Antioxidants

antioxidants
Article
High Therapeutic and Esthetic Properties of Extracellular
Vesicles Produced from the Stem Cells and Their Spheroids
Cultured from Ocular Surgery-Derived Waste Orbicularis Oculi
Muscle Tissues
Kyung Min Lim 1,† , Ahmed Abdal Dayem 1,† , Yujin Choi 1 , Yoonjoo Lee 1 , Jongyub An 1 , Minchan Gil 1 ,
Soobin Lee 1 , Hee Jeong Kwak 1 , Balachandar Vellingirl 2 , Hyun Jin Shin 3, * and Ssang-Goo Cho 1, *
1 Molecular & Cellular Reprogramming Center (MCRC), Department of Stem Cell & Regenerative
Biotechnology, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Korea;
lmin0217@konkuk.ac.kr (K.M.L.); ahmed_morsy86@yahoo.com (A.A.D.); trikk33@naver.com (Y.C.);
leyjo97@gmail.com (Y.L.); delrar@naver.com (J.A.); minchangil@gmail.com (M.G.);
soobineey@naver.com (S.L.); h_jeong9581@naver.com (H.J.K.)
2 Human Molecular Cytogenetics and Stem Cell Laboratory, Department of Human Genetics and Molecular
Biology, Bharathiar University, Coimbatore 641-046, India; geneticbala@buc.edu.in
3 Department of Ophthalmology, Research Institute of Medical Science, Konkuk University Medical Center,
Konkuk University School of Medicine, Seoul 05029, Korea
* Correspondence: shineye@kuh.ac.kr (H.J.S.); ssangoo@konkuk.ac.kr (S.-G.C.)
† These authors contributed equally to this study.

Citation: Lim, K.M.; Dayem, A.A.; Abstract: Extracellular vesicles (EVs) are paracrine factors that mediate stem cell therapeutics. We
Choi, Y.; Lee, Y.; An, J.; Gil, M.; Lee, S.; aimed at evaluating the possible therapeutic and esthetic applications of EVs prepared from the
Kwak, H.J.; Vellingirl, B.; Shin, H.J.;
waste human facial tissue-derived orbicularis oculi muscle stem cells (OOM-SCs). OOM-SCs were
et al. High Therapeutic and Esthetic
isolated from the ocular tissues (from elders and youngsters) after upper eyelid blepharoplasty or
Properties of Extracellular Vesicles
epiblepharon surgeries. EVs were prepared from the OOM-SCs (OOM-SC-EVs) and their three-
Produced from the Stem Cells and
dimensional spheroids. OOM-SCs showed a spindle-like morphology with trilineage differentiation
Their Spheroids Cultured from
Ocular Surgery-Derived Waste
capacity, positive expression of CD105, CD 90, and CD73, and negative expression of CD45 and
Orbicularis Oculi Muscle Tissues. CD34, and their stem cell properties were compared with other adult mesenchymal stem cells.
Antioxidants 2021, 10, 1292. https:// OOM-SC-EVs showed a high inhibitory effect on melanin synthesis in B16F10 cells by blocking
doi.org/10.3390/antiox10081292 tyrosinase activity. OOM-SC-EVs treatment led to a significant attenuation of senescence-associated
changes, a decrease in reactive oxygen species generation, and an upregulation of antioxidant
Academic Editor: Ram Kannan genes. We demonstrated the regeneration activity of OOM-SC-EVs in in vitro wound healing of
normal human dermal fibroblasts and upregulation of anti-wrinkle-related genes and confirmed
Received: 8 June 2021 the therapeutic potential of OOM-SC-EVs in the healing of the in vivo wound model. Our study
Accepted: 8 August 2021
provides promising therapeutic and esthetic applications of OOM-SC-EVs, which can be obtained
Published: 16 August 2021
from the ocular surgery-derived waste human facial tissues.
Publisher’s Note: MDPI stays neutral

Keywords: waste orbicularis oculi muscle tissue; OOM-SC extracellular vesicles; anti-senescence;
with regard to jurisdictional claims in
antioxidant; whitening; wound healing
published maps and institutional affil-
iations.
1. Introduction
Copyright: © 2021 by the authors.

Eyelid blepharoplasty is one of the most commonly performed facial cosmetic proce-
Licensee MDPI, Basel, Switzerland.
dures [1], and myocutaneous flaps of the orbicularis oculi muscle (OOM) have previously
This article is an open access article
been used to repair facial skin defects of the cheek, nose, and eyelid [2,3]. During these
distributed under the terms and surgeries, however, large amounts of OOM were removed and considered as medical waste.
conditions of the Creative Commons Thus, in this study, we aimed to exploit these waste tissues for the isolation of stem cells
Attribution (CC BY) license (https:// with beneficial therapeutic applications.
creativecommons.org/licenses/by/ OOMs, which are rich in vascular distribution, may have regenerative capacity and
4.0/). play vital roles in tissue grafting and facial burn injury repair [4]. Recent reports have
Antioxidants 2021, 10, 1292. https://doi.org/10.3390/antiox10081292 https://www.mdpi.com/journal/antioxidants

Antioxidants 2021, 10, 1292 2 of 27
shown the efficacy of the ocular muscle tissue as a rich source of stem cells with high
proliferation, differentiation, and therapeutic capacities [5–9]. In this regard, OOM-derived
stem cells (OOM-SCs) have garnered much attention and application recently for disease
therapy and tissue regeneration due to their self-renewal, proliferation, and trilineage
differentiation capacities [10].
Extracellular vesicles (EVs) are nano-sized vesicles (approximately 30–150 nm) which
play vital roles in cell-cell communication, transportation of key molecules between cells,
and maintenance of homeostasis [11–17]. Few studies have shown the possible clinical
applications of stem cell-derived EVs in the treatment of various diseases [18–21]. EVs
and secretomes are components of paramount importance in mesenchymal stem cell
(MSC)-associated paracrine action and subsequent regenerative capacities [22–25]. It is
of note that various reports have shown the implications of MSC-derived EVs in tissue
regeneration [26–28]. Applications of EVs in disease therapy provide several merits over
the parent cells, including the ease of handling and storing at −70 ◦ C for a long time,
the enhanced binding capacity with the target cells, the reduced immune rejection and
tumor formation, the ease of sterilizing via filtration before injection, and the convenience
of handling EVs during therapy because of, for instance, easy to control EVs dose and
injection route [29–34].
EVs are considered as the fingerprints of the original parent cells due to the depen-
dence of their composition and properties on the composition and characteristics of the
producing parent cells and could indicate their biological functions in the regeneration of
target tissues or organs [35–37]. Regardless of the parent cell source, EV-associated markers,
which depend on the presence or absence of specific proteins, could determine their purity
and unique characteristics [35,36].
EVs possess specific proteins and microRNA (miRNA), which are implicated in EV-
associated biological functions [38–40]. Moreover, EV-associated lipids are involved in
EV-mediated anti-cancer activity and particular lipids possess angiogenic, mitogenic,
migratory, and immunomodulatory activities that are consequently useful for healing
incurable skin wounds [41,42]. It is of note that the capacity of human MSCs (hMSCs)-
derived EVs in the healing of skin wounds is attributed to their robust involvement in
regulating cellular proliferation, extracellular matrix remodeling, inflammatory events,
angiogenesis, and activation of specific signaling pathways [27,43–46]. Various reports
have proved the crosslink between EVs and the modulation of pathophysiological events
in the skin [34,47].
In the present study, we examined the characteristics of OOM-SCs in terms of ex-
pression of surface markers, stemness markers expression level, colony-forming, and
trilineage differentiation capacities in comparison to other MSCs such as human umbilical
cord Wharton’s jelly-MSCs (WJ-MSCs), human adipose-derived MSCs (AD-MSCs), and
human urine-derived stem cells (USCs). Then, we tried to investigate the therapeutic and
esthetic applications of OOM-SC-derived EVs (OOM-SC-EVs) that were purified from
OOM-SCs, which were isolated from the ocular surgery-derived waste of human facial
tissues from both youngsters and elders. Our results may indicate the possible applications
of OOM-SC-EVs for esthetic and reconstructive purposes, which are outlined in Figure 1A.
Antioxidants 2021, 10, x FOR PEER REVIEW 3 of 28
FigureFigure 1. Schematic representation for application of novel OOM-SC-EVs and OOM-SCs preparation. (A) Schematic rep-
1. Schematic representation for application of novel OOM-SC-EVs and OOM-SCs preparation. (A) Schematic
resentation of isolation of stem cells from various sources, such as OOM, adipose tissue, Wharton’s Jelly, and urine and
representation of isolation of stem
then their characterization, whichcells
werefrom various
carried out viasources, such as
the enzymatic OOM, using
digestion adipose tissue, Wharton’s
collagenase type II. USCsJelly,
wereand
ob- urine
and then their characterization, which were carried out via the enzymatic digestion using collagenase type
tained via centrifugation at 400× g, and purification of EVs from OOM-SCs and WJ-MSCs using differential centrifugation,II. USCs
were obtained via centrifugation at 400× g, and purification of EVs from OOM-SCs and WJ-MSCs using differential
centrifugation, ultrafiltration, and ultracentrifugation. Our study sought the therapeutic applications of the purified EVs
including antioxidant, anti-senescence, whitening, and wound healing. OOM-SC-EVs were isolated from the collected
culture soup of the OOM-SCs cultured in α-MEM medium containing exosome-depleted 10% FBS for two days, which were
subjected to differential centrifugation, vacuum filtration, ultrafiltration, and ultracentrifugation for EVs purification. The
antioxidant, anti-wrinkling, skin whitening, and in vitro and in vivo wound healing activities of the OOM-SC-EVs were
observed. These vesicles can be further applied for therapeutic applications in combination with microneedles. Parts of the
schematic diagram are created with BioRender.com. (B) Figure illustrating the upper eyelid blepharoplasty for the isolation
of pretarsal OOM after the consent of donors. OOM-SCs were prepared from healthy donors. (C) Morphologies of WJ-MSCs,
AD-MSCs, USCs, and OOM-SCs (isolated from different donors (OOM-SCs #1(5y), OOM-SCs#2 (19y), and OOM-SCs#3
(67y)). Phase-contrast microscopic image of isolated cells that showing spindle-like morphologies. Scale bar = 50 µm.
OOM-SC proliferation kinetics including (D) population doubling time and (E) Cumulative cell number of WJ-MSCs,
AD-MSCs, USCs, and OOM-SCs. Cell population doubling time was measured up to passage 13. For cumulative cell
number, cells were counted using a hemocytometer after staining with 0.4% trypan blue under a phase contrast microscope.
Figure 1D data are presented as mean ± SD. All experiments were performed for three independent times, and statistical
significance was determined using RMANOVA: ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
2. Materials and Methods

2.1. Preparation and Culture of OOM-SCs, WJ-MSCs, AD-MSCs, and USCs
The experimental protocols for isolation of OOMs and orbicularis oculi fats (OOFs)
were approved by the ethics committees of Konkuk University Medical Center (IRB num-
ber: KUMC 2019-05-043) and conformed to the principles outlined in the Declaration of
Helsinki. For the preparation of OOM-SCs and OOF-derived cells (OOFCs), 16 donors who
underwent eyelid blepharoplasty were enrolled in this study; age ranged from 5-year-old to
81-year-old males and females and is listed in detail in supplementary Table 1. All patients
provided written informed consent and did not present any other ocular/orbital pathology
(dermatochalasis, entropion, and epiblepharon). Muscle fragments were obtained from the
pretarsal portion of the OOM during the surgery. Human OOMs and OOFs were washed
twice with phosphate-buffered saline (PBS) containing 50 µg/mL gentamicin, and the
clotted blood was removed to avoid tissue contamination and blood clots. The tissues
were then chopped with a sterile blade and incubated with 4 mg/mL of collagenase type
II (Worthington, LS004176) at 37 ◦ C for 90 min with intermittent shaking every 5 min to
obtain single cells. After the end of the incubation period, we centrifuged the digested
tissues twice at 400× g for 10 min to remove the supernatant containing the remaining col-
lagenase. We then suspended the tissue pellets with the alpha-minimum essential medium
(α-MEM) (Gibco, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum
(FBS, Hyclone, Logan, UT, USA) and 1% penicillin/streptomycin (PS, Gibco), seeded onto
0.2% gelatin-coated culture dish, and incubated at 37 ◦ C in 5% CO2 with the continuous
microscopic observation of cell adherence and morphology.
Table 1. Primer sequences of the genes used in this study.
Gene NCBI Forward Primer (50 to 30 )

Product Length (bp)
(Application) Accession Number Reverse Primer (50 to 30 )
NANOG TCCTGAACCTCAGCTACAAAC
NM_001355281.2 108
(Semi-qPCR) GCGTCACACCATTGCTATTC
SOX2 CATCACCCACAGCAAATGAC
NM_003106.4 110
(Semi-qPCR) GAAGTCCAGGATCTCTCTCATAAA
REX1 GTTTCGTGTGTCCCTTTCAAG
NM_001304358.2 141
(Semi-qPCR) CTGTTATCTGCTTCATCCTGTTG
ITGA6 CGAAACCAAGGTTCTGAGCCCA
NM_001394928.1 151
(Semi-qPCR) CTTGGATCTCCACTGAGGCAGT
CD146 GTGTTGAATCTGTCTTGTGAA
NM_006500.3 600, 419
(Semi-qPCR) ATGCCTCAGATCGATG
TM4SF1 GGCTACTGTGTCATTGTGGCAG
NM_014220.3 133
(Semi-qPCR) ACTCGGACCATGTGGAGGTATC
CD19 CCTGGGGTCCCAGTCCTATG
NM_001385732.1 287
(Semi-qPCR) GCTCCAGAGGTTGGCATCAT
Table 1. Cont.
Gene NCBI Forward Primer (50 to 30 )

Product Length (bp)
(Application) Accession Number Reverse Primer (50 to 30 )
CD45 TCAGTGGTCCCATTGTTGTG
NM_080921.4 146
(Semi-qPCR) GCATCTCTGTGGCCTTAGCT
CD29 GCCGCGCGGAAAAGATG
NM_002211.4 206
(Semi-qPCR) ACATCGTGCAGAAGTAGGCA
CD73 TATCCGGTCGCCCATTGATG
NM_002526.4 138
(Semi-qPCR) ACGCTATGCTCAAAGGCCTT
CD105 CCAAGACCGGGTCTCAAGAC
NM_001278138.2 174
(Semi-qPCR) TGTACCAGAGTGCAGCAGTG
CD166 GAACACGATGAGGCAGACGA
NM_001627.4 179
(Semi-qPCR) CCGAGGTCCTTGTTTACATGTTT
GAPDH AATCCCATCACCATCTTCCAG
NM_001357943.2 146
(Semi-qPCR) ATGACCCTTTTGGCTCCC
GPX1 CAGTCGGTGTATGCCTTCTCG
NM_001329503.2 105
(qPCR) GAGGGACGCCACATTCTCG
GPX2 GGTAGATTTCAATACGTTCCGGG
NM_002083.4 174
(qPCR) TGACAGTTCTCCTGATGTCCAAA
GPX3 AGAGCCGGGGACAAGAGAA
NM_001329790.2 153
(qPCR) ATTTGCCAGCATACTGCTTGA
GPX4 GAGGCAAGACCGAAGTAAACTAC
NM_001367832.1 100
(qPCR) CCGAACTGGTTACACGGGAA
GPX7 CCCACCACTTTAACGTGCTC
NM_015696.5 86
(qPCR) GGCAAAGCTCTCAATCTCCTT
GSR TTCCAGAATACCAACGTCAAAGG
NM_001195102.3 94
(qPCR) GTTTTCGGCCAGCAGCTATTG
SOD1 GGTGGGCCAAAGGATGAAGAG
NM_000454.5 227
(qPCR) CCACAAGCCAAACGACTTCC
SOD2 GCTCCGGTTTTGGGGTATCTG
NM_001322816.2 92
(qPCR) GCGTTGATGTGAGGTTCCAG
SOD3 ATGCTGGCGCTACTGTGTTC
NM_003102.4 99
(qPCR) CTCCGCCGAGTCAGAGTTG
Catalase TGTTGCTGGAGAATCGGGTTC
NM_001752.4 87
(qPCR) TCCCAGTTACCATCTTCTGTGTA
TMX1 AGTATGTCAGCACTCTTTCAGC
NM_030755.5 83
(qPCR) CACACTGGCAATCCAAGGTCT
TXNIP GGTCTTTAACGACCCTGAAAAGG
NM_006472.6 87
(qPCR) ACACGAGTAACTTCACACACCT
TXN GTGAAGCAGATCGAGAGCAAG
NM_001244938.2 87
(qPCR) CGTGGCTGAGAAGTCAACTACTA
Col1A1 GATTCCCTGGACCTAAAGGTGC
NM_000088.4 107
(qPCR) AGCCTCTCCATCTTTGCCAGCA
MCP-1 AGAATCACCAGCAGCAAGTGTCC
NM_002982.4 98
(qPCR) TCCTGAACCCACTTCTGCTTGG
MCP-3 ACAGAAGGACCACCAGTAGCCA
NM_006273.4 117
(qPCR) GGTGCTTCATAAAGTCCTGGACC
CCL5 CCTGCTGCTTTGCCTACATTGC
NM_002985.3 125
(qPCR) ACACACTTGGCGGTTCTTTCGG
PAI-1 CTCATCAGCCACTGGAAAGGCA
NM_001386456.1 154
(qPCR) GACTCGTGAAGTCAGCCTGAAAC
TGF-β1 TACCTGAACCCGTGTTGCTCTC
NM_000660.7 122
(qPCR) GTTGCTGAGGTATCGCCAGGAA
TGF-β3 CTAAGCGGAATGAGCAGAGGATC
NM_001329939.2 161
(qPCR) TCTCAACAGCCACTCACGCACA
GAPDH GTCTCCTCTGACTTCAACAGCG
NM_001357943.2 131
(qPCR) ACCACCCTGTTGCTGTAGCCAA
For the preparation of WJ-MSCs, a human umbilical cord was procured from Konkuk
University Hospital after approval by the IRB (7001355-201705-BR-181) of Konkuk Uni-
versity. The tissues were chopped and the cells from the tissues were cultured in α-MEM
supplemented with 10% FBS and 1% PS. The isolation and characterization of AD-MSCs
and USCs were carried out as described in our recent publication [48].
2.2. Cell Growth Kinetics, Viability and Colony Formation Assays

Cell growth kinetics were estimated according to population doubling time (PDT)
and cumulative cell number. Briefly, cells were seeded at the density of 1 × 105 cells
onto a 60 × 15 mm culture plate (SPL, 20060, Pocheon-si, Gyeonggi-do, Korea) and
incubated at 37 ◦ C and 5% CO2 until reaching 80–90% confluence. Cells were har-
vested after each passage (P), stained with 0.4% trypan blue solution, and counted us-
ing a hemocytometer under a phase-contrast microscope. Cell population doubling
was calculated as reported previously [49] and according to the following equation:
No(PD) = (log Nt − log N0)/0.301, where PD represents population doubling, Nt de-
notes cell number after trypsinization/collection of cells, and N0 indicates the number of
seeded cells.
For estimation the effect of EVs in the viability of B16F10 melanoma cells, cells were
seeded at 3 × 103 cells/well onto a 96-well plate (SPL, 30096) and incubated at 37 ◦ C and 5%
CO2 overnight. Cells were then exposed to OOM-SC-EVs in a dose-dependent manner for
24 h. Afterward, cells were treated with 10 µL of CCK-8 solution/well (Dojindo, CK04-05,
Rockville, MD, USA) and then incubated for 2 h with protection from light. The absorbance
was measured at the wavelength of 450 nm using a Bio-RAD x-MarkTM spectrophotometer
(Bio-Rad Laboratories, Hercules, California, USA). To measure the self-renewal ability
of the stem cells, colony-forming units (CFU) were assessed. Stem cells were seeded at
1 × 103 cells per well in 6-well plates (SPL, 32006) and incubated at 37 ◦ C and 5% CO2 for
14 days. Following incubation, the cells were washed and stained with 0.15% crystal violet
solution. After washing with PBS, we captured images of the colonies using a microscope
(Carl Zeiss).
2.3. Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Quantitiative PCR
(qPCR) Analyses
Total RNA was isolated from the cells using Labozol Reagent (LaboPass, CMRZ001,
Yuseong-gu, Daejeon, Korea) according to the manufacturer’s instructions, and the quan-
tification of the purified RNA was performed using a NanoDrop spectrophotometer (Nan-
odrop Technologies Inc., Wilmington, DE, USA). cDNA synthesis was performed from 2 µg
total RNA using the M-MuLV reverse transcription kit (Labopass, CMRT010) and oligo
dT primers. PCR was performed using rTaq Plus 5× PCR Master Mix (ELPISBIOTECH,
EBT-1319, Seo-gu, Daejeon, Korea), and PCR products were visualized with 1–2% agarose
gels. We performed quantitative real-time PCR via the estimation of the expression changes
using the EzAmp™ qPCR 2× Master Mix (ELPISBIOTECH, EBT-1802) and an Applied
Biosystems 7500 real-time PCR system. We then normalized the expression level of target
genes to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH),
and the relative expression was calculated based on the comparative 2(− ∆∆Ct) method as
reported [50]. The primer sequences for the genes analyzed in this study are shown in
Table 1.
2.4. Flow Cytometry

Immunophenotyping analysis of OOM-SCs was performed using flow cytometry.
Briefly, cells were trypsinized to obtain a single cell suspension and bound with the
following primary and secondary antibodies for 10 min on ice. The primary antibodies
were used against the following: CD34 (R&D system, Minneapolis, MN, MAB72271), CD45
PD7/26/16 + 2B11 (Invitrogen, Waltham, MA, USA, MA5-13197), CD73/NT5E (Invitrogen,
RG235718), CD90/Thy1 (R&D system, AF2067), CD105 (Invitrogen, MA5-11854).
We incubated 1 × 109 particles with CD9 magnetic beads (human exosome-Human
CD9 flow detection reagent with Dynabeads® magnetic separation technology; Invitrogen,
10620D) overnight at 4 ◦ C for flow cytometry measurement. Next, the mixture was sub-
jected to brief centrifugation that was followed by washing before using the measurement
with the flow cytometry. The antibodies used in the flow cytometry analysis were against
the following: CD63-PE (BD Pharmingen, 556020), and CD81-APC (Miltenyi Biotec B.V. &
Co. KG, Bergisch Gladbach, Germany, 130-119-787). A flow cytometer (BD Bioscience, San
Jose, CA, USA) was used to measure the fluorescence intensity generated by the fluorescent
labeled antibody.
2.5. Trilineage Differentiation

The trilineage differentiation capacities of the isolated stem cells were estimated via
the induction of osteogenic, chondrogenic, and adipogenic differentiation. For osteogenic
induction, cells were seeded at 5 × 104 cells/well in 24-well plates and exposed for two
weeks to the osteogenic differentiation medium containing 10% Dulbecco’s Modified Eagle
Medium (DMEM) low glucose medium supplemented with 50 µg/mL L-ascorbic acid
2-phosphate (Sigma, St. Louis, MO, USA), 10 nM β-glycerophosphate (Sigma), and 100 nM
dexamethasone (Sigma). Osteogenic capacity was measured using Alizarin Red S staining
(Sigma) to visualize calcium mineralization.
For chondrogenic differentiation, cells were seeded at a density of 5 × 104 cells/well in
a 24-well plate and exposed to induction medium, which was composed of 10% DMEM low
glucose medium containing 100 nM dexamethasone, 10 nM β-glycerophosphate, 50 µg/mL
L-ascorbic acid 2-phosphate, 10 µg/mL transforming growth factor-β1 (Sigma), 1 mM
sodium pyruvate (Sigma), 40 µg/mL proline, and 1× insulin-transferrin-selenium (Sigma).
The chondrogenic differentiation capacity was evaluated via Alcian Blue staining (Sigma).
For adipogenic differentiation, cells were seeded at 5 × 104 cells/well in a 24-well plate
and then exposed to adipogenic differentiation medium containing 10% DMEM low glucose
medium supplemented with 10 µg/mL insulin, 500 µM isobutylmethylxanthine (Sigma),
100 µM indomethacin (Sigma), and 1 µM dexamethasone. The adipogenic differentiation
capacity was evaluated using Oil Red O staining (Sigma) to visualize the fat droplets.
2.6. OOM-SC-EV and WJ-MSC-EV Isolation and Characterization

For the isolation of EVs, OOM-SCs or WJ-MSCs were seeded at 1 × 106 onto 150-mm
cell culture dishes with α-MEM medium containing 10% FBS for two days. After reaching
80–90% confluence, we changed the media using a 10% EV-depleted FBS medium, in
which the exosome was depleted as described previously [51] for EV isolation. To prepare
the EV-depleted FBS, the FBS was subjected to ultracentrifugation at 120,000× g for 18 h
(Optima L-90K ultracentrifuge, SW32.1 rotor, k-factor 229, Beckman Coulter, Indianapolis,
IN, USA). During all the in vitro evaluation experiments of stem cell-derived EVs using
various cell lines, we changed the basic culture media to 10% EV-depleted FBS medium that
is used for EVs treatment. The culture medium was collected and subjected to differential
centrifugation at 300× g for 10 min for cell depletion. Subsequently, the supernatant was
carefully transferred to a new tube and centrifuged at 2000× g for 10 min to remove cell
debris. We then transferred the supernatant to a new tube and centrifuged it at 20,000× g
for 1 h. Subsequently, the resultant supernatant was subjected to filtration using a 0.22-µm
vacuum filter (EMD Millipore SCGP00525 Steriflip-GP Filter), and the subsequent filtrate
was subjected to ultrafiltration with an Equilibrate Amicon® Ultra-15 filter (#UFC901024,
10 kDa MWCO). Finally, EVs pellets prepared via ultracentrifugation (100,000× g, for 2 h)
were suspended in 100 µL PBS.
The size of the EVs was determined using dynamic light scattering (DLS) analysis
using a Nano Zetasizer (Malvern Instruments, Malvern, UK), and the number of EVs was
counted with a nanoparticle tracking analyzer NS300 (NTA, Nanosight, Amesbury, UK)
using the following settings: number of captures: four, capture duration: 30 s, Screen gain:
12, camera level: 11, threshold: two, and temperature: 25 ◦ C.
Further, the morphology and structure of EVs were analyzed by transmission electron
microscopy (TEM) at 80 kV (JEM-1010, Nippon Denshi, Tokyo, Japan). We then measured
the protein concentration of OOM-SC-EVs using a BCA protein assay kit (Pierce, Waltham,
MA, USA) according to the manufacturer’s protocol. We used 3 µg of OOM-SC-EVs protein

for western blotting analysis for EV-associated markers.
2.7. Western Blotting Assay

We measured the protein levels of the isolated EVs using the BCA protein assay
kit according to the manufacturer’s protocol. We extracted the cellular proteins using a
buffer composed of 100 mM Tris-HCl (pH 7.5), 1% Triton X-100 (Sigma), 10 mM NaCl,
10% glycerol (Amresco, Solon, OH, USA), 50 mM sodium fluoride (Sigma), 1 mM phenyl-
methylsulfonyl fluoride (PMSF; Sigma), 1 mM p-nitrophenyl phosphate (Sigma), and 1 mM
sodium orthovanadate (Sigma). The cell lysates were then centrifuged at 13,000 rpm for
15 min at 4 ◦ C. The supernatant was carefully transferred into a new E-tube, and protein
quantification was performed using a BCA protein assay kit. The proteins (3 µg) were sep-
arated by 8–12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
and then transferred onto nitrocellulose membranes (Bio-Rad). Membranes were blocked
using 5% skimmed milk in Tris-buffered saline for 1 h, followed by incubation overnight
at 4 ◦ C with the appropriate primary antibodies (Abs): anti-CD9 (Abcam, ab263023), anti-
CD63 (Invitrogen, 10628D), anti-CD81 (Santa Cruz, sc-7637), anti-calnexin (CST, 2679T),
anti-GM130 (CST, 12480S), and anti-β-actin (CST, 4970S). Subsequently, the membranes
were incubated with secondary antibodies (anti-mouse or -rabbit IgGs), which were conju-
gated with horseradish peroxidase (Santa Cruz Biotechnology) for 1 h at room temperature.
Protein signals were visualized using an enhanced chemiluminescence kit (Amersham
Biosciences, Piscataway, NJ, USA) and ChemiDocTM Imaging System (Bio-RAD, 17001401).
2.8. Three-Dimensional (3D) Spheroids Culture and EVs Isolation

For 3D culture, OOM-SCs and WJ-MSCs were seeded at 2 × 106 cells per well onto
F127 (P2443, Sigma)-coated AggreWell 400TM plates (STEMCELL Technologies, 34425,
Vancouver, BC, Canada) and then incubated overnight for embryonic bodies (EBs) forma-
tion. Then, we transferred EBs into a 100 mm petri dish (SPL, 10090) and cultured them
with a 10% EV-depleted FBS medium. Next, the culture plates were transferred onto an
Orbital shaker (ORS) with a sticky mat (INFORS HT Celltron, 69455) and subjected to
rotation at 60 rpm for two days. We then collected the media and purified EVs as described
above. The characterization of the isolated EVs was performed using NTA as described
above. In this experiment, we compared the concentration of 3D culture-derived EVs with
monolayer-derived EVs.
2.9. Senescence-Associated β-Galactosidase (SA-βgal) Assay

To estimate the impact of OOM-SC-EVs in ameliorating senescence-related changes
in the late stage of normal human dermal fibroblasts (NHDFs) (P15–17) (Promocell, C-
12302, Heidelberg, Germany), we performed SA-βgal staining as described previously [52].
In brief, cells were seeded onto 6-well plates and incubated at 37 ◦ C and 5% CO2 until
reaching 80% confluence. Next, cells were exposed to 1.5 × 109 particles/mL of OOM-SC-
EVs for 24 h at 37 ◦ C. Cells were then washed with PBS and fixed with a mixture of 0.2%
glutaraldehyde (vol/vol) and 2% formaldehyde (vol/vol) that was diluted in PBS buffer
for 5 min at RT, followed by the removal of the fixative solution and washing twice with
PBS. Subsequently, we added a freshly prepared SA-βgal staining solution to the cells and
incubated it overnight at 37 ◦ C (without CO2 ). We prepared SA-βgal staining solution
using a mixture of 40 mM citric acid/Na phosphate buffer, 5 mM K3 [Fe (CN)6 ], 5 mM
K4 [Fe (CN)6 ], 3H2 O, 2 mM magnesium chloride, 150 mM sodium chloride, and 1 mg/mL
X-gal dissolved in distilled water. Stained cells were then washed twice with PBS and once
with methanol. Finally, cells were dried and kept at room temperature under protection
from light until being photographed using phase-contrast microscopy. SA-βgal-positive
cells showed blue color.
2.10. Reactive Oxygen Species (ROS) Generation Measurement

To measure the modulation of intracellular generation level of ROS after EVs treatment,
we measured the changes in the intracellular ROS level using 20 ,70 -dichlorodihydrofluorescein
diacetate (H2 DCFDA, Invitrogen) according to the manufacturer’s protocol. In brief, the cells
were incubated with 1.5 × 109 particles/mL of OOM-SC-EVs for 24 h at 37 ◦ C. Following
incubation, cells were washed twice with PBS and then incubated with 10 µM H2 DCFDA
solution for 30 min at 37 ◦ C and 5% CO2 under protection from light by wrapping in aluminum
foil. ROS-induced green fluorescent signals were visualized using a fluorescence microscope
(Nikon Eclipse TE2000-E). In addition, the fluorescence intensity of the H2DCFDA probe was
measured using flow cytometry.
2.11. Melanin Content Assay

B16F10 cells were seeded onto 12-well plates at a density of 4 × 104 cells/well and
cultured with RPMI medium containing 10% FBS overnight. Subsequently, 200 nM α-
melanocyte-stimulating hormone (α-MSH) (sigma, M4135) and dose-dependent exposure
of OOM-SC-EVs (1.5, 3, 9, and 15 × 108 particles/mL) or arbutin (100 µM) (Sigma, A4256)
were administered and incubated for 60 h. Further, to measure extracellular melanin, we
transferred 100 µL of culture medium to a new 96-well plate, and absorbance was detected
at 405 nm wavelength with a Bio-RAD x-MarkTM spectrophotometer. Additionally, for
intracellular melanin measurement, each well was washed with PBS and then dissolved
with 200 µL of 1 N NaOH for 1 h at 80 ◦ C. Absorbance was then measured at 405 nm.
The extracellular and intracellular melanin levels were normalized to the total protein
concentration.
2.12. Tyrosinase Activity Assay

B16F10 cells were cultured at a density of 4 × 104 cells/well onto 12-well plates for
24 h. Subsequently, each well was treated with 200 nM of α-MSH and OOM-SC-EVs (1.5, 3,
9, and 15 × 108 particles/mL) or arbutin (100 µM) and then incubated for 48 h. Each well
was washed with PBS, and the cells were harvested with PBS and suspended in 50 mM
of phosphate buffer (pH 6.8) containing 1% Triton X-100. After vortexing, the mixture
was incubated at 80 ◦ C for 30 min and then subjected to thawing at room temperature.
After centrifugation at 1000× g for 10 min, 40 µL of the supernatant and 100 µL of 10 mM
L-DOPA (Sigma, 333786) were added to a 96-well plate and incubated at 37 ◦ C for 1 h.
Absorbance was then measured at 405 nm using a Bio-RAD x-MarkTM spectrophotometer.
Each absorbance value was normalized to that of total protein.
2.13. In Vitro Cell Migration (Scratch Assay)

To evaluate the effect of OOM-SC-EVs on the migration of NHDFs, which were seeded
at a density of 5 × 105 cells/well onto 6-well plates and cultured in high-glucose DMEM
containing 10% FBS and 1% PS until confluency. To stop cell proliferation, 10 µg/mL
mitomycin C (M4287, Sigma) was treated for 2 h at 37 ◦ C, and subsequently, we scratched
the cells with a 200-µL tip after washing. After treatment with 1.5 × 109 particles/mL
OOM-SC-EVs or WJ-MSC-EVs, in vitro wound (scratch) closure was examined, and the
evaluation of the size of the wound closure (in triplicate) was performed using TScratch
software [53].
2.14. In Vivo Wound Healing Assay

To analyze the in vivo wound healing capacity, we used six-week-old BALB/c nude
female mice (CAnN.Cg-Foxn1nu/CrljOri SPF/VAF Immunodeficient mice), which were
purchased from ORIENT BIO Animal Center (Seongnam-si, Korea). The immunodeficient
mice (with innate immunity) used in this study are hairless mice, which obviate the
difficulties of using haired mice, such as the inflammation or unexpected wounds from
the hair removal process, hindering the wound healing process from hair re-growth, and
both mice share similar wound healing stages [54]. The in vivo experiment was performed
Antioxidants 2021, 10, 1292 10 of 27
following the approval from the Institutional Animal Care and Use Committee (IACUC)
at Konkuk University (approval no.: KU20132-1). One week before the experiment, the
mice were kept in a well-ventilated room with adjusted temperature and humidity and
under a 12 h light/12 h dark cycle for appropriate adaptation. The animals were provided
with food and water ad libitum. They were divided into two groups as follows: (1) Control
wounded group (PBS treated) and (2) OOM-SC-EV-treated group (n = 5 mice in each
group). Before creating the in vivo wound, all mice were subjected to anesthesia via the
intraperitoneal injection of 60 mg/kg of alfaxalone (Alfaxan; Careside, Gyeonggi-do, Korea).
Mice were anesthetized, and wounds were excised using a sterile biopsy punch (diameter
of 8 mm; Kai Industries, Tokyo, Japan) to make two full-thickness skin wounds on the
back of each of the animals. The mice were then injected subcutaneously at four points
around each wound; only PBS (control group) and 1.5 × 109 particles/mL of OOM-SC-EVs
were suspended in 30 µL PBS. To protect the wounds from external contamination, they
were sealed with silicon (0.5 mm T), Tegaderm tape (1622W), and bandage (DUPOL). We
monitored the progress in wound closure using a digital camera. The size of the wounds
was measured with a 30-cm ruler and recorded using a camera in a time-dependent manner.
In addition, we measured scar formation at 2 weeks post-wounding. On day 14 after cell
injection, the mice were sacrificed, and skin tissues around the wounds were sectioned,
fixed using 4% paraformaldehyde (PFA, Biosesang, Korea), and dehydrated using various
concentrations of alcohol, followed by paraffin embedding. Subsequently, the tissues were
cut vertically to the wound surface into 4µm thick tissue sections, and the cut tissues were
placed on slides that were pre-coated with poly L-lysine 0.1% w/v (Sigma, St. Louis, MO,
USA). For visualization of tissue lesions and regeneration, the sections were subjected to
hematoxylin and eosin staining to evaluate the degree of re-epithelization. In addition,
Masson’s trichrome staining was used to estimate the rate of collagen synthesis. To obtain
the tissue images, the slides were scanned using a digital slide scanner (3d-histech, H-1141
Budapest, Öv u. 3., Hungary).
2.15. Statistical Analysis

All statistical analyses were performed using GraphPad Prism (version 7). All ex-
periments were performed independently at least in triplicate. Data are expressed as
means ± SD. p-values were calculated using one-way ANOVA or RMANOVA and two-
tailed t test to determine statistical significance. In all figures, the asterisk symbol indicates
statistical significance as follows: * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, and ns;
not significant.
3. Results
3.1. OOM-SCs Characterization
To prepare OOM-SCs, we obtained muscle fragments from the pretarsal portion
of the OOM of healthy patients (both elders and youngsters) who underwent eyelid
surgeries. The isolation method for the OOM-derived cells was based on enzymatic
digestion using collagenase type II after washing and chopping of the OOM tissues,
followed by several centrifugations, and seeding of the obtained single cell onto a 0.2%
gelatin-coated culture plate, as shown in Figure 1A. From patients (n = 16) (Supplementary
Table S1), we could isolate the pretarsal parts of OOM tissues, which are composed of
orbital, preseptal, and pretarsal parts [55] (Figure 1B,C). We also isolated OOFCs using the
enzymatic digestion method.
Then, we confirmed the spindle-like morphology and the adherence of OOM-SCs
derived from a 74-year-old donor (OOM-SC-74) and the OOFC-74 that derived from the
same donor (Figure S1A). We also found a sharp increase in population doubling time
in OOFC-74 at P 9, whereas OOM-SC-74 showed an increase in the doubling time at P13
(Figure S1B). OOM-SC-74 showed a marked higher cumulative cell number compared with
that shown by OOFC-74 (Figure S1C).
Antioxidants 2021, 10, 1292 11 of 27
We compared the population doubling time and cumulative number rate of OOM-
SCs that isolated from a 5-year-old donor (OOM-SC-5) with that of other MSCs, namely
WJ-MSC, AD-MSCs, and USCs. Among the tested MSCs, WJ-MSCs showed the lowest
doubling time (30.53 h) and maintained the highest proliferation (3.8 × 1014 ) until P13. It
was followed by OOM-SCs that possess a doubling time of 39.58 h and showed the second-
best proliferation capacity: (3.3 × 1011 ) up to P13. (Figure 1D,E). ADS-MSCs showed
the third-best proliferating MSCs up to P13, whereas USCs maintained the proliferation
capacity up to P9 (Figure 1E). The detailed results of cell doubling time and cumulative
cell number are described in Table 2.
Table 2. Comparison of WJ-MSCs, AD-MSCs, USCs, and OOM-SCs in the cumulative cell number
and doubling time in correlation with the volume of tissue of origin.
WJ-MSCs AD-MSCs USCs OOM-SCs

Volume/Length 14 cm 60 cc 100 mL 2 cm
Cumulative Cell Number 3.8 × 1014 2.1 × 1010 1.0 × 1010 3.3 × 1011
Doubling time 30.53 h 42.34 h 44.46 h 39.58 h
It is of note that we could not detect any significant difference in the proliferation
of OOM-SC-5 or OOM-SC-74. Taken together, OOM-SC-5 showed the best in the cell
proliferation kinetics compared with other MSCs except for WJ-MSCs, which showed
better proliferation capacity. We, therefore, used WJ-MSCs as a potential control MSCs for
our further experiments.
We found that OOM-SC-5 showed high CFU (Figure 2A). We also verified the high
expression of the stemness markers, such as Nanog, Sox2, and Rex1, similar to those of
WJ-MSCs (Figure 2B). Notably, both the MSCs and fibroblasts share a similar morphol-
ogy [56–58]; therefore, it is essential to confirm that our cells possess MSC characteristics.
The OOM-SC-5 and WJ-MSCs showed apparent expression of integrin subunit α6 (ITGA6),
CD146, and Transmembrane 4 L Six Family Member 1 (TM4SF1) genes that are known
to be highly expressed in MSCs, although, as expected, NHDFs showed no or weak ex-
pression of the genes [59–62] (Figure 2C). Further, we assessed the expression levels of
CD markers to confirm the MSC properties of OOM-SC-5, and we found that these cells
significantly expressed CD29, CD73, CD105, and CD166 MSC-positive markers but not
CD19 and CD45 MSC-negative markers (Figure 2D), strongly indicating that OOM-SC-5
are a type of MSCs. In addition, we compared the expression levels of CD markers of
OOM-SCs with other adults MSCs including, WJ-MSCs, AD-MSCs, and USCs using the
flow cytometry analysis. As shown in other adults MSCs, OOM-SC-5 positively express
CD73, CD90, and CD105, whereas they negatively express CD34 and CD 45 Figure 2E. It is
of note that USCs showed the lowest expression of CD 105 compared with other MSCs and
OOM-SCs. The flow cytometry data is presented in percentages in a table (Figure 2E. right
panel). We also found that OOM-SC-5 have adipogenic, chondrogenic, and osteogenic
differentiation capacities, which were measured using Oil red O, Alizarin red S, and Alcian
blue staining, respectively (Figure 2F). The OOM-SC-5 showed similar adipogenic and
osteogenic differentiation capacities to those of WJ-MSCs and higher differentiation ability
than that of USCs (Figure 2F, Table 3). In the case of chondrogenic differentiation, OOM-
SC-5 showed a similar differentiation capacity to that of USCs (Table 3). Taken together,
OOM-SC-5 were confirmed to possess the characteristic features of MSCs, most similarly
with WJ-MSCs.
Antioxidants 2021, 10, 1292 OOM-SC-5 showed a similar differentiation capacity to that of USCs (Table 3). Taken to-12 of 27
gether, OOM-SC-5 were confirmed to possess the characteristic features of MSCs, most
similarly with WJ-MSCs.
FigureFigure 2. Verification
2. Verification of OOM-SCs
of OOM-SCs Characteristics.
Characteristics. (A)(A) Microscopicimages
Microscopic imagesdepict
depictthe
the CFU
CFU ofof OOM-SCs
OOM-SCsthat thatwere
werevisual-
visualized
ized with 0.15% crystal violet solution after two weeks of culture. Images of the stained colonies were captured using
with 0.15% crystal violet solution after two weeks of culture. Images of the stained colonies were captured using phase-
phase-contrast microscopy. (B) RT-PCR results of the expression of the stemness markers Nanog, Sox2, and Rex1 in com-
contrast microscopy.
parison (B)ofRT-PCR
with those results
WJ-MSCs. GAPDHof the
wasexpression of the stemness
used as a housekeeping markers
gene. Nanog,
(C) RT-PCR Sox2,
results of and Rex1
specific in comparison
markers, in-
with those of ITGA6,
cluding WJ-MSCs. GAPDH
CD146, was used
and TM4SF1, as a housekeeping
distinguish gene. MSCs
between multipotent (C) RT-PCR results
and NHDFs. of genes
These specific
aremarkers, including
only expressed
ITGA6,inCD146,
multipotent
andMSCs. (D) RT-PCR
TM4SF1, data for
distinguish the expression
between levels ofMSCs
multipotent the surface
and markers
NHDFs.of These
the isolated
genes OOM-SCs
are onlycompared
expressed in
with those of WJ-MSCs. These markers included the negatively (CD19 and CD45) and positively (CD73, CD105, and
multipotent MSCs. (D) RT-PCR data for the expression levels of the surface markers of the isolated OOM-SCs compared
CD166) expressed markers. (E) FACS analysis for confirming the expression of the negative markers CD34 and CD45 and
with those of WJ-MSCs. These markers included the negatively (CD19 and CD45) and positively (CD73, CD105, and CD166)
expressed markers. (E) FACS analysis for confirming the expression of the negative markers CD34 and CD45 and positive
markers CD73, CD90, and CD105 for OOM-SCs, compared with those of WJ-MSCs. FACS results are summarized in the
table (right panel), and all results are presented in percentages. (F) Microscopic images of adipogenic, chondrogenic, and
osteogenic differentiation were evaluated by Oil Red, Alcian Blue, and Alizarin Red S staining, respectively. The upper and
lower panels represent undifferentiated and differentiated cells, respectively. Scale bar = 200 µm.
Antioxidants 2021, 10, 1292 13 of 27
Table 3. Trilineage differentiation capacity of OOM-SCs compared with those of WJ-MSCs and USCs.
WJ-MSCs USCs OOM-SCs

Adipogenic +++ ++ +++
Chondrogenic +++ ++ ++
Osteogenic +++ ++ +++
3.2. OOM-SC-EVs and WJ-MSC-EVs Characterization

To prepare OOM-SC-EVs and WJ-MSC-EVs, cells were cultured in 10% exosome-
depleted FBS media for 48 h until reaching 80–90% confluency. Dead cells and cell debris
were removed via differential centrifugation, and the ultrafiltration process, and EVs
were collected in a filter device using an Amicon 10-kDa (pore size) regenerated cellulose
membrane. The TEM images of the purified EVs revealed the morphology of the purified
EVs, which were cup- or sphere-shaped (Figure 3A). We confirmed the expression levels of
EV-associated positive markers including the tetraspanin membrane proteins, namely CD9,
CD63, and CD81 using immunoblotting (Figure 3B). Moreover, we verified the expression
levels of EV-negative markers, such as calnexin and 130-kDa cis-Golgi matrix protein
(GM130), which were not detected in the OOM-SC-EVs and WJ-MSC-EVs (Figure 3B).
The EVs size distribution was tracked using a Nanosizer or DLS, and we could not
detect any significant variation in the size between OOM-SC-EVs and WJ-MSC-EVs with
a size range of 90 to 120 nm (Figure 3C), while their concentration was determined to be
1.66 × 1010 particles/mL for OOM-SC-EVs and 1.5 × 1010 particles/mL for WJ-MSC-EVs,
which measured using NTA (Figure 3D). Finally, we confirmed the expression levels of the
positive EVs markers using FACS analysis. For OOM-SC-EVs, CD63, and CD81 expression
levels were 99.5% and 99.4%, respectively. In the case of OOM-SC-EVs, the CD63 and CD81
expression levels were 98.7% and 99.9%, respectively (Figure 3E).
In addition, supplementary Table S2 summarizes the criteria for EVs preparation and
characterization according to the recommendations of Minimal information for studies of
extracellular vesicles 2018 (MISEV2018) that calibrate the EVs preparation procedure [63].
3.3. Advanced 3D Culture Approach for Efficient EVs Production

In this experiment, we pursued an efficient approach for EVs production with a high
yield in comparison with the monolayer culture system. For that purpose, we prepared
spheroids from OOM-SC-74 and WJ-MSCs using ORS at 60 rpm for two days. Figure 3F
shows the spheroids morphology of OOM-SC-74 and WJ-MSCs compared with the mono-
layer morphology of WJ-MSCs. We purified EVs from the culture supernatant of the
cultured spheroids and monolayer, and we measured the number of the particles per cell
and the EVs concentration. We could isolate a significantly higher particles number per
cell (Figure 3G) and higher concentration (Figure 3H) in the case of 3D culture compared
with the monolayer culture.
3.4. OOM-SC-EV Treatment Modulated ROS Generation and DELAYED Senescence-Related

Changes in NHDFs
We examined the potential of OOM-SC-EVs in delaying senescence-associated changes
in NHDFs. The late-stage NHDFs showed a high number of SA-βgal-positive, blue-colored
cells; however, treatment with OOM-SC-EVs led to a significant decrease in SA-βgal
positive cells compared with control cells (Figure 4A). We then measured the modulation
of ROS generation following OOM-SC-EV treatment and found that high levels of ROS
generation in late passage NHDFs were significantly suppressed upon the treatment
(Figure 4B). Moreover, we observed that this treatment resulted in a significant increase
in the expression levels of antioxidant genes, such as glutathione peroxidase (GPX) 2,
GPX3, glutathione S-reductase (GSR), and catalase (Figure 4C). Additionally, OOM-SC-EV-
exposed cells showed a marked increase in the expression level of extracellular superoxide
dismutase (SOD3) (Figure 4C).
Antioxidants 2021, 10, 1292 14 of 27
Figure
Figure 3. Characterization
3. Characterization ofof OOM-SC-EVs.(A)
OOM-SC-EVs. (A)TEM
TEM images
images of
of EVs
EVs showing
showingcup-
cup-or
orsphere-shaped
sphere-shaped morphology.
morphology. TEM
TEM
analysis was performed at 80 kV. Scale bar = 100 nm. (B) Characterization of the expression levels of the EV-associated
analysis was performed at 80 kV. Scale bar = 100 nm. (B) Characterization of the expression levels of the EV-associated
positive surface markers, including CD9, CD63, CD81, calnexin, and GM130, via immunoblotting. We used 3 μg of EVs
positive surface markers, including CD9, CD63, CD81, calnexin, and GM130, via immunoblotting. We used 3 µg of EVs for
for the immunoblotting analysis. The protein expression levels of the EV markers were compared with those of the whole
the immunoblotting analysis. The protein expression levels of the EV markers were compared with those of the whole cell
lysate. (C) Dynamic light scattering analysis of EVs sizes. The average diameter of the purified EVs was of a size range of 90
Antioxidants 2021, 10, 1292 15 of 27
to 120 nm. (D) Nanoparticle tracking analyzer NS300 for counting EV numbers. EVs concentrations were 1.66 × 1010 par-
ticles/mL for OOM-SC-EVs and 1.5 × 1010 particles/mL for WJ-MSC-EVs. (E) FACS analysis confirmed the expression
of EV-associated markers, namely CD63 and CD81. (F) Phase-contrast microscopic pictures of WJ-MSCs monolayer and
spheroids of WJ-MSCs and OOM-SCs (OOM-SC-74). For spheroid culture, WJ-MSCs and OOM-SCs were seeded onto
F127 -coated AggreWell 400TM plates for 24 h for EB formation. Then, EBs were transferred to the ORS at 60 rpm for two
days. EVs were isolated from both spheroids and the monolayer simultaneously. Scale bar = 200 µm. (G,H) Nanoparticle
tracking analyzer NS300 for counting EV numbers in monolayer and spheroids. We detected 1246 particles/cell in WJ-MSCs
monolayer, whereas EVs yield from WJ-MSCs and OOM-SCs spheroids were 3984 particles/cell and 4033 particles/cell,
respectively. Data shown in Figure 3G are presented as mean ± SD. Statistical significance was determined using One-way
ANOVA: ****
Antioxidants p <10,0.0001,
2021, ns; not
x FOR PEER significant.
REVIEW 16 of 28
FigureFigure 4. OOM-SC-EVs
4. OOM-SC-EVs alleviate
alleviate senescence-associatedchanges
senescence-associated changesand
andmodulate
modulate ROSROSgeneration.
generation.(A)(A) SA-βgal
SA-βgal assay show-
assay showing
ing a significant
a significant reduction reduction of SA-βgal-positive
of SA-βgal-positive cells after
cells after OOM-SC-EV
OOM-SC-EV treatment.
treatment. SA-βgal-positive cells
SA-βgal-positive cells are
are stained
stainedblue.
blue. The
The lower panel graphical data represents the number of SA-βgal-positive cells shown in the upper panel, shown as a
lower panel graphical data represents the number of SA-βgal-positive cells shown in the upper panel, shown as a percentage
percentage of that of the control cells (late passage NHDF). Data are presented as mean ± SD. Statistical significance was
of thatdetermined
of the control
usingcells (late passage
Two-tailed t test: **NHDF). Databar
p < 0.01. Scale are= presented
200 μm. (B) as mean ±ofSD.
Mitigation ROS Statistical
generationsignificance was determined
in OOM-SC-EV-treated
using late
Two-tailed t test: cells.
passage NHDF ** p <ROS 0.01. Scalewere
signals bardetected
= 200 µm. (B) Mitigation
via incubation in a 10ofμM
ROS generation
H2DCFDA in OOM-SC-EV-treated
solution for 30 min at 37 °C, late
passagefollowed
NHDFby observation
cells. ROS signalsusingwerea fluorescence
detected via microscope.
incubation The
in left
a 10panel shows the visualization
µM H2DCFDA solution forof 30ROS at 37 ◦signals
mingreen C, followed
using the fluorescent microscope, while the right panels show the FACS-mediated quantitative analysis of ROS generation.
by observation using a fluorescence microscope. The left panel shows the visualization of ROS green signals using the
The left panel shows the visualization of ROS green signals using the fluorescent microscope, while the right panel shows
fluorescent microscope, quantitative
the FACS-mediated while the right panels
analysis of ROSshow the FACS-mediated
generation. Data are presented quantitative analysis
as mean ± SD. of ROS
Statistical generation.
significance was The
left panel
determined using One-way ANOVA: *** p < 0.001. Scale bar = 200 μm. (C) RT-PCR analysis of the expression levels of the
shows the visualization of ROS green signals using the fluorescent microscope, while the right panel shows
antioxidant quantitative
FACS-mediated genes in OOM-SC-EV-treated
analysis of ROS cells. OOM-SC-EVs
generation. Datasignificantly
are presented increased the expression
as mean levels of significance
± SD. Statistical the antioxi- was
dant genes GPX2, GPX3, GSR, SOD3, and catalase. Data are presented as mean ± SD. Statistical significance was deter-
determined using One-way ANOVA: *** p < 0.001. Scale bar = 200 µm. (C) RT-PCR analysis of the expression levels of
mined using Two-tailed t test: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
antioxidant genes in OOM-SC-EV-treated cells. OOM-SC-EVs significantly increased the expression levels of the antioxidant
genes GPX2, GPX3, GSR, SOD3, 3.5.and catalase. Data
OOM-SC-EV are presented
Treatment Modulated as the
mean ± SD.Synthesis
Melanin Statistical significance
of B16F10 was determined
Melanoma Cells
using Two-tailed t test: * p < 0.05, ** We p < 0.01, *** p < 0.001, and **** p < 0.0001.
investigated the effect of OOM-SC-EV treatment on cell viability or melatonin
synthesis in B16F10 melanoma cells (Figure 5A). The melanoma cells were seeded onto
12-well plates in RPMI 1640 medium and cultured until confluency. The cells were then
cultured in DMEM high glucose media and treated with OOM-SC-EVs. There were no
significant changes in cell viability upon treatment with 1.5, 3, 9, and 15 × 108 particles/mL
Antioxidants 2021, 10, 1292 16 of 27
3.5. OOM-SC-EV Treatment Modulated the Melanin Synthesis of B16F10 Melanoma Cells
We investigated the effect of OOM-SC-EV treatment on cell viability or melatonin
synthesis in B16F10 melanoma cells (Figure 5A). The melanoma cells were seeded onto
12-well plates in RPMI 1640 medium and cultured until confluency. The cells were then
cultured in DMEM high glucose media and treated with OOM-SC-EVs. There were no
significant changes in cell viability upon treatment with 1.5, 3, 9, and 15 × 108 particles/mL
OOM-SC-EVs, although a slight decrease in cell viability was detected upon treatment
with 30 × 108 particles/mL OOM-SC-EVs (Figure 5B). Subsequently, we treated the B16F10
melanoma cells with a melanin synthesis activator (α-MSH, 200 nM), melanin synthesis
inhibitor (arbutin, 100 µM), or OOM-SC-EVs (1.5, 3, 9, and 15 × 108 particles/mL) and
found that OOM-SC-EV treatment led to an apparent inhibitory activity on α-MSH-induced
melatonin synthesis in a dose-dependent manner (Figure 5C). Additionally, we measured
the intracellular and extracellular melanin contents upon OOM-SC-EV treatment and found
that this treatment resulted in significant suppression of both intracellular (cell pellets) and
extracellular melanin contents (Figure 5D, E). Further, we evaluated changes in the mRNA
expression levels of tyrosine synthesis-related genes, namely microphthalmia-associated
transcription factor (MITF), tyrosinase-related protein-1 (TYRP-1), and TYRP-2, and tyrosi-
nase activity upon OOM-SC-EV treatment. Our results showed that although there were no
significant changes in the expression of the tyrosine synthesis-related genes (Figure 5F), ty-
rosinase activity was significantly reduced (Figure 5G). This tyrosinase activity-suppressing
effect of OOM-SC-EV treatment was also visually confirmed (Figure 5G lower panel).
3.6. In Vitro and In Vivo Wound Healing and Anti-Wrinkle Capacities of OOM-SC-EVs
The wound healing and anti-wrinkle capacities of OOM-SC-EVs were examined. We
conducted a cell scratch assay using NHDFs and found that NHDF migration increased
upon OOM-SC-EV treatment. OOM-SC-EVs led to a similar NHDFs migration-increasing
activity to that of WJ-MSC-EVs (Figure 6A,B). We also measured the effect of OOM-SC-74-
EVs and OOFC-74-EVs on the in vitro wound closure, in which OOM-SC-74 -EVs showed
a significant closure of the in vitro wound, especially at 24 h post scratch (Figure S2).
Moreover, we found that OOM-SC-EVs treatment significantly increased the expression
levels of the anti-wrinkle-related genes ColA1, monocyte chemoattractant protein-1 (MCP-
1), MCP-3, chemokine (C-C motif) ligand 5 (CCL-5), and plasminogen activator inhibitor-1
(PAI-1), transforming growth factor-β (TGFβ) 1, and TGFβ3 (Figure 6C). It is of note that
our data show the increased ratio of TGFβ3 to TGFβ1, which is in agreement with a
previous report’s conclusions on the effect of the increased ratio of TGFβ3 to TGFβ1 by
MSC derived exosome treatment in efficient in in vivo scarless wound healing [64].
Antioxidants 2021, 10, 1292 17 of 27
Figure 5. Modulatory effects of OOM-SC-EVs on melanin synthesis and tyrosinase activity. (A) A representative scheme
Figure 5. Modulatory effects of OOM-SC-EVs on melanin synthesis and tyrosinase activity. (A) A representative scheme
elucidates the experimental schedule for evaluating the effects of OOM-SC-EVs on melanin synthesis and tyrosinase ac-
elucidates
tivity. Inthe
thisexperimental
experiment, schedule for B16F10
we cultured evaluating the effects
melanoma cellsofusing
OOM-SC-EVs on melanin
a growth medium synthesis
(RPMI 1640). and
The tyrosinase activity.
cells were then
In this experiment, we cultured B16F10 melanoma cells using a growth medium (RPMI 1640). The cells were then exposed
Antioxidants 2021, 10, 1292 18 of 27
to OOM-SC-EVs in a dose-dependent manner in combination with arbutin (melanin synthesis inhibitor) and α-MSH
(melanin synthesis activator) in DMEM high glucose medium. Tyrosine activity and melanin content were measured after
OOM-SC-EV and inhibitor treatments on day 2 and day 3, respectively. (B) Effect of concentration-dependent exposure of
OOM-SC-EVs on the viability of B16F10 cells. B16F10 cells were plated at 3 × 103 cells/well in a 96-well plate and maintained
in serum-free RPMI medium overnight. The cells were then exposed to OOM-SC-EVs in a concentration-dependent manner
(0.6, 1.5, 3, 9, 15, and 30 × 108 particles/mL) for 48 h. Subsequently, we added 10 µL of CCK-8 solution/well (Dojindo,
CK04-05), followed by incubation for 2 h with protection from light. Absorbance was measured at 450 nm using a Bio-RAD
x-MarkTM spectrophotometer. (C) Microscopic images showing the dose-dependent inhibitory action of OOM-SC-EVs
on α-MSH-mediated melanosome formation compared with that of the melanin synthesis-suppression chemical arbutin.
The formation of melanosomes is indicated by a yellow arrow. OOM-SC-EVs showed a dose-dependent suppression
of melanosome formation. Scale bar = 100 µm. (D) Measurement of intracellular melanin levels after treatment with
OOM-SC-EVs. Significant inhibition of melanin synthesis by OOM-SC-EVs was detected at 9 and 15 × 108 particles/mL,
similar to the inhibitory effect of arbutin. The lower panel showing the qualitative inhibitory action of OOM-SC-EVs against
melanosome formation was visualized in cells via a change in the color of the cell pellets. (E) Estimation of the effect of
OOM-SC-EVs on the suppression of α-MSH-mediated induction of extracellular melanin levels compared to that of arbutin.
(F) RT-PCR data for measuring changes in the expression levels of melanin synthesis-associated genes, including tyrosine
synthesis-related genes, such as MITF, tyrosinase, TYRP-1, and TYRP-2, after treatment with OOM-SC-EVs in combination
with α-MSH. GAPDH was used as a housekeeping gene. (G) Measurement of tyrosinase activity after treatment with various
concentrations of OOM-SC-EVs compared with those after treatment with arbutin and α-MSH for 48 h. Subsequently, cells
were harvested, permeabilized, frozen and thawed, and centrifuged. For the tyrosine activity assay, the supernatant was
mixed with 10 mM L-DOPA in a 96-well plate and incubated for 1 h at 37 ◦ C. The activity was measured at 405 nm using
a spectrophotometer and represented as a percentage of the control value. The lower panel shows the visual analysis of
tyrosinase activity in a 96-well plate. Data shown in Figure 5B,D,E,G are presented as mean ± SD. Statistical significance
was determined in Figure 5B,D,E,G using Two-tailed t test: * p < 0.05, ** p < 0.01 *** p < 0.001, and **** p < 0.0001.
In addition, we confirmed the in vivo wound healing capacity of OOM-SC-EVs using

an animal model. After performing a full-thickness skin wound on the mice back, we
injected OOM-SC-EVs subcutaneously in the vicinity of the experimental wound and
observed a significant wound healing effect (Figure 6D,E). Moreover, we confirmed the
marked re-epithelization of the wound following OOM-SC-EVs treatment using hema-
toxylin and eosin and Masson’s trichrome staining (Figure 6F).
Antioxidants 2021, 10, 1292 19 of 27
Figure 6. In vitro and in vivo wound healing capacities and the anti-wrinkling activity of the OOM-SC-EVs (A) Effect of
Figure 6. In vitro and in vivo wound healing capacities and the anti-wrinkling activity of the OOM-SC-EVs (A) Effect of
OOM-SC-EVs in the closure of in vitro scratches of fully confluent NHDFs tablet 10. μg/mL mitomycin C for 2 h and then
OOM-SC-EVs in the
scratched with closure
a 200-μL tip.ofSubsequently,
in vitro scratches
cells of fully
were confluent
exposed NHDFs
to 1.5 tablet 10.
× 109 particles of µg/mL mitomycin
OOM-SC-EVs C for 2 h and
or WJ-MSC-EVs in then
a
scratched with a 200-µL tip. Subsequently, cells were exposed to 1.5 × 109 particles of OOM-SC-EVs or WJ-MSC-EVs in a
Antioxidants 2021, 10, 1292 20 of 27
time-dependent manner (0, 12, and 24 h). Scale bar = 200 µm. (B) Graphic diagram representing the in vitro scratch assay in
Figure 6A, and the wound closure was evaluated using TScratch software. Data are presented as mean ± SD. Statistical
significance was determined using RMANOVA with post-hoc analysis: *** p < 0.001, and **** p < 0.0001, NS; not significant.
(C) RT-PCR results showing changes in the expression levels of anti-wrinkle-associated genes. OOM-SC-EV treatment
markedly increased the expression levels of collagen synthesis-related genes, namely ColA1, MCP-1, MCP-3, CCL-5, PAI-1,
TGF-β1, and TGF-β3, which are related to high collagen synthesis and the treatment of wrinkles. Data are presented as
mean ± SD. Statistical significance was determined using Two-tailed t test: ** p < 0.01 *** p < 0.001, and **** p < 0.0001.
(D) In vivo wound healing assay. In this model, two full-thickness skin wounds, on the back of each mouse, were excised
via a sterile biopsy punch, followed by the subcutaneous injection of 1.5 × 109 particles/mL OOM-SC-EVs diluted in 30 µL
PBS. Wound closure was monitored every two days until day 14. (E) Graphical data depicting the closure of the wound
area as calculated relatively to the original wound area on day 0 after inducing the injury (n = 5) and in a time-dependent
manner. Data are presented as mean ± SD. Statistical significance was determined using RMANOVA with post-hoc analysis:
** p < 0.01, and **** p < 0.0001. (F) Hematoxylin and eosin and Masson’s trichome staining of the mice skin after sacrifice
(on day 14). Two weeks after injection of OOM-SC-EVs into the experimental wound, the skin tissues were fixed with 4%
PFA and then dehydrated using various concentrations of alcohol, followed by paraffin embedding. For the evaluation of
regeneration and re-epithelization of the wound after OOM-SC-EV application, the sections were stained with hematoxylin
and eosin. Further, Masson’s trichrome staining was performed to estimate collagen synthesis rate. Scale bar = 200 µm.
4. Discussion
The goal of our research is to efficiently utilize the waste of human facial tissue from
the daily performed ocular surgeries for therapeutic (blepharoplasty and ptosis repair) or
cosmetic (double lid crease formation) purposes in both elders and youngsters. Eyelid
blepharoplasty is a widespread cosmetic surgery, during which the removed OOM tissues
are discarded as medical waste. Compared to muscles in other body sites, the OOM in
the eyelids is easily accessible under local anesthesia with little discomfort to the patient,
and its removal is far from being associated with loss of function and morbidity for the
donor due to its high regenerative capacity. The OOM consists of three anatomic regions,
including pretarsal, preseptal, and orbital regions, and each region is suggested to have
a different physiological function in the histological microstructure [65]. The pretarsal
OOM used in this study contained a high ratio of muscle tissue and a low percentage of fat
tissue [65].
In this study, we isolated OOM-SCs from the pretarsal OOMs using the enzymatic
digestion method. The OOM-SCs successfully adhered to the culture plate and showed a
spindle-like morphology, high clonogenic proliferative behavior, and high stemness and
self-renewal capacities. Generally, MSCs have various unique features, including trilineage
differentiation potential, stemness, and self-renewal capacities [66]. Similarly, compared
with MSCs including WJ-MSCs, AD-MSCs, and USCs, the OOM-SCs showed expression
profiles of MSC surface markers and trilineage differentiation potential. Moreover, we
confirmed the high expression levels of ITGA6, CD146, and TM4SF1, which are specifically
expressed in multipotent MSCs but not in fibroblasts.
The therapeutic potential of MSC-derived EVs has been widely reported [67–72]. EVs,
which are secreted by most cells, are lipid vesicles with small membranes with diameters
of 30–120 nm [73,74]. Stem cell-derived EVs have been reported to contain transcription
factors that are secreted by stem cells, which are responsible for maintaining stem cell
properties, as well as secreted signaling molecules, such as WNTs, TGF-β, and β-catenin,
implicated in EV-mediated therapeutic actions [75–77]. EVs can also convey RNAs, in-
cluding mRNAs, miRNAs, and lncRNAs, which represent their cells of origin [78–84].
Interestingly, EVs possess the capacity to transfer specific proteins and genetic materials
to the recipient cells and, also, EV membranes can be engineered using organ-specific
therapeutic proteins or drugs for treating the incurable disease of target organs [85–90].
Moreover, the application of EVs obviates the biosafety issues incurred by the direct appli-
cation of whole stem cells, including tumorigenicity and immunogenic reactions [91,92].
In the field of ophthalmology, the capacity of EVs to treat immune-related eye diseases,
Antioxidants 2021, 10, 1292 21 of 27
retinal inflammation, and retinal ischemia and their application as biomarkers for ocu-
lar diseases have been reported [93–97]. The in vivo corneal wound healing activity of
MSC-derived exosomes has also been demonstrated [98]. Here, we could effectively isolate
and characterize OOM-SC-EVs and reveal their high therapeutic effects on melanogenesis
suppression, the anti-wrinkle process, and wound healing. According to the guidelines
determined by MISEV2018 for EVs nomenclature, the term EVs can be applied to particles
that are naturally released from cells and are characterized by their inability to replicate, are
surrounded by a lipid bilayer, and lack any functional nucleus [63]. According to the size,
EVs could be classified into small EVs (less than 100 nm or 200 nm) and large or medium
EVs (more than 200 nm) [63]. In our study, we carried out differential centrifugation,
ultrafiltration, and ultracentrifugation to get rid of debris, dead cells, macrovesicles, and
most of the soluble proteins. We ultimately obtained small EVs of 90–120 nm.
Interestingly, OOM-SC-EVs led to marked suppression of enhanced ROS generation
in the late-passaged (aged) NHDFs. Moreover, they increased the expression levels of
antioxidant genes, namely catalase, GPX2, GPX3, GSR, and SOD3 in aged NHDFs. Our
data also showed the capacity of OOM-SC-EVs in the in vitro and in vivo wound closure in
NHDFs and mice, respectively. This result is consistent with a previous report that umbilical
cord MSC-derived EVs showed potent capacities for enhancing wound healing and skin
regeneration [39,99]. In addition, OOM-SC-EVs markedly enhanced the expression levels of
collagen synthesis-related genes, namely ColA1, MCP-1, MCP-3, CCL-5, PAI-1, TGFβ1, and
TGFβ3. Previous reports have demonstrated the capacities of stem cell-derived exosomes in
the alleviation of skin aging change [100], enhancement of collagen synthesis, angiogenesis,
and scar healing [101,102]. Additionally, EVs have been previously implicated in ROS
modulation [103]. To our knowledge, this is the first study revealing the roles of OOM-SC-
EVs in the improvement of wound healing in vitro and in vivo and in the significant delay
in skin aging by promoting the expression levels of collagen synthesis-related genes. We
hypothesized that OOM-SC-EV-induced upregulation of collagen synthesis genes may be
one of the mechanisms that mediate efficient wound healing. Further studies are required
to confirm the crosslink between OOM-SC-EVs and collagen synthesis and to verify OOM-
SC-EV-related ROS modulation in crosslinks with their therapeutic activities. In addition,
the role of OOM-SC-EVs in modulating the immune and inflammatory responses during
the wound healing process needs in-depth investigations.
Based on our findings, we can postulate the uptake of OOM-SC-EVs into the epidermis
and dermis, followed by the interaction of OOM-SC-EVs with fibroblasts. For clinical or
esthetic applications, this effect can emulate the application of microneedles, which are
microscopic applicators used to deliver vaccines or other drugs across various barriers,
while the transdermal application is the most popular use of microneedles. Microneedles
may help overcome poor skin penetration of OOM-SC-EVs, and several novel exciting
microneedle concepts may be of great help for the intradermal delivery of OOM-SC-EVs in
the future [104].
Melanin possesses a protective function against the harmful effects of ultraviolet (UV)
light. However, excess melanin synthesis can result in unfavorable skin disorders, such
as spots, freckles, skin hyperpigmentation, and melisma [105,106]. Therefore, inhibition
of melanin synthesis has garnered attention in the fields of dermatology and cosmetics.
In our study, we showed that OOM-SC-EVs treatment significantly suppressed melanin
synthesis in B16F10 cells. Although OOM-SC-EVs treatment did not significantly change
the expression levels of melanogenesis-related genes, such as MITF, tyrosinase, TYRP-1,
and TYRP-2, it resulted in the significant inhibition of tyrosinase activity. We hypothesized
that there is another mechanism associated with OOM-SC-EV-mediated inhibition of
melanin synthesis. For instance, previous reports have demonstrated the implication
of high ROS generation and depletion of antioxidant factors in the overproduction of
melanin [107]. Moreover, several reports have revealed the application of antioxidant
agents for the treatment of high melanin-mediated hyperpigmentation [108,109]. Here, we
demonstrated the antioxidant activity of OOM-SC-EVs, and therefore, we could postulate
Antioxidants 2021, 10, 1292 22 of 27
the role of OOM-SC-EV-related antioxidant activity in melanogenesis inhibition, which

needs further investigation.
We sought to improve the yield of OOM-SC-EVs for large scale production in the
future, and so we tried to culture OOM-SCs using the 3D platform using the ORS, and we
found a marked increase in the EVs yield upon using the 3D platform compared with using
2D culture system (Figure 3). We are planning to perform an in-depth investigation on the
mechanism implicated in the high yield of EVs during the 3D culture system compared
to the monolayer system in a future study. We also will verify the capacity of the 3D-
derived EVs in the disease model. It is noteworthy that we could not detect any significant
difference in terms of cell number, EVs yield, and functions between cells obtained from
youngsters and elders. Notably, the 3D platform showed a significantly better EVs yield
than that shown in the 2D platform (Figure 3). Therefore, in our future study, we planned
to devise a detailed efficient protocol for OOM-SC-EVs production using the 3D culture
system. Our study affords a good source for stem cell yield that ultimately produces
high-quality EVs, which possess various applications including antioxidant, anti-wrinkle,
anti-senescence, whitening effect, and skin regenerative capacity (Figure 1A).
5. Conclusions
In conclusion, we were able to efficiently isolate and culture OOM-SCs from the
human facial tissues (from youngsters and elders) that were discarded after eyelid ble-
pharoplasty or epiblepharon surgeries. Stem cell properties of OOM-SCs were compared
with human adult MSCs (WJ-MSCs, AD-MSCs, and USCs), and possible therapeutic ap-
plications of OOM-SC-EVs were verified. Our findings provide new insights into various
possible therapeutic and esthetic applications of OOM-SC-EVs, including wound healing,
modulation of collagen synthesis-related genes, whitening effect, anti-senescence activity,
inhibition of tyrosinase activity, and anti-wrinkling activity. Importantly, we exploited
the waste human facial tissues from the daily performed ocular surgeries for therapeutic
(blepharoplasty and ptosis repair) or cosmetic (double lid crease formation) purposes in
both elders and youngsters. Notably, the 3D platform showed a significantly better EVs
yield than that shown in the 2D platform. Our study provides promising therapeutic and
esthetic applications of OOM-SC-EVs, which can be competently isolated from the waste
human facial tissues.
Supplementary Materials: The following are available online at https://www.mdpi.com/article/10

.3390/antiox10081292/s1, Table S1: List of human orbicular oculi muscle and fat tissue samples, Table
S2: Checklist of EV isolation and characterization method, Figure S1: Morphology and proliferation
kinetics of OOM-SC-74 and OOFC-74, Figure S2: In vitro wound healing assay of OOM-SC-74-EVs
and OOFC-74-EVs.
Author Contributions: Conceptualization, S.-G.C., H.J.S., K.M.L. and A.A.D.; methodology, S.-G.C.,
H.J.S., K.M.L., Y.C., Y.L., J.A. and S.L.; Founding acquisition, S.-G.C.; Investigation, Validation, Formal
analysis, Supervision, Writing—original draft, Writing—Review and Editing, S.-G.C., H.J.S., K.M.L.,
A.A.D. and M.G.; Visualization, Investigation, Formal analysis, B.V., and H.J.K.; Animal Surgeries,
K.M.L., A.A.D., Y.C., Y.L., J.A., S.L. and H.J.S. All authors have read and agreed to the published
version of the manuscript.
Funding: The following research grants are acknowledged: National Research Foundation (NRF)
funded by the Korean government (Ministry of Education, Science, and Technology) (grant numbers
2019M3A9H1030682 and 2015R1A5A1009701) and by Konkuk University Researcher Fund in 2019.
Institutional Review Board Statement: The protocols used in this study were approved by the
ethics committees of Konkuk University Medical Center (KUMC 2019-05-043), Konkuk University
(7001355-201705-BR-181 and 7001355-201507-BR-072), and IACUC at Konkuk University (KU20132)
and conformed to the principles outlined in the Declaration of Helsinki.
Informed Consent Statement: Not applicable.
Antioxidants 2021, 10, 1292 23 of 27
Data Availability Statement: The data are presented within the paper. Additional raw data are
available on request from the corresponding author.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Scuderi, N.; Rubino, C. Island chondro-mucosal flap and skin graft: A new technique in eyelid reconstruction. Br. J. Plast. Surg.
1994, 47, 57–59. [CrossRef]
2. Zhou, G. Clinical Experience with Orbicularis Oculi Myocutaneous Flaps in the Temporal Area. Plast. Reconstr. Surg. 2003, 112,
1862. [CrossRef]
3. Yoshimura, Y.; Nakajima, T.; Yoneda, K. Reconstruction of the entire upper eyelid area with a subcutaneous pedicle flap based on
the orbicularis oculi muscle. Plast. Reconstr. Surg. 1991, 88, 136–139. [CrossRef] [PubMed]
4. Kostakoǧlu, N.; Özcan, G. Orbicularis oculi myocutaneous flap in reconstruction of postburn lower eyelid ectropion. Burns 1999,
25, 553–557. [CrossRef]
5. Mawrie, D.; Kumar, A.; Magdalene, D.; Bhattacharyya, J.; Jaganathan, B.G. Mesenchymal stem cells from human extra ocular
muscle harbor neuroectodermal differentiation potential. PloS ONE 2016, 11, e0156697. [CrossRef] [PubMed]
6. Polisetty, N.; Fatima, A.; Madhira, S.L.; Sangwan, V.S.; Vemuganti, G.K. Mesenchymal cells from limbal stroma of human eye.
Mol. Vis. 2008, 14, 431.
7. Formicola, L.; Marazzi, G.; Sassoon, D.A. The extraocular muscle stem cell niche is resistant to ageing and disease. Front. Aging
Neurosci. 2014, 6, 328. [CrossRef]
8. Pacheco-Pinedo, E.C.; Budak, M.T.; Zeiger, U.; Jørgensen, L.H.; Bogdanovich, S.; Schrøder, H.D.; Rubinstein, N.A.; Khurana, T.S.
Transcriptional and functional differences in stem cell populations isolated from extraocular and limb muscles. Physiol. Genom.
2009, 37, 35–42. [CrossRef]
9. Yamanaka, Y.; Takenaka, N.; Sakurai, H.; Ueno, M.; Kinoshita, S.; Sotozono, C.; Sato, T. Human Skeletal Muscle Cells Derived
from the Orbicularis Oculi Have Regenerative Capacity for Duchenne Muscular Dystrophy. Int. J. Mol. Sci. 2019, 20, 3456.
[CrossRef]
10. Liu, G.; Liao, C.; Chen, X.; Xu, Y.; Tan, J.; Han, F.; Ye, X. Identification and Characterization of Skeletal Muscle Stem Cells from
Human Orbicularis Oculi Muscle. Tissue Eng. Part C Methods 2018, 24, 486–493. [CrossRef]
11. Yáñez-Mó, M.; Siljander, P.R.-M.; Andreu, Z.; Bedina Zavec, A.; Borràs, F.E.; Buzas, E.I.; Buzas, K.; Casal, E.; Cappello, F.;
Carvalho, J. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 2015, 4, 27066.
[CrossRef] [PubMed]
12. Valadi, H.; Ekström, K.; Bossios, A.; Sjöstrand, M.; Lee, J.J.; Lötvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is
a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007, 9, 654–659. [CrossRef]
13. Zhang, Y.; Liu, Y.; Liu, H.; Tang, W.H. Exosomes: Biogenesis, biologic function and clinical potential. Cell Biosci. 2019, 9, 1–18.
[CrossRef]
14. Gowen, A.; Shahjin, F.; Chand, S.; Odegaard, K.E.; Yelamanchili, S.V. Mesenchymal stem cell-derived extracellular vesicles:
Challenges in clinical applications. Front. Cell Dev. Biol. 2020, 8, 149. [CrossRef] [PubMed]
15. Li, C.-J.; Fang, Q.-H.; Liu, M.-L.; Lin, J.-N. Current understanding of the role of Adipose-derived Extracellular Vesicles in
Metabolic Homeostasis and Diseases: Communication from the distance between cells/tissues. Theranostics 2020, 10, 7422.
[CrossRef] [PubMed]
16. Rodrigues, M.; Fan, J.; Lyon, C.; Wan, M.; Hu, Y. Role of extracellular vesicles in viral and bacterial infections: Pathogenesis,
diagnostics, and therapeutics. Theranostics 2018, 8, 2709. [CrossRef]
17. Gurunathan, S.; Kang, M.-H.; Kim, J.-H. A comprehensive review on factors influences biogenesis, functions, therapeutic and
clinical implications of exosomes. Int. J. Nanomed. 2021, 16, 1281. [CrossRef] [PubMed]
18. Nassar, W.; El-Ansary, M.; Sabry, D.; Mostafa, M.A.; Fayad, T.; Kotb, E.; Temraz, M.; Saad, A.-N.; Essa, W.; Adel, H. Umbilical cord
mesenchymal stem cells derived extracellular vesicles can safely ameliorate the progression of chronic kidney diseases. Biomater.
Res. 2016, 20, 1–11. [CrossRef] [PubMed]
19. Kordelas, L.; Rebmann, V.; Ludwig, A.; Radtke, S.; Ruesing, J.; Doeppner, T.; Epple, M.; Horn, P.; Beelen, D.; Giebel, B. MSC-
derived exosomes: A novel tool to treat therapy-refractory graft-versus-host disease. Leukemia 2014, 28, 970–973. [CrossRef]
[PubMed]
20. Sun, Y.; Shi, H.; Yin, S.; Ji, C.; Zhang, X.; Zhang, B.; Wu, P.; Shi, Y.; Mao, F.; Yan, Y. Human mesenchymal stem cell derived
exosomes alleviate type 2 diabetes mellitus by reversing peripheral insulin resistance and relieving β-cell destruction. ACS Nano
2018, 12, 7613–7628. [CrossRef]
21. Zhao, M.; Shi, J.; Cai, W.; Liu, K.; Shen, K.; Li, Z.; Wang, Y.; Hu, D. Advances on Graphene-Based Nanomaterials and Mesenchymal
Stem Cell-Derived Exosomes Applied in Cutaneous Wound Healing. Int. J. Nanomed. 2021, 16, 2647. [CrossRef] [PubMed]
22. Han, C.; Sun, X.; Liu, L.; Jiang, H.; Shen, Y.; Xu, X.; Li, J.; Zhang, G.; Huang, J.; Lin, Z. Exosomes and their therapeutic potentials
of stem cells. Stem Cells Int. 2016, 2016, 7653489. [CrossRef]
23. Teixeira, F.G.; Carvalho, M.M.; Sousa, N.; Salgado, A.J. Mesenchymal stem cells secretome: A new paradigm for central nervous
system regeneration? Cell. Mol. Life Sci. 2013, 70, 3871–3882. [CrossRef] [PubMed]
Antioxidants 2021, 10, 1292 24 of 27
24. Keshtkar, S.; Azarpira, N.; Ghahremani, M.H. Mesenchymal stem cell-derived extracellular vesicles: Novel frontiers in regenera-
tive medicine. Stem Cell Res. Ther. 2018, 9, 1–9. [CrossRef] [PubMed]
25. Yang, J.; Chen, Z.; Pan, D.; Li, H.; Shen, J. Umbilical cord-derived mesenchymal stem cell-derived exosomes combined pluronic
F127 hydrogel promote chronic diabetic wound healing and complete skin regeneration. Int. J. Nanomed. 2020, 15, 5911. [CrossRef]
[PubMed]
26. Basu, J.; Ludlow, J.W. Exosomes for repair, regeneration and rejuvenation. Expert Opin. Biol. Ther. 2016, 16, 489–506. [CrossRef]
27. Phinney, D.G.; Pittenger, M.F. Concise review: MSC-derived exosomes for cell-free therapy. Stem Cells 2017, 35, 851–858.
[CrossRef]
28. Goodarzi, P.; Larijani, B.; Alavi-Moghadam, S.; Tayanloo-Beik, A.; Mohamadi-Jahani, F.; Ranjbaran, N.; Payab, M.; Falahzadeh, K.;
Mousavi, M.; Arjmand, B. Mesenchymal stem cells-derived exosomes for wound regeneration. Cell Biol. Transl. Med. 2018, 4,
119–131.
29. Zhao, B.; Zhang, Y.; Han, S.; Zhang, W.; Zhou, Q.; Guan, H.; Liu, J.; Shi, J.; Su, L.; Hu, D. Exosomes derived from human amniotic
epithelial cells accelerate wound healing and inhibit scar formation. J. Mol. Histol. 2017, 48, 121–132. [CrossRef]
30. Hu, P.; Yang, Q.; Wang, Q.; Shi, C.; Wang, D.; Armato, U.; Prà, I.D.; Chiarini, A. Mesenchymal stromal cells-exosomes: A
promising cell-free therapeutic tool for wound healing and cutaneous regeneration. Burn. Trauma 2019, 7. [CrossRef]
31. An, T.; Chen, Y.; Tu, Y.; Lin, P. Mesenchymal stromal cell-derived extracellular vesicles in the treatment of diabetic foot ulcers:
Application and challenges. Stem Cell Rev. Rep. 2021, 17, 369–378. [CrossRef] [PubMed]
32. Yu, M.; Liu, W.; Li, J.; Lu, J.; Lu, H.; Jia, W.; Liu, F. Exosomes derived from atorvastatin-pretreated MSC accelerate diabetic wound
repair by enhancing angiogenesis via AKT/eNOS pathway. Stem Cell Res. Ther. 2020, 11, 1–17. [CrossRef] [PubMed]
33. Lai, P.; Chen, X.; Guo, L.; Wang, Y.; Liu, X.; Liu, Y.; Zhou, T.; Huang, T.; Geng, S.; Luo, C. A potent immunomodulatory role of
exosomes derived from mesenchymal stromal cells in preventing cGVHD. J. Hematol. Oncol. 2018, 11, 1–15. [CrossRef]
34. Quiñones-Vico, M.I.; Sanabria-de la Torre, R.; Sánchez-Díaz, M.; Sierra-Sánchez, Á.; Montero-Vílchez, T.; Fernández-González, A.;
Arias-Santiago, S. The Role of Exosomes Derived From Mesenchymal Stromal Cells in Dermatology. Front. Cell Dev. Biol. 2021, 9,
647012. [CrossRef]
35. Théry, C.; Zitvogel, L.; Amigorena, S. Exosomes: Composition, biogenesis and function. Nat. Rev. Immunol. 2002, 2, 569–579.
[CrossRef]
36. Colombo, M.; Raposo, G.; Théry, C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular
vesicles. Annu. Rev. Cell Dev. Biol. 2014, 30, 255–289. [CrossRef]
37. György, B.; Hung, M.E.; Breakefield, X.O.; Leonard, J.N. Therapeutic applications of extracellular vesicles: Clinical promise and
open questions. Annu. Rev. Pharmacol. Toxicol. 2015, 55, 439–464. [CrossRef]
38. Henriques-Antunes, H.; Cardoso, R.M.; Zonari, A.; Correia, J.; Leal, E.C.; Jimenez-Balsa, A.; Lino, M.M.; Barradas, A.; Kostic, I.;
Gomes, C. The kinetics of small extracellular vesicle delivery impacts skin tissue regeneration. ACS Nano 2019, 13, 8694–8707.
[CrossRef] [PubMed]
39. Zhang, B.; Wang, M.; Gong, A.; Zhang, X.; Wu, X.; Zhu, Y.; Shi, H.; Wu, L.; Zhu, W.; Qian, H. HucMSC-exosome mediated-Wnt4
signaling is required for cutaneous wound healing. Stem Cells 2015, 33, 2158–2168. [CrossRef]
40. Sicco, C.L.; Reverberi, D.; Balbi, C.; Ulivi, V.; Principi, E.; Pascucci, L.; Becherini, P.; Bosco, M.C.; Varesio, L.; Franzin, C.
Mesenchymal stem cell-derived extracellular vesicles as mediators of anti-inflammatory effects: Endorsement of macrophage
polarization. Stem Cells Transl. Med. 2017, 6, 1018–1028. [CrossRef] [PubMed]
41. Bagchi, D.; Das, A.; Roy, S. Wound Healing, Tissue Repair and Regeneration in Diabetes; Academic Press: Cambridge, MA, USA, 2020.
42. Campos, A.M.; Maciel, E.; Moreira, A.S.; Sousa, B.; Melo, T.; Domingues, P.; Curado, L.; Antunes, B.; Domingues, M.R.M.;
Santos, F. Lipidomics of Mesenchymal Stromal Cells: Understanding the Adaptation of Phospholipid Profile in Response to
Pro-Inflammatory Cytokines. J. Cell. Physiol. 2016, 231, 1024–1032. [CrossRef]
43. Bjørge, I.; Kim, S.; Mano, J.; Kalionis, B.; Chrzanowski, W. Extracellular vesicles, exosomes and shedding vesicles in regenerative
medicine–a new paradigm for tissue repair. Biomater. Sci. 2018, 6, 60–78. [CrossRef]
44. Silva, A.M.; Teixeira, J.H.; Almeida, M.I.; Goncalves, R.M.; Barbosa, M.A.; Santos, S.G. Extracellular vesicles: Immunomodulatory
messengers in the context of tissue repair/regeneration. Eur. J. Pharm. Sci. 2017, 98, 86–95. [CrossRef]
45. Carrasco, E.; Soto-Heredero, G.; Mittelbrunn, M. The role of extracellular vesicles in cutaneous remodeling and hair follicle
dynamics. Int. J. Mol. Sci. 2019, 20, 2758. [CrossRef] [PubMed]
46. Kucharzewski, M.; Rojczyk, E.; Wilemska-Kucharzewska, K.; Wilk, R.; Hudecki, J.; Los, M.J. Novel trends in application of stem
cells in skin wound healing. Eur. J. Pharmacol. 2019, 843, 307–315. [CrossRef] [PubMed]
47. Liu, J.; Yan, Z.; Yang, F.; Huang, Y.; Yu, Y.; Zhou, L.; Sun, Z.; Cui, D.; Yan, Y. Exosomes derived from human umbilical cord
mesenchymal stem cells accelerate cutaneous wound healing by enhancing angiogenesis through delivering angiopoietin-2. Stem
Cell Rev. Rep. 2021, 17, 305–317. [CrossRef] [PubMed]
48. Kim, K.; Gil, M.; Dayem, A.A.; Choi, S.; Kang, G.-H.; Yang, G.-M.; Cho, S.; Jeong, Y.; Kim, S.J.; Seok, J. Improved isolation and
culture of urine-derived stem cells (USCs) and enhanced production of immune cells from the USC-derived induced pluripotent
stem cells. J. Clin. Med. 2020, 9, 827. [CrossRef]
49. Bruckova, L.; Soukup, T.; Visek, B.; Moos, J.; Moosova, M.; Pavelkova, J.; Rezabek, K.; Kucerova, L.; Micuda, S.; Brcakova, E.
Proliferative potential and phenotypic analysis of long-term cultivated human granulosa cells initiated by addition of follicular
fluid. J. Assist. Reprod. Genet. 2011, 28, 939–950. [CrossRef]
Antioxidants 2021, 10, 1292 25 of 27
50. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ∆∆CT method.
Methods 2001, 25, 402–408. [CrossRef]
51. Shelke, G.V.; Lässer, C.; Gho, Y.S.; Lötvall, J. Importance of exosome depletion protocols to eliminate functional and RNA-
containing extracellular vesicles from fetal bovine serum. J. Extracell. Vesicles 2014, 3, 24783. [CrossRef]
52. Debacq-Chainiaux, F.; Erusalimsky, J.D.; Campisi, J.; Toussaint, O. Protocols to detect senescence-associated beta-galactosidase
(SA-βgal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 2009, 4, 1798. [CrossRef]
53. Gebäck, T.; Schulz, M.M.P.; Koumoutsakos, P.; Detmar, M. TScratch: A novel and simple software tool for automated analysis of
monolayer wound healing assays: Short Technical Reports. Biotechniques 2009, 46, 265–274. [CrossRef]
54. Benavides, F.; Oberyszyn, T.M.; VanBuskirk, A.M.; Reeve, V.E.; Kusewitt, D.F. The hairless mouse in skin research. J. Dermatol. Sci.
2009, 53, 10–18. [CrossRef]
55. Liu, G.; Liao, C.; Chen, X.; Wu, Y. In Vitro and In Vivo Osteogenesis of Human Orbicularis Oculi Muscle-Derived Stem Cells.
Tissue Eng. Regen. Med. 2018, 15, 445–452. [CrossRef]
56. Haniffa, M.A.; Collin, M.P.; Buckley, C.D.; Dazzi, F. Mesenchymal stem cells: The fibroblasts’ new clothes? Haematologica 2009, 94,
258–263. [CrossRef] [PubMed]
57. Liu, R.; Chang, W.; Wei, H.; Zhang, K. Comparison of the biological characteristics of mesenchymal stem cells derived from bone
marrow and skin. Stem Cells Int. 2016, 2016, 3658798. [CrossRef] [PubMed]
58. Vaculik, C.; Schuster, C.; Bauer, W.; Iram, N.; Pfisterer, K.; Kramer, G.; Reinisch, A.; Strunk, D.; Elbe-Bürger, A. Human dermis
harbors distinct mesenchymal stromal cell subsets. J. Investig. Dermatol. 2012, 132, 563–574. [CrossRef]
59. Bae, S.; Shim, S.H.; Park, C.W.; Son, H.K.; Ju Lee, H.; Son, J.Y.; Jeon, C.; Kim, H. Combined omics analysis identifies transmembrane
4 L6 family member 1 as a surface protein marker specific to human mesenchymal stem cells. Stem Cells Dev. 2011, 20, 197–203.
[CrossRef] [PubMed]
60. Lv, F.-J.; Tuan, R.S.; Cheung, K.M.; Leung, V.Y. Concise review: The surface markers and identity of human mesenchymal stem
cells. Stem Cells 2014, 32, 1408–1419. [CrossRef] [PubMed]
61. Battula, V.L.; Treml, S.; Bareiss, P.M.; Gieseke, F.; Roelofs, H.; De Zwart, P.; Müller, I.; Schewe, B.; Skutella, T.; Fibbe, W.E. Isolation
of functionally distinct mesenchymal stem cell subsets using antibodies against CD56, CD271, and mesenchymal stem cell
antigen-1. Haematologica 2009, 94, 173–184. [CrossRef]
62. Holley, R.J.; Tai, G.; Williamson, A.J.; Taylor, S.; Cain, S.A.; Richardson, S.M.; Merry, C.L.; Whetton, A.D.; Kielty, C.M.; Canfield,
A.E. Comparative quantification of the surfaceome of human multipotent mesenchymal progenitor cells. Stem Cell Rep. 2015, 4,
63. Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.;
Atkin-Smith, G.K. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the
International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750.
[CrossRef] [PubMed]
64. Wang, L.; Hu, L.; Zhou, X.; Xiong, Z.; Zhang, C.; Shehada, H.M.; Hu, B.; Song, J.; Chen, L. Exosomes secreted by human adipose
mesenchymal stem cells promote scarless cutaneous repair by regulating extracellular matrix remodelling. Sci. Rep. 2017, 7, 1–12.
[CrossRef]
65. Costin, B.R.; Plesec, T.P.; Kopplin, L.J.; Chundury, R.V.; McBride, J.M.; Levine, M.R.; Perry, J.D. Regional Variations in Orbicularis
Oculi Histology. Ophthalmic Plast. Reconstr. Surg. 2015, 31, 325–327. [CrossRef] [PubMed]
66. Crapnell, K.; Blaesius, R.; Hastings, A.; Lennon, D.P.; Caplan, A.I.; Bruder, S.P. Growth, differentiation capacity, and function
of mesenchymal stem cells expanded in serum-free medium developed via combinatorial screening. Exp. Cell Res. 2013, 319,
1409–1418. [CrossRef]
67. Katsuda, T.; Kosaka, N.; Takeshita, F.; Ochiya, T. The therapeutic potential of mesenchymal stem cell-derived extracellular vesicles.
Proteomics 2013, 13, 1637–1653. [CrossRef]
68. Park, K.-S.; Bandeira, E.; Shelke, G.V.; Lässer, C.; Lötvall, J. Enhancement of therapeutic potential of mesenchymal stem
cell-derived extracellular vesicles. Stem Cell Res. Ther. 2019, 10, 288. [CrossRef]
69. Huang, Y.-C.; Lai, L.-C. The potential roles of stem cell-derived extracellular vesicles as a therapeutic tool. Ann. Transl. Med. 2019,
7, 693. [CrossRef]
70. Tang, T.-T.; Wang, B.; Lv, L.-L.; Liu, B.-C. Extracellular vesicle-based Nanotherapeutics: Emerging frontiers in anti-inflammatory
therapy. Theranostics 2020, 10, 8111. [CrossRef]
71. Cao, G.; Chen, B.; Zhang, X.; Chen, H. Human Adipose-Derived Mesenchymal Stem Cells-Derived Exosomal microRNA-19b
Promotes the Healing of Skin Wounds Through Modulation of the CCL1/TGF-β Signaling Axis. Clin. Cosmet. Investig. Dermatol.
2020, 13, 957–971. [CrossRef]
72. Hao, Y.; Miao, J.; Liu, W.; Cai, K.; Huang, X.; Peng, L. Mesenchymal Stem Cell-Derived Exosomes Carry MicroRNA-125a to
Protect Against Diabetic Nephropathy by Targeting Histone Deacetylase 1 and Downregulating Endothelin-1. Diabetes Metab.
Syndr. Obes. Targets Ther. 2021, 14, 1405. [CrossRef]
73. Vlassov, A.V.; Magdaleno, S.; Setterquist, R.; Conrad, R. Exosomes: Current knowledge of their composition, biological functions,
and diagnostic and therapeutic potentials. Biochim. Et Biophys. Acta (BBA)-Gen. Subj. 2012, 1820, 940–948. [CrossRef]
74. Ramirez, M.I.; Amorim, M.G.; Gadelha, C.; Milic, I.; Welsh, J.A.; Freitas, V.M.; Nawaz, M.; Akbar, N.; Couch, Y.; Makin, L.
Technical challenges of working with extracellular vesicles. Nanoscale 2018, 10, 881–906. [CrossRef]
Antioxidants 2021, 10, 1292 26 of 27
75. Ratajczak, J.; Miekus, K.; Kucia, M.; Zhang, J.; Reca, R.; Dvorak, P.; Ratajczak, M. Embryonic stem cell-derived microvesicles
reprogram hematopoietic progenitors: Evidence for horizontal transfer of mRNA and protein delivery. Leukemia 2006, 20, 847–856.
[CrossRef]
76. Luga, V.; Zhang, L.; Viloria-Petit, A.M.; Ogunjimi, A.A.; Inanlou, M.R.; Chiu, E.; Buchanan, M.; Hosein, A.N.; Basik, M.; Wrana, J.L.
Exosomes mediate stromal mobilization of autocrine Wnt-PCP signaling in breast cancer cell migration. Cell 2012, 151, 1542–1556.
[CrossRef]
77. Gross, J.C.; Chaudhary, V.; Bartscherer, K.; Boutros, M. Active Wnt proteins are secreted on exosomes. Nat. Cell Biol. 2012, 14,
78. Feng, Y.; Huang, W.; Meng, W.; Jegga, A.G.; Wang, Y.; Cai, W.; Kim, H.W.; Pasha, Z.; Wen, Z.; Rao, F. Heat shock improves Sca-1+
stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: A critical role for
HSF1/miR-34a/HSP70 pathway. Stem Cells 2014, 32, 462–472. [CrossRef]
79. Ong, S.-G.; Lee, W.H.; Huang, M.; Dey, D.; Kodo, K.; Sanchez-Freire, V.; Gold, J.D.; Wu, J.C. Cross talk of combined gene and cell
therapy in ischemic heart disease: Role of exosomal microRNA transfer. Circulation 2014, 130, S60–S69. [CrossRef] [PubMed]
80. Yin, J.; Ge, X.; Shi, Z.; Yu, C.; Lu, C.; Wei, Y.; Zeng, A.; Wang, X.; Yan, W.; Zhang, J. Extracellular vesicles derived from hypoxic
glioma stem-like cells confer temozolomide resistance on glioblastoma by delivering miR-30b-3p. Theranostics 2021, 11, 1763.
[CrossRef] [PubMed]
81. Prattichizzo, F.; Matacchione, G.; Giuliani, A.; Sabbatinelli, J.; Olivieri, F.; de Candia, P.; De Nigris, V.; Ceriello, A. Extracellular
vesicle-shuttled miRNAs: A critical appraisal of their potential as nano-diagnostics and nano-therapeutics in type 2 diabetes
mellitus and its cardiovascular complications. Theranostics 2021, 11, 1031. [CrossRef]
82. Xia, B.; Gao, J.; Li, S.; Huang, L.; Zhu, L.; Ma, T.; Zhao, L.; Yang, Y.; Luo, K.; Shi, X. Mechanical stimulation of Schwann cells
promote peripheral nerve regeneration via extracellular vesicle-mediated transfer of microRNA 23b-3p. Theranostics 2020, 10,
8974. [CrossRef] [PubMed]
83. Dong, J.; Li, L.; Fang, X.; Zang, M. Exosome-Encapsulated microRNA-127-3p Released from Bone Marrow-Derived Mesenchymal
Stem Cells Alleviates Osteoarthritis Through Regulating CDH11-Mediated Wnt/β-Catenin Pathway. J. Pain Res. 2021, 14, 297.
[CrossRef] [PubMed]
84. Zhou, Y.; Zhu, Y.; Dong, X.; Cao, G.; Li, Y.; Fan, Y.; Chen, Q.; Cai, H.; Wu, Y. Exosomes Derived from Pancreatic Cancer Cells
Induce Osteoclast Differentiation Through the miR125a-5p/TNFRSF1B Pathway. OncoTargets Ther. 2021, 14, 2727. [CrossRef]
85. Tran, P.H.; Xiang, D.; Nguyen, T.N.; Tran, T.T.; Chen, Q.; Yin, W.; Zhang, Y.; Kong, L.; Duan, A.; Chen, K. Aptamer-guided
extracellular vesicle theranostics in oncology. Theranostics 2020, 10, 3849. [CrossRef] [PubMed]
86. Liang, Y.; Duan, L.; Lu, J.; Xia, J. Engineering exosomes for targeted drug delivery. Theranostics 2021, 11, 3183. [CrossRef]
[PubMed]
87. Walker, S.; Busatto, S.; Pham, A.; Tian, M.; Suh, A.; Carson, K.; Quintero, A.; Lafrence, M.; Malik, H.; Santana, M.X. Extracellular
vesicle-based drug delivery systems for cancer treatment. Theranostics 2019, 9, 8001. [CrossRef]
88. Zhang, K.; Dong, C.; Chen, M.; Yang, T.; Wang, X.; Gao, Y.; Wang, L.; Wen, Y.; Chen, G.; Wang, X. Extracellular vesicle-mediated
delivery of miR-101 inhibits lung metastasis in osteosarcoma. Theranostics 2020, 10, 411. [CrossRef]
89. Chen, P.; Wang, L.; Fan, X.; Ning, X.; Yu, B.; Ou, C.; Chen, M. Targeted delivery of extracellular vesicles in heart injury. Theranostics
2021, 11, 2263. [CrossRef]
90. Villa, A.; Garofalo, M.; Crescenti, D.; Rizzi, N.; Brunialti, E.; Vingiani, A.; Belotti, P.; Sposito, C.; Franzè, S.; Cilurzo, F. Transplanta-
tion of autologous extracellular vesicles for cancer-specific targeting. Theranostics 2021, 11, 2034. [CrossRef]
91. Mousavinejad, M.; Andrews, P.W.; Shoraki, E.K. Current biosafety considerations in stem cell therapy. Cell J. 2016, 18, 281.
92. Kishore, R.; Khan, M. More than tiny sacks: Stem cell exosomes as cell-free modality for cardiac repair. Circ. Res. 2016, 118,
93. Li, N.; Zhao, L.; Wei, Y.; Ea, V.L.; Nian, H.; Wei, R. Recent advances of exosomes in immune-mediated eye diseases. Stem Cell Res.
Ther. 2019, 10, 278. [CrossRef]
94. Klingeborn, M.; Dismuke, W.M.; Rickman, C.B.; Stamer, W.D. Roles of exosomes in the normal and diseased eye. Prog. Retin. Eye
Res. 2017, 59, 158–177. [CrossRef]
95. Gonzalez, E.; Falcón-Pérez, J.M. Cell-derived extracellular vesicles as a platform to identify low-invasive disease biomarkers.
Expert Rev. Mol. Diagn. 2015, 15, 907–923. [CrossRef]
96. Zhang, W.; Wang, Y.; Kong, Y. Exosomes derived from mesenchymal stem cells modulate miR-126 to ameliorate hyperglycemia-
induced retinal inflammation via Targeting HMGB1. Investig. Ophthalmol. Vis. Sci. 2019, 60, 294–303. [CrossRef]
97. Moisseiev, E.; Anderson, J.D.; Oltjen, S.; Goswami, M.; Zawadzki, R.J.; Nolta, J.A.; Park, S.S. Protective effect of intravitreal
administration of exosomes derived from mesenchymal stem cells on retinal ischemia. Curr. Eye Res. 2017, 42, 1358–1367.
[CrossRef]
98. Samaeekia, R.; Rabiee, B.; Putra, I.; Shen, X.; Park, Y.J.; Hematti, P.; Eslani, M.; Djalilian, A.R. Effect of human corneal mesenchymal
stromal cell-derived exosomes on corneal epithelial wound healing. Investig. Ophthalmol. Vis. Sci. 2018, 59, 5194–5200. [CrossRef]
99. Kim, Y.-J.; mi Yoo, S.; Park, H.H.; Lim, H.J.; Kim, Y.-L.; Lee, S.; Seo, K.-W.; Kang, K.-S. Exosomes derived from human umbilical
cord blood mesenchymal stem cells stimulates rejuvenation of human skin. Biochem. Biophys. Res. Commun. 2017, 493, 1102–1108.
[CrossRef] [PubMed]
Antioxidants 2021, 10, 1292 27 of 27
100. Oh, M.; Lee, J.; Kim, Y.J.; Rhee, W.J.; Park, J.H. Exosomes Derived from Human Induced Pluripotent Stem Cells Ameliorate the
Aging of Skin Fibroblasts. Int. J. Mol. Sci. 2018, 19, 1715. [CrossRef]
101. Hu, L.; Wang, J.; Zhou, X.; Xiong, Z.; Zhao, J.; Yu, R.; Huang, F.; Zhang, H.; Chen, L. Exosomes derived from human adipose
mensenchymal stem cells accelerates cutaneous wound healing via optimizing the characteristics of fibroblasts. Sci. Rep. 2016, 6,
32993. [CrossRef] [PubMed]
102. Gallet, R.; Dawkins, J.; Valle, J.; Simsolo, E.; De Couto, G.; Middleton, R.; Tseliou, E.; Luthringer, D.; Kreke, M.; Smith, R.R.
Exosomes secreted by cardiosphere-derived cells reduce scarring, attenuate adverse remodelling, and improve function in acute
and chronic porcine myocardial infarction. Eur. Heart J. 2017, 38, 201–211. [CrossRef]
103. Bodega, G.; Alique, M.; Puebla, L.; Carracedo, J.; Ramírez, R.M. Microvesicles: ROS scavengers and ROS producers. J. Extracell.
Vesicles 2019, 8, 1626654. [CrossRef] [PubMed]
104. Waghule, T.; Singhvi, G.; Dubey, S.K.; Pandey, M.M.; Gupta, G.; Singh, M.; Dua, K. Microneedles: A smart approach and
increasing potential for transdermal drug delivery system. Biomed. Pharmacother. 2019, 109, 1249–1258. [CrossRef] [PubMed]
105. Hearing, V.J. Biogenesis of pigment granules: A sensitive way to regulate melanocyte function. J. Dermatol. Sci. 2005, 37, 3–14.
[CrossRef] [PubMed]
106. Briganti, S.; Camera, E.; Picardo, M. Chemical and instrumental approaches to treat hyperpigmentation. Pigment. Cell Res. 2003,
16, 101–110. [CrossRef]
107. Yasui, H.; Sakurai, H. Age-dependent generation of reactive oxygen species in the skin of live hairless rats exposed to UVA light.
Exp. Dermatol. 2003, 12, 655–661. [CrossRef]
108. Yamakoshi, J.; Otsuka, F.; Sano, A.; Tokutake, S.; Saito, M.; Kikuchi, M.; Kubota, Y. Lightening effect on ultraviolet-induced
pigmentation of guinea pig skin by oral administration of a proanthocyanidin-rich extract from grape seeds. Pigment. Cell Res.
2003, 16, 629–638. [CrossRef]
109. Kao, Y.-Y.; Chuang, T.-F.; Chao, S.-H.; Yang, J.-H.; Lin, Y.-C.; Huang, H.-Y. Evaluation of the antioxidant and melanogenesis
inhibitory properties of pracparatum mungo (lu-do huang). J. Tradit. Complementary Med. 2013, 3, 163–170. [CrossRef]

Antioxidants

Uploaded by

Copyright:

Available Formats

Antioxidants

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Antioxidants

Uploaded by

Copyright:

Available Formats

antioxidants

Publisher’s Note: MDPI stays neutral

Copyright: © 2021 by the authors.

Antioxidants 2021, 10, 1292. https://doi.org/10.3390/antiox10081292 https://www.mdpi.com/journal/antioxidants

2. Materials and Methods

Table 1. Primer sequences of the genes used in this study.

Gene NCBI Forward Primer (50 to 30 )

Gene NCBI Forward Primer (50 to 30 )

2.2. Cell Growth Kinetics, Viability and Colony Formation Assays

2.4. Flow Cytometry

2.5. Trilineage Differentiation

2.6. OOM-SC-EV and WJ-MSC-EV Isolation and Characterization

MA, USA) according to the manufacturer’s protocol. We used 3 µg of OOM-SC-EVs protein

2.7. Western Blotting Assay

2.8. Three-Dimensional (3D) Spheroids Culture and EVs Isolation

2.9. Senescence-Associated β-Galactosidase (SA-βgal) Assay

2.10. Reactive Oxygen Species (ROS) Generation Measurement

2.11. Melanin Content Assay

2.12. Tyrosinase Activity Assay

2.13. In Vitro Cell Migration (Scratch Assay)

2.14. In Vivo Wound Healing Assay

2.15. Statistical Analysis

WJ-MSCs AD-MSCs USCs OOM-SCs

WJ-MSCs USCs OOM-SCs

3.2. OOM-SC-EVs and WJ-MSC-EVs Characterization

3.3. Advanced 3D Culture Approach for Efficient EVs Production

3.4. OOM-SC-EV Treatment Modulated ROS Generation and DELAYED Senescence-Related

In addition, we confirmed the in vivo wound healing capacity of OOM-SC-EVs using

the role of OOM-SC-EV-related antioxidant activity in melanogenesis inhibition, which

Supplementary Materials: The following are available online at https://www.mdpi.com/article/10

You might also like