) Three (3) Two (4) One
10. Escherichia coli is allowed to replicate once in medium having radioactive thymidine. Which one is
correct (AIPMT- 2001)
(1) Both strands of DNA become radioactive (2) One strand becomes radioactive
(3) Each strand is half radioactive (4) None is redioactive.
11. Evolution was termed RNA world due to discovery of (AIPMT- 2001)
(1) Absence of RNAs in some cells (2) Genomic RNA
(3) RNA enzymes (4) Synthesis of proteins by mRNA, tRNA, and rRNA.
12. Jacob and Mond proposed operon concept on the basis of their study of lactose metabolism in Escherichia
coli. The concept is applicable to (AIPMT- 2002)
(1) All prokaryotes only (2) All prokaryotes and some eukaryotes
(3) All prokaryotes and all eukaryotes (4) All prokaryotes and some protozoans.
13. First transformation experiment on bacteria was performed on (AIPMT- 2002)
(1) Escherichia coli (2) Salmonella typhimurium
(3) Pasteurella pestis (4) Diplococcus pneumoniae.
14. Out of 64 codons, 61 codes are for 20 types of amino acids. It is due to (AIPMT- 2002, MPPMT -2007)
(1) Overlapping genes (2) Degeneracy of genetic code
(3) Wobbling of codons (4) Universality of codons
15. Exon segments are reunited after splicing by (AIPMT - 2002)
(1) RNA primase (2) RNA protease (3) RNA polymerase (4) RNA ligase
16. Which one is correctly matched with its specificity for an amino acid, start or stop in protein synthesis
(AIPMT- 2002)
(1) UCG – start (2) UUU – stop (3) UGU – Leucine (4) UAC – Tyrosine.
17. A gene encoding for polypeptide of 50 amino acids get mutated at 25 codon UAU becoming UAA. The
result would be (AIPMT - 2003)
(1) Polypeptide of 24 amino acid
(2) Two polypeptides one with 24 amino acids and second with 25 amino acids
(3) A polypeptide with 49 amino acid
(4) A polypeptide of 25 amino acids
NEET_GENETICS - 117
18. During transcription, RNA polymerase binds to DNA site (AIPMT- 2003)
(1) Regulator (2) Promoter (3) Enhancer (4) Receptor.
19. Degeneration of genetic code is due to (AIPMT- 2003)
(1) First member of codons (2)Second member of codons
(3) Third member of codons (4) Entire codons.
20. What does lac refer to in lac operon (AIPMT- 2003)
(1) Lactase (2) 1,00,000 (3) Lac insect (4) Lactose
21. During translation, initiation in prokaryotes GTP is required for (AIPMT- 2003)
(1) Formation of formyl met - tRNA
(2) Binding of 30 S subunit of ribosome with mRNA
(3) Association of 30S - mRNA with formyl - met - tRNA
(4) Association of 50 S subunit of ribosome with initiation complex.
22. In genetic code dictionary, codons used to code for all the 20 essential amino acids are (AIPMT- 2003)
(1) 20 (2) 60 (3) 61 (4) 64
23. In gene mutation, adenine is replaced by guanine. It is (AIPMT- 2004)
(1) Frame-shift mutation (2) Transcription
(3) Transition (4) Transversion
24. The ratio constant for a species is (AIPMT- 2004)
(1) A + G/C + T (2) T + C/G + A (3) A + C/T + G (4) G + C/A + T.
25. In bacterial DNA replication, synthesis starting from the site of origin of replication (AIPMT - 2004)
(1) Involves RNA primers (2) Requires telomerase
(3) Proceeds unidirectionally (4) Moves bidirectionally
26. Telomere of eucaryotic chromosome possesses short segments of (AIPMT- 2004)
(1) Guanine rich repeats (2) Thymine rich repeats
(3) Cytosine rich repeats (4) Adenine rich repeats.
27. DNA finger printing is related to (AIPMT - 2004)
(1) Molecular analysis of profiles of DNA samples
(2) Analysis of DNA samples using imprinting devices
(3) Techniques used for molecular analysis of different specimens of DNA
(4) Techniques used in identification of finger prints of different persons
28. A nutritionally wild type organism which does not require additional biochemicals is
(AIPMT - 2004, HPPMT - 2007)
(1) Prototroph (2) Auxotroph (3) Phenotype (4) Autotroph.
29. On which organism Beadle and Tatum worked to porpose one gene-one enzyme hypothesis
(CPMT - 2004, MPMT - 2007 AIPMT - 2007)
(1) Drosophila (2) Escherichia coli (3) Neurospora crassa (4) Nostoc
30. Protein synthesis in an animal cell occurs (AIPMT - 2005)
(1) On cytosolic ribosomes only
(2) On ribosomes attached to E.R. and nuclear envelope
(3) On ribosomes present in nucleolus as well as cytoplasm
(4) On ribosomes present both in cytoplasm as well as mitochondria.
NEET_GENETICS - 118
31. During transcription, holoenzyme RNA polymerase binds to DNA sequence and DNA assumes a saddle
like structure at that point. The sequence is called (AIPMT - 2005, 2007)
(1) AAAT box (2) TATA box (3) GGTT box (4) CAAT box.
32. Amino acid sequence in protein synthesis is determined by sequence of (AIPMT - 2006)
(1) rRNA (2) tRNA (3) mRNA (4) cDNA.
33. Antibiotic inhibiting interaction between tRNA and mRNA during protein synthesis in bacteria is
(AIPMT - 2006)
(1) Tetracycline (2) Neomycin (3) Erythromycin (4) Streptomycin.
34. Antiparallel strands of DNA molecules means (AIPMT- 2006)
(1) One strand turns clockwise
(2) One strand turns anticlockwise
(3) Phosphate groups of the two strands share the same position their ends
(4) Phosphate groups at the start of the DNA strands are in opposite position
35. Okazaki fragments during DNA replication (AIPMT- 2007)
(1) Polymerise in 3 5 direction and form replication fork
(2) Prove semiconservative DNA replication
(3) Polymerise in 5 3 direction and explain 3 5 DNA replication
(4) Cause transcription
36. A sequential expression of a set of human genes occurs when a steroid molecule binds to (AIPMT - 2007)
(1) mRNA (2) DNA sequence (3) tRNA (4) Ribosome
37. Differentiation of tissues and organs is connected with (AIPMT - 2007)
(1) Differential expression of genes (2) Deletion of genes
(3) Lethal mutations (4) Developmental mutations
38. The two polynucleotide chains of DNA are (AIPMT - 2007)
(1) Discontinuous (2) Antiparallel (3) Parallel (4) Semiconservative
39. In the DNA molecule (AIPMT - 2008)
(1) The proportion of adenine in relation of thymine varies with the organism
(2) There are two strands which run antiparallel one in 5’ 3’ direction and other in 3’ 5’
(3) The total amount of purine nucleotides and pyrimidine nucleotides is not run always equal
(4) There are two strands which run paralled in the 5’ 3’ direction.
40. Which one of the following pairs of codons is correctly matched with their function or the signal for the
particular amino acid ? (AIPMT - 2008)
(1) AUG, ACG – start/methionine (2) UUA, UCA – Leucine
(3) GUU – Alanine (4) UAG, UGA – stop
41. What is antisense technology? (AIPMT - 2008)
(1) When a piece of RNA that is complementary in sequence is used to stop expression of a specific gene
(2) RNA polymerase producing DNA
(3) A cell displaying a foreign antigen used for synthesis of antigens
(4) Production of somoclonal variants in tissue culture.
NEET_GENETICS - 119
42. What is not for genetic code (AIPMT - 2009)
(1) It is unambiguous
(2) A codon in mRNA is read in a non-contiguous fashion
(3) It is nearly universal
(4) It is degenerate
43. Removal of introns and joining the exons in a defined order in a transcription unit is called(AIPMT - 2009)
(1) Capping (2) Splicing (3) Tailing (4) Transformation
44. Semiconservative replication of DNA was first demonstrated in (AIPMT - 2009)
(1) Salmonella typhimurium (2) Drosophila melangaster
(3) Escherichia coli (4) Streptococcus pneumoniae
45. Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a “triplet”
(AIPMT - 2009)
(1) Beadle and Tatum (2) Nirenberg and Mathaei
(3) Hershey and Chase (4) Morgan and sturtevant
46. The one aspect which is not a salient feature of genetic code, is its being (AIPMT - 2010)
(1) Ambiguous (2) Universal (3) Specific (4) Degenerate
47. Select the two correct statements out of the four (a-d) given below about lac operon. (AIPMT - 2010)
(a) Glucose or galactose may bind with the repressor and inactivate it
(b) In the absence of lactose the repressor binds with the operator region
(c) The z-gene codes for permease
(d) This was elucidated by Francois Jacob and jacque Monod
The correct statements are
(1) (a) and (c) (2) (b) and (d) (3) (a) and (b) (4) (b) and (c)
48. Satellite DNA is useful tool in (AIPMT- 2010)
(1) Sex determination (2) Forensic science (3) Genetic engineering (4) Organ transplantation
49. What are those structures that appear as beads - on - string in the chromosomes when viewed under
electron microscope ? (AIPMT- 2011)
(1) Genes (2) Nucleotides (3) Nucleosomes (4) Base pairs
50. Removal of RNA polymerase III from nucleoplasm will affect the synthesis of : (AIPMT Pre. 2012)
(1) t-RNA (2) hn-RNA (3) m-RNA (4) r-RNA
51. Which one of the following is not a part of a transcription unit in DNA ? (AIPMT Pre. 2012)
(1) The inducer (2) A terminator (3) A promoter (4) The structural gene
52. Given below is the diagrammatic representation of one of the categories of small molecular weight organic
compounds in the living tissues. Identify the category shown and the one blank component "X" in it.
(AIPMT Pre. 2012)
Category Component
(1) Cholesterol Guanin
(2) Amino acid NH2
(3) Nucleotide Adenine
(4) Nucleoside Uracil
NEET_GENETICS - 120
53. Removal of introns and joining of exons in a defined order during transcription is called :
(AIPMT Pre. 2012)
(1) Looping (2) Inducing (3) Slicing (4) Splicing

54. Which one of the following represents a palindromic sequence in DNA ? (AIPMT Mains 2012)
(1) 5' - GAATTC - 3'
3' - CTTAAG - 5'
(2) 5' - CCAATG - 3'
3' - GAATCC - 5'
(3) 5' - CATTAG - 3'
3' - GATAAC - 5'
(4) 5' - GATACC - 3'
3' - CCTAAG - 5'
55. What is it that forms the basis of DNA Fingerprinting ? (AIPMT Mains 2012)
(1) The relative proportions of purines and pyrimidines in DNA
(2) The relative difference in the DNA occurrence in blood, skin and saliva
(3) The relative amount of DNA in the ridges and grooves of the fingerprints.
(4) Satellite DNA occurring as highly repeated short DNA segments
56. Read the following four statements (A-D): (AIPMT Mains 2012)
(A) In transcription, adenosine pairs with uracil.
(B) Regulation of lac operon by repressor is referred to as positive regulation.
(C) The human genome has approximately 50,000 genes.
(D) Haemophilia is a sex-linked recessive disease.
How many of the above statements are right ?
(1) Two (2) Three (3) Four (4) One
1. Which is true according to Chargaff’s rule (RPMT-1998)

A T
(1) A + G = T + C (2) A = C (3) G = T (4) =1
C G
2. tRNA takes part in (RPMT- 1998)

(1) Transfer of genetic code to cytoplasm (2) Carry amino acids to ribosomes
(3) Collection of RNA in ribosome (4) Copy the genetic code from DNA in nucleus.
3. RNA code for DNA codon ATG will be (RPMT -1998)

(1) ATG (2) AUG (3) UAC (4) TAC
4. Intron is part of DNA which (RPMT-1998)

(1) Codes for protein synthesis (2) Helps in joining pieces of DNA
(3) Does not code for protein synthesis (4) Initiates transcription.
NEET_GENETICS - 121
5. Reverse transcriptase (AFMC-1999)
(1) Disintegrates host DNA (2) Polymerises host DNA
(3) Translates host DNA (4) Transcribes viral RNA to c DNA
6. Operon contains (Pb. PMT-1999)
(1) Operator and regulator genes
(2) Operator and structural gene
(3) Operator and regulator genes repressor
(4) Operator gene, regulator gene repressor, structural genes and promoter gene
7. Lactose operon produces enzymes (Kerala- 2000)
(1) - galactosidase, permease and glycogen synthetase
(2) -galactosidase, permease and transacetylase
(3) Permease, glycogen synthetase and transacetylase
(4) -galactosidase, permease and phosphoglucose isomerase
(5) - galactosidase, permease and phosphoglucose isomerase.
8. Temin worked on virus (RPMT-2000)
(1) Rhinovirus (2) Dengue virus (3) Herpes virus (4) Retrovirus.
9. Nucleotide pairs present in one turn of DNA helix (MPPMT- 1999, 2000)
(1) 4 (2) 8 (3) 10 (4) 9
10. Types of coiling in DNA is (MPPMT-1999, HPPMT-2007)
(1) Right handed (2) Left handed (3) Zigzag (4) Opposite.
11. Starting and stopping codons are (JKCMEE-1999)
(1) AUG and UGA (2) GUA and AAA (3) UCA and UAA (4) GUC and AUG
12. Which is true for DNA helicases ? (AFMC -1999)
(1) Separate DNA strands and establish replication forks
(2) ATP requiring unwinding enzymes
(3) Hydrolyse ATP
(4) All the above.
13. During elongation of polypeptide chain, sigma factor is (AFMC-1999)
(1) Functionless (2) Retained for specific function
(3) Released for re-use (4) Required during closing of chain
14. In DNA replication, the leading strand is the one which replicates in (DPMT - 1999, PbPMT-1999, 2005)
(1) 5’ 3’ direction continuously (2) 3’ 5’ direction continuously
(3) 5’ 3’ direction discontinuously (4) 3’ 5’ direction discontinuously.
15. Hargobind Khorana was awarded Nobel Prize for (Pb. PMT-1999)
(1) Deciphering genetic code (2) Artificial gene synthesis
(3) Nucleotide sequence of t RNA (4) Discovery of transposons.
16. tRNA has the function of (AMU-1999)
(1) Transcription
(2) Adapter for attaching amino acids over mRNA template
(3) Transferring information to mRNA
(4) Carry genetic code to cytoplasm.
NEET_GENETICS - 122
17. Length of mRNA that carries information for complete polypeptide synthesis is (AMU-1999)
(1) Muton (2) Codon (3) Operon (4) Cistron.
18. Formation of mRNA over DNA template is called (JKCMEE- 2000, karnataka- 2000, CPMT-2007)
(1) Translation (2) Transcription (3) Reverse transcription (4) Transduction
19. Best method to determine parternity is (AIIMS - 2000)
(1) Protein analysis (2) Chromosome counting
(3) Gene counting (4) DNA finger printing
20. Codon AUG specifies (Kerala- 2000)
(1) Methionine (2) Valine (3) Tyrosine (4) Phenylalanine
21. Enzyme required for peptide formation is (Kerala- 2000)
(1) Peptidase (2) Peptidyl transferase (3) Protease (4) Nitrate reductase
22. Extrachromosomal DNA is present in (RPMT - 2000)
(1) Nucleus (2) Glyoxysome (3) Ribosome (4) Chloroplast.
23. Which one codes for an amino acid (Manipal - 2000)
(1) Cistron (2) Exon (3) Intron (4) Codon
24. Okazaki fragments are (Kerala - 2001, CPMT- 2005)
(1) RNA primers (2) Short DNA fragments on leading strand
(3) Short DNA fragements on lagging strand (4) DNA fragements from dimerisation
25. Heat killed pathogenic NL cells and live nonpathogenic cells are mixed and injected into mice. The result
would be (Kerala - 2001)
(1) Mice develop disease and die (2) Mice die without developing disease
(3) Mice remain healthy (4) 50% mice develop disease and die
(5) All mice remain healthy but lose vision
26. In lac operon, lactose of lac operon is (HPPMT- 2001)
(1) Inducer (2) Co-inducer (3) Repressor (4) Co-repressor.
27. Which of the following causes point mutation (DPMT - 2002)
(1) Deletion (2) Inversion (3) Transition (4) All the above
28. Repressor binds to operator of lac operon (Manipal - 2002)
(1) Lactose is unable to remove the repressor (2) RNA polymerase is activated
(3) Galactosidase does not act on lactose (4) Structural genes X, Y and Z fail to transcribe.
29. Enzyme catalysing peptide formation in located in (AMU - 2002)
(1) Smaller subunit of ribosome (2) Larger subunit of ribosome
(3) Central part of tRNA (4) None of the above
30. Diameter of DNA double helix is (BHU-1988,1989, RPMT 1998- CMC 2002 Kerala - 2002,Orissa - 2003, AIEEE - 2003)
(1) 34 Å (2) 20 Å (3) 3·4 Å (4) 340 Å
31. Wobble hypothesis was proposed by (AFMC - 2002, MH - 2007)
(1) Holley (2) Nirenberg (3) Khorana (4) Crick.
32. Chargaff’s rules are applicable to (Karnataka - 2002)
(1) Single stranded RNA (2) Single stranded DNA and RNA
(3) Single stranded DNA (4) Double stranded DNA.
NEET_GENETICS - 123
33. Who was awarded Nobel Prize for in vitro synthesis of polyribonucleotides (RPMT - 2002)
(1) Kornberg (2) Tatum (3) Ochoa (4) Khorana
34. What is correct (Orissa - 2002)
(1) mRNA is polycistronic in eukaryotes and moncistronic in prokaryotes
(2) mRNA is polycistronic in both eukaryotes and prokaryotes
(3) mRNA is monocistronic in both eukaryotes and prokaryotes
(4) mRNA is polycistronic in prokaryotes and monocistronic in eukaryotes
35. VNTR is employed for (AMU -2002, Karnataka - 2006, HPPMT. -2007)
(1) Protoplasmic culture (2) DNA finger printing
(3) Regulation of plant growth hormones (4) Enhancing photosynthesis in desert plant.
36. Smallest part of DNA that can undergo recombination is (DPMT- 2002)
(1) Muton (2) Cistron (3) Replicon (4) Recon
37. DNA molecule has small units called (BHU - 2002)
(1) Purines (2) Adenine and thymine
(3) Cistron, Muton and Recon (4) Adenine
38. In eukaryotes transcription occurs in (BHU - 2002)
(1) Cytoplasm (2) Nucleus (3) Cytosol (4) Matrix.
39. Which of the following is the Pribnow box (Karnataka - 2003)
(1) 5’ TATAAT3’ (2) 5’ TAATTA3’ (3) 5’ AATAAT3’ (4) 5’ATATTA’3.
40. Who discovered genetic code (Wardha - 2003)
(1) Nirenberg (2) Khorana (3) Ochoa (4) Crick
41. Who discovered jumping gene in Maize (CPMT- 2003, BHU - 2006, 2007)
(1) Khorana (2) Morgan (3) McClintock (4) Beadle and Tatum
42. Genes are organised over (CPMT- 2003)
(1) Chromosome (2) Chromonema (3) Lysosome (4) Golgi body
43. Find out the correct matching (Manipal - 2003)
a Helicase i Joining of nucleotides

b Gyrase ii Opening of DNA
c Primase iii Unwinding of DNA
d DNA polymerase III iv RNA priming.
(1) a – ii, b – iii, c – iv, d – i (2) a – i, b – ii, c – iii, d – iv

(3) a – iv, b – iii, c – i, d – ii (4) a – ii, b – iv, c – iii, d – i
44. Watson and Crick shared the Nobel Prize for DNA structure with (DPMT - 2003)
(1) Franklin (2) Pauling (3) Wilkins (4) Tatum
45. DNA was proved to be genetic material through experiment of (Har PMT - 2003)
(1) Transduction (2) Replica experiment
(3) Viral infection of Tobacco (4) Transformation
46. DNA and RNA differs by (BHU - 2003)
(1) Nitrogen bases and sugars (2) Nitrogen bases and phosphate groups
(3) Number of C- atoms in sugars (4) Sugar and phosphate groups.
NEET_GENETICS - 124
47. Break through of the year 2002 is (Kerala- 2003)
(1) mRNA (2) cDNA (3) miRNA (4) rDNA
48. Which one is joining or repair enzyme (AIEEE - 2003)
(1) DNA kinase (2) DNA ligase (3) DNA polymerase (4) Transcriptase
49. cDNA is formed by (DPMT - 2003)
(1) DNA dependent DNA polymerase (2) RNA dependent DNA polymerase
(3) DNA dependent RNA polymerase (4) DNA ligase
50. DNA acts as a template for synthesis of (BCECE- 2003)
(1) RNA (2) DNA (3) Both (1) and (2) (4) Protein
51. Length of DNA with 23 base pairs is (Kerala- 2004)
(1) 78·4 Å (2) 78·2 Å (3) 78 Å (4) 74 ·8 Å
52. The function of promoter in lac-operon is to (AIEEE - 2004)
(1) Bind to gyrase (2) Bind to RNA polymerase
(3) Code for DNA polymerse (4) Process mRNA.
53. Find the correct match (AIIMS - 2004)
(1) UUA – Valine (2) AUG – Cysteine (3) AAA – Lysine (4) CCC– Alanine
54. The Z-DNA helix is left handed and has a structure that repeats every (BCECE- 2004)
(1) 2 base pairs (2) 3 base pairs (3) 4 base pairs (4) 5 base pairs
55. The double helix model of Watson and Crick is known as (CPMT- 2004)
(1) C-DNA (2) B-DNA (3) Z-DNA (4) D-DNA
56. In lac-operon, repressor protein binds to (Manipal- 2004, Karnataka - 2006)
(1) Regulator gene (2) Operator gene (3) Promoter gene (4) Structural gene
57. – CCA 3’ end of t-RNA is called (Manipal- 2004)
(1) Anticodon loop (2) DHU loop (3) T C (4) Amino acid binding site
58. Main function of mRNA is (JIPMER- 2004)
(1) Acting as template for RNA (2) DNA synthesis
(3) Protein synthesis (4) Conversion of DNA to RNA
59. Portion of gene which is transcribed but not translated is (CPMT - 2005)
(1) Exon (2) Intron (3) Cistron (4) Codon.
60. Haploid and monoploid numbers of chromosomes of hexaploid Wheat are (CPMT - 2005)
(1) 21 and 42 (2) 7 and 21 (3) 21 and 7 (4) 42 and 21
61. Mode of DNA replication in Escherichia coli is (CPMT - 2005)
(1) Conservative and unidirectional (2) Semiconservative and unidirectional
(3) Conservative and bidirectional (4) Semiconservative and bidirectional.
62. Which one is wrong ? (Manipal - 2005)
(1) DNA cannot produce its copies without DNA polymermase
(2) DNA cannot produce RNA
(3) RNA produces complementary DNA
(4) DNA helps in protein synthesis
NEET_GENETICS - 125
63. Denaturation of DNA after heating can be studied by comparing (Wardha - 2005)
(1) Number of nucleotides (2) A : T ratio
(3) C : G ratio (4) Sugar p hosphate ratio
64. Supercoiled DNA occurs in (Wardha - 2005)
(1) Prokaryotes and eukaryotes (2) Prokaryotes only
(3) Eukaryotes only (4) None of these
65. The bond formed between phosphate and pentose sugars of DNA is (RPMT - 2005)
(1) Sulphide bond (2) Phosphodiester bond
(3) Hydrogen bond (4) Covalent bond
66. In DNA finger printing, analysis is made of (DPMT - 2005)
(1) Satellite DNA (2) Moderately repetitive sequences
(3) microsatellites (4) Variable number of tandem repeats.
67. Matching DNA sequence of criminal with suspect is known as (AMU - 2005)
(1) DNA finger printing (2) DNA amplification (3) Gene mapping (4) DNA resolution
68. Unwinding due to release of coiling tension ahead of moving replication fork is due to
(DPMT- 2005, Kerala - 2006)
(1) Gyrase (2) Unwindase (3) Topoisomerase (4) All the above
69. Synthesis of RNA molecule is terminated by (DPMT - 2005, AMU - 2005)
(1) Alpha factor (2) Gamma factor (3) Delta factor (4) rho factor
70. Lac operon concept was proposed by (DPMT - 2005)
(1) Jacob and Monod in 1961 (2) Jacob and Monod in 1969
(3) Watson and Crick in 1953 (4) Watson and Crick in 1963
71. Transcription (DPMT - 2005)
(1) Starts at initiations region and ends at stop region
(2) Starts at operator region and ends at telomeric end
(3) Starts at promoter region and ends are terminator region
(4) Starts at CCA box and ends at TATA box.
72. Chromosome breaks and the two fragments join together but after rotating at 180º. The aberration is called
(DPMT - 2005)
(1) Translocation (2) Inversion (3) Tandem duplication (4) Reverse tandem duplication.
73. In ATG ACC AGG ACC CCA ACA sequence, the first base gets mutated. It will affect (Kerala - 2005)
(1) Change in types and sequence of amino acids
(2) Change in first amino acid only
(3) No change
(4) One amino acid less
74. In lac operon system, lac gene –1 codes for (BHU - 2005)
(1) Inducer (2) Repressor (3) Promoter (4) -galactosidase
75. Why does cytosine make pair with guanine and not with adenine (Pb. PMT - 2005)
(1) Polar nature of C and A
(2) C - A pair would not reach across the double helix
(3) C - A pair would be wider than double helix
(4) Hydrogen bond forming functional groups are not complementary between C and A
76. UV exerts action through (Pb. PMT - 2005)
(1) Photodynamic action (2) Destruction of H-bonds
(3) Formation of pyrimidine (4) Formation of sticky metaphase.
NEET_GENETICS - 126
77. Adenine is 30%. What would be percentage of guanine (Har. PMT - 2005)
(1) 10% (2) 20% (3) 30% (4) 40%
78. Hn-RNA is (Har. PMT 2005)
(1) Heteronuclear RNA (2) Homonuclear RNA (3) Heterogeneous RNA (4) Useful RNA.
79. In lac operon, sturctural gene ‘Z’ synthesises (AMU - 2005)
(1) -galactosidase (2) Galactosidase permease
(3) Galactosidase transacetylase (4) None of the above.
80. Continuously functional genes which are regulated on the tissue level are (AMU - 2005)
(1) House keeping genes (2) Luxury genes
(3) Mild genes (4) Gene battery.
81. When lactose is added to culture of Escherichia coli, its molecules get into cell with the help of
(Manipur - 2005)
(1) Lactase (2) Galactosidase (3) Permease (4) Transacetylase.
82. Which are termination codons? (Kerala- 2006)
(1) UAA, UAG and UGA (2) GUA, GUG, GCG and GAA
(3) UUG, UUG, CCU, CAA and CUA (4) UUA, UUG, CUU, CUC, CUA and CUG
(5) AAG, AAG, GAC and CGG.
83. Match the columns (Kerala - 2006)
I II
a Termination 1 Aminoacyl tRNA synthetase
b Translation 2 Okazaki fragments
c Transcription 3 GTP dependent release factor
d DNA replication 4 DNA polymerase
(1) a – 2, b – 3, c – 1, d – 4 (2) a – 1, b – 4, c – 2, d – 3
(3) a – 3, b – 1, c – 4, d – 2 (4) a – 2, b – 4, c – 1, d – 3
(5) a – 2, b – 4, c – 1, d – 3.
84. In double helix model of DNA, how far is each base pair from the next base pair (Kerala - 2006)
(1) 3 · 4 nm (2) 0 · 34 nm (3) 2 · 0 nm (4) 34 nm
85. Which amino acid is specified by genetic codes ACU, ACC, ACA, ACG showing degeneracy
(1) Leucine (2) Methionine (3) Glycine (4) Threonine (Manipur - 2006)
86. Transfer of DNA bands from agarose gel to nitrocellulose or nylon membrane is (Kerala - 2006)
(1) Southern transfer (2) Western transfer (3) Northern transfer (4) Eastern transfer
87. DNA element with ability to change its position is (BHU - 2006)
(1) Cistron (2) Transposon (3) Intron (4) Recon.
88. Match the columns I and II (Kerala - 2007)
I II
1 450 – 700 genes a Escherichia coli
2 4000 genes b Drosophila melanogaster
3 13000 genes c Mycoplasma
4 32000 – 50000 gene d Homo sapiens
5 35000 – 45000 gene e Oryza sativa
(1) 1 – b, 2 – a, 3 – e, 4 – c, 5 – d (2) 1 – c, 2 – a, 3 – b, 4 – e, 5 – d
(3) 1 – c, 2 – b, 3 – a, 4 – e, 5 – d (4) 1 – b, 2 – c, 3 – a, 4 – e, 5 – d
89 The genome of Coenorhabditis elegans has (Kerala - 2007)
(1) 3 billiion bp and 30, 000 genes (2) 180 million bp and 13000 genes
(3) 4· 7 million bp and 4000 genes (4) 97 million bp and 18000 genes
NEET_GENETICS - 127
90. Complete turns in 45000 bp DNA would (Karnataka - 2007)
(1) 45 (2) 450 (3) 4500 (4) 45, 000.
91. Terminious central dogma of protein synthesis is (Karnataka - 2007)
(1) DNA — DNA — mRNA — protein (2) mRNA — gRNA — DNA — Protein
(3) gRNA — DNA — mRNA — Protein (4) DNA — gRNA — mRNA — Protein
92. Which is wrong (COMED–K’s - 2007)
(1) A + G = T + C (2) A + T =G + C (3) G = C (4) A = T
93. Enzyme responsible for DNA chain elongation is (COMED – K’s - 2007)
(1) DNA polymerase II (2) DNA ligase (3) RNA poymerase III (4) DNA polymerase III
94. AUG codon is (JKCMEE - 2007)
(1) Ochre (2) Amber (3) Initiation codon (4) Opal.
95. While working on Neurospora crassa Beadle and Tatum proved (CPMT - 2007)
(1) Every gene is responsible for a specific enzyme
(2) Plant cells are totipotent
(3) DNA replication is semiconservative
(4) Viruses have genetic material.
96. C-value paradox is (CPMT - 2007)
(1) Diploid DNA content (2) Haploid DNA content
(3) Variation is C- value (4) Constancy of C-value
97. DNA replication requires (MPPMT- 2007)
(1) DNA polymerase (2) DNA ligase (3) RNA polymerase (4) All the above
98. DNA is acidic acid due to (MPPMT- 2007)
(1) Sugar (2) Purine (3) Phosphoric acid (4) Pyrimidine
99. Which conserved motifs occur in Escherichia coli genes (DPMT - 2007)
(1) TATA box (2) CAAT box (3) Pribnow box (4) None of the above
100. Central dogma of molecular biology was modified with the discovery of (DPMT - 2007)
(1) Ligase (2) RNA polymerase (3) DNA polymerase (4) Reverse trascriptase
101. Anitcodon is present on (AFMC - 2007)
(1) rRNA (2) mtRNA (3) tRNA (4) mRNA.
102. In retroviruses RNA dependent DNA polymerase synthesizes (DPMT - 2007)
(1) DNA (2) RNA (3) RNA - DNA (4) None of these.
103. The RNA primer is used in (DPMT - 2007)
(1) Translation (2) Replication (3) Conjugation (4) Transformation
104. A nucleoside is (BCECE- 2007)
(1) purine / pyrimidine + phosphate (2) purine / pyrimidine + sugar
(3) pyrimidine + purine + phosphate (4) Purine + sugar + phosphate
105. The diameter of Z-DNA is (BCECE- 2007)
(1) 34Å (2) 20Å (3) 18Å (4) 45Å
106. In a DNA, percentage of thymine is 20% What is the percentage of guanine (CPMT- 2007)
(1) 20% (2) 40% (3) 30% (4) 60%
107. The sequence of events mentioned below are symbolised by alphabets. Choose the correct answer where
the alphabets are matched with the processes (KCET - 2008)
a b c d
RNA DNA DNA mRNA Polypeptide
(1) a = Reverse transcription. b= Replication, c = Transcription, d = Translation
(2) a = Replication, b = Transformation, c = Transcription, d = Translation
(3) a = Reverse transcription, b = Transformation c= Transcription, d = Translation
(4) a = Replication, b = Transduction. c = Translation, d = Transcription.
NEET_GENETICS - 128
108. According to the lac-operon concept, which functional unit of the bacterial genetic material is responsible
for suppressing the activity of the operator gene in the absence of lactose (KCET-2008)
(1) Structural gene (2) Regulator gene (3) Repressor protein (4) Promoter gene.
109. During translation in eukaryotes the anticodon to be aligned with the initiation codon is
(COMEDK’s - 2008)
(1) 5’ – UAC – 3’ (2) 3’ – UAC – 5’ (3) 5’ – UCA – 3’ (4) 3’ – CAU – 5’
110. Larger subunit of the Ribosome helps in producing (COMEDK’s - 2008)
(1) Gyrase (2) Topoisomerase (3) Peptidyl transferase (4) RNA-polymerase.
111. The sequence in m-RNA transcribed from a piece of DNA having a sequence ATTGCATCT is
(Orissa - 2008)
(1) TAAATGGCC (2) UAACGUAGA (3) TAACGTAGA (4) AATTGCAGA
112. In a DNA segment having six coils, there are 22 nitrogen base pairs linked by two hydrogen bonds. How
many cytosine bases are found in that segment (EAMCET - 2008)
(1) 22 (2) 38 (3) 44 (4) 76
113. Identify the triplet codons which code for amino acids serine and proline. (EAMCET - 2008)
(a) UCC (b) CCA (c) GGG (d) AAG
The correct answer is
(1) a and c (2) b and d (3) c and d (4) a and b
114. The strand of DNA acting as template for m-RNA transcription is (EAMCET - 2008)
(a) Coding strand (b) Noncoding strand (c) Sense strand (d) Antisense strand
The correct answer is
(1) a and c (2) a and d (3) b and c (4) b and d
115. The haploid content of human DNA is (KPMT - 2008)
9 9 6
(1) 3·3 × 10 bp (2) 3·3 × 10 kbp (3) 4·6 × 10 bp (4) 48502 bp
116. The basis of DNA finger-printing is (KPMT - 2008)
(1) The double helix (2) Error in base sequence
(3) Polymorphism in sequence (4) DNA replication
(5) DNA coiling
117. What is C-value paradox (BCECE 2008)
(1) Haploid DNA content (2) Huge variations in C-values between species
(3) Constant C-value for all species (4) Diploid DNA conent
118. An eukaryotic gene contains two kinds of base sequences. Which of these plays an important role in
protein synthesis (CPMT 2008)
(1) Introns (2) Exons (3) Both (1) and (2) (4) None of these
119. Out of 64 codons only 61 codons code for the 20 different amino acids. This character of genetic code is
called (BCECE 2008)
(1) degeneracy (2) non-ambiguous nature
(3) redundancy (4) overlapping
120. Width of the DNA molecule is (BHU 2009)
(1) 15 Å (2) 20 Å (3) 25 Å (4) 34 Å
121. The functional unit of DNA molecule that codes for a particular gene product is (AFMC 2009)
(1) Cistron (2) Exon (3) Intron (4) Gene

122. The initiation codon in eukaryotes is (AFMC 2009)
(1) AUG (2) UGA (3) UAG (4) UAA
NEET_GENETICS - 129
PART- 2
Section-A (1 marks each)

1. Mention the polarity of the DNA stands a — b and c-d shown in the replicating fork given below :
[CBSE 2008]
2. When and a what end does the 'tailing' of hnRNA take place ? [CBSE 2009]
3. Name one autosomal dominant and one autosomal recessive Mendelian disorder in humans.[CBSE 2010]
4. Name the enzyme involved in the continuous replication of DNA strand. Mention the polarity of the template
strand. [CBSE 2010]
5. Mention the role of the codons AUG and UGA during protein synthesis. [CBSE 2011]
6. A garden pea plant produced axial white flowers. Another of, the same species produced terminal violet
flowers. Identify the dominant traits. [CBSE 2012]
Section-B (2 marks each)

1. A plant of Antirrhinum majus with red flowers was crossed with another plant of the same species with
white flowers. The plants of the F 1 generation bore pink flowers. Explain the pattern of inheritance with
the help of a cross. [CBSE 2008]

OR
A woman with blood group O married a man with AB group. Show the possible blood groups of the
progeny. List the alleles involved in this inheritance.
2.
[CBSE 2009]
(a) Name the molecule 'X' synthesised by 'i' gene. How does this molecule get inactivated?
(b) Which one of the structural genes codes for -galactosidase?
(c) When will the transcription of this gene stop?
NEET_GENETICS - 130
3. How do histones acquire positive charge ? [CBSE 2011]
4. (a) Draw a neat labelled diagram of a nucleosome. [CBSE 2012]
(b) Mention what enables histones to acquire a positive charge.
Section-C (3 marks each)
1. [CBSE 2008]
Study the mRNA segment given above which is complete to be translated into a polypeptide chain.
(i) Write the codons ‘a’ and ‘b’
(ii) What do they code for ?
(iii) How is peptide bond formed between two amino acids in the ribosome?
2. Study the given pedigree chart and answer the questions that follow : [CBSE 2008]
(a) Is the trait recessive or dominant’?

(b) Is the trait sex-linked or autosomal?
(c) Give the genotypes of the parents is generation I and of their third and fourth child in generation
3. (a) Draw the stucture of the initiator tRNA adaptor molecule. [CBSE 2008]
(b) Why is tRNA called an adaptor molecule?
(b) t- RNA is called an adaptor molecule because on one hand it read the code on m RNA and on other
hand it would bind to specific amino acid.
4. Recently a girl baby has been reported to suffer from haemophilia. How is it possible ?
Explain with the help of a cross. [CBSE 2009]

OR
What are satellite DNA in a genome? Explain their role in DNA finsgerprinting.
NEET_GENETICS - 131
Section - D (5 marks each)
1 (a) Draw a schematic representation of the structure of a transcription unit and show the following
in it:
(i) Direction in which the transcription occurs
(ii) Polarity of the two strands involved
(iii) Template strand
(iv) Terminator gene
(b) Mention the function of promoter gene in trascription. [CBSE 2009]
OR
(a) In human geonome which one of the chromosomes has the most genes and which one has the fewest ?
(b) Scientists have identified about 1.4 million single nucleotide polymorphs in human genome. How is the
information of their existence going to help the scientists ?
2. In a series of experiments with Streptococcus and mice F. Griffith concluded that R-strain bacteria had
been transformed. Explain. [CBSE 2010]
3. How are dominance, co-dominance and incomplete dominance patterns of inheritance different from each
other ? [CBSE 2011]
4. The base sequence in one of the strands of DNA is TAGCATGAT [CBSE 2011]
(i) Give the base sequence of its complementary strand.
(ii) How are these base pairs held together in a DNA molecule ?
(iii) Explain the base complementarity rules. Name the scientist who framed this rule.
5. (a) Sickle cell anaemia in humans is a result of point mutation. Explain. [CBSE 2011]
(b) Write the genotypes of both the parents who have produced a sickle cell anaemic offspring.
6. (a) Explain the phenomenon of multiple allelism and co-dominance taking ABO blood group as an example.
(b) What is the phenotype of the following : [CBSE 2012]
(i) I AI o
(ii) I oI o
7. List the salient features of double helix structure of DNA.
OR
How are the structural genes activated in the lac operon in E. coli? [CBSE 2012]
8. A tall pea plant with yellow seeds (heterozygous for both the traits) is crossed with a dwarf pea plant
with green seeds. Using a Punnett square work out the cross to show the phenotypes and the geno-
types of F1 generation. [CBSE 2008]
OR
(a) Why is DNA molecule a more stable genetic material than RNA? Explain.
(b) “Unambiguous”, “degenerate” and “universal” are some of the salient features of genetic code.
Explain.
9. What is ‘semi-conservative’ DNA replication? How was it experimentally proved and by whom?
OR
NEET_GENETICS - 132
A homozygous tall pea plant with green seeds is crossed with a dwarf pea plant with yellow seeds.
(i) What would be the phenotype and genotype ? [CBSE 2008]

(ii) Work out the phenotypic ratio of F generation with the help of a Punnett square.
2
10. Given below is a table showing the genotypes and the phenotypes of blood groups in the human population:
S.No. Genotype Phenotype
1 (W) A
2 I BI O (Y)
3 I AI B (Z)
4 (X) O
(i) Identify the genotype (W) and (X) and the phenotypes (Y) and (Z).
(ii) How is co-dominance different from incomplete dominance and dominance?
(iii) Name the pattern of inheritance exhibited by the phenotypes (Y) and (Z) in the table.
OR
Diagrammatically represent a portion of the double stranded polypeptide chain sequence in a DNA molecule
involving all the four nitrogenous bases. [CBSE 2008]
11. How did Hershey and Chase prove that DNA is the hereditary material? Explain their experiment with
suitable diagrams.
OR
A particular garden pea plant produces only violet flowers.
(a) Is it homozygous dominant for the trait or heterozygous ?
(b) How would your ensure its genotype ? Explain with the help of crosses.
12. (a) State the law of independent assortment. [CBSE 2010]
(b) Using Punnett Square demonstrate the law of independent assortment in a dihybrid cross involving
two heterozygous parents.
OR
How did Alfred Hershey and Martha Chase arrive at the conclusion that DNA is the genetic material?
13. Describe Frederick Griffith’s experiment on Streptococcus pneumoniae. Discuss the conclusion he
arrived at.
OR
(a) Explain a monohybrid cross taking seed coat colour as a trait in Pisum sativum. Work out the cross
upto F2 generation.
(b) State the laws of inheritance that can be derived from such a cross .:
(c) How is the phenotypic ratio of F2 generation different in a dihybrid cross? [CBSE 2012]
NEET_GENETICS - 133
BOARD LEVEL EXERCISE : HINT & SOLUTIONS
1. 2n (n = number of loci) and therefore, 24 = 16 type of gametes.
2. Hugo de Vries of Holland, Carl Correns of Germany and Erich von Tschermak of Austria.
3. DNA fingerprinting is a modern techneque of identifying individuals by comparing nucleotide sequences of

their DNAs.
4. These are short nucleotide repeats in the DNA that vary in number from person to person, but are inherited.
5.
(a) Tall and green ( ) 3/8 or 6/16, i.e., 37.5% (b) Dwarf green (x) 1/8 or 2/16, i.e., 12.5%
6. Given : Father A group × Mother B type
Child O
O is a recessive group due to I0 I0. It is possible when both the parents have allele |0 and therefore,
genotype of father and mother are
The possibility of blood groups in offspring of this couple is AB, A, B, O.

7. First make template strand on the given coding strand of DNA. Then the RNA is trancribed on this template
strand.
DNA coding strand –5' ATGCATGCATGC ATGCATGCA TGC ATGC 3'
Template strand – 3' TACGTACGTACGTACGTACGTACGTACG 5'
RNA strand – 5' AUGCAUGCAUGCAUGCAUGCAUGCAUGC 3'
8. Promoter : It is one of the three components of a transcription unit that takes part in transcription, It is
located at the start 5' end and provides site for attachment of transcription factors (TATA Box) and RNA
polymerase.
tRNA : It takes part in the transfer of activated amino acids from cellular pool ot ribosome for their taking
part in protein formation.
Exons : In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which
are transcribed and translated both.
NEET_GENETICS - 134
9. (ii) Multiplication of Bacteriophage (Transduction) :
The transfer of genetic material from one bacterium to another through bacteriophage is called transduction.
T2 is a Bacteriophage which infects E. coli.
Hershey and Chase (1952) used radioactive phosphorus 32P & radio-active sulphur 35S for their experiment
and proved that DNA is a genetic matarial.
10. (i) Sequencing of more than 3 × 109 bp.

(ii) Identification of all the genes present in human genome.
(iii) High expenditure of more than 9 billion dolars.
(iv) Identification of all the alleles of genes and their functions.
(v) Storage of data for sequencing would require space equal to 3300 books of 1000 pages it each page
contains 1000 letters.
11. II (N15 – N15)
II II All N15–N14 Ist Generation
II II II II 50% N15– N14 : 50% N14 – N14 IInd generation

(a) all DNAs will have N15 after I round of replication
(b) after two rounds , 50% DNA will be have N15 and 50% as N14.
12. Mechanism of DNA Replication :

(1) Origin of Replication :
It starts at a particular place called origin of replication or Ori. In procaryotes replication starts at one
point & entire DNA strand takes part in replication thus it contains single replicon while in Eucaryotes
several replicons present.
DNA replicaton is bidirectional, semidiscontinuous and semiconservative in eucaryotes .
(2) Activation of Deoxyribonucleotides :
The phosphorylated nucleotides (deAMP, deGMP, deCMP , deTMP) are found in inactivated form. they
react with ATP in the presence of phosphorylase enzyme & converted in to active deATP, deGTP,
deCTP, deTTP.
NEET_GENETICS - 135
(3) Exposure of DNA helix :
Helicase enzyme acts over the ori site of DNA template and unwinds the two strands of DNA.
SSB (single stranded binding) Protein prevents the recoiling of uncoiled DNA strands.
Topoisomerases cause nicking of one strand of DNA (for removing coils) and resealing the same.
Along with Topoisomerase, bacteria possess another enzyme called DNA Gyrases which can intro-
duce negative supercoils.
Whole of the DNA does not open in one stretch due to very high energy requirement but the point of
separation proceeds slowly from one end to other . It gives the appearance of Y-shaped structure called
replication fork.
(4) RNA Primer :

It is small strand of RNA (5–10 nucleotide). It is synthesized at 5’end of new strand with help of enzyme
Primase. Formation of RNA primer constitutes the initiation phase of synthesis because without the
presence of RNA primer, DNA polymerases can not add nucleotides.
In eucaryotes, the function of primase is carried out by enzyme DNA polymerase .
(5) DNA Polymerases :

Prokaryotes possess three types of DNA synthesising enzymes called DNA polymerases III, II and I
they add nucleotides in 5’ 3’ direction on 3’ 5’ strand. DNA replication is mainly performed by DNA
polymerase III. DNA polymerase I is major repair enzyme where as polymerase II is minor repair enzyme.
In eukaryotes five types of DNA polymerases ( have been reported. out of them
are major enzymes. According to sugino et al, DNA polymerase acts at both the leading and lagging
strands and initiates DNA synthesis along with primase activity while DNA polymerase are involved in
elongation of the leading and lagging strands respectively.
(6) Base Pairing :

Two separated strands of DNA in the replication fork function as template.
Deoxyribnucleoside tri phosphates come to lie opposite the nitrogen bases of exposed DNA
templates – deTTP opposite-A, deCTP opposite G, deATP opposite T and deGTP opposite C.
With the help of pyrophosphatase enzyme the two extra phosphates present on the dexyribonucleotides
NEET_GENETICS - 136
separate. Energy is released in this process that is utillized for base pairing.
Energy is used in establilshing hydrogen bonds between the free nucleotides and nitrogen bases of
templates.
(7) Chain formation :
It requires DNA polymerase III in procaryotes and polymerase δ/ in eucaryotes. DNA polymerase
III is a complex enzyme having seven subunits ( ).
++
In the presence of Mg , ATP/ GTP, TPP and DNA polymerase -III, the adjacent nucleotides attached to
nitrogen bases of each template DNA strand establish phosphodiester bonds and get linked to form
replicated DNA strand. Two strands of DNA run antiparalled to each other.
Replication on one DNA template is continuous in 5’ 3’ direction due to opening of its 3’ end this newly
formed strand is called leading strand.
On the second DNA template the replication of DNA is discontinuous due to opening of small stretch of
fork at a time. Small fragments deposite with the help of RNA primer. these fragements are called okazaki
fragements (1000 - 2000 nucleotides in prokaryotes and 100–200 in eukaryotes).
After deposition of each okazaki fragment RNA primer is released and gap is filled by the activity of DNA
polymerase thus the new strand is formed called Lagging strand.
After deposition of bases DNA Ligase enzyme seals these bases.
Thus one strand grows continuously while the other strand is formed discontinuously hence DNA replica-
tion is semidiscontiuous.
(8) Proof reading and DNA repair:

Sometimes wrong base is deposited in the strand. DNA poymerase III is able to check this error and
removes the wrong base. It allows addition of proper base but DNA polymerase III can not distinguish
uracil from thymine such an error is corrected by number of enzymes.
DNA polymerase I removes the wrong base and attaches the correct base in the strand in Prokaryotes
where as DNA polymerase in eukaryotes.
OR
A = DNA helix, B = Sigma factor, C = Promoter, D = RNA polymerase, E = Terminator,

F = RNA G = rho factor.
EXERCISE - 1
1. (2) 2. (3) 3. (3) 4. (3) 5. (3) 6. (1) 7. (3)
8. (4) 9. (4) 10. (4) 11. (1) 12. (2) 13. (4) 14. (2)
15. (1) 16. (2) 17. (1) 18. (3) 19. (2) 20. (3) 21. (3)
22. (2) 23. (4) 24. (2) 25. (2) 26. (1) 27. (4) 28. (3)
29. (2) 30. (4) 31. (4) 32. (2) 33. (4) 34. (3) 35. (2)
36. (4) 37. (4) 38. (3) 39. (2) 40. (2) 41. (1) 42. (4)
43. (3) 44. (2) 45. (1) 46. (2) 47. (4) 48. (2) 49. (3)
50. (2) 51. (4) 52. (1) 53. (1) 54. (4) 55. (2) 56. (2)
57. (3) 58. (3) 59. (1) 60. (4) 61. (3) 62. (1) 63. (2)
64. (1) 65. (1) 66. (2) 67. (1) 68. (3) 69. (1) 70. (3)
71. (3) 72. (4) 73. (3) 74. (4) 75. (3) 76. (1) 77. (3)
78. (1) 79. (2) 80. (3) 81. (3) 82. (1) 83. (4) 84. (2)
85. (4) 86. (3) 87. (2) 88. (4) 89. (4) 90. (1) 91. (2)
92. (4) 93. (3) 94. (2) 95. (2) 96. (1) 97. (2) 98. (2)
99. (2) 100. (4) 101. (2) 102. (4) 103. (4) 104. (1) 105. (3)
NEET_GENETICS - 137
106. (1) 107. (2) 108. (3) 109. (1) 110. (2) 111. (1) 112. (4)
113. (1) 114. (1) 115. (1) 116. (3) 117. (4) 118. (2) 119. (4)
120. (1) 121. (1) 122. (4) 123. (2) 124. (3) 125. (4) 126. (4)
127. (2) 128. (4) 129. (4) 130. (4) 131. (3) 132. (1) 133. (4)
134. (2) 135. (1) 136. (2) 137. (1) 138. (4) 139. (2) 140. (1)
141. (3) 142. (3) 143. (3) 144. (1) 145. (4) 146. (2) 147. (1)
148. (3) 149. (2) 150. (2) 151. (3) 152. (1) 153. (1) 154. (4)
155. (2) 156. (1) 157. (2) 158. (4) 159. (2) 160. (4) 161. (2)
162. (4) 163. (2) 164. (3) 165. (1) 166. (4) 167. (3) 168. (1)
169. (3) 170. (2) 171. (1) 172. (3) 173. (2) 174. (3) 175. (1)
176. (2) 177. (1) 178. (2) 179. (3) 180. (4) 81. (2) 182. (3)
183. (2)
EXERCISE - 2
1. (4) 2. (1) 3. (3) 4. (4) 5. (1) 6. (2) 7. (1)
8. (2) 9. (2) 10. (C) 11. (B) 12. (C) 13. (B) 14. (D)
EXERCISE - 3
1. (4) 2 (2) 3. (1) 4. (1) 5. (1) 6. (3) 7. (2)
8. (2) 9. (2) 10. (4) 11. (3) 12. (3) 13. (1) 14. (4)
15. (4) 16. (4) 17. (2) 18. (3) 19. (3) 20. (3) 21. (2)
22. (2) 23. (3) 24. (2) 25. (4) 26. (1) 27. (3) 28. (3)
29. (3) 30. (3) 31. (1)
EXERCISE - 4
LEVEL - 1
1. (2) 2. (3) 3. (1) 4. (4) 5. (1) 6. (3) 7. (1)
8. (4) 9. (2) 10. (4) 11. (3) 12. (1) 13. (2) 14. (2)
15. (2) 16. (4) 17. (3) 18. (3) 19. (4) 20. (1) 21. (1)
22. (2) 23. (2) 24. (3) 25. (4) 26. (1) 27. (1) 28. (4)
29. (3) 30. (2) 31. (3) 32. (3) 33. (2) 34. (1) 35. (2)
36. (2) 37. (3) 38. (4) 39. (2) 40. (3) 41. (4) 42. (3)
43. (4) 44. (2) 45. (1) 46. (4) 47. (4) 48. (2) 49. (3)
50. (3) 51. (4) 52. (3) 53. (3) 54. (3) 55. (4) 56. (2)
57. (3) 58. (2) 59. (3) 60. (4)
LEVEL - 2
1. (3) 2. (1) 3. (4) 4. (3) 5. (3) 6. (3) 7. (1)
8. (2) 9. (2) 10. (1) 11. (2) 12. (3) 13. (4) 14. (4)
15. (2) 16. (1) 17. (2) 18. (1) 19. (2) 20. (1) 21. (1)
NEET_GENETICS - 138
22. (4) 23. (3) 24. (2) 25. (1) 26. (1) 27. (1) 28. (4)
29. (1) 30. (4) 31. (3) 32. (2) 33. (1) 34. (1) 35. (3)
36. (2) 37. (3) 38. (2) 39. (4) 40. (3) 41. (2) 42. (4)
43. (4) 44. (3) 45. (1) 46. (2) 47. (3) 48. (2) 49. (1)
50. (3) 51. (1) 52. (3) 53. (2) 54. (3) 55. (1) 56. (2)
57. (4) 58. (2) 59. (3) 60. (3) 61. (4) 62. (1) 63. (3)
64. (1) 65. (2) 66. (1) 67. (1) 68. (4) 69. (2) 70. (2)
71. (4) 72. (3) 73. (2) 74. (2) 75. (3) 76. (1) 77. (1)
78. (1) 79. (1) 80. (2) 81. (4) 82. (1) 83. (2) 84. (1)
85. (4) 86. (1) 87. (3) 88. (4) 89. (1) 90. (4) 91. (3)
92. (2) 93. (4) 94. (3) 95. (3) 96. (3) 97. (4) 98. (4)
99. (4) 100. (3) 101. (1) 102. (2) 103. (1) 104. (2) 105. (3)
106. (2) 107. (4) 108. (2) 109. (4) 110. (4) 111. (3) 112. (4)
113. (2) 114. (1) 115. (4) 116. (2) 117. (1) 118. (3) 119. (1)
120. (2) 121. (4) 122. (1) 123. (3) 124. (3) 125. (2) 126. (3)
127. (2) 128. (4) 129. (2) 130. (2) 131. (4) 132. (3) 133. (4)
134. (1) 135. (1) 136. (2) 137. (2) 138. (2) 139. (2) 140. (1)
141. (4) 142. (2) 143. (1) 144. (1) 145. (2) 146. (3) 147. (1)
EXERCISE - 1
1. (3) 2. (2) 3. (4) 4. (3) 5. (3) 6. (2) 7. (3)

8. (4) 9. (1) 10. (1) 11. (4) 12. (3) 13. (3) 14. (3)
15. (1) 16. (2) 17. (4) 18. (2) 19. (1) 20. (2) 21. (2)
22. (1) 23. (1) 24. (1) 25. (1) 26. (3) 27. (3) 28. (2)
29. (2) 30. (3) 31. (2) 32. (1) 33. (1) 34. (4) 35. (2)
36. (3) 37. (3) 38. (4) 39. (1) 40. (1) 41. (4) 42. (4)
43. (3) 44. (2) 45. (3) 46. (3) 47. (3) 48. (1) 49. (1)
50. (3) 51. (2) 52. (3) 53. (1) 54. (2) 55. (1) 56. (3)
57. (2) 58. (3) 59. (2) 60. (1) 61. (4) 62. (3) 63. (1)
64. (1) 65. (2) 66. (2) 67. (2) 68. (2) 69. (2) 70. (2)
71. (4) 72. (4) 73. (2) 74. (3) 75. (4) 76. (3) 77. (2)
78. (2)
EXERCISE - 2
1. (4) 2. (3) 3. (C) 4. (D) 5. (A)
NEET_GENETICS - 139
EXERCISE - 3
1. (2) 2. (1) 3. (2) 4. (1) 5. (2) 6. (1) 7. (4)
8. (1) 9. (2) 10. (3) 11. (3) 12. (4) 13. (1) 14. (2)
15. (4) 16. (4) 17. (1) 18. (2) 19. (1) 20. (3) 21. (1)
22. (4) 23. (1) 24. (2) 25. (4) 26. (3)
EXERCISE - 4
PART- 1
LEVEL - 1
1. (1) 2. (1) 3. (2) 4. (1) 5. (4) 6. (1) 7. (4)

8. (1) 9. (2) 10. (2) 11. (3) 12. (3) 13. (4) 14. (3)
15. (4) 16. (4) 17. (1) 18. (2) 19. (3) 20. (4) 21. (3)
22. (3) 23. (3) 24. (4) 25. (4) 26. (1) 27. (1) 28. (1)
29. (3) 30. (4) 31. (2) 32. (3) 33. (2) 34. (4) 35. (3)
36. (2) 37. (1) 38. (2) 39. (2) 40. (4) 41. (1) 42. (2)
43. (2) 44. (3) 45. (2) 46. (1) 47. (2) 48. (2) 49. (3)
51. (1) 52. (4) 53. (4) 54. (1) 55. (4) 56. (1)
LEVEL-2
1. (1) 2. (2) 3. (3) 4. (3) 5. (4) 6. (4) 7. (2)
8. (4) 9. (3) 10. (1) 11. (1) 12. (1) 13. (1) 14. (1)
15. (2) 16. (2) 17. (4) 18. (2) 19. (4) 20. (1) 21. (2)
22. (4) 23. (4) 24. (1) 25. (1) 26. (1) 27. (3) 28. (4)
29. (2) 30. (2) 31. (4) 32. (4) 33. (3) 34. (4) 35. (2)
36. (4) 37. (3) 38. (2) 39. (1) 40. (1) 41. (3) 42. (2)
43. (1) 44. (1) 45. (4) 46. (1) 47. (3) 48. (2) 49. (2)
50. (3) 51. (2) 52. (2) 53. (3) 54. (1) 55. (2) 56. (2)
57. (4) 58. (3) 59. (2) 60. (3) 61. (4) 62. (2) 63. (1)
64. (1) 65. (2) 66. (4) 67. (1) 68. (3) 69. (4) 70. (1)
71. (3) 72. (2) 73. (2) 74. (4) 75. (2) 76. (2) 77. (2)
78. (3) 79. (1) 80. (1) 81. (3) 82. (1) 83. (3) 84. (2)
85. (4) 86. (1) 87. (2) 88. (2) 89 (4) 90. (3) 91. (3)
92. (2) 93. (4) 94. (3) 95. (1) 96. (2) 97. (4) 98. (3)
99. (3) 100. (4) 101. (3) 102. (3) 103. (2) 104. (2) 105. (3)
NEET_GENETICS - 140
106. (3) 107. (1) 108. (2) 109. (2) 110. (3) 111. (2) 112. (2)
113. (4) 114. (4) 115. (1) 116. (3) 117. (2) 118. (2) 119. (1)
120. (2) 121. (1) 122. (1)
PART- 2
Section-A
1. a – b has polarity 3' – 5'
c – d has polarity 5' – 3'
2. 'Tailing' of hnRNA take place during conversion of hnRNA into functinal mRNA, it takes place at 3'-end.
3. Autosomal dominant – Myotonic dystrophy
Autosomal recessive – Phenylketonuria / sickle cell anaemia / cystic fibrosis/ Thalesemia
4. DNA dependent DNA polymerase and polarity of the template strand is 3’ –> 5’
5. AUG - codes for methionine / initiation codon ,
UGA - termination codon / stop codon
6. Axial, violet flower.
Section-B
1. Inheritance of flower colour in Antirrhinum majus.
F2 generation
R r
RR Rr
R
R e d flo w e r P in k flo w e r
r Rr Rr
P in k flo w e r W h it e flo w e r
OR
The three alleles I A , I , i are involved in this inheritance.
NEET_GENETICS - 141
2. (a) The molecule 'X' is repressor. It gets inactivated when lactose (inducer) binds with the repressor
molecule.
(b) Z-gene codes for -galactosidase.
(c) Transcription of the gene stops when lactose is absent and thus repressor is free to bind with the
operator.
3. Histones are rich in basic amino acids, Lysine, Arginine (present as residues in their side chains), which
are positively charged
4. (a)
(b) Basic amino acid residues of lysines and arginines.
Section-C (3 marks each)
1. (i) a is AUG
b is UAA/UAG/UGA
(ii) AUG codes for methionine (initiation codon). UAA/UAG/UGA does not code for any amino acid, i.e.,
stop or terminating codon.
(iii) There are two sites (P-site and A-site) in the large subunit of ribosome, where subsequent amino acids
bind to and thus are close enough to form peptide bond. The ribosome also acts as a catalyst for the
formation of peptide bond.
NEET_GENETICS - 142
2. (a) Recessive trait.
(b) Autosomal trait.
(c) Genotype of generation I is Aa and Aa.
Genotype of generation II of third child is aa and fourth child is Aa.
3. (a)
(b) t- RNA is called an adaptor molecule because on one hand it read the code on m RNA and on other
hand it would bind to specific amino acid.
4. It is possible to have a haemophilic girl when a cross is made between a carrier woman and haemophilic
man.
or
A small stretch of DNA sequences repeats many a time, shows a high degree of polymorphism and form a
bulk of DNA in a genome called as satellite DNA. DNA are very specific in each individual and vary in
number from person to person but are inherited. Each individual inherits these repeats from his/her parents
which are used as genetic markers in DNA fingerprinting.
Section - D (5 marks each)

1 (a)
NEET_GENETICS - 143
(i) Transcription occurs in 5' 3'
(b) Promotor gene has DNA sequence that provide binding site for RNA polymerase.
OR
(a) Chromosome 1 has most genes and the Y has the fewest gene.
(b) The information regarding the occurrence of 1.4 million SNPs (single nucleotide polymorphism)
revolution is the processes of finding chromosomal locations for disease associated sequences and
tracing human ancestory (history).
Schematic structure of a transcription unit
2. See page no. 45 point a, b, c and d
3. Dominance: One allele expresses itself in the hybrid heterozygous condition, other is suppressed
Co-dominance : Both the alleles of a gene express in a heterozygous hybrid containing two dominant
alleles.
Incomplete dominance : Neither of the two alleles of a gene is completely dominant over the other in
heterozygous condition , the hybrid is intermediate.
4. (i) ATCGTACTA
(ii) Through Hydrogen bonds , between A and T and C and G on the two strands
(iii) A = T and C G , Watson and Crick / Chargaff
5. (a) Mutation arising due to change in a single base pair of DNA , the defect is caused by the substitution
of Glutamic acid (Glu) by Valine (Val) at the sixth position of the beta globin chain of the haemoglobin
molecule..
(b) Father - HbA HbS , Mother - HbA HbS .
(Both parents are heterozygous)
6. (a) Multiple allelism is the phenomenon of occurrence of a gene in more than two allelic forms on the same
locus. In ABO blood group in humans one gene I has three alleles I A, IB and IO/ i.
Co-dominance is the phenomena in which both alleles express independently themselves when present
together. We inherit any two alleles for the blood group. When the genotype is I A 1B the individual has
AB blood group since both IA and IB equally influence the formation of antigens A and B.
(b) (i) IA — A blood group.
(ii) ii — O blood group.
NEET_GENETICS - 144
7. See page no. 46
OR
Lactose acts as the inducer that binds with repressor protein and frees the operator gene. RNA polymerase
freely moves over the structural genes, transcribing lac mRNA, which in` turn produces the enzymes -
galactosidase, permease, transacetylase responsible for the digestion of lactose.
8.
The phenotypes & genotypes are in the ratio of 1 : 1 : 1 : 1

Tall plants, Tall plants, Dwarf plants, Dwarf plants
yellow seeds : Green Seeds : yellow seeds : green seeds
TtYy : Ttyy : ttYy : ttyy
1 : 1 : 1 : 1
OR
(a) to see p.no. 49

(b) to see p.no. 57-58 (point iv, x and vi)
9. Follow page No. 51

OR
NEET_GENETICS - 145
F2 generation
TY Ty tY ty
TY TTYY TTYy TtYY TtY
Tall, Yellow seeds Tall, Yellow seeds Tall, Yellow seeds Tall, Yellow seeds
Ty TTYy TTyy TtYy Ttyy

Tall, Yellow seeds Tall, Green seeds Tall, Yellow seeds Tall, Green seeds
tY TtYY TtYy ttYY ttYy

Tall, Yellow seeds Tall, Yellow seeds Dwarf, Yellow seeds Dwarf, Yellow seeds
ty TtYy Ttyy ttYy ttyy

Tall, YellW seeds Tall, Green seeds Dwarf, Yellow seeds Dwarf, Green seeds
(i) Phenotype of F1 — Tall plants with yellow seeds.

Genotype of F1 — TtYy.
(ii) Phenotypic ratio of F2 generation:

Tall yellow seeds : Tall green seeds : Dwarf yellow seeds : Dwarf green
seeds.
9 : 3 : 3 : 1
TY Ty tY ty
TY TTYY TTYy TtYY TtY
Tall, Yellow seeds Tall, Yellow seeds Tall, Yellow seeds Tall, Yellow seeds
Ty TTYy TTyy TtYy Ttyy

Tall, Yellow seeds Tall, Green seeds Tall, Yellow seeds Tall, Green seeds
tY TtYY TtYy ttYY ttYy

Tall, Yellow seeds Tall, Yellow seeds Dwarf, Yellow seeds Dwarf, Yellow seeds
ty TtYy Ttyy ttYy ttyy

Tall, YellW seeds Tall, Green seeds Dwarf, Yellow seeds Dwarf, Green seeds
NEET_GENETICS - 146
(i) Phenotype of F1 — Tall plants with yellow seeds.
Genotype of F1 — TtYy.
(ii) Phenotypic ratio of F2 generation:

Tall yellow seeds : Tall green seeds : Dwarf yellow seeds : Dwarf green
seeds.
9 : 3 : 3 : 1
10. (i) (W) = IAIA or IAIO, (X) = IOIO, (Y) = B Blood Group , (Z) = AB Blood Group
(ii) Dominance: One allele expresses itself in the hybrid heterozygous condition, other is suppressed
Co-dominance : Both the alleles of a gene express in a heterozygous hybrid containing two dominant
alleles.
Incomplete dominance : Neither of the two alleles of a gene is completely dominant over the other in
heterozygous condition , the hybrid is intermediate.
(iii) Y = heterozygous B that shows complete dominance, (Z) condition is shown by codominance where A
and B both alleles are expressed equally.
OR
Ans. Follow page NO. 47
11. See page no. 45
OR
(a) It could be homozygous dominant or heterozygous dominant.
(b) By performing test cross, genotype can be determined.
12. (a) See p.no. 6-7 for Q (a) and (b)

OR
See page no. 45
NEET_GENETICS - 147
13. Ans. See p.no. 44-45
OR
(a)
F2 Phenotypic ratio = 3 : 1
F2 Genotypic ratio = 1 : 2 : 1
(b) To See p. no. 4 & 6 (Law of Dominance and Law of segregation)
(c) Phenotypic ratio of F2 in monohybrid cross is 3 : 1 whereas in a dihybrid cross the phenotypic ratio is
9 : 3 : 3 : 1.
NEET_GENETICS - 148

Gen Itics

Uploaded by

Copyright:

Available Formats

Gen Itics

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Gen Itics

Uploaded by

Copyright:

Available Formats

PRINCIPLES OF INHERITANCE & VARIATION

GENETIC BASIS OF INHERITANCE

He passed graduation in 1840 and completed two year diploma in Philosophy.

Re-discovery of Mendel’s work :

Reason’s for Mendel’s Success :

NEET_GENETIC BASIS OF INHERITANCE - 1

NEET_GENETIC BASIS OF INHERITANCE - 2

NEET_GENETIC BASIS OF INHERITANCE - 3

Conclusion of monohybrid cross :

Exceptions of Principle of Dominance and Paired Factors :

NEET_GENETIC BASIS OF INHERITANCE - 4

NEET_GENETIC BASIS OF INHERITANCE - 5

Table: Different aspects of blood group

NEET_GENETIC BASIS OF INHERITANCE - 6

Mendel selected the following two character for this purpose.

Thus the Conclusion of dihybrid cross

NEET_GENETIC BASIS OF INHERITANCE - 7

(i) Phenotypic ratio = 100% (Tall plants)

(i) Phenotypic ratio 1 : 1

NEET_GENETIC BASIS OF INHERITANCE - 8

(i) Phenotypic ratio 1 : 1 : 1 : 1

(ii) Genotypic ratio 1 : 1 : 1 : 1

Read & Digest

NEET_GENETIC BASIS OF INHERITANCE - 9

Fig. Dominant epistasis : Inheritance of fruit colour in Cucurbita pepo

NEET_GENETIC BASIS OF INHERITANCE - 10

(c) Dominant Recessive Epistasis :

NEET_GENETIC BASIS OF INHERITANCE - 11

Gene C Enz Gene P Oxidase

(iii) Supplementary Genes :

NEET_GENETIC BASIS OF INHERITANCE - 12

(iv) Duplicate Genes :

NEET_GENETIC BASIS OF INHERITANCE - 13

(vi) Collaborative Supplementary Genes :

Fig. Collaborative Supplementary Genes: Inheritance of Comb types in poultry

NEET_GENETIC BASIS OF INHERITANCE - 14

(vii) Qualitative and Quantitative Inheritance :

(a) Qualitative or Monogenic Inheritance :

(b) Quantitative Inheritance or Polygenic inheritance :

5 Phenotypes form in the above example

NEET_GENETIC BASIS OF INHERITANCE - 15

Thus Monohybrid phenotypic ratio is modified

NEET_GENETIC BASIS OF INHERITANCE - 16

NEET_GENETIC BASIS OF INHERITANCE - 17

2. Sex chromosomes or Allosomes or Heterosomes :

NEET_Chromosomal Basis of Inheritance - 18

Sex determination in plants (XX - XY type) :

NEET_Chromosomal Basis of Inheritance - 19

(iii) XX —X0 type or Protenor type :

NEET_Chromosomal Basis of Inheritance - 20

(v) Haplo-diploidy type :

Hormonal theory for sex determination :

Genic balance theory :

NEET_Chromosomal Basis of Inheritance - 21

(B) Environmental sex determination :

In Bacteria sex determination is controlled by fertility factor located on a plasmid.

Morgan & Casttle (1911) proposed chromosomal theory of linkage

NEET_Chromosomal Basis of Inheritance - 22

(1) Complete Linkage (2) Incomplete Linkage