Pak. J. Agri. Sci., Vol.

60(2), xxx-xxx; 2023

ISSN (Print) 0552-9034, ISSN (Online) 2076-0906
DOI:10.21162/PAKJAS/23.30
http://www.pakjas.com.pk1

Role of monolaurin additive with medium-chain fatty acids against dextran sulfate
sodium-induced acute colitis through down regulating the oxidative stress in wistar
rats
Samia Ali, Muhammad Naeem Faisal*, Junaid Ali Khan and Faqir Muhammad
Institute of Physiology and Pharmacology, Faculty of Veterinary Science, University of Agriculture, Faisalabad-Pakistan
*Corresponding author’s e-mails: m.naeem.faisal@uaf.edu.pk

Inflammatory bowel disease (IBD) is the persistent inflammation of Gastrointestinal tract (GIT). IBD mainly divided into
ulcerative colitis and Crohn’s disease. The Crohn’s disease affects the whole gastrointestinal tract, while ulcerative colitis is
limited to the colon. The current experimental study elucidates the antioxidative and microbial homeostatic efficacy of
monolaurin, monolaurin with butyric acid and propionic acid in Dextran Sulfate Sodium (DSS) induced acute colitis in rat
model. The results revealed that total antioxidant capacity was significantly raised in all the treatment groups compared to the
positive control group. While the results of total oxidative stress and relevant gene expression analysis revealed that mRNA
expression of cell stress pathways such as Traf-4, Traf-6 and MAPK-8 genes (Mitogen activated Protein Kinase) pathways and
Calm-2, Gerk-2 and Pias-2 genes (Calcium signaling pathways) were significantly higher expressed in the positive control
group as compared to all the treatment groups. Total antioxidant capacity and NFR-1, Keap-1 and Nef-212 (Nrf2 signaling
cascade) were significantly down expressed in the positive control group as compared to all the treatment groups.
Histopathological study revealed that disruption of intestinal mucosa and immune infiltration in the positive control group,
while restoration and regeneration of intestinal parenchyma were observed in all the treatment groups. Overall study results
concluded that monolaurin, monolaurin with butyric acid and propionic acid can develop innovative, customized remedies
against DSS-induced acute colitis.
Keywords: Oxidative stress, Dextran sulfate sodium, Inflammatory bowel disease, Antioxidant capacity, Nrf-2 signaling
cascade, Dual oxidases.

INTRODUCTION antibiotics are commonly used drugs for the management of

IBD (Wall, 2005). These medicines have many serious
Inflammatory bowel disease (IBD) is a term used to explain adverse effects on the body, which include changes in body
chronic inflammation of the intestinal mucosa (Laurence and fluid and electrolyte balance as well as susceptibility to
Keith, 2008). Ulcerative colitis as well as Crohn’s disease are infection. They have also caused ulceration of intestinal
two major forms of IBD (Nakase et al., 2020). There are about mucosa, myopathy, osteoporosis and psychological
five million people around the globe affected by IBD. Most disturbances etc. (Laurence and Keith, 2008).
infected cases among them are young ones in the urban region Alternate treatments therapies to overcome inflammation as
(Ye et al., 2020). Major symptoms of IBD are lethargy, fever, well as to minimize the chances of resistance against several
loose bloody stool, abdominal discomfort and weight loss bacterial species. Herbal medicines are getting popularity for
(Zuo et al., 2018). the treatment of IBD. Bioflavonoids possess great therapeutic
It was first assumed that IBD is only related to ethnicity and potential especially antioxidative activity (Bergquist 2006). A
geography but later it develops among Western people possible investigation has shown that the anti-microbial
(Kaplan et al., 2016). The propagation of IBD persists among efficacy of fatty acids and their derivatives should be
every civilization till the end of the 20th century. As cases of considered as preventive measures for anti-bacterial
IBD increase in Eastern people will reach every country of the infections (Churchward et al., 2018).
globe till the start of 21st century (Ng, 2018). Organic acids being produced by the fermentation process of
Several drugs used in IBD give temporary symptomatic relief. microbes in the intestine do not dissolve in water reducing
Amino salicylates, immunomodulators, glucocorticoids and bacterial growth. These acids are also found in other tissues

Ali, S., M.N. Faisal, J.A. Khan and F. Muhammad.. 2023. Role of monolaurin additive with medium-chain fatty acids against dextran sulfate sodium-induced
acute colitis through down regulating the oxidative stress in wistar rats. Pakistan Journal of Agricultural Sciences 60: xxx-xxx.
[Received xx Xxx 2021; Accepted xx Xxx 2021; Published (online) xx Xxx 2022]
Attribution 4.0 International (CC BY 4.0)
 Ali, Faisal, Khan & Muhammad

of the animals as well as plant tissues (Khan et al., 2019). treatments groups during the trial. IBD was induced in rats
These acids possess anti-bacterial properties that effectively through intraperitoneal administration of a single dose of
prevent both gram-negative and gram-positive bacterial DSS. Metronidazole is used widely in clinical setup as a
infections (Rossi et al., 2010). However, supplementation of reference standard (Ursing et al., 1982). The experimental
organic acid increases digestion by improving intestine health design was the following: Group1: Negative Control; Group2:
in piglet (Upadhaya et al., 2018; Han et al., 2018 and Yang et Positive Control were exposed with diet + DSS (5 % intra-
al., 2019). rectal (0.5 µL)); Group 3: Treated with DSS + Standard drug
For colonocytes, butyric acid has a primary energy source. (metronidazole,15 mg/kg Orally); Group4: Treatment I with
The butyric acid produced by the large intestinal microflora. DSS + Monolaurin (1.5 ml/L orally). Group 5: Treatment II
Butyric acid supplementation is necessary because its with DSS + Monolaurin + butyric acid (1.5% orally). Group
production may get reduced. Its specific characteristics like 6: DSS+ Monolaurin + propionic acid (1.5% orally).
ready absorption and rancid smell in the gastrointestinal tract Treatment was given for 14 days. Rats were decapitated at the
make it limited to the treatment of the gastrointestinal end of research to analyze the pathophysiological aspects of
disorder. In the polish market micro-encapsulation, modern DSS induced gut inflammatory response. Blood samples were
technology has made sodium butyrate available. Sodium collected were preserved for lab analysis. Tissue samples of
butyrate play’s role in the absorption of substrates into both the intestine were also collected in TRIzol ™ for mRNA
small and large intestines. Here in the intestines, sodium extraction.
butyrate gets dissociate into butyric acid. Butyric acid Oxidative Stress Markers: The calorimetric method was used
mechanism of action is associated with the reduction of pain to determine the serum total oxidative stress (TOS) and
during inflammation and defecation (Pituch et al.,2013). (TAC) total antioxidant capacity following the protocol by
Fatty acids i.e., monoglycerides with antibacterial efficacy as Erel (2005).
it denatures or destabilize the bacterial cell membrane Histopathological examination: For histopathological study,
composed of phospholipids leading to either direct or indirect intestinal tissues were sliced into 5-μm thick sections with the
inhibitory effects by lowering the pH of the intestinal lumen. help of microtome and fixed on glass slides with cover slides.
The target of study was to characterize and implement Hematoxylin-eosin with periodic acid Schiff used for staining
experimental approaches for destabilization of bacterial cell the tissue sliced sections for structural and morphological
membrane with the antibacterial efficacy of fatty acids, within evaluation (Butt et al., 2019). Light microscope (MCX 100
the wider scope for the introduction of current knowledge from Micros Austria) was used to evaluate and analyze the
regarding biological, antimicrobial activities of lipids, test tissue slides.
strategy with applications against bacterial infections (Yoon Gene Expression Analysis: RNA from the large bowel was
et al., 2018). isolated for mRNA expression analysis by using Trizole®
The purpose of the current experimental study was to (Thermo Fisher Scientific, Massachusetts, US) method (Liu
recognize the anti-oxidative driven regenerative and and Patel, 1995). Isolation of RNA samples were then
antimicrobial efficacy of monolaurin, monolaurin with quantified through nanodrop. Revert-Aid cDNA synthesis kit
butyric acid and propionic acid against DSS induced acute (Thermo Fisher Scientific) for cDNA synthesis was used.
colitis in the animal model. Quantitative real-time polymerase chain reaction (qRT-PCR)
by utilizing SYBR Green /ROX Master Mix (Maxima)
MATERIALS AND METHODS (Thermo Fisher Scientific) on an iQ5 machine (Bio-Rad). The
relative gene expression levels of Traf-4, MAPK-8 and Traf-
Drugs and Chemicals: Metronidazole dose (Flagyl) was 6 (MAPK) Calm-2, GrK-2 and Pias-2 genes for calcium
bought from the commercial pharmacy. Dextran Sodium signaling cascade and JAK-2, STAT-1 for JAK/STAT
Sulfate (DSS mol. Wt. 36-44kDa) used for induction of pathways, Duox, Duox-1, Duox-2 for dual oxidases and NFR-
inflammatory bowel disease was taken from Sigma Aldrich. 1, Nef-212 and Keap1 for Nrf2
Experimental Induction and Maintenance of IBD: The transcriptional factor while as, beta-actin was used as
research trial was conducted at the animal model room, reference gene.
University of Agriculture, Faisalabad, Pakistan. The total During qRT-PCR following the protocol as, initial
duration of the research was 28 days. The cages/boxes for denaturation for 10 min at 95oC then denaturation for 15
keeping the Wistar rats were decontaminated/cleaned seconds at 95oC, annealing was at 58oC for 30 seconds while
properly. as the extension for 20 seconds at 72oC for 39 cycles. Finally,
Experimental Setup: The Wistar rats (Experimental animal) the q-RT-PCR data was analyzed by using the 2*(-ΔΔct)
were divided into six different groups with three-biological method. Invitrogen, Karlsruhe, Germany provided all the
replication. Adult healthy Wister rats male and female both primers listed here:
(n=108) weighing 170-200g were used. Diet having crude
protein and similar metabolize energy was provided to all the

2
 Oxidative stress modulatory potential of monolaurin against DSS induced-colitis in rats

Traf-4 (F: CGACTACAAGTTCCTGGAGAAGC, signaling cascade) genes were significantly higher expressed
R: AGGTGTCGCAGAAGCGGTG) in G2 as compared to G1, G3, G4, G5 and G6 groups.
Traf-6 (F: GGCGCCTAGTAAGACAGGAC, MAPK pathway: The expression level of Traf-4, MAPK-8,
R: ACATGCATGCTCTGCGTTTC) and Traf-6 genes was evaluated for MAPK downstream JNK
MAPK-8 (F: CTCAGCATCCGGTCTCTTCG, pathway. The relative expression level of Traf-4, MAPK-8,
R: CTGCTGTCTGTATCCGAGGC) and Traf-6 genes were significantly higher expressed in G2 as
compared to G1, G3, G4, G5 and G6 groups.
Calm-2 (F: AAGTGTGGAGTTGTGAGCGT,
R: GAGTACCGGACAGAACACCC)
Grk-2 (F: GGAAGTCCTACAGAAGGGCG,
R: CCCGCAACAACTTGAAGAGC)

Pias-2 (F: CCAGTAGAGCCTGACTTGGC,

R: TGACGGTGAATGAGGTGCAA)
JAK-2 (F: GAGAAGGACCAGACTCCCCT,
R: GCACGCACTTCGGTAAGAAC)

STAT-1 (F: GGGCTCATTGATTGCACTGTC,

R: CCAGAACGTCCAACTGTGGT)
Duox (F: TCATGTGGATGGCACCAGAC,
R: CGAAACCACAACAAGCCCAG)

Duoxa-1 (F: FGAAAGGAAGCATCAACACCCC,

R: RGTGGTGTCCATTGGGAAGGT)

Duox-2 (F: FCTCTCCAGCTCTCAGGGTCT’3,

R: GCGAGAGTATCTGTCTGGGC)
Keap1 (F: CATGTGATGAACGGGGCAGT,
R: AGAACTCCTCCTCCCCGAAG)

NFR1 (F: CTCCGACTAGCCATTGACGC,

R: CAAATCCATGTCCTGCTGGGA)
Nfe-212 (F: CTTGTCCCGTCCCTAGGTC,
R: GGAGTGGCAGGCCAGTCTTA)

Statistical analysis: Experimental study data were analyzed

statistically through ANOVA (analysis of variance) and for
significance DMR for statistical variance between the means
of different (Steel et al., 1997).

RESULTS

Oxidative Stress Markers: Effect of monolaurin, butyric acid

and propionic acid on oxidative stress markers is shown in
Fig. 1. It was observed from the results that DSS elevated the
serum total oxidative stress by causing a significant decrease
in serum total antioxidant capacity. Monolaurin, butyric acid,
and propionic acid showed a significant raised and restored
serum TAC level with a significant decline in serum TOS in
all the treatment groups.
Gene Expression Analysis
Calcium pathway: The results revealed that relative mRNA
expression levels of Pias-2, Calm-2 and Grk-2 (Calcium

3
 Ali, Faisal, Khan & Muhammad

JAK / STAT pathway: The relative expression levels of significant expression levels of STAT-1 and JAK-2 were
STAT-1 and JAK-2 genes were evaluated for the possible analyzed among G1, G2, G3, G4, G5 and G6 groups.
involvement of the JAK/STAT pathway. Statistically a non- Nrf2 signaling cascade: The relative expression levels of
Nef-212, Keap-1 and NRF 1 genes were analyzed. Results

Figure 3. mRNA expression level of MAPK-8, Traf-4, and Traf-6 genes in the ileum of the negative control group
in comparison to the positive control, standard drug, and treatment groups.

Figure 4. mRNA expression level of JAK-2 and STAT-1 genes in the ileum of a negative control group in comparison
to the positive control, standard drug, and treatment groups.

Figure 1. Mean serum TAC & TOS level of all treatments groups in comparison to control groups and standard
Figure 5. mRNA expression level of Nef-212, NFR 1, and Keap-1 genes in the ileum of a negative control group in
drug group
comparison to the positive control, standard drug, and treatment groups.

Figure 6.
2. mRNA expression level of dual oxidases
Pias-2, for Duox,
Calm-2, Duoxa-1,
and Grk-2 genesand Duox-2
in the ileumgenes in negative
of the the ileumcontrol
of the group
negative
in
control group
comparison to in
thecomparison to the standard
positive control, positive control, standard
drug, and drug,
treatment and treatment groups.
groups

4
 Oxidative stress modulatory potential of monolaurin against DSS induced-colitis in rats

A C

Figure 7. Microscopic images showing histology and histopathology of the ileum tissue (H & E staining; 100 X); A.
G1 Negative control; B. G2 Positive control; C. G3 Standard drug group; D; G4 Treatment group I; E.
G5 Treatment group II; F.G6 Treatment group III.
statistically a significant difference among G2 as compared to oxidative stress in the gastrointestinal tract against DSS -
G1, G3, G4, G5 and G6 groups. induced acute colitis. Based on physical parameters,
Dual oxidases: Study results revealed that the relative biochemical tests, oxidative stress markers, gene
expression level of following genes Duox, Duoxa-1, and expression analysis and histopathological examination;
Duox-2 for the possible involvement of dual oxidases. monolaurin, butyric acid and propionic acid modulate the
Statistically the relative expression level of Duox, Duoxa-1, oxidative stress and oxidative stress dependent immune
and Duox-2 (Dual Oxidases) genes showed a significantly reaction. The current experimental study was devised to
higher expression in G2 in comparison to G1, G 3, G4, G5 and investigate the level of oxidative stress because oxidative
G6 groups. stress is the key to causing prolonged healing, chronic
Histopathology of Gut: Destruction and disruption of the inflammation, and the onset of fibrosis at the epithelial
intestinal mucosal surface, lymphatic infiltration, signature. Studies showed that administration of monolaurin,
hemorrhage, and cellular degeneration were observed in the butyric acid and propionic acid decreased the serum total
G2 group. Moreover, sloughing of the intestinal mucosa, oxidative stress significantly as compared to the positive
disorganization of crypts, shortening of villi, and congestion control and standard group.
of blood vessels were also observed in the positive control Prolong inflammation alters the immune system response
(Fig. 7B). However, the control group showed normal after gut microbiota alteration (Cetinkaya et al., 2005).
intestinal mucosa (Fig. 7A) while restoration of epithelial Treatment of IBD includes antibiotics, immunosuppressive,
lining and regeneration of normal parenchyma was observed steroids and biologic agents (TNF-alpha) (Laurence and
in all the treatments groups (Fig. 7C-F). Keith, 2008). Monolaurin is widely used as a natural
Photomicrograph 3.7 showed reversal of pathological compound that possessed significant pharmacological
destruction of intestinal mucosal in the G3 group. Healing activities especially, antioxidant, anti-inflammatory and
after sloughed epithelium, improved height, and the surface antibacterial. Monolaurin acts as antibacterial agent and
of villi increase in goblet cells and fibrosis are more inhibits the growth of microorganisms (Subroto, 2020).
prominent in the G4, G5 and G6 groups comparing with G3 Organic acids widely used for many years to control the
group. bacterial propagation and acquired the additional beneficial
effects of being non-toxic to human beings. Treatment with
DISCUSSION organic acid which is composed of individual acids and a
mixture of many acids have similar action on microbes such
Ulcerative colitis is one of the most common kinds of IBD, as antibiotics (Wang et al., 2009).
which is chronic inflammation of GIT starting from mouth to The study revealed that acute colitis shows comparable
last part of the alimentary canal (Otari et al., 2012). The study inflammatory mediators as human inflammatory mediators
results revealed the potential role of monolaurin, butyric released during inflammation or injury. DSS is a sulfated
acid and propionic acid on immune-modulatory and anti- polysaccharide that has good colitis properties. DSS induces

5
 Ali, Faisal, Khan & Muhammad

acute colitis mechanism is not yet known, but it is mentioned The microscopic analysis of the colon showed disrupted
that start of intestinal inflammation because of epithelium structural design as determined through high
disruption which may lead to direct exposure to commensal histopathological damage scores (Balaha et al., 2016 and
bacteria and other harmful products (Martin et al., 2016). The Islam et al., 2017). The crypts do not regenerate due to colitis
main reason of the oxidative stress due to disbalance in (Hamam et al., 2014), which may also elaborate the presence
between the synthesis and removal of reactive oxygen species of enlarged submucosa and damaged crypts might explained
will not restrict to inflamed epithelial layer instead it will by the enhanced deposition of collagen, edema and infiltration
extend to the submucosa and muscular layers of the intestinal of inflammatory cells. Microscopically, the aggregation of
layers and may penetrate to systemic circulation (Bourgonje lymphocytes, atrophy of glands and disappearance of goblet
et al., 2019). Over synthesis of reactive oxygen species cell were observed against challenged by DSS, indicating the
damaging the already inflamed epithelial layer of the intestinal inflammation and development of significant
intestine, which compromised the alimentary canal function, colitis.
increasing intestinal permeability, disturbing gut motility and
malabsorption of the nutrients (Tian et al., 2017). So, Conclusions: Current study shown that the role of
oxidative stress in the large bowel is one of the key effective monolaurin additives with short chain fatty acids against DSS
mechanisms in the pathogenesis of ulcerative colitis and induced acute colitis. Dextran sodium sulfate induced
Crohn’s disease for the development of clinical correlation of oxidative stress, activation of stress related cell signaling
disease onset. Increasing cell antioxidant capacity and cascades, resulting in cellular necrosis, apoptosis, and
decreasing intestinal oxidative stress are effective treatments disruption of gut epithelial signature. Ultimately, causing
to reduce ulcerative colitis (Ma et al., 2019). bloody diarrhea, abdominal pain, weight loss, anemia, and
The in-vivo serum total antioxidant capacity and in vitro intestinal perforation. Untreated positive control group are
DPPH scavenging activity was significantly increased and the more prone for the developing colorectal cancer. All the
antioxidant capacity and activity of herbal plants were treatment groups (Monolaurin, butyric acid and propionic
significant (Otari et al., 2012; Brobbey et al., 2020 and Zhao acid) reduced the intestinal inflammation and improve the
et al., 2019). Prolonged inflammation will lead to the disturbed lipid profile, oxidative stress and settled the bloody
development of IBD and ultimately colorectal cancer (CRC). diarrhea. Treatments groups also have significant antioxidant
These extraintestinal complications are inflammatory property and down regulate cell stress pathways such as, Nrf-
conditions that follow the same pattern of the disease or 2, calcium signaling pathways, JNK pathways, dual oxidases,
improve individually. Additionally, other secondary JAK/STAT pathways showing gastroprotective
complications include osteoporosis, cholelithiasis, venous characteristics of monolaurin, butyric acid and propionic acid
thromboembolism and drug-induced complications (Garber in DSS induced IBD rats. Overall, based on the research trial
and Regueiro, 2019). There are increased chances of it is concluded that monolaurin, butyric acid, and propionic
colorectal cancer development in chronic GIT inflammation acid are effective in the settlement of colorectal injury
in IBD especially ulcerative colitis. Lymphomas and skin induced by DSS.
cancers are also found in Crohn's disease (Biancone et al.,
2019). So, early diagnosis and authoritative treatment are Ethical Approval: All procedures and experimental protocols
essential to prevent these serious complications. The were approved from Institutional Bioethical Committee
activation of the calcium signaling pathway, cellular stress (D.No.7991/ORIC/05/11/2021) of the University of
pathways, MAPK pathway, Nrf2 pathways, and JAK/STAT Agriculture, Faisalabad.
pathway behind the onset of oxidative stress, necrosis, and Conflicts of interest: Its authors declared that there were no
apoptosis under DSS or any other inducer. The activation of known competing financial interests or even no personal
the Nrf2 pathways will turn on transcriptional factor NF-kB relationships that could have appeared to influence the work
after DSS induction (Hu et al., 2019). Nrf1 gene is responsible reported in this paper.
for antioxidant effects and inhibition of cellular apoptosis. Author’s contribution statement: SA and MNF planned and
Gut microbiota composition affects intestinal immune cell executed the research. SA wrote the initial draft with inputs
populations and inflammatory disease risk (Gensollen et al., from MNF. JAK and FM helps in impoving the manuscript
2016; Ruiz et al., 2017; Vieira et al., 2018 and Palm et al., and data visualization.
2014). During IBD (Grigg et al., 2017) gut microbiota range Acknowledgment: All the authors would like to extend their
and fullness are significantly decreased (Kamada et al., 2013). sincere appreciation to the University of Agriculture,
But in experimental studies of humans, the underlying Faisalabad-Pakistan for their support during the research.
direction is not known (Harkin et al., 2019). In IL-10 or IL-2,
deficient rats develop milder IBD indicating microbiota roles
in the inflammatory process (Sellon et at., 1998).

6
 Oxidative stress modulatory potential of monolaurin against DSS induced-colitis in rats

REFERENCES Hamam, G.G., M.H. Raafat and Y. Shoukry. 2014. Possible

protective effect of dietary extra-virgin olive oil on
Alzoghaibi, M.A. 2013. Concepts of oxidative stress and experimentally induced acute colitis in adult male albino
antioxidant defense in Crohn’s disease. World Journal of rats: a histological and immunohistochemical study.
Gastroenterology 19:6540. Egyptian Journal of Histology 37:373-385.
Balaha, M., S. Kandeel and W. Elwan. 2016. Garlic oil Han, Y.M., C.H. Yun and X.S. Piao. 2018. Mixed organic
inhibits dextran sodium sulfate-induced ulcerative colitis acids as antibiotic substitutes improve performance,
in rats. Life Sciences 146:40-51. serum immunity, intestinal morphology and microbiota
Biancone, L., A. Armuzzi, M. Scribano, F. Castiglione, R. for weaned piglets. Animal Feed Science and
’incà, A. Orlando, C. Papi, M. aperno, M. Vecchi, G. Technology 235:23-32.
Riegler, W. Fries, P. Alvisi, G. Meucci, F. Mocciaro, F. Harkins, C.P., H.H. Kong and J.A. Segre. 2020. Manipulating
Rogai, S. Festa, L. Guidi, A. Testa, L. Spina, S. Renna, the human microbiome to manage disease. JAMA
A. Viola, M. Patturelli, R. Di Mitri, I. Frankovic, E. 323:303-304.
Calabrese, C. Petruzziello, E. De Cristofaro, G. Sena, A. Hu, Y., D. Chen, P. Zheng, J. Yu, J. He, X. Mao and B. Yu.
Ruffa, B. Neri and A. Rossi. 2019. Cancer Risk in 2019. The Bidirectional Interactions between Resveratrol
Inflammatory Bowel Disease: A 6-Year Prospective and Gut Microbiota: An Insight into Oxidative Stress and
Multicenter Nested Case-Control IG-IBD Study. Inflammatory Bowel Disease Therapy. BioMed
Inflammatory Bowel Disease 26:450-59. Research International.pp. 1-9.
Bourgonje, A.R., J.Z. von Martels, M.L. Bulthuis, M. van Islam, J., S. Sato, K. Watanabe, T. Watanabe, K. Hirahara, Y.
Londen, K.N. Faber, G. Dijkstra and H. van Goor. 2019. Aoyama, S. Tomita, H. Aso, M. Komai and H.
Crohn’s disease in clinical remission is marked by Shirakawa. 2017. Dietary tryptophan alleviates dextran
systemic oxidative stress. Frontiers in Physiology sodium sulfate-induced colitis through aryl hydrocarbon
10:499. receptor in mice. The Journal of Nutritional Biochemistry
Brobbey, A., Y. Jibira, B. Fuseini, R. Nii-Lamptey and J. 42:43-50.
Adu. 2020. Antioxidant and Hepatoprotective properties Kamada, N., S.U. Seo, G.Y. Chen and G. Núñez. 2013. Role
of Helianthus seed extract against paracetamol-induced of the gut microbiota in immunity and inflammatory
liver toxicity. The Journal of Phytopharmacology 9:361- disease. Nature Review Immunology 13:321-335.
366. Kaplan, G.G. and S.C. Ng. 2016. Globalisation of
Cetinkaya, A., E. Bulbuloglu, E.B. Kurutas, H. Ciralik, B. inflammatory bowel disease: perspectives from the
Kantarcekan and M.A. uyukbese. 2005. eneficial evolution of inflammatory bowel disease in the UK and
effects of N-acetylcysteine on acetic acid induced colitis China. The Lancet Gastroenterology & Hepatology
in rats. The Tohoku journal of experimental medicine 1:307-316.
206:131-39. Ke, F., P.K. Yadav and L.Z. Ju. 2012. Herbal medicine in the
Churchward, C.P., R.G. Alany and A.S.S. Lori. 2018. treatment of ulcerative colitis. The Saudi Journal of
Alternative antimicrobials: the properties of fatty acids Gastroenterology 18:3.
and monoglycerides. Critical Review in Microbiology Khan, S.H. and J. Iqbal. 2016. Recent advances in the role of
44:561-570. organic acids in poultry nutrition. Jouranl of Applied
de Araújo Júnior, R.F., A.A. de Araújo, J.B. Pessoa, F.P.F Animal Research 44:359-69.
Neto, G.R. da Silva, A.L.C.L. Oliveira, T.G. de Carvalho, Laurence, L.B. and L.P. Keith. 2008. Goodman and Gilman’s
.F. Silva, M. ugênio, C. Sant’Anna and L. . manual of pharmacology and therapeutics. McGraw Hill
Gasparotto. 2017. Anti-inflammatory, analgesic and anti- Publication, New Delhi 635-660.
tumor properties of gold nanoparticles. Pharmacological Liu, J.L. and Y.C. Patel. 1995. Glucocorticoids inhibit
Reports 69:119-129. somatostatin gene expression through accelerated
Garber, A. and M. Regueiro. 2019. Extraintestinal degradation of somatostatin messenger ribonucleic acid
Manifestations of Inflammatory Bowel Disease: in human thyroid medullary carcinoma (TT) cells.
Epidemiology, Etiopathogenesis, and Management. Endocrinol 136:2389-6
Current Gastroenterology Reports 21:7. Ma, B., M. France, J. Crabtree, J.B. Holm, M. Humphrys, R.
Gensollen, T., D.L. Kasper and R.S. Blumberg. 2016. How Brotman and J. Ravel. 2019. VIRGO, a comprehensive
colonization by microbiota in early life shapes the non-redundant gene catalog, reveals extensive within
immune system. Science 352:539-544. community intraspecies diversity in the human vagina.
Grigg, J.B. and G.F. Sonnenberg. 2017. Host-microbiota bioRxiv 660498.
interactions shape local and systemic inflammatory Mani-López, E., H.S. García and A. López-Malo. 2012.
diseases. The Journal of Immunology 198:564-571. Organic acids as antimicrobials to control Salmonella in

7
 Ali, Faisal, Khan & Muhammad

meat and poultry products. Food Research International weaning pigs fed high and low-density diet with and
45:713-721. without protected organic acid blends. Animal Feed
Martin, J., G. Bériou and R. Josien. 2016. Dextran Sulfate Science and Technology 239:1-8.
Sodium (DSS)-Induced Acute Colitis in the Rat. Methods Ursing, B.O., T. Alm, F. Bárány, I. Bergelin, K. Ganrot-
in Molecular Biology 4:197-203. Norlin, J. Hoevels, B. Huitfeldt, G. Jarnerot, U. Krause,
Nakase, H., M. Uchino and S. Shinzaki. 2021. Evidence- A. Krook and B. Lindström. 1982. A comparative study
based clinical practice guidelines for inflammatory bowel of metronidazole and sulfasalazine for active Crohn's
disease. Journal of Gastroenterology 56:489-526. disease: The cooperative Crohn's disease study in
Ng, S.C., H.Y. Shi, N. Hamidi, F.E. Underwood, W. Tang, Sweden: II. Result. Gastroenterology 83:550-562.
E.I. Benchimol, R. Panaccione, S. Ghosh, J.C. Wu, F.K. Vieira, S.M., M. Hiltensperger, V. Kumar, D. Zegarra-Ruiz,
Chan and J.J. Sung. 2017. Worldwide incidence and C. Dehner, N. Khan, F.R.C. Costa, E. Tiniakou, T.
prevalence of inflammatory bowel disease in the 21st Greiling, W. Ruff and A. Barbieri. 2018. Translocation
century: a systematic review of population-based studies. of a gut pathobiont drives autoimmunity in mice and
The Lancet 390:2769-2778. humans. Science 359:1156-1161.
Otari, K., P. Gaikwad, R. Shete and C. Upasani. 2012. Wall, G.C. 2005. Lower gastrointestinal disorders. In: Koda-
Protective effect of aqueous extract of Spinacia oleracea Kimble M.A., L.Y. Young, W.A. Kradjan, B.J.
leaves in experimental paradigms of inflammatory bowel Guglielmo, B.K. Alldredge, R.L. Corelli (eds.)
disease. InflammoPharmacology 20:277-287. Handbook of applied therapeutics, 8th ed. Lipponcott
Palm, N.W., M.R. De Zoete, T.W. Cullen, N.A. Barry, J. William and Wilkins Publishers, New York. 28-31.
Stefanowski, L. Hao, P.H. Degnan, J. Hu, I. Peter, W. Wang, J.P., J.S. Yoo, J.H. Lee, T.X. Zhou, H.D. Jang, H.J.
Zhang and E. Ruggiero. 2014. Immunoglobulin A Kim and I.H. Kim. 2009. Effects of phenyllactic acid on
coating identifies colitogenic bacteria in inflammatory production performance, egg quality parameters, and
bowel disease. Cell 158:1000-1010. blood characteristics in laying hens. Journal of Applied
Pituch, A., J. Walkowiak and A. Banaszkiewicz. 2013. Poultry Research 18:203-209.
Butyric acid in functional constipation. Gastroenterology Yang, Y., K.Y. Lee and I.H. Kim. 2019. Effects of dietary
Review/Przegląd Gastroenterologiczny 8:295-298. protected organic acids on growth performance, nutrient
Rossi, R., G. Pastorelli, S. Cannata and C. Corino. 2010. digestibility, fecal microflora, diarrhea score, and fecal
Recent advances in the use of fatty acids as supplements gas emission in weanling pigs. Canadian Journal of
in pig diets: A review. Animal Feed Science and Animal Science 99:514-520.
Technology 162:1-11. Yoon, B.K., J.A. Jackman, E.R. Valle-González and N.J.
Sellon, R.K., S. Tonkonogy, M. Schultz, L.A. Dieleman, W. Cho. 2018. Antibacterial free fatty acids and
Grenther, E.D. Balish, D.M. Rennick and R.B. Sartor. monoglycerides: biological activities, experimental
1998. Resident enteric bacteria are necessary for testing, and therapeutic applications. International
development of spontaneous colitis and immune system Journal of Molecular Sciences 19:1114.
activation in interleukin-10-deficient mice. Infection and Ye, Y., S. Manne, W.R. Treem and D. Bennett. 2020.
Immunity 66:5224-5231. Prevalence of Inflammatory Bowel Disease in Pediatric
Steel, R.G.D., J.H. Thorrie and D.A. Dicky. 1997. Principles and Adult Populations: Recent Estimates From Large
and procedures of statistics: A biometrical approach (3 rd National Databases in the United States, 2007-2016.
Ed.). McGraw Hill Book Co. Inc., New York. U.S.A. Inflammatory Bowel Disease 4:619-625.
Subroto, E. 2020. Monoacylglycerols and diacylglycerols for Zhao, M., H. Cai, M. Liu, L. Deng, Y. Li, H. Zhang and F.
fat-based food products: a review. Food Research 4:932- Feng. 2019. Dietary glycerol monolaurate
943. supplementation for the modification of functional
Tian, T., Z. Wang and J. Zhang. 2017. Pathomechanisms of properties of egg white protein. Journal of the Science of
oxidative stress in inflammatory bowel disease and Food Agriculture 99:3852-3859
potential antioxidant therapies. Oxidative medicine and Zuo, T., M.A. Kamm, J.F. Colombel and S.C. Ng. 2018.
cellular longevity. Urbanization and the gut microbiota in health and
Upadhaya, S.D., K.Y. Lee, S. Serpunja, T.H. Song and I.H. inflammatory bowel disease. Nature Reviews
Kim. 2018. Growth performance, nutrient digestibility, Gastroenterology & Hepatology 15:440-452.
fecal microbiota and fecal noxious gas emission in