animals

Article
Canine Mesenchymal-Stem-Cell-Derived Extracellular Vesicles
Attenuate Atopic Dermatitis
Byong Seung Cho 1,† , Sung-Bae Kim 2,† , Sokho Kim 3,† , Beomseok Rhee 3,4 , Jungho Yoon 5 and Jae Won Lee 2, *

1 ExoCoBio Exosome Institute (EEI), ExoCoBio Inc., Seoul 08594, Republic of Korea; ceo@exocobio.com
2 Korea Conformity Laboratories, Incheon 21999, Republic of Korea; suaa10@kcl.re.kr
3 Research Center, HLB bioStep Co., Ltd., Incheon 22014, Republic of Korea; skim@hlbbiostep.com (S.K.);
beomseok@hlbbiostep.com (B.R.)
4 Department of Veterinary Medical Imaging, College of Veterinary Medicine, Chungnam National University,
Daejeon 34134, Republic of Korea
5 Equine Clinic, Jeju Regional Headquarter, Korea Racing Authority, Jeju 63346, Republic of Korea;
junghoy11@gmail.com
* Correspondence: zenithvet@gmail.com; Tel.: +82-32-713-5222
† These authors contributed equally to this work.

Simple Summary: Atopic dermatitis (AD) is a chronic inflammatory skin disease associated with
systemic inflammation and immune modulation. Previous studies showed that extracellular vesicles
from human adipose-tissue-derived mesenchymal stem cells reduced inflammatory cytokines and
attenuated AD-like symptoms. In this study, we aimed to investigate the effects of canine ASC-
exosomes on canine AD using a Biostir-induced AD mouse model. The study found that cASC-EVs
improved AD-like dermatitis, decreased serum IgE, ear thickness, and inflammatory cytokines such
as IL-4 and IFN-γ in a dose-dependent manner. The study also conducted in vivo toxicity studies in
ICR mice and found no systemic toxicity. miRNA analysis using next-generation sequencing showed
anti-inflammatory miRNAs present in cASC-EVs, which suggests a promising cell-free therapy for
treating canine AD.

Abstract: Atopic dermatitis (AD) is a chronic inflammatory skin disease that is associated with
systemic inflammation and immune modulation. Previously, we have shown that extracellular
Citation: Cho, B.S.; Kim, S.-B.; Kim, vesicles resulting from human adipose-tissue-derived mesenchymal stem cells (ASC-EVs) attenuated
S.; Rhee, B.; Yoon, J.; Lee, J.W. Canine
AD-like symptoms by reducing the levels of multiple inflammatory cytokines. Here, we aimed to
Mesenchymal-Stem-Cell-Derived
investigate the improvement of canine AD upon using canine ASC-exosomes in a Biostir-induced
Extracellular Vesicles Attenuate
AD mouse model. Additionally, we conducted in vivo toxicity studies to determine whether they
Atopic Dermatitis. Animals 2023, 13,
targeted organs and their potential toxicity. Firstly, we isolated canine ASCs (cASCs) from the adipose
2215. https://doi.org/10.3390/
ani13132215
tissue of a canine and characterized the cASCs-EVs. Interestingly, we found that cASC-EVs improved
AD-like dermatitis and markedly decreased the levels of serum IgE, ear thickness, inflammatory
Academic Editor: Salvatore Desantis
cytokines, and chemokines such as IL-4 and IFN-γ in a dose-dependent manner. Moreover, there
Received: 15 May 2023 was no systemic toxicity in single- or repeat-dose toxicity studies using ICR mice. In addition, we
Revised: 15 June 2023 analyzed miRNA arrays from cASC-EVs using next-generation sequencing (NGS) to investigate
Accepted: 25 June 2023 the role of miRNAs in improving inflammatory responses. Collectively, our results suggest that
Published: 6 July 2023 cASC-EVs effectively attenuate AD by transporting anti-inflammatory miRNAs to atopic lesions
alongside no toxicological findings, resulting in a promising cell-free therapeutic option for treating
canine AD.

Copyright: © 2023 by the authors.

Keywords: canine atopic dermatitis; extracellular vesicles; mesenchymal stem cells; adipose tissue
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
1. Introduction
creativecommons.org/licenses/by/ Atopic dermatitis (AD) is a chronic and relapsing skin disorder characterized by
4.0/). cutaneous inflammation and defects in the epidermal barrier function [1]. It is one of the

Animals 2023, 13, 2215. https://doi.org/10.3390/ani13132215 https://www.mdpi.com/journal/animals

Animals 2023, 13, 2215 2 of 21

most common skin disorders, estimated to be present in up to 1–3% of adults and 20% of
children worldwide [2]. The pathophysiology of AD remains unclear, although epidermal
barrier dysfunction due to immunological responses and genetic defects plays an important
role in the deterioration and development of AD [1].
AD in dogs is an allergic skin disease with a prevalence of 10–15% and many similari-
ties with human AD [3]. The cause of the onset of canine AD remains unclear, although it is
usually presumed to be due to skin barriers or immunological changes resulting from vari-
ous interactions, such as an imbalance in immune function, as in humans [3–5]. Currently,
canine AD drugs have different clinical efficacy in different breeds, potentially because
multiple gene abnormalities and altered immunological processes can be involved [3,6]. In
addition, steroids should be used for moderate or high forms of AD, which have serious
side effects; therefore, the development of safe and effective drugs is continuously being
studied [7]. Thus, there is a trend to utilize stem cell treatments or various new technologies
for the treatment of canine AD.
Mesenchymal stem cells (MSCs) are self-regenerative cells with the potential to dif-
ferentiate into multiple cell types [8]. MSCs are present in various tissues, such as bone
marrow, fat, umbilical cord, and kidney, and can differentiate into osteoblasts, adipose cells,
and muscle cells. [9,10] Since MSCs were established, cell therapy using them has been
reported in various disease models, including autoimmune diseases [11], myocarditis [12],
and glomerulonephritis [13]. MSCs also have the immunomodulatory ability to regulate
the inhibition of Th2 cells and increase regulatory T (Treg) cells [14]. In particular, MSCs
do not have major histocompatibility complex (MHC) II, while co-stimulatory molecules,
such as CD80 and CD86 play an important role in allogeneic antigen recognition [15].
Therefore, because the immunogenicity of MSCs is relatively low, the therapeutic effect of
immunomodulatory action can be clinically expected [16].
Recent studies have shown that MSCs exert an immunosuppressive effect by pro-
ducing and releasing extracellular vesicles (EVs) of various sizes, which consist of lipid
bilayers rather than through cell-to-cell contact [17]. EVs are considered essential carriers
of cellular communication molecules, which encapsulate a variety of genetic materials.
MSC-derived EVs (MSC-EVs) contain regulatory molecules capable of modulating immune
cell functions [18]. MSC-EVs have also been shown to have immunomodulatory abilities
similar to those found in MSCs [18].
EVs are nanosized vesicles (approximately 30–200 nm in size) that play an important
role in cell-to-cell communications [17]. Alix and TSG101, which are known to exist inside
EVs, and CD63, CD9, and CD81, which are present on the surface of EVs, are well-known as
specific markers [18]. In addition, it is known that there is a difference in expression levels
depending on the cell of origin. Stem cell-derived EVs contain a large number of molecules
related to the regeneration/healing, anti-inflammatory, and immunomodulatory abilities
of stem cells; therefore, research is underway for the development of a next-generation non-
cell therapy [19]. Specifically, MSC-EVs have been shown to have broad anti-inflammatory
and regenerative effects in an array of inflammatory disease models, including atopic
disease [19].
It is difficult to accurately identify the trends in the animal cell therapy market because
global market analysis has not been conducted properly. However, there are several
confirmed reports on the therapeutic effects of EVs from adipose-derived stem cells in
horses and dogs with arthritis [20]. Therefore, there is potential for using EVs to treat
diseases in animals.
In the present study, we isolated canine adipose stem cell (cASC)-derived EVs and
characterized them. We also investigated whether cASC-EVs improved AD-like dermatitis
in an animal model and addressed the safety concern in systemic toxicity studies using ICR
mice. In addition, we performed next-generation sequencing (NGS) to study the role of
miRNAs in improving inflammatory responses.
Animals 2023, 13, 2215 3 of 21

2. Materials and Methods

2.1. Isolation and Cultivation of Canine ASCs (cASCs)
Canine adipose tissue was obtained from Knotus Co., Ltd. (Incheon, Republic of
Korea). Ten individual beagles at one year of age were used. In brief, the adipose tissue
was chopped, and an aliquot was enzymatically digested at 37 ◦ C for 1 h with 1% type
2 collagenase (Sigma, St. Louis, MO, USA) in phosphate-buffered saline (PBS), using a
shaking incubator. The digested adipose tissue was centrifuged at 1000 rpm for 5 min,
and the pellet was resuspended and passed through a 70 µm mesh filter (Cell Strainer,
Becton Dickinson, Franklin Lakes, NJ, USA) to remove the debris. Cells were plated in
100 mm culture dishes at mononuclear cells with Dulbecco’s Modified Eagle Medium: Nu-
trient Mixture F-12 (DMEM/F12) containing 10% fetal bovine serum (FBS) and antibiotics
(100 U/mL penicillin G and 100 µg/mL streptomycin). After one day, the medium was
changed to remove non-adherent cells, while the adhered cells were expanded for five days
and subcultured [21].

2.2. Fluorescence-Activated Cell Sorting (FACS) Analysis

Phenotypical characterization of cASCs (passage No. 3) was performed using a
flow cytometer (Agilent, St. Clara, CA, USA, NovoCyte 3000). ASCs were removed via
trypsinization, placed on ice for 30 min, and treated with the following labeled stemness-
associated antigen markers: CD29+, CD44+, CD90+, CD105+, CD4−, CD8−, CD14−,
CD25−, CD45−, CD80−, CD184−, and MHCII−. Other antibodies with the indicated
specifications were purchased separately: CD29+ (Thermo Fisher Scientific, MA1-19458),
CD44+ (Thermo Fisher Scientific, 11-5440-42), CD90+ (Thermo Fisher Scientific, 12-5900-42),
CD4 (Thermo Fisher Scientific, MA5-16989), CD8 (Thermo Fisher Scientific, 17-5080-42),
CD14 (BD, 555397), CD25 (Thermo Fisher Scientific, 63-0250-42), CD45 (Thermo Fisher
Scientific, 48-5450-42), CD80− (Thermo Fisher Scientific, 46-0801-82), and CD184− (Thermo
Fisher Scientific, 12-9991-82) [22].

2.3. Reverse Transcription Polymerase Chain Reaction (RT-PCR) for Phenotypical Characterization
of cASCs
Total RNA was extracted from fresh cells (cASCs and CMT-U27; canine mammary
cancer cell lines for comparison) using the RNA extraction Hybrid-R kit (GeneAll, 305-101).
RNA concentration was measured at an absorbance of 260 nm with a spectrophotome-
ter (Thermo Fisher Scientific, Waltham, MA, USA), and cDNA was synthesized from
total RNA using the PrimeScript RT reagent kit with gDNA Eraser (TOYOBO, FSQ-301),
according to the manufacturer’s protocol. The expression of specific genes was quan-
tified by RT-PCR, in accordance with the instructions of i-StarMAX II ™ DNA Poly-
merase (iNtRON Biotechnology, 25173). The primer sequence is as follows. SOX2, F:
ACAGCATGTCCTACTCGCAG, R: GGACTTGACCACCGAGCC; Nanog, F: CCAGAC-
CTGGAACAGCCAAT, R: ACAGTTGTGGAGCGGATTGT; Oct4, F: GACACCTCCCAGC-
CGGA, R: TGCTCCAGCTTCTCCTTGTC; GAPDH, F: GTTTGTGATGGGCGTGAACC, R:
TTTGGCTAGAGGAGCCAAGC.
For multipotency marker analysis, target genes were amplified at 94 ◦ C (2 min),
35 cycles of 94 ◦ C (10 s), 60 ◦ C (10 s), 72 ◦ C (10 s), followed by 72 ◦ C for 7 min. PCR
products were separated on a 2% agarose gel by electrophoresis, stained with Red Safe
(iNtRON Biotechnology, Seongnam, Republic of Korea) and visualized under UV light.
Images were digitally captured using an iBright™ CL1500 Imaging System (Invitrogen™,
Waltham, MA, USA).

2.4. Osteogenic Differentiation: Alizarin Red Staining

Osteogenesis differentiation medium (Osteogenic Differentiation SingleQuotsTM Sup-
plements Kit; Lonza) was used according to the manufacturer’s instructions. ASCs were
cultured for 21 days, the medium was changed every 3rd day, and differentiation was
assessed using alizarin red staining. For this process, the cells were fixed with 4% formalde-
Animals 2023, 13, 2215 4 of 21

hyde solution for 30 min, followed by rinsing with PBS, and incubation with alizarin red
solution in the dark for 30 min. Then, the cells were washed several times with PBS and
visualized under a light microscope. Red staining indicates the deposition of calcium
phosphate precipitates by osteoblasts [23].

2.5. Chondrogenic Differentiation: Alcian Blue Staining

Chondrogenic differentiation medium (Chondrogenic SingleQuot Kit; Lonza, Basel,
Swizerland) was used according to the manufacturer’s instructions. ASCs were cultured
for 28 days, the medium was changed every 3rd day, and differentiation was assessed
using Alcian blue staining. Cells were fixed with 4% formaldehyde for 30 min and washed
with PBS. Then, 1% Alcian blue, which was prepared in 0.1 N HCl, was added for 30 min
incubation, and distilled water was added. Blue staining indicated chondrocyte synthesis
of proteoglycans [23]. Additionally, the pellet culture in 15 mL conical tubes was observed
for 35 days. The pellet was stained after paraffin sectioning.

2.6. Adipogenic Differentiation: Oil Red O Staining

An adipogenesis differentiation kit (Adipogenic Induction SingleQuot Kit, Lonza) was
used according to the manufacturer’s instructions. ASCs were cultured for 35 days. Cells
were cultured with cASCs in supplemented adipogenesis induction medium and cultured
for 3 days (37 ◦ C and 5% CO2 ) followed by 1–3 days of culture in supplemented adipogenic
maintenance medium. These cycles were repeated three times. The cells were cultured for
7 days in a supplemented adipogenic maintenance medium. Differentiation was assessed
by the presence of lipid droplets, which were visualized after staining with Oil Red O
solution. Cells were fixed with 10% formal calcium fixative for 60 min, washed with PBS,
and then with 70% ethanol. The addition of Oil Red O solution was followed by rinsing the
cells with 70% ethanol, followed by tap water. Red staining indicates the presence of lipids.

2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) for Analysis of Differentiation
Total RNA was extracted from fresh cells using an RNA extraction Hybrid-R kit (Ge-
neAll, 305-101). RNA concentration was quantified by measuring absorbance at 260 nm
with a spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and cDNA was
synthesized from total RNA using a PrimeScript RT reagent kit with a gDNA Eraser (TOY-
OBO, FSQ-301), according to the manufacturer’s protocol. Then, the expression of our cho-
sen genes was quantified by RT-PCR, in accordance with the instructions of the qPCRBIO
SyGreen Blue Mix Separate-Rox (PCR Biosystems, PB20.17-05). The primer sequence is as
follows. BMP2, F: CGGGAACAGATGCAGGAACC, R: AAAGTCTGGTCACGGGGAAC;
RUNX2, F: TGCTTCATTCGCCTCACAAAC, R: GACTCTGTTGGTCTCGGTGG; OPN, F:
AGGGACAGCCATGCAAAAGA, R: TACTCTTGGGAGTGCTTGCG; SOX9, F: CTACAT-
GAACCCCGCGCAGA, R: GTGTGTAGACAGGCTGTTCCC; Aggrecan, F: AGAAGC-
CCTTCACTTTCGCC, R: CTCTCCAGTCCTGTTCTCGG; FAS, F: CTGCACGTCTTAT-
GCGGGTA, R: TGCTCTCCATCGCAGATTCC; SREBP-1, F: TGCACGACTGCCAGCAAA,
R: CGCGGACGGGGATCTA; GAPDH, F: GTTTGTGATGGGCGTGAACC, R: TTTGGCTA-
GAGGAGCCAAGC.
Reactions were performed using a CFX96 Touch Real-Time PCR Detection System
(Bio-Rad, Hercules, CA, USA) with the following process steps: 95 ◦ C for 2 min, 40 cycles
of 95 ◦ C for 10 s, and 60 ◦ C for 20 s, followed by melting curve analysis. The specificities
of the PCR products were verified by melting curve analyses between 65 and 95 ◦ C. At
the end of each reaction, CT values were obtained by analyzing the fluorescence data.
Gene expression was calculated using the 2−∆∆Ct method, where the values from different
samples were averaged and calibrated in relation to GAPDH CT values.

2.8. Isolation of cASC-EVs

cASC-Evs were isolated from cASC-conditioned media (CM) by tangential flow fil-
tration (TFF)-based ExoSCRT™ technology, as previously described [24]. Briefly, CM was
Animals 2023, 13, 2215 5 of 21

filtered through a 0.22 µm polyethersulfone membrane filter (Merck Millipore, Billerica,

MA, USA) to remove non-exosomal particles, such as cells, cell debris, microvesicles, and
apoptotic bodies. Then, the CM was concentrated by tangential flow filtration with a
500 kDa molecular weight cut-off filter membrane cartridge (Cytiva, Chicago, IL, USA),
and buffer exchange was performed by diafiltration with DPBS. The amount of protein in
isolated cASC-EVs was approximately 0.5% of the amount of protein in the CM. Isolated
cASC-EVs were aliquoted into polypropylene disposable tubes and stored at −80 ◦ C until
use. Before use, frozen cASC-Exos were left at 4 ◦ C until completely thawed and were
not frozen again. Characterization and profile analysis of the cASC-EVs were conducted
following the Minimal Information for Studies of Extracellular Vesicles 2018 (MISEV2018),
recommended by the International Society for Extracellular Vesicles (ISEV) [17].
The cASC-EVs used for analysis and AD treatment in this study were derived from
passage 3 cASC and isolated from the CM collected under the same culture conditions for
two days.

2.9. Quantification of cASC-EVs

To determine size distribution and particle concentration, cASC-EVs were diluted
with DPBS and analyzed by nanoparticle tracking analysis (NTA) using a NanoSight
NS300 (Malvern Panalytical, Amesbury, UK) equipped with a 642 nm laser. Then, the
cASC-EVs were diluted with DPBS to between 20 and 80 particles per frame and scattered
and illuminated by the laser beam, while their movements under Brownian motion were
captured for 20 s each, at a camera level of 16. The subsequent videos were analyzed
by NTA 3.2 software using constant settings. To provide a representative result, at least
five videos were captured, and more than 2000 validated tracks were analyzed for each
individual sample. The NTA instrument was regularly checked with 100 nm standard
beads (Thermo Fisher Scientific). To provide a representative size distribution of the EVs,
the size distribution profiles from each video replicate were averaged.
Protein quantification of cASC-EVs determined using the Micro BCA protein assay kit
(Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol.

2.10. Bead-Based Flow Cytometric Analysis of Exosomal Surface Markers

The isolated cASC-EVs were captured and labeled with Dynabeads, according to the
manufacturer’s instructions. Briefly, 2 µg of cASC-EVs were incubated overnight at 4 ◦ C
with capture beads. The captured EVs were labeled with a mixture of APC-conjugated anti-
CD81 antibodies for 1 h at room temperature. The bead populations and APC intensities
were analyzed using a NovoCyte 2000 R Flow Cytometer (ACEA Biosciences, San Diego,
CA, USA), and the data were analyzed using NovoExpress software (ACEA Biosciences).
The background was corrected with the median intensity of the anti-IgG-APC signals.
Assays were performed in triplicate for three independent samples.

2.11. In Vivo Efficacy Study

2.11.1. Animals and Study Design
Animal care and experimental procedures were approved by the Institutional Animal
Care and Use Committee of the Korea Conformity Laboratories (IACUC number: IA20-
02200). Male 6-week-old NC/Nga mice were obtained from Central Lab Animal, Inc.
(Seoul, Republic of Korea). The mice were divided into six groups (n = 8 per group) as
follows: the normal group (Ctrl group), Df-induced with no treatment group (AD group),
Df-induced with EV treatment groups (1.00 × 109 , 3.33 × 109 , and 1.00 × 1010 particles/mL),
and Df-induced with prednisolone treatment group (10 mg/kg). To induce AD-like skin
lesions, 100 mg Dermatophagoides farinae ointment (Df; Biostir® -AD cream, Kobe, Japan)
was applied to the shaved dorsal skin, 2 h after the 4% sodium dodecyl sulfate application
(SDS, Sigma-Aldrich, St. Louis, MO, USA), twice a week, for 3 weeks in NC/Nga mice,
and EVs were administered subcutaneously (SC) into the loose skin over the neck 3 times a
week for 4 weeks. As a positive control, prednisolone was orally administered daily. In the
Animals 2023, 13, 2215 6 of 21

seventh week, the mice were sacrificed, and skin and blood samples were collected. The
experimental design is illustrated in Figure 4A.

2.11.2. Clinical Observation of AD

Clinical observation of the backs of NC/Nga mice was performed once a week for 4
weeks. To compare the skin lesions of the mice, the clinical severity of dermatitis was scored
using the previously described macroscopic diagnostic criteria, which are normally used
for human AD. Briefly, dermatitis severity was evaluated once per week. The development
of (1) erythema/hemorrhage, (2) scarring/dryness, (3) edema, and (4) excoriation/erosion
was scored as 0 (none), 1 (mild), 2 (moderate), and 3 (severe), respectively. The sum of
individual scores was used as the dermatitis score. Ear thickness was measured using a
caliper (Mitutoyo, 209-572M External Digital Caliper Gauge (0–20 mm, 0.01 mm); Myanmar)
4 weeks after Df-induction [25].

2.11.3. Total Serum IgE Measurement

Total serum IgE levels were measured using a mouse IgE ELISA kit (ab157718; Abcam,
Waltham, MA, USA), according to the manufacturer’s instructions. Serum samples were
obtained by centrifugation at 12,000 rpm for 10 min and stored at −80 ◦ C until required for
the assay.

2.11.4. Quantitative Real-Time PCR Analysis

After the administration of EVs for four weeks, skin lesions from the back were re-
moved, frozen immediately in liquid nitrogen, and stored at −80 ◦ C. The mRNA levels of
the inflammatory cytokines were analyzed using RT-qPCR. RNA extraction was performed
by disrupting 20 mg or less of tissue with a homogenizer, followed by RNA extraction using
the AccuPrep® Universal RNA Extraction Kit (Bioneer, Daejeon, Republic of Korea, Cat.K-
3140) and DNase treatment using the RNase-Free-DNase Set (Qiagen, Hilden, Germany,
Cat.79254). RNA quality, concentration, and purity were measured with a NanoDrop One
(Thermo Fisher Scientific), and an 18S/28S peak was confirmed with a 5200 Fragment Ana-
lyzer (Agilent). RT-qPCR was performed using 48 ng RNA for the AccuPower® GreenStar™
RT-qPCR Master Mix (Cat.K-6403) and Exicycler TM 384 Real-Time Quantitative Thermal
Block (Cat.A-2061). Primers were provided by Bioneer (Il4, 146 bp; primer no. PM00287,
Gene Bank NM_021283; Il5, 110 bp, primer no. PM00178, Gene Bank NM_010558; Il13,
212 bp, primer no. PM00288, Gene Bank NM_008355; Ifng, 156 bp, primer no. PM00289,
Gene Bank NM_008337; Gapdh, 146 bp, primer no. PM00118, Gene Bank NM_001289726,
NM_008084).

2.11.5. Histopathologic Evaluation

The tissues of the experimental mice were removed, fixed in 10% phosphate-buffered
formalin, embedded in paraffin, sectioned, and stained with H&E. To measure mast cell
infiltration, paraffin-embedded tissue sections were stained with toluidine blue, and the
number of mast cells was counted at five random sites.

2.11.6. Immunohistochemistry
Serial sections of paraffin-embedded skin were deparaffinized and incubated with an
anti-TSLP (10 µg/mL; ab115700; Abcam) and CD-86(4 µg/mL; ab213044; Abcam) at 4 ◦ C
for 24 h after being blocked with normal goat serum. The slides were incubated with a
biotinylated secondary antibody for 1 h, followed by avidin–biotin–peroxidase complexes
(Envision kit; Dako, K5007, Glostrup, Denmark) for 2 h. Peroxidase activity was confirmed
using 3,3-diaminobenzidine (Vector Labs, Newark, CA, USA) followed by a hematoxylin
counterstain. The stained cells were counted in each group. The staining intensity for
TSLP and CD-86 was scored on a 5-point scale as follows: 0, no positive staining; 1+, mild
cytoplasmic staining; 2+, moderate-to-severe cytoplasmic staining; 3+, moderate-to-severe
cytoplasmic staining with nuclear staining; 4+, severe cytoplasmic staining [25].
Animals 2023, 13, 2215 7 of 21

2.12. In Vivo Toxicity Studies

2.12.1. Single-Dose Toxicity Study
This toxicity study began after approval of the IACUC of KCL (approval number: IA19-
01714). The aim of this study was to investigate the toxicity symptoms and the approximate
lethal dose. Briefly, 8-week-old, ICR mice (OrientBio, Seongnam, Republic of Korea) were
randomly assigned to four groups of ten animals (five male and five female mice per group).
The cASC-EVs were subcutaneously administered once each to the male and female ICR
mice at doses of 7.45 × 108 (low dose), 2.98 × 109 (mid-dose), and 1.19 × 1010 (high dose)
particles/20 g and compared to the vehicle control group, only treated with DPBS. During
the experiment, the occurrence of dead animals, symptoms, and changes in bodyweight
were noted, and the overall gross findings from the sacrificed animals were observed at the
end of the experiment.

2.12.2. Twenty-Eight-Day Repeat-Dose Toxicity Study

This study was conducted to evaluate the potential toxicity and the organs being
targeted when the cASC-EVs were repeatedly administered to ICR female and male mice for
4 weeks. All animal experiments were approved by the IACUC of KCL (approval number:
IA21-02194). Briefly, 8-week-old, ICR mice (OrientBio, Seongnam, Republic of Korea) were
randomly assigned to four groups of twenty animals (ten male and ten female mice per
group). The cASC-EVs were subcutaneously administered at doses of 7.45 × 108 (low dose),
2.98 × 109 (mid-dose), and 1.19 × 1010 (high dose) particles/20 g 3 times a week. Mortality,
clinical observation, bodyweight change, food consumption, water intake, urinalysis,
hematology, blood chemistry, necropsy findings, organ weight, and histopathological
findings were evaluated during the experiment. Hematological evaluation was measured
using a blood analyzer (ADVIA 2120, SIEMENS, Munich, Germany) and blood chemistry
evaluation was performed using a blood biochemical analyzer (Hitachi 7180, HITACHI,
Tokyo, Japan).

2.13. microRNA Profiling

Raw reads of small RNAs were preprocessed to eliminate adapter sequences. Adapters
in the raw reads were trimmed using the Cutadapt program. The first three nucleotides
of all reads were trimmed to remove extra bases that were inserted during the SMART
template-switching activity process. If a sequence was matched to more than the first 5 bp
of the 3’ adapter sequence, it was regarded as an adapter sequence and trimmed from the
read. Trimmed reads longer than 18 bp were selected for mapping reliability. Then, the
remaining reads were classified into non-adapter reads, whose adapter sequences were not
sequenced. Trimmed and non-adapter reads were combined and regarded as processed
reads for downstream analysis.
To minimize sequence redundancy for computational efficiency, the processed reads
were clustered by a sequence. A unique cluster consists of reads with the same sequence
and length. To eliminate rRNA, the reads aligned to the 45S pre-rRNA and mitochondrial
rRNA from Canis lupus familiaris were excluded.
Sequence alignment and detection of known and novel miRNAs were performed
using the miRDeep2 software algorithm. The rRNA-filtered reads were aligned to the
mature and precursor miRNAs of Canis lupus familiaris obtained from miRBase v22.1
using the miRDeep2 quantifier module. The miRDeep2 algorithm is based on the miRNA
biogenesis model; it aligns reads to potential hairpin structures to check whether their
mapping context is consistent with Dicer processing and assigns scores representing the
probability that hairpins are true miRNA precursors.
The reference genome of Canis lupus familiaris, released as CanFam3.1, was retrieved
from RefSeq. The reference genome was indexed, and rRNA-filtered reads were mapped
using Bowtie (1.1.2). Novel miRNAs were predicted from mature, star, and loop sequences,
according to the RNAfold algorithm, using miRDeep2. The RNAfold function uses a
Animals 2023, 13, 2215 8 of 21

nearest-neighbor Thermodynamic model to predict the minimum free-energy secondary

structure of an RNA sequence.
Uniquely clustered reads were sequentially aligned to the reference genome, miRBase
v22.1, and the non-coding RNA database RNAcentral release 14.0 to identify the known
miRNAs and the other RNA types for classification.
For the bioinformatic analysis of miRNAs, predicted targets of miRNAs with a score
of 75 or higher were selected from the miRDB database (http://miRDB.org, accessed on
30 April 2021). The gene ontology (GO) analysis of the targets was performed using DAVID
6.8 (https://david.ncifcrf.gov/home.jsp, accessed on 9 June 2023).

2.14. Statistical Analysis

All quantitative data are reported as means ± standard deviation. Between-group
comparisons were performed using the two-tailed Student t-test or ANOVA, followed
by Tukey’s test for normally distributed variables, or nonparametric analysis with a
Mann–Whitney U-test or Kruskal–Wallis test, followed by Dunn’s multiple comparison
test for nonnormally distributed variables. p < 0.05 was considered statistically significant.

3. Results
3.1. Characterization of Canine Adipose-Tissue-Derived Mesenchymal Stem Cells (cASC)
We isolated canine adipose-derived stem cells (cASCs) from canine adipose tissue
that had been preserved for 24 h. To characterize the surface phenotype of the ASCs
isolated from an aliquot preserved for 24 h, cell surface markers were examined at the third
passage. Flow cytometry results showed that ASCs isolated after 24 h of preservation were
positive for CD29, CD44, and CD90. In addition, the expressions of CD4, CD8, CD14, CD25,
CD45, CD80, and CD184 were not observed. We confirmed the expression of CD29, CD44,
and CD90 on the cASC surface using flow cytometry (Figure 1A). Our results indicated
that cASCs express CD29, CD44, and CD90 specifically on the surface, similar to human
ASCs. In general, the differentiation potential of stem cells was maintained during the
early passages. The expression of multipotency stem cell markers in cASCs at P2 was
observed using RT-PCR (Oct4, Nanog, and Sox2). The cASCs positively expressed Oct4,
Nanog, and Sox2. The expression of Oct4 and SOX9 decreased with an increasing number of
subpassages. However, the expression of Nanog was negatively correlated with the number
of subpassages. Specific early stem cell markers include transcription factors, such as Sox2,
Oct4, and Nanog (Figure 1B). As a result, it was confirmed that the expression levels of
Sox2 and Oct4 decreased as the passage number increased, and the expression level of these
transcription factors was higher than the control (CMT-U27), until the second passage.

3.2. cASCs Have a Differentiation Phenotype for Osteogenesis, Adipogenesis, and Chondrogenesis
Differentiation into multiple mesodermal lineages is a characteristic feature of MSCs.
To demonstrate multilineage differentiation potency, cASCs were cultured in osteogenic,
chondrogenic, or adipogenic conditions to induce differentiation for several weeks. To
determine their ability to differentiate, third passage cASCs were induced to differentiate
into adipocytes, chondrocytes, and osteocytes using a modified differentiation medium
for adipocytes and chondrocytes, and an osteogenic medium for osteocytes. Osteogenesis:
After 21 days of culture, the cells were stained with alizarin red and analyzed for calcium
mineralization. Calcium staining was evident within the differentiated cells; however,
no calcium mineralization was observed in the control cells (Figure 2A). Analysis of the
RT-qPCR results revealed that the mRNA expression levels of the osteogenic marker Runt-
related transcription factor 2 (RUNX2) and bone morphogenetic protein 2 (BMP2) were
significantly higher in differentiated cells than in non-induced control cells (Figure 2B).
Chondrogenesis: After 35 days of culture, the cells were stained with Alcian blue and
examined for the presence of proteoglycans. Proteoglycans were stained blue in the
differentiated cells, yet positive staining was not detected in the non-induced control
cells. After 35 days of pellet culturing, pellet formation was observed, whereby the pellet
Animals 2023, 13, 2215 9 of 21

grew gradually. Proteoglycans were confirmed by Alcian blue (Figure 2A). The RT-qPCR
results showed that the mRNA expression levels of the chondrogenic markers Sox9 and
aggrecan were significantly higher in the differentiated cells (Figure 2B). Adipogenesis:
After 35 days of culture, cells were stained with Oil Red O and examined for intracellular
lipid accumulation. The differentiated cells showed stained lipid droplets; however, the
non-induced control cells did not stain positively (Figure 2A). Based on RT-qPCR analysis,
the mRNA expression levels of adipogenic markers, such as FAS and SREBP-1, were
significantly higher in the differentiated cells (Figure 2B). These results suggest that cASCs
have the potential to differentiate into osteocytes, chondrocytes, and adipocytes.

3.3. Isolation and Characterization of the cASC-Derived Extracellular Vesicles

First, we isolated canine ASC-derived extracellular vesicles (cASCs) using ExoSCRT™
technology from the cASC-conditioned media, under serum-free conditions [26]. The
detailed isolation process is summarized in a schematic of the EV separation methods
(Figure 3A). Characterization of EVs was performed according to the Minimal Informa-
tion for Studies of Extracellular Vesicles 2018 (MISEV2018), recommended by the Inter-
national Society for Extracellular Vesicles. To characterize cASC-derived EVs, we first
analyzed the concentration and size distribution of the particles using an NS300 (NTA)
instrument (Figure 3B,C). The results indicated that the ASC-EV mode size was approx-
imately 103.07 +/− 6.24 nm and the average particle concentration was 9.46 × 109 ±
1.72 × 109 particles/mL. The average protein concentration from the three batches was
28.13/−8.80 µg/mL and the average purity of the ASC-EVs was 3.45 × 108 ± 5.02 ×
107 particles/mL (Figure 3D,E). To further characterize the ASC-EVs, flow cytometry anal-
ysis was conducted to test the presence of tetraspanin markers known to be enriched
in EVs, such as CD9, CD63, and CD81. As no antibodies reacted with canine proteins,
anti-human CD9, CD63, and CD81 staining antibodies were used. The results showed that
only anti-human CD81 antibodies bound to canine exosomal CD81 protein, indicating that
only CD81 has cross-reactivity between humans and dogs (Figure 3F). Next, the levels of
negative markers of EVs, such as calnexin, were measured (Figure 3G). The concentration
of calnexin in canine ASC cell lysates was 138.43 pg/mL and the average concentration
of calnexin in the three batches was 2.02 pg/mL, showing significantly lower levels of
calnexin compared to the cell lysates.
Next, we examined the anti-inflammatory effects of ASC-derived EVs. In general,
ASCs have a unique immunomodulatory function [14,15], which makes them suitable for
cellular therapy, such as repairing tissue damaged by chronic inflammation or autoimmune
diseases. For example, they have been reported to exert beneficial effects in murine models
of experimental systemic lupus erythematosus (SLE) [27] and inflammation-mediated au-
toimmune diseases [11–13]. AD is a chronic, relapsing, and highly pruritic inflammatory
skin disease that significantly reduces the quality of life for patients [28,29]. As reported
in our previous study on human ASC-EVs, systemic administration of ASC-EVs ame-
liorated AD-like symptoms through the regulation of inflammatory responses and the
expression of inflammatory cytokines [26]. With the same flow, canine ASC-derived EVs
have similar effects on the regulation of the inflammatory response and expression of
inflammatory cytokines.
Animals 2023, 13, x FOR PEER REVIEW 9 of 23
Animals 2023, 13, 2215 10 of 21

Figure1.
Figure Characterization of cASCs.
1. Characterization cASCs.(A–C)
(A–C)Expression
Expressionofof
cell surface
cell markers
surface of cASCs
markers isolated
of cASCs from
isolated
adipose
from tissue
adipose preserved
tissue for 24
preserved forh,24determined by flow
h, determined cytometry.
by flow (D) (D)
cytometry. Expression of multipotency
Expression of multipo-
tency markers
markers (Sox2,(Sox2,
Oct4,Oct4, and Nanog)
and Nanog) by RT-PCR
by RT-PCR in cASCs
in cASCs duringduring continuous
continuous passages.
passages. GAPDH
GAPDH was
was
usedused
as anasinternal
an internal control.
control. TheThe
cASCscASCs were
were positive
positive for markers.
for all all markers. CMT-U27
CMT-U27 (canine
(canine mam-
mammary
mary cancer
cancer cell line)
cell line) is used
is used for comparison.
for comparison.

3.4.cASCs
3.2. Effect of EVsa on
Have ImprovementPhenotype
Differentiation of Biostir-Induced Atopic Skin
for Osteogenesis, Lesions in and
Adipogenesis, Mice
Chondrogenesis
To investigate the effect of EVs on Biostir-induced AD, all animals were clinically
observed on a weekly
Differentiation intoschedule. Df-stimulated
multiple mesodermal back skin
lineages is a from NC/Ngafeature
characteristic mice developed
of MSCs.
AD-like
To skin lesions.
demonstrate We found
multilineage that the SC administration
differentiation potency, cASCsofwereEVscultured
significantly decreased
in osteogenic,
Animals 2023, 13, 2215 11 of 21

AD symptoms. Compared to the negative control group, the skin condition of the EV-
treated groups was improved, and the thickness of the ear increased by Biostir decreased
as well (Figure 4B,D). In addition, the clinical evaluation scores of the EV treatment groups
were significantly reduced (Figure 4C). The concentration of total plasma IgE tends to be
high in allergic patients, such as those with AD, and is known to increase with disease
onset and exacerbation [26]. We measured the total plasma IgE levels in mice with AD
induced by Biostir using an ELISA kit. As a result, an increased level of IgE was also used
as a diagnostic indicator of AD. Df significantly upregulated total plasma IgE production
induced by Df stimulation. As shown in Figure 4E, the EV treatment group and the
positive control group showed significantly downregulated IgE levels in NC/Nga mice
(Figure 4E). The mRNA levels of inflammatory cytokines were analyzed using RT-qPCR.
The systemic administration of EVs dose-dependently reduced the upregulated mRNA
levels of IL-4 and IFN-È-in the skin lesions compared to the vehicle control; the reduction
was comparable to that with prednisolone treatment (Figure 4F,G). It was shown that the
dorsal skin of NC/Nga in the AD group (G2) had distinct hyperplasia and hyperkeratosis in
the thickened epidermis and infiltrated inflammatory cells, which were attenuated by EVs
and prednisolone treatment, reducing the thickness of the epidermis in a dose-dependent
manner (Figure 5).

3.5. cASC-EVs Ameliorate the Signs of AD In Vivo

To investigate whether EVs ameliorate AD symptoms in vivo, we evaluated the his-
tological effects of EVs in a murine model. We found that the administration of EVs
significantly decreased epidermal thickness, and the manifestations of mast cells including,
TSLP, and CD86, as shown in the histology (Figure 5A). Consistently, the number of mast
cells decreased in the EV-treated mice (Figure 5B). We also found that the intensity of TSLP
and CD86 in the skin lesions was significantly decreased by the administration of EVs
(Figure 5C,D). Interestingly, it has been reported that T cells and inflammatory dendritic
epidermal cells, which are not found in normal mice but are abundant in AD mice, express
both TSLP and CD86 on their surfaces. These results indicated that cASC-derived EVs
significantly decreased AD symptoms compared to negative control group.

3.6. In Vivo Toxicity Studies

3.6.1. Single-Dose Toxicity Study
No dead animals or notable symptoms were observed during the experiment. How-
ever, the analysis of weight measurements indicated weight loss in some animals, although
statistical tests showed no statistically significant difference between groups, and it was
judged to be a transient change between individuals that had no toxicological significance.
As a result of the necropsy at the end of the experiment, no gross findings were observed in
any of the tested animals.
Based on the above results, no dead animals were observed when the cASC-EVs were
administered once to an ICR mouse, and thus, the approximate lethal dose of cASC-EVs
under this test condition is judged to be 1.19 × 1010 particles/20 g or more.
 Animals2023,
Animals 13,2215
2023,13, x FOR PEER REVIEW 11 of 12
23of 21

Figure
Figure 2.
2. Differentiation
Differentiationofofcanine
canineadipose-derived
adipose-derived mesenchymal
mesenchymal stem cells
stem (cASCs)
cells intointo
(cASCs) osteocyte,
osteocyte,
chondrocyte, and adipocyte lineages. (A) Images of alizarin red staining for osteogenic
chondrocyte, and adipocyte lineages. (A) Images of alizarin red staining for osteogenic lineage. lineage. Im-
ages of Alcian blue staining for chondrogenic lineage. Images of Oil Red O staining for adipogenic
Images of Alcian blue staining for chondrogenic lineage. Images of Oil Red O staining for adipogenic
lineage. (B) Reverse-transcript quantitative PCR (RT-qPCR) data on gene expression relating to os-
lineage. (B) Reverse-transcript quantitative PCR (RT-qPCR) data on gene expression relating to
teogenic, chondrogenic, and adipogenic factors (BNP2 and RUNX2 for osteogenic, Sox9 and aggre-
osteogenic,
can chondrogenic,
for chondrogenic, andFAS
alongside adipogenic factors
and SREBP1 (BNP2 and RUNX2
for adipogenesis, for osteogenic,
respectively; Sox9
n = 3 for each lin- and
eage). Data
aggrecan forare
chondrogenic, p < 0.05 vs.FAS
mean ± SD. * alongside Control
and group,
SREBP1 p < adipogenesis,
** for 0.001 vs. Control group.
respectively; n = 3 for each
lineage). Data are mean ± SD. * p < 0.05 vs. Control group, ** p < 0.001 vs. Control group.
 Animals 2023, 13, x FOR PEER REVIEW 13 of 23
Animals 2023, 13, 2215 13 of 21

Figure 3. Isolation and characterization of canine ASC-EVs. (A) The schematic summary of the EV
Animals 2023, 13, 2215 14 of 21

separation methods. (B) Histogram of particle concentration and size distribution of canine ASC-EVs
measured by nanoparticle tracking analysis (NTA) (n = 3). The red part of the histogram represents
the range of deviation. (C–E) Particle concentration, protein concentration, and purity of canine
ASC-EVs (n = 3). (F) Histograms showing canine ASC-EVs stained with anti-human CD81 antibody,
which are shown in comparison to an IgG1 isotype-stained negative control. (G) Calnexin and
concentration of canine ASC-EVs in each batch (n = 3).

3.6.2. Twenty-Eight-Day Repeat-Dose Toxicity Study

During the experimental period, no animal deaths were observed in any treated group.
The cASC-EV-related changes were not detected in any treated groups when analyzing clin-
ical observations, bodyweight, feed consumption, water intake, and urinalysis parameters.
There were no cASC-EV-related changes in the hematology parameters. Some dif-
ferences showed statistically significant increases in EO (eosinophil), EOP (percent of
eosinophil), and LUP (percent of the large unstained cell) levels in the male group compared
to the control group, and significantly decreased RBC (red blood cell), Hb (hemoglobin),
and HCT (hematocrit) levels in the male group. Moreover, EO, LUC (large unstained
cell), and MPV (mean platelet volume) in the female group were statistically significantly
increased compared to the control group. However, there was no toxicological significance
because there was no dose-response correlation or minimal change within the range of
biological fluctuations with a slight difference in degree (Tables S1-1 and S1-2).
There were no cASC-EV-related changes in the blood chemistry parameters. The
PRO (total protein) level in the males decreased statistically significantly compared to the
control group, and the Cl (chloride) level in the males increased statistically significantly.
The Na (sodium) level in the females decreased statistically significantly. However, these
differences were attributed to biological variation because the degree was minor and the
dose-response correlation was not clear; therefore, there was no toxicological significance
(Tables S2-1 and S2-2).
In organ weight change, the relative ovary (right) weight in the female animals treated
with 2.98 × 109 particles/20 g was statistically significantly lower than in the control group,
but the dose-response correlation was not clear and notable findings were not observed in
the histopathological evaluation.
In the scheduled necropsy, no gross findings were noted in any of the terminal animals
and no cASC-EV-related microscopic findings were noted. The microscopic findings
observed were considered incidental to the nature commonly observed in mice and thus
were considered unrelated to the administering of the cASC-EVs.

3.7. MicroRNA Profiling of cASC-Derived EVs

We analyzed the expression of 798 miRNAs in two batches of cASC-EVs. Heatmaps
of the expressed miRNAs were applied between the two batches to identify statistically
significant differentially expressed miRNAs (Figure 6A). Twenty highly expressed miRNAs
(|FC| > 2 and cutoff p ≤ 0.05) were analyzed. Using heat map analysis, it was possible
to observe highly expressed miRNAs in the gene expression profile (blue (down) and
red (up)) between the two batches (Figure 6B). In the profiling data, the top 20 miRNAs
accounted for 87% of the total miRNAs and the top 7 miRNAs (let-7a, let-7b, miR-21, let-7f,
miR-125b, miR-24, and miR-29a) consisted of 66% of the total miRNAs. Interestingly, recent
studies have confirmed a key role for miR-21 and let-7b in the resolution of inflammation
and in negatively regulating the proinflammatory response induced by many of the same
stimuli that trigger miR-21 and let7b induction itself. Further, miR-21 has emerged as a key
mediator of anti-inflammatory responses in macrophages.
Animals 2023,13,
Animals2023, 13,x2215
FOR PEER REVIEW 1515ofof23
21

Figure
Figure4.4.cASC-EVs
cASC-EVs alleviate dermatitis
alleviate in Biostir-induced
dermatitis in Biostir-inducedatopic dermatitis-like
atopic skin skin
dermatitis-like lesions. (A)
lesions.
Schedule of the
(A) Schedule of in
thevivo animal
in vivo experiments.
animal (B)(B)
experiments. Photographs
Photographs of of
thethe
dorsal lesion
dorsal lesionarea
areaofofmice
miceonon
days
days00 and
and 28.
28. (C) Clinical evaluation
(C) Clinical evaluationusing
usingthe
thescore
scoreindex
indexofof AD,
AD, each
each week
week forfor
fourfour weeks.
weeks. (D)(D)
Ear
Animals 2023, 13, 2215 16 of 21
Animals 2023, 13, x FOR PEER REVIEW 16 of 23

thickness in mice with Biostir-induced AD-like skin lesions. (E) IgE levels in the total plasma of
Ear thickness in mice with Biostir-induced AD-like skin lesions. (E) IgE levels in the total plasma of
Biostir-induced AD mouse model. (F,G) IL-4 and IFN-gamma mRNA levels, measured by RT-qPCR
Biostir-induced AD mouse model. (F,G) IL-4 and IFN-gamma mRNA levels, measured by RT-qPCR
(n ==3).
(n 3).Data
Dataare mean± ±
aremean SD.SD. p <p 0.01
** ** < 0.01
vs.vs. group
group 2, *2,p*<p0.05
< 0.05
vs.vs. group
group 2. G1
2. G1 = Negative
= Negative control
control
9
group,
group,G2G2==Biostir-induced
Biostir-inducedADAD group,
group,G3G3= Biostir-induced
= Biostir-induced AD + cASC-EV
AD 1.001.00
+ cASC-EV × 10× treated
9 group,
10 treated group,
G4
G4==Biostir-induced
Biostir-inducedAD AD+ +cASC-EV
cASC-EV 3.33 × 10
3.33 treated
× 910 group, G5 = Biostir-induced AD + cASC-EV
9 treated group, G5 = Biostir-induced AD + cASC-EV

1.00
1.00××1010 treated
10 10 group,
treated G6G6
group, = Biostir-induced
= Biostir-induced AD AD+ prednisolone
+ prednisolone10 mg/kg treated
10 mg/kg group.
treated group.

Figure
Figure5.5.Inhibitory
Inhibitoryeffects
effectsofofEVs
EVs onon
AD-like lesions
AD-like in in
lesions Biostir-AD
Biostir-ADinduced
inducedatopic dermatitis-like
atopic dermatitis-like
phenotypes in a murine model. (A) Representative H&E (hematoxylin & eosin) and TB (toluidine
phenotypes in a murine model. (A) Representative H&E (hematoxylin & eosin) and TB (toluidine
blue) staining images of dorsal skin in normal mice and mice with Biostir-induced AD topically
blue) staining images of dorsal skin in normal mice and mice with Biostir-induced AD topically
treated with EVs in a dose-dependent manner (1.00 × 109, 3.33 × 109, and 1.00 × 1010 particles/mL) and
treated with (10
EVsmg/kg;
in a dose-dependent manner (1.00 × 10 9 , 3.33 × 109 , and 1.00 × 1010 particles/mL)
prednisolone positive control). Representative immunohistochemical staining images re-
vealed infiltration of
and prednisolone (10TSLP and positive
mg/kg; CD86 incontrol).
dermatitis. Positively stained
Representative cells are shown instaining
immunohistochemical brown. images
(B)
Graph indicating
revealed the of
infiltration number
TSLP andof infiltrated
CD86 in mast cells inPositively
dermatitis. the tissue,stained
determined by toluidine
cells are shown inblue
brown.
Animals 2023, 13, 2215 17 of 21

(B) Graph indicating the number of infiltrated mast cells in the tissue, determined by toluidine blue
staining. (C) Graph indicating the intensity of immune-positive cells of TSLP expression in dermatitis.
(D) Graph indicating the intensity of immune-positive cells of CD86 expression in dermatitis. Data
are mean ± SD. ** p < 0.01 vs. group 2. G1 = Negative control group, G2 = Biostir-induced ADgroup,
G3 = Biostir-induced AD + cASC-EV 1.00 × 109 treated group, G4 = Biostir-induced AD + cASC-EV
3.33 × 109 treated group, G5 = Biostir-induced AD + cASC-EV 1.00 × 1010 treated group, G6 = Biostir-
induced AD + prednisolone 10 mg/kg treated group.

The results of the GO analysis performed on the targets of cASC-EV miRNAs revealed
that the biological process of the targets is primarily associated with “intrinsic apoptotic
signaling pathway in response to DNA damage” processes (Figure 6C), the molecular
Animals 2023, 13, x FOR PEER REVIEW 19 of 23
function is “protein serine/threonine kinase activity” (Figure 6D), and the pathway most
strongly associated is the “JAK-STAT signaling pathway” (Figure 6E).

Figure6.6.miRNA
Figure miRNAexpression
expressionprofiles
profilesinindifferent
differentbatches
batchesofofcASC-derived
cASC-derivedEVs.
EVs.(A)
(A)The
Theheatmap
heatmap
describes the total miRNA profiles in EVs. (B) The ratio of different miRNAs in the top 20 miRNAs
describes the total miRNA profiles in EVs. (B) The ratio of different miRNAs in the top 20 miRNAs
in EVs. (C–E) Gene Ontology (GO) analysis of the targets of cASC-EV miRNA. Enrichment of GO
in EVs. (C–E) Gene Ontology (GO) analysis of the targets of cASC-EV miRNA. Enrichment of
biological process, molecular function and pathway performed using DAVID Bioinformatics re-
GO biological
sources 6.8. process, molecular function and pathway performed using DAVID Bioinformatics
resources 6.8.

4.4.Discussion
Discussion
HumanMSCs
Human MSCsareareknown
knowntotoregulate
regulateinflammatory
inflammatoryrelief
reliefand
andimmune
immuneactivation
activation
through the secretion and interaction of EVs, growth factors, and various cytokines [30,31].
through the secretion and interaction of EVs, growth factors, and various cytokines [30,31].
In particular, MSC-EVs are known to contain abundant substances such as proteins, lipids,
and miRNAs, and are attracting attention as a leader in cell-free therapy as an alternative
to cell therapy [32]. Recent studies have reported that it is related to various immunolog-
ical diseases, such as allergic reactions, asthma, and AD [33]. Additionally, various studies
have shown that MSC-EVs play a major role in immunosuppression. In the field of cell
Animals 2023, 13, 2215 18 of 21

In particular, MSC-EVs are known to contain abundant substances such as proteins, lipids,
and miRNAs, and are attracting attention as a leader in cell-free therapy as an alternative to
cell therapy [32]. Recent studies have reported that it is related to various immunological
diseases, such as allergic reactions, asthma, and AD [33]. Additionally, various studies
have shown that MSC-EVs play a major role in immunosuppression. In the field of cell
therapy, the development of treatments using MSCs is an important topic, yet issues
related to immunogenicity and side effects are emerging as the biggest problems in cell
therapy [34]. The development of treatments using MSC-EVs has been suggested as a good
alternative to reduce the side effects [35]. Therefore, many studies have been conducted
to alleviate symptoms of AD, such as itchiness, skin barrier defects, and inflammation
through MSC-EVs [36].
However, in the case of canine AD, few studies have investigated treatments using
canine MSCs. Therefore, there are few treatments for AD or other inflammatory diseases
using canine-MSCs [24]. We are interested in the treatment of inflammation using cASC-
EVs, particularly in the treatment of atopy. Here, we separated canine MSCs from adipose
tissue, verified the cells, and isolated EVs from the cells. We previously identified the
anti-inflammatory effect of human MSC-EVs by investigating the therapeutic effect of
AD from human MSC-EVs [26]. Accordingly, we hypothesized that confirming the anti-
inflammatory effect of canine MSC-EVs could lead to the same concept. Previously, there
were only a few studies using characteristic canine AD models other than DNBC-treated
models, and it was expected that using cASC-EVs would have a promising effect on the
treatment of canine AD [24].
In the Biostir-induced AD model, we confirmed both a reduction in inflammation-
related factors and the reduction of AD-related levels in a dose-dependent manner follow-
ing treatment with cASC-EVs. This result indicates that the inflammatory environment
of AD mice is regulated by the activation of T cells and mast cells, thereby reducing the
inflammatory response in the Biostir-induced AD model. In addition, the reduction of
serum inflammation-related cytokines, such as IL-4 and IFN-gamma, demonstrated the
effectiveness of cASC-EVs in the treatment of AD. In general, IL-4 and IFN-gamma strongly
inhibit the expression of barrier-related molecules that play an important role in maintain-
ing the structural integrity and function of the stratum corneum of the skin and allow the
stratum corneum to be maintained [37]. Through this, it was confirmed that the reduction
in the same inflammation-related factors occurred in both human ASC-EVs and in dogs.
In addition, the increase in serum IgE levels in the Biostir-induced AD model was
remarkably reduced by treatment with cASC-EVs. This result indicated that cASC-EVs
inhibited skin inflammation in the Biostir-induced AD model through T-cell activation and
mast cells. Thus, it was possible to confirm the regulation of immune cell activation by
cASC-EVs. Similarly, TSLP and CD86 [38], which are indicators of inflammatory diseases,
including in AD models, were decreased in a concentration-dependent manner by cASC-
EVs, confirming that cASC-EVs exhibit anti-inflammatory effects.
From the single-dose and 28-day repeat-dose toxicity studies, the potential toxicity
and target organs were not observed when cASC-EVs were subcutaneously administered
to ICR mice under test conditions. Therefore, the NOAEL (no observed adverse effect level)
of cASC-EVs is considered to be 1.19 × 1010 particles/20 g (the highest dose).
Although EVs have been studied for many years, the biological roles of EV-miRNAs
have only recently been investigated [39]. Our data showed that 798 miRNAs were iden-
tified and profiled using thermal map analysis. We analyzed the top 20 most highly
expressed miRNAs in cASC-EVs. Among the various miRNAs, let-7a, let-7b, and miR-21
were highly expressed in cASC-EVs. These miRNAs, which are abundant in cASC-EVs, are
known to exert anti-inflammatory effects in recipient cells through miRNA transfer [40–42].
Since let-7b and miR-21 have been shown to regulate inflammation in various contexts,
our findings provide new insights into how and where they function, allowing us to better
understand how they regulate inflammation-related processes. Furthermore, our study
adds to the promising body of evidence which highlights that miRNA transfer within
Animals 2023, 13, 2215 19 of 21

EVs is part of an intercellular communication network that coordinates complex immune

responses [43,44].

5. Conclusions
We successfully isolated canine adipose stem cells and EVs in this study. It was shown
that cASC-EVs have a beneficial effect in an AD model and also demonstrated that cASC-
EVs provide no safety concerns in single- or repeat-dose toxicity studies, and we identified
the role of EV miRNAs in improving anti-inflammatory function using NGS. Therefore,
these findings can serve as a basis for the treatment of AD and suggest that cASC-EVs may
provide a novel therapeutic approach to treating canine AD.

Supplementary Materials: The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/ani13132215/s1. Table S1-1. Hematological values of male mice in
the 28-day repeat-dose toxicity study. Table S1-2. Hematological values of female mice in the 28-day
repeat-dose toxicity study. Table S2-1. Blood chemistry values for male mice in the 28-day repeat-
dose toxicity study. Table S2-2. Blood chemistry values for female mice in the 28-day repeat-dose
toxicity study.
Author Contributions: Conceptualization, J.W.L. and J.Y.; methodology, B.S.C., S.-B.K. and S.K;
resources, B.S.C. and B.R.; writing—original draft preparation, S.-B.K., S.K. and J.W.L.; writing—re-
view and editing, J.Y., B.R. and J.W.L. All authors have read and agreed to the published version of
the manuscript.
Funding: This work was supported by the Korea Institute of Planning and Evaluation for Technology
in Food, Agriculture and Forestry (IPET) through the Animal Disease Management Technology
Development Program funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA)
(320063-02).
Institutional Review Board Statement: Animal care and experimental procedures were approved
by the Institutional Animal Care and Use Committee of the Korea Conformity Laboratories (IACUC
number: IA19-01714, IA20-02200, and IA21-02194).
Informed Consent Statement: Not applicable.
Data Availability Statement: All the data of the study can be made available upon request.
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript;
or in the decision to publish the results.

References
1. Boguniewicz, M.; Leung, D.Y. Atopic dermatitis: A disease of altered skin barrier and immune dysregulation. Immunol. Rev. 2011,
242, 233–246. [CrossRef] [PubMed]
2. Nutten, S. Atopic dermatitis: Global epidemiology and risk factors. Ann. Nutr. Metab. 2015, 66 (Suppl. S1), 8–16. [CrossRef]
3. Gedon, N.K.Y.; Mueller, R.S. Atopic dermatitis in cats and dogs: A difficult disease for animals and owners. Clin. Transl. Allergy
2018, 8, 41. [CrossRef]
4. Pucheu-Haston, C.M. Atopic dermatitis in the domestic dog. Clin. Dermatol. 2016, 34, 299–303. [CrossRef]
5. Jassies-van der Lee, A.; Rutten, V.; Spiering, R.; van Kooten, P.; Willemse, T.; Broere, F. The immunostimulatory effect of CpG
oligodeoxynucleotides on peripheral blood mononuclear cells of healthy dogs and dogs with atopic dermatitis. Vet. J. 2014, 200,
103–108. [CrossRef] [PubMed]
6. Olivry, T.; DeBoer, D.J.; Favrot, C.; Jackson, H.A.; Mueller, R.S.; Nuttall, T.; Prelaud, P.; International Task Force on Canine Atopic
Dermatitis. Treatment of canine atopic dermatitis: 2010 clinical practice guidelines from the International Task Force on Canine
Atopic Dermatitis. Vet. Dermatol. 2010, 21, 233–248. [CrossRef] [PubMed]
7. Little, P.R.; King, V.L.; Davis, K.R.; Cosgrove, S.B.; Stegemann, M.R. A blinded, randomized clinical trial comparing the efficacy
and safety of oclacitinib and ciclosporin for the control of atopic dermatitis in client-owned dogs. Vet. Dermatol. 2015, 26, 23-e8.
[CrossRef] [PubMed]
8. Anjos-Afonso, F.; Siapati, E.K.; Bonnet, D. In vivo contribution of murine mesenchymal stem cells into multiple cell-types under
minimal damage conditions. J. Cell Sci. 2004, 117, 5655–5664. [CrossRef]
9. Murphy, M.B.; Moncivais, K.; Caplan, A.I. Mesenchymal stem cells: Environmentally responsive therapeutics for regenerative
medicine. Exp. Mol. Med. 2013, 45, e54. [CrossRef]
Animals 2023, 13, 2215 20 of 21

10. Kang, J.W.; Kang, K.S.; Koo, H.C.; Park, J.R.; Choi, E.W.; Park, Y.H. Soluble factors-mediated immunomodulatory effects of canine
adipose tissue-derived mesenchymal stem cells. Stem Cells Dev. 2008, 17, 681–693. [CrossRef]
11. Zappia, E.; Casazza, S.; Pedemonte, E.; Benvenuto, F.; Bonanni, I.; Gerdoni, E.; Giunti, D.; Ceravolo, A.; Cazzanti, F.; Frassoni,
F.; et al. Mesenchymal stem cells ameliorate experimental autoimmune encephalomyelitis inducing T-cell anergy. Blood 2005, 106,
1755–1761. [CrossRef] [PubMed]
12. Ohnishi, S.; Yanagawa, B.; Tanaka, K.; Miyahara, Y.; Obata, H.; Kataoka, M.; Kodama, M.; Ishibashi-Ueda, H.; Kangawa, K.;
Kitamura, S.; et al. Transplantation of mesenchymal stem cells attenuates myocardial injury and dysfunction in a rat model of
acute myocarditis. J. Mol. Cell. Cardiol. 2007, 42, 88–97. [CrossRef]
13. Kunter, U.; Rong, S.; Djuric, Z.; Boor, P.; Muller-Newen, G.; Yu, D.; Floege, J. Transplanted mesenchymal stem cells accelerate
glomerular healing in experimental glomerulonephritis. J. Am. Soc. Nephrol. 2006, 17, 2202–2212. [CrossRef] [PubMed]
14. Batten, P.; Sarathchandra, P.; Antoniw, J.W.; Tay, S.S.; Lowdell, M.W.; Taylor, P.M.; Yacoub, M.H. Human mesenchymal stem cells
induce T cell anergy and downregulate T cell allo-responses via the TH2 pathway: Relevance to tissue engineering human heart
valves. Tissue Eng. 2006, 12, 2263–2273. [CrossRef] [PubMed]
15. Le Blanc, K.; Tammik, C.; Rosendahl, K.; Zetterberg, E.; Ringden, O. HLA expression and immunologic properties of differentiated
and undifferentiated mesenchymal stem cells. Exp. Hematol. 2003, 31, 890–896. [CrossRef]
16. Ringden, O.; Uzunel, M.; Rasmusson, I.; Remberger, M.; Sundberg, B.; Lonnies, H.; Marschall, H.U.; Dlugosz, A.; Szakos, A.;
Hassan, Z.; et al. Mesenchymal stem cells for treatment of therapy-resistant graft-versus-host disease. Transplantation 2006, 81,
1390–1397. [CrossRef]
17. Thery, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.;
Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the
International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750.
[CrossRef]
18. Ha, D.H.; Kim, H.K.; Lee, J.; Kwon, H.H.; Park, G.H.; Yang, S.H.; Jung, J.Y.; Choi, H.; Lee, J.H.; Sung, S.; et al. Mesenchymal
Stem/Stromal Cell-Derived Exosomes for Immunomodulatory Therapeutics and Skin Regeneration. Cells 2020, 9, 1157. [CrossRef]
19. Dabrowska, S.; Andrzejewska, A.; Janowski, M.; Lukomska, B. Immunomodulatory and Regenerative Effects of Mesenchymal
Stem Cells and Extracellular Vesicles: Therapeutic Outlook for Inflammatory and Degenerative Diseases. Front. Immunol. 2020,
11, 591065. [CrossRef]
20. Mocchi, M.; Dotti, S.; Bue, M.D.; Villa, R.; Bari, E.; Perteghella, S.; Torre, M.L.; Grolli, S. Veterinary Regenerative Medicine for
Musculoskeletal Disorders: Can Mesenchymal Stem/Stromal Cells and Their Secretome Be the New Frontier? Cells 2020, 9, 1453.
[CrossRef]
21. Eom, Y.W.; Lee, J.E.; Yang, M.S.; Jang, I.K.; Kim, H.E.; Lee, D.H.; Kim, Y.J.; Park, W.J.; Kong, J.H.; Shim, K.Y.; et al. Rapid isolation
of adipose tissue-derived stem cells by the storage of lipoaspirates. Yonsei Med. J. 2011, 52, 999–1007. [CrossRef]
22. Zoller, N.; Schreiner, S.; Petry, L.; Hoffmann, S.; Steinhorst, K.; Kleemann, J.; Jager, M.; Kaufmann, R.; Meissner, M.; Kippenberger,
S. Collagen I Promotes Adipocytogenesis in Adipose-Derived Stem Cells In Vitro. Cells 2019, 8, 302. [CrossRef] [PubMed]
23. Enciso, N.; Avedillo, L.; Fermin, M.L.; Fragio, C.; Tejero, C. Cutaneous wound healing: Canine allogeneic ASC therapy. Stem Cell
Res. Ther. 2020, 11, 261. [CrossRef] [PubMed]
24. Kim, S.Y.; Yoon, T.H.; Na, J.; Yi, S.J.; Jin, Y.; Kim, M.; Oh, T.H.; Chung, T.W. Mesenchymal Stem Cells and Extracellular Vesicles
Derived from Canine Adipose Tissue Ameliorates Inflammation, Skin Barrier Function and Pruritus by Reducing JAK/STAT
Signaling in Atopic Dermatitis. Int. J. Mol. Sci. 2022, 23, 4868. [CrossRef] [PubMed]
25. Matsuda, H.; Watanabe, N.; Geba, G.P.; Sperl, J.; Tsudzuki, M.; Hiroi, J.; Matsumoto, M.; Ushio, H.; Saito, S.; Askenase, P.W.; et al.
Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice. Int. Immunol. 1997, 9, 461–466.
[CrossRef]
26. Cho, B.S.; Kim, J.O.; Ha, D.H.; Yi, Y.W. Exosomes derived from human adipose tissue-derived mesenchymal stem cells alleviate
atopic dermatitis. Stem Cell Res. Ther. 2018, 9, 187. [CrossRef]
27. Kuca-Warnawin, E.; Janicka, I.; Bonek, K.; Kontny, E. Modulatory Impact of Adipose-Derived Mesenchymal Stem Cells of
Ankylosing Spondylitis Patients on T Helper Cell Differentiation. Cells 2021, 10, 280. [CrossRef]
28. Kim, J.E.; Kim, H.J.; Lew, B.L.; Lee, K.H.; Hong, S.P.; Jang, Y.H.; Park, K.Y.; Seo, S.J.; Bae, J.M.; Choi, E.H.; et al. Consensus
Guidelines for the Treatment of Atopic Dermatitis in Korea (Part I): General Management and Topical Treatment. Ann. Dermatol.
2015, 27, 563–577. [CrossRef]
29. Weidinger, S.; Beck, L.A.; Bieber, T.; Kabashima, K.; Irvine, A.D. Atopic dermatitis. Nat. Rev. Dis. Prim. 2018, 4, 1. [CrossRef]
30. Jee, M.K.; Im, Y.B.; Choi, J.I.; Kang, S.K. Compensation of cATSCs-derived TGFbeta1 and IL10 expressions was effectively
modulated atopic dermatitis. Cell. Death Dis. 2013, 4, e497. [CrossRef]
31. Kavanagh, H.; Mahon, B.P. Allogeneic mesenchymal stem cells prevent allergic airway inflammation by inducing murine
regulatory T cells. Allergy 2011, 66, 523–531. [CrossRef]
32. Hu, P.; Yang, Q.; Wang, Q.; Shi, C.; Wang, D.; Armato, U.; Pra, I.D.; Chiarini, A. Mesenchymal stromal cells-exosomes: A promising
cell-free therapeutic tool for wound healing and cutaneous regeneration. Burns Trauma. 2019, 7, 38. [CrossRef] [PubMed]
33. Johnson, C.C.; Ownby, D.R. Allergies and Asthma: Do Atopic Disorders Result from Inadequate Immune Homeostasis arising
from Infant Gut Dysbiosis? Expert Rev. Clin. Immunol. 2016, 12, 379–388. [CrossRef]
Animals 2023, 13, 2215 21 of 21

34. Marofi, F.; Vahedi, G.; Biglari, A.; Esmaeilzadeh, A.; Athari, S.S. Mesenchymal Stromal/Stem Cells: A New Era in the Cell-Based
Targeted Gene Therapy of Cancer. Front. Immunol. 2017, 8, 1770. [CrossRef] [PubMed]
35. Lu, C.H.; Chen, Y.A.; Ke, C.C.; Liu, R.S. Mesenchymal Stem Cell-Derived Extracellular Vesicle: A Promising Alternative Therapy
for Osteoporosis. Int. J. Mol. Sci. 2021, 22, 12750. [CrossRef]
36. Hong, S.; Kim, E.Y.; Lim, S.E.; Kim, J.H.; Sohn, Y.; Jung, H.S. Dendrobium nobile Lindley Administration Attenuates Atopic
Dermatitis-like Lesions by Modulating Immune Cells. Int. J. Mol. Sci. 2022, 23, 4470. [CrossRef] [PubMed]
37. Furue, M. Regulation of Filaggrin, Loricrin, and Involucrin by IL-4, IL-13, IL-17A, IL-22, AHR, and NRF2: Pathogenic Implications
in Atopic Dermatitis. Int. J. Mol. Sci. 2020, 21, 5382. [CrossRef]
38. Yi, Y.W.; Lee, J.H.; Kim, S.Y.; Pack, C.G.; Ha, D.H.; Park, S.R.; Youn, J.; Cho, B.S. Advances in Analysis of Biodistribution of
Exosomes by Molecular Imaging. Int. J. Mol. Sci. 2020, 21, 665. [CrossRef]
39. Munir, J.; Yoon, J.K.; Ryu, S. Therapeutic miRNA-Enriched Extracellular Vesicles: Current Approaches and Future Prospects. Cells
2020, 9, 2271. [CrossRef]
40. Koeppen, K.; Nymon, A.; Barnaby, R.; Bashor, L.; Li, Z.; Hampton, T.H.; Liefeld, A.E.; Kolling, F.W.; LaCroix, I.S.; Gerber, S.A.; et al.
Let-7b-5p in vesicles secreted by human airway cells reduces biofilm formation and increases antibiotic sensitivity of P. aeruginosa.
Proc. Natl. Acad. Sci. USA 2021, 118, e2105370118. [CrossRef]
41. Castro-Leyva, V.; Arenas-Huertero, F.; Espejel-Nunez, A.; Giono Cerezo, S.; Flores-Pliego, A.; Espino, Y.S.S.; Reyes-Munoz, E.;
Vadillo-Ortega, F.; Borboa-Olivares, H.; Camacho-Arroyo, I.; et al. miR-21 differentially regulates IL-1beta and IL-10 expression in
human decidual cells infected with streptococcus B. Reprod. Biol. 2022, 22, 100604. [CrossRef] [PubMed]
42. Tangtanatakul, P.; Klinchanhom, S.; Sodsai, P.; Sutichet, T.; Promjeen, C.; Avihingsanon, Y.; Hirankarn, N. Down-regulation of
let-7a and miR-21 in urine exosomes from lupus nephritis patients during disease flare. Asian Pac. J. Allergy Immunol. 2019, 37,
189–197. [CrossRef] [PubMed]
43. Teng, G.G.; Wang, W.H.; Dai, Y.; Wang, S.J.; Chu, Y.X.; Li, J. Let-7b is involved in the inflammation and immune responses
associated with Helicobacter pylori infection by targeting Toll-like receptor 4. PLoS ONE 2013, 8, e56709. [CrossRef] [PubMed]
44. Sheedy, F.J. Turning 21: Induction of miR-21 as a Key Switch in the Inflammatory Response. Front. Immunol. 2015, 6, 19. [CrossRef]
[PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.