12th Zoology EM - WWW - Tntextbooks.in

www.tntextbooks.
in
GOVERNMENT OF TAMIL NADU
HIGHER SECONDARY SECOND YEAR
ZOOLOGY
A publication under Free Textbook Programme of Government of Tamil Nadu
Department of School Education

Untouchability is Inhuman and a Crime
XII Std Zoology Introduction EM.indd 1 12/14/2021 10:56:05 AM

www.tntextbooks.in
Government of Tamil Nadu
First Edition - 2019

Revised Edition - 2020, 2022
(Published under New Syllabus)
NOT FOR SALE
Content Creation
The wise
possess all
State Council of Educational Research

and Training
© SCERT 2019
Printing & Publishing
Tamil NaduTextbook and Educational

Services Corporation
www.textbooksonline.tn.nic.in
II

www.tntextbooks.in
CONTENTS
ZOOLOGY
PAGE
UNIT CONTENTS MONTH
No.
UNIT I
Chapter 1 Reproduction in Organisms 01
Chapter 2 Human Reproduction 11 June
Chapter 3 Reproductive Health 32
UNIT II
Chapter 4 Principles of Inheritance and Variation 45
July
Chapter 5 Molecular Genetics 61
Chapter 6 Evolution 92 August
UNIT III
Chapter 7 Human Health and Diseases 112
August
Chapter 8 Immunology 129
Chapter 9 Microbes in Human Welfare 148 September
UNIT IV
Chapter 10 Applications of Biotechnology 157 October
UNIT V
Chapter 11 Organisms and Populations 176 October
Chapter 12 Biodiversity and its Conservation 197
November
Chapter 13 Environmental Issues 219
E-book Assessment
III

www.tntextbooks.in
Conceptual picture with caption relating to

every chapter is given in this text book.
New life for woolly mammoth DNA-researchers can now re-create the
genes of mammoth and study the proteins they encoded
Chapter Outline Presents a complete overview of the chapter
Goals to transform the classroom processes into

Learning Objectives:
learner centric with a list of bench marks
Amazing facts, Rhetorical questions to lead students

to biological inquiry
Directions are provided to students to conduct activities

Activity in order to explore, enrich the concept.
Infographics Visual representation of the lesson to enrich learning .
HOW TO USE Superfluous information about a personality or day to

THE BOOK? day life experience relating to the content
To motivate the students to further explore the content

digitally and take them to virtual world
ICT To enhance digital Science skills among students
Conceptual diagram that depicts relationships between

Concept Map concepts to enable students to learn the content schematically
Glossary Explanation of scientific terms
Evaluation Assess students to pause, think and check their understanding
References List of related books for further details of the topic
Web links List of digital resources
IV

www.tntextbooks.in
Prospects of Zoology
National and International Biology Olympiad Exam
Who can participate? : Secondary and Higher Secondary students
Five stages of Exam
Stage I : National Standard Examination in Biology
Stage II : Indian National Biology Olympiad
Stage III : Orientation cum Selection Camp in Biology
Stage IV : Pre-departure Training Camp for
International Biology Olympiad
(IBO) (for 4 members)
Stage V : Participation in IBO
Weblink: https://www.entrancei.com
Scholarship for Biology Students

Ministry of Science and Technology offers biology scholarship to 100 students
from schools around the country. Among them 52 (two from each state board) are
selected for the award which carries a cash prize of Rs 20,000, a certificate and a medal.
http://www.dbtindia.nic.in
It also offers INSPIRE programme for science students. www.online.inspire.gov.in
Tamilnadu State Council of Science and Technology offers Young Scientists Fellowship
Scheme to encourage scientist below 40 years, who are working in educational institutions.
They are given Rs.10000 for 2- 6 months. (http://www.tanscst.nic.in/)
Tamilnadu State Council of Science and Technology offers Student project
scheme for Science and Technology useful to our society. Student scientists are
awarded with the cash prize of Rs.5000 - 10000 for their best project or model.
(http://www.tanscst.nic.in/)
Institutes
Institutes affiliated
affiliated to Dr. M.G.R.
to Dr. M.G.R. Medical
Medical University,
University, Chennai.
Chennai.
Occupation Therapy Colleges:
• College of Occupational Therapy, Christian Medical College, Vellore
Physiotherapy Colleges:
• Govt. College of Physiotherapy, Trichy
• Govt. Institute of Rehabilitation Medicine, Chennai
• College of Physiotherapy, Christian Medical College, Vellore
• Tamilnadu Paramedical Institutions College of Physiotherapy, Chennai
Siddha Colleges:
• Govt. Siddha Medical College, Chennai
• Govt. Siddha Medical College, Tirunelveli
• National Institute of Siddha, Chennai
V

www.tntextbooks.in
Pharmacy Colleges: • Vellore Govt. Medical College, Vellore

• Coimbatore Medical College, Coimbatore Homeopathy Colleges:
• College of Pharmacy, Madras Medical • Govt. Homeopathic Medical College
College, Chennai and Hospital, Tirumangalam
• College of Pharmacy, Madurai Medical • Tamilnadu Homeopathy Medical
College, Madurai College, Salem
• Thanjavur Medical College, Thanjavur
Dental Colleges:
• College of Allied Medical Sciences,
• Tamilnadu Govt. Dental College,
Madurai
Chennai
• Department of Pharmacy, Annamalai
University, Cuddalore Ayush Institutions In Tamilnadu
• Ayurveda College, 242-B, Trichy
Nursing Colleges: Road, Sulur, 215 Pathanjalipuri (Post),
• College of Nursing, Madras Medical Coimbatore – 641402
College, Chennai
• Venkataramana Ayurveda College, 216
• College of Nursing, Madurai Medical 596,A1&A2,31st St. TNHB Colony,
College, Madurai Periyar Nagar, Korattur, Chennai
Medical Colleges: • Sri Sai Ram Ayurvedic Medical
• Cancer Institute, College of Oncological College & 217 Research Centre,
Sciences, Chennai Saileo Nagar, Poonthandalam Village,
• Chengalpattu Medical College, Sriperumbudur, Chennai – 600044
Chengalpattu • Dharma Ayurvedic Medical College and
• Christian Medical College, Vellore Hosp, 48 218 Grand West Trunk Road,
• Coimbatore Medical College, Coimbatore Sriperumbudur, Kanchipuram, 602 105
• Government Dharamapuri Medical • Sri Sankara College of Ayurveda,
College, Dharampuri Sannasipatti, 219 Poolankulathupatti
(Post) Trichy-620009
• Kanyakumari Govt. Medical College,
Kanyakumari
• Kilpauk Medical College, Chennai List of Tamilnadu Veterinary
• Madras Medical College and Research
colleges affiliated to Tamilnadu
Institute, Chennai
Veterinary University
• Madurai Medical College, Madurai
• Stanley Medical College, Chennai • Tamilnadu Veterinary University,
• Thanjavur Medical College, Thanjavur Chennai
• Theni Government Medical College, • Veterinary College and Research
Theni Institute, Namakkal
• Thoothukudi Govt. Medical College, • Fishery College and Research Institute,
Thoothukudi Thoothukudi
• Tirunelveli Medical College, Tirunelveli
VI

www.tntextbooks.in
List of Tamilnadu Agricultural Salim Ali Centre for Ornithology

colleges affiliated to Tamilnadu and Natural History (SACON)
Agricultural University Coimbatore
in Tamilnadu • National Ornithological Databank
(NOD) Cell
• GIS Laboratory
• Tamilnadu Agricultural University,
• Ecotoxicology Laboratory
Coimbatore
• Conservation Genetics Laboratory
• Agricultural College and Research
Institute, Kanniyakumari Institute of Basic Medical Science
(IBMS) Tharamani, Chennai
• Agricultural Engineering College and
• Blood transfusion
Research Institute, Coimbatore
• Chromatography
• Avvaiyar Government College for • Mass spectroscopy
Women, Kodaikanal • Clinical Data interpretation
• Horticulture College and Research • Diagnosis of blood courses
Institute, Periyakulam
Centre for Marine Fisheries and
Research Institute (CMFRI)
Institutes conducting
• Marine capture fisheries
Researches in Zoology • Mariculture
Indian Institute of Science (IISC) • Biodiversity
Bangalore • Marine Biotechnology
• Fishery environment
• Biochemistry (BC)
• Central Animal Facility (CAF) National Environmental
• Centre for Ecological Sciences (CES) Engineering Research Institute
(NEERI)
• Centre for Infectious Disease Research
• Air Pollution control
(CIDR)
• Climate sustainability and skill
• Centre for Neuroscience (CNS)
development
• Microbiology and Cell Biology (MCB) • Cleaner technology and modeling
• Molecular Biophysics Unit (MBU) • Environmental Biotechnology and
Genomic division
IFS Service
IFS (Indian Forest (IndianExamination)
Forest Service)Examination
Examination
• Conducting authority - UPSC
• Educational - B.Sc. in any one degree like Physics, Chemistry, Botany, Zoology,
Qualification: Agriculture, Maths, Geology, or B.E or B.V.Sc.
• Age - Minimum 21, Maximum 32 Yrs
• Weblink - https://upsconline.nic.in
VII

www.tntextbooks.in
ZOOLOGY
VIII

www.tntextbooks.in
1
UNIT - I
Reproduction
in Organisms
CHAPTER
Paramecia is capable of both sexual and

Chapter Outline asexual reproduction.
1.1. Modes of reproduction

1.2. Asexual reproduction in continuation of species and introduces
1.3. Sexual reproduction variations in organisms, which are essential
for adaptation and evolution of their
own kind.
Learning Objectives
1.1. Modes of reproduction
➢➢ Learns the modes of asexual All modes of reproduction have some
reproduction in organisms. basic features such as synthesis of RNA and
proteins, replication of DNA, cell division and
➢➢ Understands the growth, formation of reproductive units and
significance of asexual their fertilization to form new individuals.
reproduction.
Organisms exhibit two major modes of
➢➢ Comprehends the reproduction namely asexual and sexual
different modes of reproduction. Reproduction by a single parent
sexual reproduction. without the involvement of gamete formation
is asexual reproduction and the offspring
➢➢ Realizes the significance and produced are genetically identical. Asexual
advantage of sexual reproduction and reproduction is usually by amitotic or mitotic
its role in evolution. division of the somatic (body) cells, hence
is also known as somatogenic or blastogenic
reproduction. When two parents participate
L iving organisms show a life cycle in the reproductive process involving two
involving birth, growth, development, types of gametes (ova and sperm), it is called
maturation, reproduction and death. sexual reproduction.
Reproduction is the fundamental feature of
all living organisms. It is a biological process 1.2. Asexual reproduction
by which organisms produce their young Asexual reproduction is wide spread
ones. The young ones grow and mature to among different organisms. It is common in
repeat the process. Thus reproduction results members of Protista, Bacteria, Archaea and
XII Std Zoology Chapter 1 EM.indd 1 18/12/2021 14:50:06

www.tntextbooks.in
in multicellular organisms with relatively i) Simple irregular binary fission

simpler organisation. The offsprings show ii) Transverse binary fission
“uniparental inheritance” without any genetic
iii) Longitudinal binary fission
variation. The different modes of asexual
iv) Oblique binary fission
reproduction seen in animals are fission,
budding, fragmentation and regeneration. Simple irregular binary fission is seen
in irregular shaped organisms like Amoeba
Fission is the division of the parent (Fig. 1.1), where the plane of division is
body into two or more identical daughter hard to observe. The contractile vacuoles
individuals. Five types of fission are seen in cease to function and disappear. The
animals. They are binary fission, multiple nucleoli disintegrate and the nucleus divides
fission, plasmotomy, strobilation and mitotically. The cell then constricts in the
sporulation. middle, so the cytoplasm divides and forms
In binary fission, the parent two daughter cells.
organism divides into two halves and In transverse binary fission, the plane of
each half forms a daughter individual. the division runs along the transverse axis of
The nucleus divides first amitotically or the individual. e.g. Paramecium and Planaria.
mitotically (karyokinesis), followed by the In Paramecium (Fig. 1.2) the macronucleus
division of the cytoplasm (cytokinesis). divides by amitosis and the micronucleus
The resultant offsprings are genetically divides by mitosis.
identical to the parent. Depending on the In longitudinal binary fission, the
plane of fission, binary fission is of the nucleus and the cytoplasm divides in the
following types, longitudinal axis of the organism (Fig 1.3). In
Contractile
vacuole
Simple irregular Binary Fission in Amoeba
Nuclear
Contractile
membrane
vacuole
Nucleus
Hyaline area
Chromosomes
Daughter amoebae
Fig. 1.1 Irregular simple binary fission in Amoeba

Macronucleus
New oral
groove
forming
Micronucleus Oral groove

disappearing
Daughter
paramecia
New
contractile
vacuoles
Macronucleus Micronucleus New

dividing dividing oral groove
amitotically mitotically forming
Fig. 1.2 Transverse binary fission in Paramecium
Reproduction in Organisms 2

www.tntextbooks.in
Longitudinal furrow
Daughter
Euglena
Chromosomes
Nucleus
Nucleoli
Nucleus
Chromatids Nucleolar Nuclear

body constriction
Fig. 1.3 Longitudinal binary fission in Euglena
flagellates, the flagellum is retained usually by the process is complete, then this division is
one daughter cell. The basal granule is divided called repeated fission. e.g. Vorticella.
into two and the new basal granule forms a During unfavorable conditions (increase
flagellum in the other daughter individual. or decrease in temperature, scarcity of food)
e.g. Vorticella and Euglena. Amoeba withdraws its pseudopodia and
In oblique binary fission the plane of secretes a three-layered, protective, chitinous
division is oblique. It is seen in dinoflagellates. cyst wall around it and becomes inactive
e.g. Ceratium. (Fig. 1.4). This phenomenon is called
In multiple fission the parent body encystment. When conditions become
divides into many similar daughter cells favourable, the encysted Amoeba divides
simultaneously. First, the nucleus divides by multiple fission and produces many
repeatedly, later the cytoplasm divides into as minute amoebae called pseudopodiospore
many parts as that of nuclei. Each cytoplasmic or amoebulae. The cyst wall absorbs
part encircles one daughter nucleus. This water and breaks off liberating the young
results in the formation of many smaller pseudopodiospores, each with a fine
individuals from a single parent organism. pseudopodia. They feed and grow rapidly to
If multiple fission produces four or many lead an independent life.
daughter individuals by equal cell division In some metazoan animals, a special type
and the young ones do not separate until of transverse fission called strobilation occurs
Pseudopodiospores
Ruptured
Three cyst wall
layered
cyst wall
Nucleus
Cytoplasm
Daughter
nuclei
Daughter nuclei Pseudopodiospores Young
cyst formation formation amoebae
Fig. 1.4 Multiple fission in encysted Amoeba
3 Reproduction in Organisms

www.tntextbooks.in
Tentacles
Tentacles
Mouth
Manubrium
Manubrium
Mouth
Ephyrae Early Ephyra
budding (side view)
Inter radial
canal Per radial
canal
Mouth
Stomach Sense
organ
Stalk Manubrium
Stolon Marginal
lappet Bifid arm
Adhesive
disc
Young Adult Early Ephyra
strobila strobila (oral view)
Fig. 1.5 Strobilation in Aurelia
(Fig. 1.5). In the process of strobilation, several Nucleus breaks into several small fragments
transverse fissions occur simultaneously or chromatin blocks. Each fragment develops
giving rise to a number of individuals which a nuclear membrane, becomes surrounded by
often do not separate immediately from cytoplasm and develops a spore-case around
each other e.g. Aurelia. Plasmotomy is the it (Fig. 1.6). When conditions become
division of multinucleated parent into many favourable, the parent body disintegrates and
multinucleate daughter individuals with the the spores are liberated, each hatching into a
division of nuclei. Nuclear division occurs young amoeba.
later to maintain normal number of nuclei. In budding, the parent body produces one
Plasmotomy occurs in Opalina and Pelomyxa or more buds and each bud grows into a young
(Giant Amoeba). one. The buds separate from the parent to lead
During unfavourable conditions Amoeba a normal life. In sponges, the buds constrict
multiplies by sporulation without encystment. and detach from the parent body and the bud
develops into a new sponge (Fig. 1.7).
Chromatin Nuclear membrane Spores Spore case
blocks disintegrating
Nuclei
Nucleus
D Cytoplasm
Nucleus Spore case

Young
amoeba
Nucleus
Cytoplasm
Cytoplasm
Fig. 1.6 Sporulation in Amoeba


www.tntextbooks.in
Individual
parent Osculum
Hydra Growth Bud develops Bud detaches

of bud mouth and from parent and
Bud Bud Daughter tentacles leads an
forming growing individual independent life
Fig. 1.7 Budding in Leucosolenia (Sponge) Fig. 1.8 Budding in Hydra
When buds are formed on the outer In fragmentation, the parent body
surface of the parent body, it is known as breaks into fragments (pieces) and each of the
exogenous budding e.g. Hydra. In Hydra when fragment has the potential to develop into a new
food is plenty, the ectoderm cells increase and individual. Fragmentation or pedal laceration
form a small elevation on the body surface occurs in many genera of sea anemones. Lobes
(Fig. 1.8). Ectoderm and endoderm are pushed are constricted off from the pedal disc and each
out to form the bud. The bud contains an of the lobe grows mesenteries and tentacles to
interior lumen in continuation with parent’s form a new sea anemone.
gastro-vascular cavity. The bud enlarges,
In the tapeworm, Taenia solium, the gravid
develops a mouth and a circle of tentacles at its
(ripe) proglottids are the oldest at the posterior
free end. When fully grown, the bud constricts
end of the strobila (Fig. 1.10). The gravid
at the base and finally separates from the parent
proglottids are regularly cut off either singly or
body and leads an independent life.
in groups from the posterior end by a process
In Noctiluca, hundreds of buds are called apolysis. This is very significant since it
formed inside the cytoplasm and many remain
helps in transferring the developed embryos
within the body of the parent. This is called
from the primary host (man) to find a secondary
endogenous budding. In freshwater sponges
host (pig).
and in some marine sponges a regular and
Scolex
peculiar mode of asexual reproduction occurs
Neck
by internal buds called gemmules is seen
(Fig. 1.9). A completely grown gemmule is
a hard ball, consisting of an internal mass of
food-laden archaeocytes. During unfavourable
conditions, the sponge disintegrates but the Immature
gemmule can withstand adverse conditions. proglottids
Mature
When conditions become favourable, the proglottids
gemmules begin to hatch.
Micropyle
Monaxon
spicules Outer
membrane
Archaeocytes
Gravid
proglottids
Inner
membrane
Fig. 1.9 Gemmule in sponges Fig. 1.10 Apolysis in Taenia solium

www.tntextbooks.in
zygote, which develops into

a new organism. It leads to
genetic variation. The types
of sexual reproduction seen
in animals are syngamy
(fertilization) and
conjugation. In syngamy, the fusion of two
haploid gametes takes place to produce a diploid
zygote. Depending upon the place where the
fertilization takes place, it is of two types. In
external fertilization, the fusion of male and
Fig. 1.11 Regeneration in Hydra female gametes takes place outside the body
Regeneration is regrowth in the injured of female organisms in the water medium. e.g.
region. Regeneration was first studied in Hydra sponges, fishes and amphibians. In internal
by Abraham Trembley in 1740. Regeneration is fertilization, the fusion of male and female
of two types, morphallaxis and epimorphosis. gametes takes place within the body of female
In morphallaxis the whole body grows from a organisms. e.g. reptiles, aves and mammals.
small fragment e.g. Hydra and Planaria. When POWER OF
Hydra is accidentally cut into several pieces, REGENERATION
each piece can regenerate the lost parts and
Sponge when macerated
develop into a whole new individual (Fig. 1.11).
and squeezed through
The parts usually retain their original polarity,
fine silk cloth, the cluster of cells pass
with oral ends, by developing tentacles
through, and these can regenerate new
and aboral ends, by producing basal discs.
sponges. This technique is used for
Epimorphosis (Fig. 1.12) is the replacement
cultivation of sponges.
of lost body parts. It is of two types, namely
reparative and restorative regeneration. In
reparative regeneration, only certain damaged Different kinds of syngamy (fertilization)
tissue can be regenerated, e.g. human beings are prevalent among living organisms.
whereas in restorative regeneration severed a) Autogamy- The male and female
body parts can develop. e.g. star fish, tail of wall gametes are produced by the same cell or same
lizard. organism and both the gametes fuse together
to form a zygote. e.g. Actinosphaerium and
Paramecium.
b) Exogamy- The male and female gametes
are produced by different parents and they fuse
to form a zygote. So it is biparental. e.g. Human
beings – dioecious or unisexual animal.
c) Hologamy- Lower organisms,
Fig. 1.12 Restorative regeneration in star fish sometimes the entire mature organisms do not
form gametes but they themselves behave as
1.3. Sexual reproduction gametes and the fusion of such mature individuals
Sexual reproduction involves the fusion is known as hologamy e.g. Trichonympha.
of male and female gametes to form a diploid

www.tntextbooks.in
d) Paedogamy- It is the sexual union of PARTHENOGENESIS

young individuals produced immediately after (Gr. Parthenos – virgin, Genesis-
the division of the adult parent cell by mitosis. produce)
e.g. Actinophrys. Development of an egg into a complete
e) Merogamy- The fusion of small individual without fertilization is known as
sized and morphologically different gametes parthenogenesis. It was first discovered by
(merogametes) takes place. e.g. Protozoa. Charles Bonnet in 1745. Parthenogenesis is of
f) Isogamy- The fusion of morphological two main types namely, Natural Parthenogenesis
and physiological identical gametes and Artificial Parthenogenesis. In certain
(isogametes) is called isogamy. e.g. Monocystis. animals, parthenogenesis occurs regularly,
constantly and naturally in their life cycle and
g) Anisogamy- The fusion of dissimilar is known as natural parthenogenesis.
gametes is called anisogamy (Gr. An-without;
iso-equal; gam-marriage). Anisogamy occurs Natural
in higher animals but it is customary to use parthenogenesis are of
the term fertilization instead of anisogamy different types:
or syngamy. e.g. higher invertebrates and all a) Arrhenotoky: In this type
vertebrates. only males are produced by parthenogenesis.
Conjugation is the temporary union of the eg: honey bees
two individuals of the same species. During their b) Thelytoky: In this type only females are
union both individuals, called the conjugants produced by parthenogenesis.eg: Solenobia
exchange certain amount of nuclear material c) Amphitoky: In this type parthenogenetic
(DNA) and then get separated. Conjugation egg may develop into individuals of any sex.
is common among ciliates, e.g. Paramecium, eg: Aphis
Vorticella and bacteria (Prokaryotes).
Natural parthenogenesis may be of
Phases of life cycle: Organisms have three
two types, viz., complete and incomplete.
phases – Juvenile phase, reproductive phase and
Complete parthenogenesis is the only form
senescent phase. Juvenile phase/ vegetative
of reproduction in certain animals and there is
phase is the period of growth between the birth
no biparental sexual reproduction. There are
of the individual upto reproductive maturity. no male organisms and so, such individuals
During reproductive phase/ maturity phase are represented by females only. Incomplete
the organisms reproduce and their offsprings parthenogenesis is found in some animals
reach maturity period. On the basis of time, in which both sexual reproduction and
breeding animals are of two types: seasonal parthenogenesis occurs. e.g. In honeybees;
breeders and continuous breeders. Seasonal fertilized eggs (zygotes) develop into queen
breeders reproduce at particular period of and workers, whereas unfertilized eggs
the year such as frogs, lizards, most birds, develop into drones (male). In paedogenetic
deers etc., Continuous breeders continue to parthenogenesis (paedogenesis) the larvae
breed throughout their sexual maturity e.g. produce a new generation of larvae by
honey bees, poultry, rabbit etc., Senescent parthenogenesis. It occurs in the sporocysts
phase begins at the end of reproductive phase and Redia larvae of liver fluke. It is also seen
when degeneration sets in the structure and in the larvae of some insects. e.g. Gall fly. In
functioning of the body. artificial parthenogenesis, the unfertilized
egg (ovum) is induced to develop into a
complete individual by physical or chemical
stimuli. e.g., Annelid and seaurchin eggs.

www.tntextbooks.in
Summary and conjugation. Parthenogenesis is the

special type of sexual reproduction seen
Reproduction is a process by which the
in animals. It is of two main types namely
living beings propagate or duplicate their
natural parthenogenesis and artificial
own kind. Reproduction can be broadly
parthenogenesis.
classified into asexual reproduction and
sexual reproduction. In asexual reproduction
fusion of gametes are not involved, but in
sexual reproduction the formation and Evaluation
fusion of gametes occur. Different modes of 1. In which type of
asexual reproduction are fission, budding, parthenogenesis are
fragmentation and regeneration. Fission is only males produced?
further divided into binary fission, multiple a) Arrhenotoky
fission, sporulation and strobilation. b) Thelytoky
According to the plane of fission different
c) Amphitoky d) Both a and b
kinds of binary fission have been identified
in different organisms. They are simple 2. The mode of sexual reproduction in
irregular binary fission, transverse binary bacteria is by
fission, longitudinal binary fission and a) Formation of gametes
oblique binary fission. Multiple fission is b) Endospore formation
the division of the parent into many small c) Conjugation
daughter cells simultaneously. Budding is d) Zoospore formation
another mode of asexual reproduction. The
parent body produces one or more buds; each 3. In which mode of reproduction variations
bud grows into a young one and may separate are seen
from the parent to lead a normal life. When a) Asexual b) Parthenogenesis
many buds are formed on the outer surface of c) Sexual d) Both a and b
the parent, it is known as exogenous budding.
4. Assertion and reasoning questions:
Hundreds of buds are formed inside the
cytoplasm and remain within the body of In each of the following questions there
the parent, this process is called endogenous are two statements. One is assertion (A)
budding. Fragmentation is another mode and other is reasoning (R). Mark the
of asexual reproduction. In fragmentation correct answer as
the body of the parent breaks into fragments a. If both A and R are true and R is correct
(pieces). Each fragment has the potential to explanation for A
develop into a new individual. Regeneration b If both A and R are true but R is not the
is the development of the whole body of an correct explanation for A
organism from a small fragment. It is of two
c. If A is true but R is false
types namely restorative regeneration and
reparative regeneration. d. If both A and R are false.
Various modes of sexual reproduction I. Assertion: In bee society, all the
is seen in animals. In syngamy the fusion of members are diploid
two haploid gametes takes place to produce except drones.
a zygote. The following kinds of syngamy Reason: Drones are produced by

is prevalent among the living organism. parthenogenesis.
They are autogamy, exogamy, hologamy, a b c d
paedogamy, merogamy, isogamy, anisogamy

www.tntextbooks.in
II. Assertion: Offsprings produced by 9. The unicellular organisms which

asexual reproduction are genetically reproduce by binary fission are considered
identical to the parent. immortal. Justify.
Reason: Asexual
reproduction 10. Why is the offspring formed by asexual
involves only mitosis and no meiosis. reproduction referred as a clone?
a b c d 11. Give reasons for the following:
(a) Some organisms like honey bees are
5. Name an organism where cell division is
called parthenogenetic animals
itself a mode of reproduction.
(b) A male honey bee has 16 chromosomes
6. Name the phenomenon where the female where as its female has 32 chromosomes.
gamete directly develops into a new 12. Differentiate between the following:
organism with an avian example. (a) External and Internal fertilization
7. What is parthenogenesis? Give two (b) Regeneration in lizard and Planaria
examples from animals 13.
How is juvenile phase different from
reproductive phase?
8. Which type of reproduction is effective -
Asexual or sexual and why? 14. Explain the different kinds of syngamy in
living organisms.

www.tntextbooks.in
Concept Map
Simple irregular fission
Transverse fission
Binary fission
Longitudinal fission
Oblique fission
Multiple fission Repeated fission
Sporulation
Fission
Strobilation
Plasmotomy
Exogenous budding
Budding
Asexual Endogenous budding Gemmule
Fragmentation
Morphallaxis
Regeneration Reparative
Epimorphosis
Restorative
External fertilization
Internal fertilization
Syngamy
Autogamy
Reproduction Sexual
Conjugation
Exogamy
Hologamy
Paedogamy
Merogamy
Isogamy
Anisogamy
Natural
Complete parthenogenesis
Parthenogenesis Artificial
Incomplete parthenogenesis
Paedogenesis

www.tntextbooks.in
2
UNIT - I
Human
Reproduction
CHAPTER
In every child who is born, the potentiality of

Chapter Outline the human race is born again
- James Agee
2.1 Human reproductive system
2.2 Gametogenesis
2.3 Menstrual cycle
2.4 Menstrual disorders and menstrual E very organ system in the human
body works continuously to maintain
homeostasis for the survival of the individual.
hygiene
The human reproductive system is essential for
2.5 Fertilization and implantation
the survival of the species. An individual may
2.6 Maintenance of pregnancy and
live a long healthy life without producing an
embryonic development
offspring, but reproduction is inevitable for the
2.7 Parturition and lactation existence of a species.
The reproductive system has four
Learning Objectives main functions namely,
• to produce the gametes namely

➢ Creates an awareness towards a
sperms and ova
healthy reproductive life in adolescents.
• to transport and sustain these gametes
➢ Understands the structure of the male
and female reproductive systems. • to nurture the developing offspring
➢ Explains the functions of • to produce hormones
the structures associated
The major reproductive events in human
with the male and female
beings are as follows:
reproductive system.
➢ Compares the process • Gametogenesis: Formation of gametes by
of spermatogenesis and spermatogenesis and oogenesis.
oogenesis. • Insemination: Transfer of sperms by the
➢ Discusses the changes in a female body male into the female genital tract.
during and after Fertilization. • Fertilization: Fusion of male and
➢ Appraises the role of hormones in the female gametes to form zygote, called
process of reproduction. Fertilization.
➢ Understands the events in pregnancy • Cleavage: Rapid mitotic divisions of
and foetal development. the zygote which convert the single celled
11

www.tntextbooks.in
zygote into a multicellular structure 2.1 Human reproductive system

called blastocyst. The male reproductive system comprises
• Implantation: Attachment of blastocyst of a pair of testes, accessory ducts, glands and
to the uterine wall. external genitalia (Fig. 2.1).
• Placentation: Formation of placenta Testes are the primary male sex organs.
which is the intimate connection between They are a pair of ovoid bodies lying in the
foetus and uterine wall of the mother for scrotum (Fig.2.2 a). The scrotum is a sac of
exchange of nutrients. skin that hangs outside the abdominal cavity.
• Gastrulation: Process by which Since viable sperms cannot be produced
blastocyst is changed into a gastrula with at normal body temperature, the scrotum
three primary germ layers is placed outside the abdominal cavity to
• Organogenesis: Formation of specific provide a temperature 2-3oC lower than the
tissues, organs and organ systems from normal internal body temperature. Thus,
three germ layers. the scrotum acts as a thermoregulator for
spermatogenesis.
• Parturition: Expulsion of the foetus from
the mother’s womb. Each testis is covered by an outermost
fibrous tunica albuginea and is divided
These functions are carried out by the
by septa into about 200 - 250 lobules each
primary and accessory reproductive organs.
containing 2-4 highly coiled testicular
The primary reproductive organs namely
tubules or seminiferous tubules. These highly
the ovary and testis are responsible for
convoluted tubules which form 80 percent of
producing the ova and sperms respectively.
the testicular substance are the sites for sperm
Hormones secreted by the pituitary gland and
production.
the gonads help in the development of the
secondary sexual characteristics, maturation The stratified epithelium of the seminiferous
of the reproductive system and regulation tubule is made of two types of cells namely sertoli
of normal functioning of the reproductive cells or nurse cells and spermatogonic cells
system. The accessory organs help in or male germ cells. Sertoli cells are elongated
transport and to sustain the gametes and to and pyramidal and provide nourishment to
nurture the developing offspring. the sperms till maturation. They also secrete
inhibin, a hormone which
is involved in the negative
feedback control of sperm
production. Spermatogonic
8ULQDU\ 8UHWHU cells divide meiotically and
EODGGHU
5HFWXP differentiate to produce
9DV
GHIHUHQV 6HPLQDOYHVLFOH spermatozoa.
3HQLV (MDFXODWRU\GXFW Interstitial cells or
8UHWKUD 3URVWDWHJODQG Leydig cells are embedded
(SLGLG\PLV $QXV in the soft connective
*ODQVSHQLV %XOERXUHWKUDO tissue surrounding the
7HVWLV JODQG
seminiferous tubules. These
6FURWXP cells are endocrine in nature
and are characteristic
Fig. 2.1 Male reproductive system
Human Reproduction 12

www.tntextbooks.in
CRYPTORCHISM The failure of one or both testes to descend down into the scrotal sacs is
known as cryptorchism (crypto – hidden + orchis – testicle). It occurs in 1 – 3 percent of new
born males. A surgical correction at a young age can rectify the defect, else these individuals
may become sterile and are unable to produce viable sperms.
features of the testes of mammals. It secretes bulbourethral glands also called Cowper’s
androgens namely the testosterone hormone gland and a single prostate gland. The seminal
which initiates the process of spermatogenesis. vesicles secrete an alkaline fluid called seminal
Other immunologically competent cells are plasma containing fructose sugar, ascorbic acid,
also present. prostaglandins and a coagulating enzyme called
The accessory ducts associated
with the male reproductive system Ureter
include rete testis, vasa efferentia,

Urinary bladder
epididymis and vas deferens
(Fig. 2.2 b). The seminiferous Seminal vesicle
tubules of each lobule converge to
Prostate gland
form a tubulus rectus that conveys Bulbourethral
the sperms into the rete testis. The gland
rete testis is a tubular network on Vas deferens
the posterior side of the testis. The Epididymis
sperms leave the rete testis and enter Glans penis
the epididymis through the vasa Scrotum
efferentia. The epididymis is a single
Testis
highly coiled tube that temporarily
stores the spermatozoa and they Fig. 2.2 (a) Diagrammatic view of
the male reproductive system
undergo physiological maturation
and acquire increased motility and
fertilizing capacity. The epididymis
leads to the vas deferens and joins
the duct of the seminal vesicle to
form the ejaculatory duct which Blood vessels
passes through the prostate and and nerves
opens into the urethra. The urethra Vas deferens
is the terminal portion of the male
Epididymis
reproductive system and is used to
convey both urine and semen at Vasa efferentia
Rete testis
different times. It originates from the
Tunica albuginea
urinary bladder and extends through Tubulus rectus
the penis by an external opening Seminiferous tubule
called urethral meatus.
The accessory glands of the
male reproductive system include
Fig. 2.2 (b) Testis showing
the paired seminal vesicles and
inner details
13 Human Reproduction

www.tntextbooks.in
vesiculase which enhances sperm motility. The region (Fig. 2.3 a). These parts along with the
bulbourethral glands are inferior to the prostate mammary glands are integrated structurally and
and their secretions also help in the lubrication of functionally to support the process of ovulation,
the penis. The prostate encircles the urethra and Fertilization, pregnancy, child birth and child
is just below the urinary bladder and secretes a care.
slightly acidic fluid that contains citrate, several Ovaries are the primary female sex organs
enzymes and prostate specific antigens. Semen that produce the female gamete, ovum. The
or seminal fluid is a milky white fluid which ovaries are located one on each side of the lower
contains sperms and the seminal plasma (secreted abdomen. The ovary is an elliptical structure
from the seminal vesicles, prostate gland and the about 2-4 cm long. Each ovary is covered by a
bulbourethal glands). The seminal fluid acts as a thin cuboidal epithelium called the germinal
transport medium, provides nutrients, contains epithelium which encloses the ovarian stroma.
chemicals that protect and activate the sperms The stroma is differentiated as the outer cortex and
and also facilitate their movement. inner medulla. Below the germinal epithelium is
The penis is the male external genitalia a dense connective tissue, the tunica albuginea.
functioning as a copulatory organ. It is made The cortex appears dense and granular due
of a special tissue that helps in the erection of to the presence of ovarian follicles in various
penis to facilitate insemination. The enlarged stages of development. The medulla is a
end of the penis called glans penis is covered loose connective tissue with abundant blood
by a loose fold of skin called foreskin or vessels, lymphatic vessels and nerve fibres.
prepuce. The ovary remains attached to the pelvic
The female reproductive system is far more wall and the uterus by an ovarian ligament
complex than the male because in addition called mesovarium.
to gamete formation, it has to nurture the The fallopian tubes (uterine tubes or
developing foetus. The female reproductive oviducts), uterus and vagina constitute the
system consists of a pair of ovaries along with female accessory organs (Fig. 2.3 b). Each
a pair of oviducts, uterus, cervix, vagina and fallopian tube extends from the periphery
the external genitalia located in the pelvic of each ovary to the uterus. The proximal
part of the fallopian tube bears a
funnel shaped infundibulum. The
8WHULQH
WXEH edges of the infundibulum have
2YDU\ many finger like projections called
)LPEULDH
fimbriae which help in collection
8WHUXV &HUYL[
of the ovum after ovulation.
8ULQDU\ 5HFWXP
EODGGHU
8UHWKUD 9DJLQD
&OLWRULV Female
/DELXP $QXV
PLQRUD uterus
/DELXP contains
PDMRUD one of the
Fig. 2.3 (a) Female pelvis showing reproductive system strongest muscles of the
human body.

www.tntextbooks.in
8WHUXV
minora, hymen and
,VWKPXV clitoris.
$PSXOOD The Bartholin’s glands
)DOORSLDQ
WXEH
,QIXQGLEXOXP (also called greater
)LPEULDH vestibular glands) are
(QGRPHWULXP 2YDU\ located posterior to
0\RPHWULXP
3HULPHWULXP
&HUYL[ the left and right of the
&HUYLFDOFDQDO opening of the vagina.
9DJLQD They secrete mucus to
lubricate the vagina and
Fig. 2.3 (b) Diagrammatic view of female reproductive system are homologous to the
bulbourethral glands of
The infundibulum leads to a wider central the male. The Skene’s glands are located on
portion called ampulla. The last part of the the anterior wall of the vagina and around
oviduct is the isthmus which is short and the lower end of the urethra. They secrete a
thick walled connecting the ampulla and lubricating fluid and are homologous to the
infundibulum to the uterus. prostate gland of the males.
The uterus or womb is a hollow, thick-walled, The external opening of the vagina is partially
muscular, highly vascular and inverted pear closed by a thin ring of tissue called the hymen.
shaped structure lying in the pelvic cavity The hymen is often torn during the first coitus
between the urinary bladder and rectum. The (physical union). However in some women it
major portion of the uterus is the body and the remains intact. It can be stretched or torn due to
rounded region superior to it, is the fundus. The a sudden fall or jolt and also during strenuous
uterus opens into the vagina through a narrow physical activities such as cycling, horseback
cervix. The cavity of the cervix called the riding, etc., and therefore cannot be considered
cervical canal communicates with the vagina as an indicator of a woman’s virginity.
through the external orifice and with the uterus The mammary glands are modified sweat
through the internal orifice. The cervical canal glands present in both sexes. It is rudimentary
along with vagina forms the birth canal. in the males and functional in the females. A
The wall of the uterus has three layers of pair of mammary glands is located in the
tissues. The outermost thin membranous thoracic region. It contains glandular tissue
serous layer called the perimetrium, and variable quantities of fat with a median
the middle thick muscular layer called nipple surrounded by a pigmented area called
myometrium and the inner glandular layer the areola. Several sebaceous glands called
called endometrium. The endometrium the areolar glands are found on the surface
undergoes cyclic changes during the and they reduce cracking of the skin of the
menstrual cycle while myometrium exhibits nipple. Internally each mammary gland
strong contractions during parturition. consists of 2-25 lobes, separated by fat and
Vagina is a large fibromuscular tube that connective tissues (Fig. 2.4). Each lobe is made
extends from the cervix to the exterior. It is up of lobules which contain acini or alveoli
the female organ of copulation. The female lined by epithelial cells. Cells of the alveoli
reproductive structures that lie external to secrete milk. The alveoli open into mammary
the vagina are called as the external genitalia tubules. The tubules of each lobe join to form
or vulva comprising of labia majora, labia a mammary duct. Several mammary ducts

www.tntextbooks.in
2.2 Gametogenesis
Gametogenesis is the process of formation
of gametes i.e., sperms and ovum from the
6XVSHQVRU\
OLJDPHQW
primary sex organs in all sexually reproducing
$GLSRVHWLVVXH organisms. Meiosis plays the most significant
/REH
role in the process of gametogenesis (Fig.2.5).
$UHROD
1LSSOH
Spermatogenesis
/DFWLIHURXVGXFW
0DPPDU\DPSXOOD
Spermatogenesis is the sequence of
0DPPDU\GXFW events in the seminiferous tubules of the
/REXOHFRQWDLQLQJ testes that produce the male gametes, the
DOYHROL
0DPPDU\WXEXOHV sperms. During development, the primordial
germ cells migrate into the testes and become
immature germ cells called sperm mother
Fig. 2.4 Mammary gland cells or spermatogonia in the inner surfaces
of the seminiferous tubules (Fig. 2.6 a). The
join to form a wider mammary ampulla spermatogonia begin to undergo mitotic
which is connected to the lactiferous duct in division at puberty and continue throughout
the nipple. Under the nipple, each lactiferous life.
duct expands to form the lactiferous sinus In the first stage of spermatogenesis, the
which serves as a reservoir of milk. Each spermatogonia migrate among sertoli cells
lactiferous duct opens separately by a minute towards the central lumen of the seminiferous
pore on the surface of the nipple. tubule and become modified and enlarged
Normal development of the breast to form primary spermatocytes which are
begins at puberty and progresses with diploid with 23 pairs i.e., 46 chromosomes.
changes during each
6SHUPDWRJHQHVLV 2RJHQHVLV
menstrual cycle. In non-
pregnant women, the
6SHUPDWRJRQLD Q )RHWDO Q 2RJRQLD
glandular structure is OLIH
largely underdeveloped 0LWRWLFGLYLVLRQ 0LWRWLFGLYLVLRQ
and the breast size is 3ULPDU\ Q 3ULPDU\RRF\WH

largely due to amount VSHUPDWRF\WH Q
of fat deposits. The size 0HLRVLV,

0HLRVLV,FRPSOHWHG
of the breast does not 6HFRQGDU\ )LUVW
Q
SULRUWRRYXODWLRQ
VSHUPDWRF\WH Q Q SRODU
have an influence on the ERG\ Q
6HFRQGDU\RRF\WH
efficiency of lactation. 0HLRVLV,,

$GXOW
XOW
6SHUPDWLG Q Q Q Q UHSURGXFWLYH
OLIH
6SHUPLRJHQHVLV &RPSOHWLRQ
6HFRQG RIPHLRVLV,,
SRODU
6SHUPDWR]RD Q Q Q Q Q
ERG\
Q 2YXP
Fig. 2.5 Gametogenesis

www.tntextbooks.in
Spermatid
Spermatogonia
Sertoli cells
Interstitial cell
Fig. 2.6 (a) Cross sectional view of seminiferous tubule
Some of the primary spermatocytes

undergo first meiotic division to form two
secondary spermatocytes which are haploid
with 23 chromosomes each. The secondary
spermatocytes undergo second meiotic
division to produce four haploid spermatids.
The spermatids are transformed into mature
spermatozoa (sperms) by the process Fig. 2.6 (b) Seminiferous
called spermiogenesis. Sperms are finally tubules (Enlarged)
released into the cavity of seminiferous
Structure of human spermatozoan
tubules by a process called spermiation.
The human sperm is a microscopic,
The whole process of spermatogenesis
flagellated and motile gamete (Fig. 2.7).
takes about 64 days. At any given time,
The whole body of the sperm is enveloped
different regions of the seminiferous tubules
by plasma membrane and is composed of a
contain spermatocytes in different stages
head, neck, middle piece and a tail. The head
of development (Fig. 2.6 b). The sperm
comprises of two parts namely acrosome and
production remains nearly constant at a rate
nucleus. Acrosome is a small cap like pointed
of about 200 million sperms per day.
structure present at the tip of the nucleus
Spermatogenesis starts at the age of and is formed mainly from the Golgi body
puberty and is initiated due to the increase of the spermatid. It contains hyaluronidase,
in the release of Gonadotropin Releasing a proteolytic enzyme, popularly known as
Hormone (GnRH) by the hypothalamus. sperm lysin which helps to penetrate the
GnRH acts on the anterior pituitary gland and ovum during Fertilization. The nucleus is flat
stimulates the secretion of two gonadotropins and oval. The neck is very short and is present
namely Follicle Stimulating Hormone between the head and the middle piece.
(FSH) and Lutenizing Hormone (LH). FSH It contains the proximal centriole towards
stimulates testicular growth and enhances the the nucleus which plays a role in the first
production of Androgen Binding Protein division of the zygote and the distal centriole
(ABP) by the sertoli cells and helps in the gives rise to the axial filament of the sperm.
process of spermiogenesis. LH acts on the The middle piece possesses mitochondria
Leydig cells and stimulates the synthesis of spirally twisted around the axial filament
testosterone which in turn stimulates the called mitochondrial spiral or nebenkern.
process of spermatogenesis. It produces energy in the form of ATP
molecules for the movement of sperms. The

www.tntextbooks.in
tail is the longest part

Out of the million eggs
of the sperm and is Acrosome
women possess during
slender and tapering. Head
Nucleus birth, only about 300 to
It is formed of a
400 will ovulate before
central axial filament Neck menopause.
or axoneme and an
outer protoplasmic Mitochondria On the other hand, males produce more
sheath. The lashing
Middle
piece
than 500 billion sperms in their life time.
movements of the
The primary follicle gets surrounded
tail push the sperm
forward. The human by many layers of granulosa cells and a new
Tail
male ejaculates about theca layer to form the secondary follicle. A

200 to 300 million fluid filled space, the antrum develops in the
sperms during coitus. follicle and gets transformed into a tertiary
It is estimated that follicle. The theca layer gets organized into an
around 60 percent inner theca interna and an outer theca externa.
of sperms must have At this time, the primary oocyte within the
normal shape of which Fig. 2.7 Structure of tertiary follicle grows in size and completes its
at least 40 per cent human sperm first meiotic division and forms the secondary
must show vigorous oocyte. It is an unequal division resulting in
motility for normal fertility. the formation of a large haploid secondary
oocyte and a first polar body. The first polar
body disintegrates. During Fertilization, the
The sperm is the smallest
secondary oocyte undergoes second meiotic
human cell and the
division and produces a large cell, the ovum
ovum or egg is the largest
and a second polar body. The second polar body
human cell.
also degenerates. The tertiary follicle eventually
becomes a mature follicle or Graafian follicle.
Oogenesis
If Fertilization does not take place, second
Oogenesis is the process of development
meiotic division is never completed and the
of the female gamete or ovum or egg in the
egg disintegrates. At the end of gametogenesis
ovaries. During foetal development, certain
in females, each primary oocyte gives rise to
cells in the germinal epithelium of the foetal
only one haploid ovum.
ovary divide by mitosis and produce millions of
egg mother cells or oogonia. No more oogonia Structure of ovum
are formed or added after birth. The oogonial Human ovum is non-cleidoic, alecithal
cells start dividing and enter into Prophase I of and microscopic in nature. (Fig. 2.8 (b)). Its
meiotic division I to form the primary oocytes cytoplasm called ooplasm contains a large
which are temporarily arrested at this stage. nucleus called the germinal vesicle. The ovum
The primary oocytes then get surrounded by is surrounded by three coverings namely an
a single layer of granulosa cells to form the inner thin transparent vitelline membrane,
primordial or primary follicles (Fig. 2.8 a). middle thick zona pellucida and outer thick
A large number of follicles degenerate during the coat of follicular cells called corona radiata.
period from birth to puberty, so at puberty only Between the vitelline membrane and zona
60,000 to 80,000 follicles are left in each ovary. pellucida is a narrow perivitelline space.

www.tntextbooks.in
7HUWLDU\ 6HFRQGDU\ 3ULPDU\ 3ULPRUGLDO %ORRG

IROOLFOH IROOLFOH IROOLFOH IROOLFOHV YHVVHOV
&RURQDUDGLDWD
=RQD3HOOXFLGD
9LWHOOLQH
PHPEUDQH
&RUSXV 1XFOHXV
DOELFDQV *HUPLQDOYHVLFOH
2RSODVP
&RUSXV
OXWHXP
0DWXUH 6HFRQGDU\
JUDDILDQ RFF\WH
IROOLFOH Fig. 2.8 (b) Diagrammatic view of the
human ovum
Fig. 2.8 (a) Sectional view of the ovary
2.3 Menstrual cycle 2. Follicular or proliferative phase

The menstrual or ovarian cycle occurs The follicular phase extends from the 5th
approximately once in every 28/29 days day of the cycle until the time of ovulation.
during the reproductive life of the female from During this phase, the primary follicle in the
menarche (puberty) to menopause except ovary grows to become a fully mature Graafian
during pregnancy. The cycle of events starting follicle and simultaneously, the endometrium
from one menstrual period till the next one is regenerates through proliferation. These changes
called the menstrual cycle during which cyclic in the ovary and the uterus are induced by the
changes occurs in the endometrium every secretion of gonadotropins like FSH and LH,
month. Cyclic menstruation is an indicator of which increase gradually during the follicular
normal reproductive phase (Fig. 2.9). phase. It stimulates follicular development and
Menstrual cycle comprises of the following secretion of oestrogen by the follicle cells.
phases 3. Ovulatory phase
1. Menstrual phase Both LH and FSH attain peak level in
2. Follicular or proliferative phase the middle of the cycle (about the 14th day).
3. Ovulatory phase Maximum secretion of LH during the mid
4. Luteal or secretory phase cycle called LH surge induces the rupture of
the Graafian follicle and the release of the ovum
1. Menstrual phase (secondary oocyte) from the ovary wall into
The cycle starts with the menstrual phase the peritoneal cavity. This process is called
when menstrual flow occurs and lasts for 3-5 as ovulation.
days. Menstrual flow is due to the breakdown of 4. Luteal or secretory phase
endometrial lining of the uterus, and its blood During luteal phase, the remaining part
vessels due to decline in the level of progesterone of the Graafian follicle is transformed into
and oestrogen. Menstruation occurs only if the a transitory endocrine gland called corpus
released ovum is not fertilized. Absence of luteum. The corpus luteum secretes large
menstruation may be an indicator of pregnancy. amount of progesterone which is essential
However it could also be due to stress, hormonal for the maintenance of the endometrium.
disorder and anaemia. If Fertilization takes place, it paves way for

www.tntextbooks.in
(a) FSH and LH secreted by the anterior pituitary

14th day LH Surge triggers ovulation
Lutenizing hormone(LH)
Follicle stimulating hormone(FSH)
(b) Events in the ovary

Single mature Ovulation Corpus Corpus
follicle luteum albicans
Several follicles start developing
Follicular phase Luteal phase
(c) Ovarian hormones
Progesterone
Oestrogen
(c) Events in the endometrium of the uterus Highly proliferated and vascularized endometrium
Bleeding and sloughing

Thickness of the
(menstruation)
endometrium
Days 1 3 5 7 9 11 13 17 19 21 23 25 27 28
Menstrual phase Follicular phase Luteal phase
Fig. 2.9 Different phases of the menstrual cycle

the implantation of the fertilized ovum. The In the absence of Fertilization, the corpus
uterine wall secretes nutritious fluid in the luteum degenerates completely and leaves a scar
uterus for the foetus. So, this phase is also tissue called corpus albicans. It also initiates
called as secretory phase. During pregnancy the disintegration of the endometrium leading
all events of menstrual cycle stop and there is to menstruation, marking the next cycle.
no menstruation.
POLY CYSTIC OVARY SYNDROME (PCOS)

PCOS is a complex endocrine system disorder that affects women in their reproductive
years. Polycystic means ‘many cysts’. It refers to many partially formed follicles on the ovaries,
which contain an egg each. But they do not grow to maturity or produce eggs that can be
fertilized. Women with PCOS may experience irregular menstrual cycles, increased androgen
levels, excessive facial or body hair growth (hirsutism), acne, obesity, reduced fertility and
increased risk of diabetes. Treatment for PCOS includes a healthy lifestyle, weight loss and
targeted hormone therapy.

www.tntextbooks.in
2.4 Menstrual disorders and productivity of women. The impact of

Absence of menstruation is called poor menstrual hygiene on girls is increased
amenorrhoea. If menarche does not stress levels, fear and embarrassment during
appear till the age of 18, it is called primary menstruation. This can keep girls inactive
amenorrhoea. Absence of menstruation for during such periods leading to absenteeism
over three consecutive months is secondary from school.
amenorrhoea. Clean and safe absorbable clothing
Polymenorrhoea is a term used to materials, sanitary napkins, pads, tampons
describe a menstrual cycle that is shorter than and menstrual cups have been identified
21 days. It may be due to hyperactivity of the as materials used to manage menstruation.
anterior pituitary gland causing frequent Changing sanitary material 4-5 hours as per
ovulation, psychological disturbances and the requirement, provides comfort, cleanliness
malnutrition. Chronic pelvic inflammation by and protection from infections. It also helps in
certain sexually transmitted diseases (STD) enhancing the quality of life of women during
such as chlamydiasis or gonorrhoea can this period. Used sanitary napkins should be
cause inflammation in the uterus causing wrapped in paper and disposed. It should not
polymenorrhoea. be thrown in open areas or drain pipe of toilets.
Flushing of sanitary napkins in the drain pipes
Pain associated with menstruation is called
causes choking of the drainage line leading to
dysmenorrhoea. It is the most commonly
water pollution.
reported menstrual disorder. There are two types
of dysmenorrhoea viz primary and secondary
dysmenorrhoea. Primary dysmenorrhoea is Disposal of Napkins
pain or cramps during menstrual period and The ecofriendly way to dispose
is caused by secretions of prostaglandin in the menstrual waste scientifically and
uterus. Secondary dysmenorrhoea is caused hygienically is to destroy the sanitary
by a disorder in the reproductive system like napkins using incinerators. Measures are
endometriosis or uterine fibroids. being taken to install incinerators and
Heavy and prolonged menstrual period napkin vending machines in washrooms
that disrupts a woman’s normal activities is of schools , colleges and public facilities.
referred to as menorrhagia. Menorrhagia
may be due to hormonal imbalance, ovarian Menopause
dysfunction, uterine fibroids and may also be Menopause is the phase in a women’s
due to cancer of the ovary, uterus or cervix. life when ovulation and menstruation stops.
Oligomenorrhoea is a condition with The average age of menopause is 45-50 years.
infrequent menstrual periods. It occurs in It indicates the permanent cessation of the
women of childbearing age. Some variation primary functions of the ovaries.
in menstruation is normal, but a woman
who regularly goes more than 35 days 2.5 Fertilization and implantation
without menstruating may be diagnosed with Fertilization occurs when a haploid sperm
oligomenorrhoea. fuses with a haploid ovum to form a fertilized
Menstrual hygiene egg or diploid zygote.
Menstrual hygiene is vital for good The sperms deposited in the female
health, well-being, dignity, empowerment reproductive tract undergo capacitation, which

www.tntextbooks.in
is a biochemical event that enables the sperm cluster of 16 or more cells called the morula
to penetrate and fertilise the egg. Fertilization (Fig. 2.11).
occurs only if the ovum and sperms are Under the influence of progesterone,
transported simultaneously to the ampullary smooth muscles of the fallopian tube relax
isthmic junction of the fallopian tube. and the dividing embryo takes 4-5 days to
Before a sperm can enter the egg, move through the fallopian tube into the
it must penetrate the multiple layers of uterine cavity and finally gets implanted in
granulosa (follicular) cells which are around the uterine wall. At this point the embryo
the ovum forming the corona radiata (Fig. consists of a fluid filled hollow ball of about
2.10). The follicular cells are held together 100 cells, called the blastocyst. The blastocyst
by an adhesive cementing substance called is composed of a single layer of large flattened
hyaluronic acid. The acrosomal membrane cells called trophoblast and a small cluster
disintegrates releasing the proteolytic enzyme, of 20-30 rounded cells called the inner cell
hyaluronidase during sperm entry through mass. The inner cell mass of the blastocyst
the corona radiata and zona pellucida. This is develops into the embryo and becomes
called acrosomal reaction. Once Fertilization embedded in the endometrium of the uterus.
is accomplished, cortical granules from the This process is called implantation and it
cytoplasm of the ovum form a barrier called results in pregnancy.
the Fertilization membrane around the ovum If the fertilized ovum is implanted outside
preventing further penetration of other sperms. the uterus it results in ectopic pregnancy.
Thus polyspermy is prevented. About 95 percent of ectopic pregnancies
The first cleavage produces two identical occur in the fallopian tube. The growth of
cells called blastomeres. These produce 4 cells, the embryo may cause internal bleeding,
then 8 and so on. After 72 hours of Fertilization, infection and in some cases even death due to
a loose collection of cells forms a berry shaped rupture of the fallopian tube.

7KHQXFOHXVDQGRWKHU &RUWLFDOJUDQXOHVIRUPDEDUULHU
FRPSRQHQWVRIWKHVSHUP FDOOHGIHUWLOL]DWLRQPHPEUDQH
HQWHUWKHHJJ ZKLFKQRZIXQFWLRQVDVDEORFN
WRSRO\VSHUP\

%UHDNGRZQRIWKH]RQD
SHOOXFLGDE\WKHVHHQ]\PHV
DOORZVWKHVSHUPWRUHDFK
WKHSODVPDPHPEUDQHRIWKH
HJJ

7KLVELQGLQJLQGXFHVWKH )ROOLFOHFHOOV
DFURVRPHUHDFWLRQLQZKLFKWKH &RUWLFDO
VSHUPUHOHDVHVK\DOXURQLGDVH 6SHUP JUDQXOH
LQWRWKH]RQDSHOOXFLGD QXFOHXV
=RQDSHOOXFLGD
7KHVSHUPPLJUDWHVWKURXJK
WKHFRDWRIIROOLFOHFHOOVDQGELQGV (JJSODVPD
WRUHFHSWRUPROHFXOHVLQWKH]RQD
PHPEUDQH
SHOOXFLGDRIWKHHJJ
$FURVRPH (JJ
F\WRSODVP
Fig. 2.10 Events of Fertilization


www.tntextbooks.in
D=\JRWH
IHUWLOL]HGHJJ
EFHOOVWDJH F0RUXOD G(DUO\EODVWRF\VW
to specific tissues, organs and organ systems
during organogenesis.
The extra embryonic membranes namely
)HUWLOL]DWLRQ
the amnion, yolk sac, allantois and chorion
2RF\WHHJJ protect the embryo from dessication, mechanical
shock and help in the absorption of nutrients
HLPSODQWHG
EODVWRF\VW
and exchange of gases (Fig. 2.12). The amnion
is a double layered translucent membrane filled
with the amniotic fluid. It provides a buoyant
environment to protect the developing embryo
Fig. 2.11 From zygote to blastocyst : passage from injury, regulates the temperature of the
of growing embryo through the foetus and provides a medium in which the
fallopian tube foetus can move. The yolk sac forms a part of
the gut and is the source of the earliest blood
Twins are two offsprings produced in the cells and blood vessels.
same pregnancy. 3ODFHQWDO
YLOOL 3ODFHQWD
➢
Monozygotic (Identical) twins are
produced when a single fertilized $OODQWRLV
egg splits into two during the first 8PELOLFDO

FRUG
)DOORSLDQ
cleavage. They are of the same sex, WXEH
8WHUXV
look alike and share the same genes. )RHWXV
&KRULRQ
$PQLRWLF
➢
Dizygotic (Fraternal) twins are IOXLG $PQLRQ
produced when two separate eggs

are fertilized by two separate sperms.
The twins may be of the same sex or
different sex and are non-identical. Fig. 2.12 Human foetus within the uterus
➢
Siamese (United) twins are the
conjoined twins who are joined The allantois forms a small out pocketing
during birth. of embryonic tissue at the caudal end of the yolk
sac. It is the structural base for the umbilical
cord that links the embryo to the placenta and
2.6 Maintenance of pregnancy ultimately it becomes part of the urinary bladder.
and embryonic development The chorion is the outermost membrane which
The inner cell mass in the blastula is encloses the embryo and all other membranes
differentiated into epiblast and hypoblast and also helps in the formation of the placenta.
immediately after implantation. The hypoblast The trophoblast cells in the blastocyst
is the embryonic endoderm and the epiblast send out several finger like projections called
is the ectoderm. The cells remaining in chorionic villi carrying foetal blood and are
between the epiblast and the endoderm form surrounded by sinuses that contain maternal
the mesoderm. Thus the transformation of the blood. The chorionic villi and the uterine
blastocyst into a gastrula with the primary germ tissues form the disc-shaped placenta. Placenta
layers by the movement of the blastomeres is is a temporary endocrine organ formed during
called gastrulation. Each germ layer gives rise pregnancy and it connects the foetus to the

www.tntextbooks.in
uterine wall through the umbilical cord. It is hCG, hPL and relaxin are produced only during
the organ by which the nutritive, respiratory pregnancy. In addition, during pregnancy the
and excretory functions are fulfilled. The level of other hormones like oestrogen and
embryo’s heart develops during the fourth week progesterone, cortisol, prolactin, thyroxine, etc.,
of pregnancy and circulates blood through the is increased several folds in the maternal blood.
umbilical cord and placenta as well as through These hormones are essential for supporting
its own tissues. foetal growth.
The primary germ layers serve as the
primitive tissues from which all body organs A female uterus is
develop. The ectoderm gives rise to the central normally about 3 inches
nervous system (brain and spinal cord),
long and 2 inches wide
peripheral nervous system, epidermis and
but can expand 20 times
its derivatives and mammary glands. The
during pregnancy.
connective tissue, cartilage and bone, muscles,
organs of urinogenital system (kidney, ureter
and gonads) arise from the mesoderm. The 2.7 Parturition and lactation
endodermal derivatives are epithelium of Parturition is the completion of pregnancy
gastrointestinal and respiratory tract, liver, and giving birth to the baby. The series of
pancreas, thyroid and parathyroids. events that expels the infant from the uterus
Human pregnancy lasts for about 280 is collectively called “labour”. Throughout
days or 40 weeks and is called the gestation pregnancy the uterus undergoes periodic
period. It can be divided for convenience into episodes of weak and strong contractions.
three trimesters of three months each. The first These contractions called Braxton-Hick’s
trimester is the main period of organogenesis, contractions lead to false labour. As the
the body organs namely the heart, limbs, pregnancy progresses, increase in the oestrogen
lungs, liver and external genital organs are well concentration promotes uterine contractions.
developed. By the end of the second trimester, These uterine contractions facilitate moulding
the face is well formed with features, eyelids and of the foetus and downward movement of
eyelashes, eyes blink, body is covered with fine the foetus. The descent of the foetus causes
hair, muscle tissue develops and bones become dilation of cervix of the uterus and vaginal
harder. The foetus is fully developed and is canal resulting in a neurohumoral reflex called
ready for delivery by the end of nine months Foetal ejection reflex or Ferguson reflex. This
(third trimester). initiates the secretion of oxytocin from the
During pregnancy, the placenta acts as neurohypophysis which in turn brings about
a temporary endocrine gland and produces the powerful contraction of the uterine muscles
large quantities of human Chorionic and leads to the expulsion of the baby through
Gonadotropin (hCG), human Chorionic the birth canal. This sequence of events is called
Somatomammotropin (hCS) or human as parturition or childbirth.
Placental Lactogen (hPL), oestrogens and Relaxin is a hormone secreted by the
progesterone which are essential for a normal placenta and also found in the corpus luteum.
pregnancy. A hormone called relaxin is also It promotes parturition by relaxing the pelvic
secreted during the later phase of pregnancy joints and by dilatation of the cervix with
which helps in relaxation of the pelvic ligaments continued powerful contractions. The amnion
at the time of parturition. It should be noted that ruptures and the amniotic fluid flows out

www.tntextbooks.in
STAGES OF
FOETAL DEVELOPMENT
20 Weeks
Length of foetus increases
Hair on the head and
eyebrows. Skin becomes
covered with
16 Weeks sebaceous gland 24 Weeks
Lower limbs reach final Lungs are well developed
development. Rapid eye movements
Movements are seen begin. Foetus starts
gaining weight
12 Weeks 28 Weeks
Eyes and ears are well Immune system starts
defined. Ossification of developing. Central
long bones are seen nervous system
Urine formation begins developed. Retina is
well developed
8 Weeks 32 Weeks
Limbs and digits fully formed. Body weight increases
Movements start taking rapidly. Skin is smooth
place. Neck appears between due to deposition of
head and thorax. External genitalia subcutaneous fat
show sex differences
4 Weeks 36 Weeks
Formation of foregut, midgut and Blood vessels are
hindgut. Heart starts functioning. completely developed.
Forebrain is most prominent. Baby is positioned into
Upper limbs appears as the pelvis in head
paddle-shaped buds down position
40 Weeks
Baby is fully formed.
Ready to be born
any day

www.tntextbooks.in
CAESAREAN When normal vaginal delivery is not possible due to factors like position of
the baby and nature of the placenta, the baby is delivered through a surgical incision in the
woman’s abdomen and uterus. It is also termed as abdominal delivery or Caesarean Section or
‘C’ Section.
through the vagina, followed by the foetus. The Colostrum is also rich in IgA antibodies. This
placenta along with the remains of the umbilical helps to protect the infant’s digestive tract
cord called “after birth” is expelled out after against bacterial infection. Breast milk is the
delivery. ideal food for infants as it contains all the
Lactation is the production of milk by constituents in suitable concentration and is
mammary glands. The mammary glands show easily digestible. It is fully sufficient till about
changes during every menstrual cycle, during 6 months of age and all infants must be breast
pregnancy and lactation. Increased level of fed by the mother to ensure the growth of a
oestrogens, progesterone and human Placental healthy baby.
Lactogen (hPL) towards the end of pregnancy
stimulate the hypothalamus towards prolactin Summary
– releasing factors. The anterior pituitary Reproduction is a process which helps in
responds by secreting prolactin which plays a the continuity and maintenance of a species.
major role in lactogenesis. Human beings are sexually reproducing and
viviparous. The reproductive events include
Oxytocin causes the “Let-Down” reflex-
gametogenesis, insemination, Fertilization,
the actual ejection of milk from the alveoli
cleavage, implantation, placentation,
of the mammary glands. During lactation,
gastrulation, organogenesis and parturition.
oxytocin also stimulates the recently emptied
uterus to contract, helping it to return to pre - The female reproductive system consists
pregnancy size. of a pair of ovaries, a pair of oviducts, uterus,
cervix, vagina and external genitalia. The male
Colostrum reproductive system consists of a pair of testes,
Colostrum, a nutrient rich a pair of duct system, accessory glands and
fluid produced by the human female external genitalia called penis.
immediately after giving birth, is loaded The process of formation of gametes in
with immune, growth and tissue repair the male is called spermatogenesis and in the
factors. It acts as a natural antimicrobial female is called oogenesis. The reproductive
agent to actively stimulate the maturation cycle in females is called menstrual cycle and
of the infant’s immune system. No artificial it is initiated at puberty. The ovum released
feed can substitute the first milk, with all during the menstrual cycle is fertilized by the
its natural benefits and therefore should be sperm and the zygote is formed.
definitely fed to the baby after birth. Zygote undergoes repeated mitotic division
and the blastocyst is implanted on the walls of
The mammary glands secrete a yellowish the uterus. It takes about 280 days or 40 weeks
fluid called colostrum during the initial for the entire development of the human foetus
few days after parturition. It has less lactose and it is delivered out through the process of
than milk and almost no fat, but it contains child birth or parturition. The new born baby is
more proteins, vitamin A and minerals. breast fed by the mother.

www.tntextbooks.in
World Breast feeding week (WBW)

August 1st week
WBW is organized and promoted world wide by WABA (World Alliance for
Breast feeding Action), WHO (World Health Organization) and UNICEF (United
Nations International Children's Emergency Fund) to stress the importance of
breast feeding during the first six months of baby’s life and a supplemented breast
feeding for two years in order to encourage new mothers for the healthy growth
and development of their children, to guard them from lethal health problems and
diseases including neonatal jaundice, pneumonia, cholera, etc., The Government
of Tamil Nadu has also initiated various projects like Mother’s Milk Bank, Feeding
rooms in bus terminals and also organisizes awareness campaigns during the first
week of August to highlight the importance of breast feeding to infants.
INTERESTING FACTS
1. Males are said to be sterile when they fail to produce viable sperms.
2. Azoospermia refers to the failure of spermatogenesis.
3. Enlargement of prostate gland is called prostatitis and can lead to difficulty in urination.
4. Castration or surgical removal of testis is known as orchidectomy
5. Spermarche is the first ejaculation of the semen.
Arunachalam Muruganantham
Inventor And Social Entrepreneur
Arunachalam Muruganantham is the man behind the world’s first low cost sanitary napkin
making machine. His mission was to provide sanitary napkins at minimal cost to poor
women across the country, especially in rural areas. The journey began when he was shocked
by the fact that women in India including his wife often used things such as old rags, leaves
and even ash during menstruation. Approximately 70 percent of all reproductive diseases
in India are caused by poor menstrual hygiene. 23 percent of girls drop out of schools once
they attain puberty. He wished to make a social impact by creating more livelihoods and
improving the menstrual hygiene of rural women.
Arunachalam initiated his research in 1999 and almost after 5 years, successfully created
a low cost machine for the production of sanitary napkins. He presented his prototype
to IIT, Madras for a national innovation competition in 2006 and out of 943 entries, his
machine stood first. Arunachalam made 250 machines in 18 months and set out to states in
Northern India namely Bihar, Madhya Pradesh, Rajasthan and Uttar Pradesh.
Arunachalam Muruganantham was named one of the Time Magazine’s 100 most
influential people in 2014. He was awarded the Padma Shri in 2016.

www.tntextbooks.in
Evaluation c. Spermiogenesis
1. The mature sperms are d. Capacitation
stored in the 10. The milk secreted by the mammary glands
a. Seminiferous tubules soon after child birth is called
b.Vas deferens a. Mucous b. Colostrum
c. Epididymis c. Lactose d. Sucrose
d. Seminal vesicle
11. Colostrum is rich in
2. The male sex hormone testosterone is a. Ig E b. Ig A
secreted from c. Ig D d. Ig M
a. Sertoli cells b. Leydig cell
c. Epididymis d. Prostate gland 12. The Androgen Binding Protein (ABP) is
produced by
3. The glandular accessory organ which a. Leydig cells b. Hypothalamus
produces the largest proportion of semen c. Sertoli cells d. Pituitary gland
is
a. Seminal vesicle 13. Find the wrongly matched pair
b. Bulbourethral gland a. Bleeding phase - f all in oestrogen and
c. Prostate gland progesterone
d. Mucous gland b. Follicular phase - rise in oestrogen
4. The male homologue of the female clitoris is c. Luteal phase - rise in FSH level
a. Scrotum b. Penis d. Ovulatory phase - LH surge
c. Urethra d.Testis
Answer the following type of questions
5. The site of embryo implantation is the
a. Uterus b. Peritoneal cavity Assertion (A) and Reason (R)
c. Vagina d. Fallopian tube a. A and R are true, R is the correct
explanation of A
6. The foetal membrane that forms the basis
b. A and R are true, R is not the correct
of the umbilical cord is
explanation of A
a. Allantois b. Amnion
c. A is true, R is false
c. Chorion d. Yolk sac
d. Both A and R are false
7. The most important hormone in intiating
14. A –
In human male, testes are extra
and maintaining lactation after birth is
abdominal and lie in scrotal sacs.
a. Oestrogen b. FSH
R – S crotum acts as thermoregulator and
c. Prolactin d. Oxytocin
keeps temperature lower by 2oC for
8. Mammalian egg is normal sperm production .
a. Mesolecithal and non cleidoic (a) A and R are true, R is the correct
b. Microlecithal and non cleidoic explanation of A
c. Alecithal and non cleidoic
15. A – O vulation is the release of ovum from
d. Alecithal and cleidoic
the Graafian follicle.
9. The process which the sperm undergoes R – It occurs during the follicular phase of
before penetrating the ovum is the menstrual cycle.
a. Spermiation (c) A is true, R is false
b. Cortical reaction

www.tntextbooks.in
16. A –
Head of the sperm consists of 31. Describe the structure of the human ovum
acrosome and mitochondria. with a neat labelled diagram.
R– Acrosome contains spiral rows of 32.
Give a schematic representation of
mitochondria. spermatogenesis and oogenesis in humans.
(d) Both A and R are false
33.
Explain the various phases of the
17. Painful menstruation is termed as menstrual cycle.
a. Dysmenorrhoea
b. Menorrhagia 34. Explain the role of oxytocin and relaxin in
c. Amenorrhoea parturition and lactation.
d. Oligomenorrhoea 35. Identify the given image and label its parts
18. Which one of the following menstrual marked as a, b, c and d
irregularities is correctly matched? d
a. Menorrhagia - excessive

menstruation a
b. Amenorrhoea - absence of b
menstruation
c. Dysmenorrhoea - irregularity of c
menstruation
d. Oligomenorrhoea - painful
menstruation
19.
Mention the differences between 36. The following is the illustration of the
spermiogenesis and spermatogenesis. sequence of ovarian events (a-i) in a
20. At what stage of development are the human female.
gametes formed in new born male and
female?
21. Expand the acronyms
a. FSH b. LH c. hCG d. hPL a) Identify the figure that illustrates ovulation
22. How is polyspermy avoided in humans? and mention the stage of oogenesis it
represents.
23. What is colostrum? Write its significance.
b) Name the ovarian hormone and the
24. Placenta is an endocrine tissue. Justify.
pituitary hormone that have caused the
25. Draw a labeled sketch of a spermatozoan. above-mentioned events.
26. What is inhibin? State its functions. c) Explain the changes that occurs in the
27. Mention the importance of the position of uterus simultaneously in anticipation.
the testes in humans. d) Write the difference between C and H.
28. What is the composition of semen?
37. List the various menstrual disorders.
29. Explain the process of fertilization and
implantation of the fertilized ovum.
30. Define gametogenesis.

Concept Map
XII Std Zoology Chapter 2 EM.indd 30

Human Reproduction
+XPDQUHSURGXFWLRQ
30
0DOHUHSURGXFWLYHV\VWHP )HPDOHUHSURGXFWLYHV\VWHP
*DPHWRJHQHVLV
$FFHVVRU\JODQGV 3ULQFLSDORUJDQV 3ULQFLSDORUJDQV $FFHVVRU\JODQGV 0HQVWUXDOF\FOH
6SHUPDWRJHQHVLV 2RJHQHVLV
6HPLQDO 7HVWLV 6SHUP 2YXP 2YDU\ 0DPPDU\ 0HQVWUXDO

YHVLFOH JODQGV SKDVH
3URVWDWH 6HPLQLIHURXV )DOORSLDQ )ROOLFXODU

6(0(1 )HUWLOL]DWLRQ
JODQG WXEXOHV WXEH SKDVH
=\JRWH
www.tntextbooks.in
2YXODWRU\
%XOERXUHWKUDO 8WHUXV
9DVGHIHUHQV SKDVH
JODQG ,PSODQWDWLRQ
/XWHDO
)RHWDO 9DJLQD
SKDVH
3HQLV GHYHORSPHQW
3DUWXULWLRQ
/DFWDWLRQ
18/12/2021 14:51:09
www.tntextbooks.in
ICT CORNER
HUMAN REPRODUCTION
Baby’s Journey to the world.
Procedure:
Step 1: Use the URL or scan the QR Code to launch the “Stages of Development before
Birth” activity page.
Step 2:On the right of the window, Click “Video” and view the development of embryo
during that particular stage.
Step 3: Click “Show Features” to know the parts. Click “Heartbeat-Symbol” to hear the
heartbeat of the embryo at that particular stage. Click “Weighing Machine” placed
below to know the weight of the offspring at that stage.
Step 4: Repeat the above steps with the different weeks by clicking the respective week tabs
placed below.
Step 1 Step 2 Step 3
Step 4
HUMAN REPRODUCTION URL:

http://www.glencoe.com/sites/common_assets/science/virtual_labs/
LS26/LS26.html
*Pictures are indicative only

*Allow flash player

www.tntextbooks.in
3
UNIT - I
Reproductive
Health
CHAPTER
Safe motherhood begins before conception
with healthy lifestyle and proper nutrition.
Chapter outline
3.1. Need for reproductive health Problems
and strategies
3.2. Amniocentesis and its statutory ban
3.3. Social impact of sex ratio,
R eproductive health represents a society with
people having physically and functionally
normal reproductive organs. Healthy people
female foeticide and infanticide have healthier babies and are able to care for
3.4. Population explosion and birth control their family, and contribute more to the society
3.5. Medical termination of pregnancy (MTP) and community. Hence, health is a community
3.6. Sexually transmitted diseases (STD) issue. Reproductive system is a complex system
3.7. Infertility controlled by the neuro-endocrine system,
3.8. Assisted reproductive technologyes (ART) hence, it is important to take necessary steps to
3..9. Detection of foetal disorders during early protect it from infectious diseases and injury.
pregnancy
3.1. N
eed for reproductive health-
Learning objectives Problems and strategies
India is amongst the first few countries
➢ Understands the importance of sex in the world to initiate the ‘Family planning
education and reproductive health. programme’ since 1951 and is periodically
➢ Learns the importance of amniocentesis as assessed every decade. These programmes are
a pre-natal diagnosis. popularly named as ‘Reproductive and Child
➢ Evaluates the effects of Health Care (RCH). Major tasks carried out
maternal and infant under these programmes are:
mortality. • Creating awareness and providing medical
➢ Identifies, compares and assistance to build a healthy society.
explains different types of • Introducing sex education in schools to
contraceptive devices. provide information about adolescence and
➢ Discusses the medical necessity and social adolescence related changes.
consequences of MTP.
• Educating couples and those in the
➢ Explains the reasons of transmission and
marriageable age groups about the
prevention of STDs.
available birth control methods and
➢ Highlights the reasons of infertility.
family planning norms.
➢ Develops a positive and healthy attitude
towards reproductive life.
32

www.tntextbooks.in
the foetus. Once the sex of the foetus is known,

Globally, about 800 women there may be a chance of female foeticide. Hence,
die every day of preventable a statutory ban on amniocentesis is imposed.
causes related to pregnancy
and childbirth; 20 per cent of these 3.3. Social impact of sex ratio,
women are from India. Similarly India's female foeticide and
infant mortality rate was 44 per 1,000 live.
infanticide
Although, India has witnessed dramatic
The sex ratio is the ratio of males to the
growth over the last two decades,
females in a population. In India, the child sex
maternal mortality still remains high
ratio has decreased over the decade from 927
as in comparison to many developing
to 919 female for every 1000 males. To correct
nations.
this ratio, steps are needed to change the mind
source: http://unicef.in
set and attitudes of people, especially in the
young adults. Female foeticide and infanticide
• Creating awareness about care for pregnant is the manifestation of gender discrimination
women, post-natal care of mother and child in our society.
and the importance of breast feeding.
Female foeticide refers to ‘aborting the
• Encouraging and supporting female in the mother’s womb’; whereas female
governmental and non-governmental infanticide is ‘killing the female child after her
agencies to identify new methods and/or birth’. These have resulted in imbalance in sex
to improve upon the existing methods of ratio. In UNDP’s GII 2018 (United nations
birth control. developmental programmes gender inequality
index) reflected that India was ranked at 135
Health care programmes such as out of 187 countries due to availability of
massive child immunization, supply of very few economic opportunities to women
nutritional food to the pregnant women, as compared to men.
Janani Suraksha Yojana, Janani Shishu In order to prevent female foeticide
Suraksha Karyakaram, RMNCH+A and infanticide, Government of India has
approach (an integrated approach for taken various steps like PCPNDT Act
reproductive, maternal, new born, child (Pre-Conception and Pre-Natal Diagnostic
and adolescent health), Pradhan Mantri Technique Act-1994) enacted to ban the
Surakshit Matritva Abhiyan, etc., are identification of sex and to prevent the
taken up at the national level by the use of prenatal diagnostic techniques for
Government of India. selective abortion. Various measures are
taken by the Government to ensure survival,
3.2. Amniocentesis and its provision of better nutrition, education,
protection and empowerment of girls by
statutory ban
eliminating the differences in the sex ratio,
Due to small family norms and the skewed
infant mortality rate and improving their
choice for a male child, female population is
nutritional and educational status. POCSO
decreasing at an alarming rate. Amniocentesis
Act (Prevention Of Children from Sexual
is a prenatal technique used to detect any
Offences), Sexual harassment at workplace
chromosomal abnormalities in the foetus and it
(Prevention, prohibition and redressal) Act
is being often misused to determine the sex of
and the changes in the Criminal law based
33 Reproductive Health

www.tntextbooks.in
on the recommendations of Justice Verma a. Periodic abstinence/rhythm method

Committee, 2013 aims at creating a safe and Ovulation occurs at about the 14th day
secure environment for both females and of the menstrual cycle. Ovum survives
males. for about two days and sperm remains
alive for about 72 hours in the female
3.4. Population explosion and reproductive tract. Coitus is to be avoided
birth control during this time.
Increased health facilities and better living b. Continuous abstinence is the simplest
conditions have enhanced longevity. According and most reliable way to avoid pregnancy
to a recent report from the UN, India’s is not to have coitus for a defined period
population has already reached 1.26 billion that facilitates conception.
and is expected to become the largest country c. Coitus interruptus is the oldest family
in population size, surpassing China around planning method. The male partner
2022. To overcome the problem of population withdraws his penis before ejaculation,
explosion, birth control is the only available thereby preventing deposition of semen
solution. People should be motivated to have into the vagina.
smaller families by using various contraceptive
d. Lactational amenorrhoea Menstrual
devices. Advertisements by the Government
cycles resume as early as 6 to 8 weeks from
in the media as well as posters/bills, etc., with
parturition. However, the reappearance
a slogan Naam iruvar namakku iruvar (we two,
of normal ovarian cycles may be
ours two) and Naam iruvar namakku oruvar
delayed for six months during breast-
(we two, ours one) have also motivated to control
feeding. This delay in ovarian cycles is
population growth in Tamilnadu. Statutory
called lactational amenorrhoea. It serves
rising of marriageable age of the female to 18
as a natural, but an unreliable form of
years and that of males to 21 years and incentives
birth control. Suckling by the baby during
given to couples with small families are the other
breast-feeding stimulates the pituitary
measures taken to control population growth in
to secrete increased prolactin hormone
our country.
in order to increase milk production.
Birth control methods This high prolactin concentration in the
The voluntary use of contraceptive mother’s blood may prevent menstrual
procedures to prevent fertilization or prevent cycle by suppressing the release of GnRH
implantation of a fertilized egg in the (Gonadotropin Releasing Hormone)
uterus is termed as birth control. An ideal from hypothalamus and gonadotropin
contraceptive should be user friendly, easily secretion from the pituitary.
available, with least side effects and should not
interfere with sexual drive. The contraceptive 2. Barrier methods In these methods, the
methods are of two types – temporary and ovum and sperm are prevented from meeting
permanent. Natural, chemical, mechanical so that fertilization does not occur.
and hormonal barrier methods are the a. Chemical barrier Foaming tablets,
temporary birth control methods. melting suppositories, jellies and creams
1. Natural method is used to prevent meeting are used as chemical agents that inactivate
of sperm with ovum. i.e., Rhythm method the sperms in the vagina.
(safe period), coitus interruptus, continuous b. Mechanical barrier Condoms are a
abstinence and lactational amenorrhoea. thin sheath used to cover the penis in
Reproductive Health 34

www.tntextbooks.in
male whereas in female it is used to cover IUDs such as Cu T-380 A, Nova T, Cu 7,
vagina and cervix just before coitus so as to Cu T 380 Ag, Multiload 375, etc. release
prevent the entry of ejaculated semen into free copper and copper salts into the
the female reproductive tract. This can uterus and suppress sperm motility. They
prevent conception. Condoms should be can remain in the uterus for five to ten
discarded after a single use. Condom also years.
safeguards the user from AIDS and STDs. Hormone-releasing IUDs such as
Condoms are made of polyurethane, latex Progestasert and LNG – 20 are often
and lambskin. called as intrauterine systems (IUS).
Diaphragms, cervical caps and vaults They increase the viscosity of the cervical
are made of rubber and are inserted into mucus and thereby prevent sperms from
the female reproductive tract to cover the entering the cervix.
cervix before coitus in order to prevent Non-medicated IUDs are made of plastic
the sperms from entering the uterus. or stainless steel. Lippes loop is a double
c. Hormonal barrier S-shaped plastic device.
It prevents the ovaries from releasing the 3. Permanent birth control methods are
ova and thickens the cervical fluid which adopted by the individuals who do not want
keeps the sperm away from ovum. to have any more children.
Oral contraceptives — Pills are used Surgical sterilisation methods are the
to prevent ovulation by inhibiting the permanent contraception methods advised for
secretion of FSH and LH hormones. A male and female partners to prevent any more
combined pill is the most commonly pregnancies. It blocks the transport of the
used birth control pill. It contains gametes and prevents conception. Tubectomy
synthetic progesterone and estrogen is the surgical sterilisation in women. In this
hormones. Saheli, contraceptive pill procedure, a small portion of both fallopian
by Central Drug Research Institute tubes are cut and tied up through a small
(CDRI) in Lucknow, India contains incision in the abdomen or through vagina.
a non-steroidal preparation called This prevents fertilization as well as the entry
Centchroman. of the egg into the uterus. Vasectomy is the
d. Intrauterine Devices (IUDs) surgical procedure for male sterilisation. In
Intrauterine devices are inserted by this procedure, both vas deferens are cut and
medical experts in the uterus through tied through a small incision on the scrotum
the vagina. These devices are available as to prevent the entry of sperm into the urethra.
copper releasing IUDs, hormone releasing Vasectomy prevents sperm from heading off
IUDs and non-medicated IUDs. IUDs to penis as the discharge has no sperms in it.
increase phagocytosis of sperm within the
uterus. IUDs are the ideal contraceptives 3.5. Medical Termination of
for females who want to delay pregnancy. Pregnancy (MTP)
It is one of the popular methods of Medical method of abortion is a
contraception in India and has a success voluntary or intentional termination of
rate of 95 to 99%. pregnancy in a non-surgical or non-invasive
Copper releasing IUDs differ from each way. Early medical termination is extremely
other by the amount of copper. Copper safe upto 12 weeks (the first trimester) of

www.tntextbooks.in
Approximately half of unintended pregnancies are due to contraceptive

failure, largely owing to inconsistent or incorrect use of contraceptive
methods. The effectiveness of long-acting reversible contraception
(intrauterine devices and contraceptive implants) is superior to that of contraceptive pills,
patch, or ring and is not altered in adolescents and young women. Educating young women
about the usage of intrauterine devices and contraceptive implants would dramatically
reduce the number of unintended pregnancies among women seeking family planning.
pregnancy and generally has no impact on a of infusion needles, surgical instruments,

women’s fertility. Abortion during the second etc with infected people, blood transfusion
trimester is more risky as the foetus becomes or from infected mother to baby. People in
intimately associated with the maternal the age of 15 to 24 years are prone to these
tissue. Government of India legalized MTP infections. The bacterial STI are gonorrhoea,
in 1971 for medical necessity and social syphilis, chancroid, chlamydiasis and
consequences with certain restrictions like sex lymphogranuloma venereum. The viral
discrimination and illegal female foeticides STI are genital herpes, genital warts,
to avoid its misuse. MTP performed illegally Hepatitis-B and AIDS. Trichomoniasis is a
by unqualified quacks is unsafe and could be protozoan STI, and candidiasis is a fungal STI.
fatal. MTP of the first conception may have STI caused by bacteria, fungi and protozoa
serious psychological consequences or parasites, can be treated with antibiotics
or other medicines, whereas STI caused by
3.6. Sexually Transmitted virus cannot be treated but the symptoms
Diseases (STD) can be controlled by antiviral medications.
Sexually transmitted Latex condoms usage greatly reduces the risk,
diseases (STD) or but does not completely eliminate the risk of
Venereal diseases (VD) or transmission of STI.
Reproductive tract infections
(RTI) are called as Sexually Prevention of STDs
transmitted infections (STI). Normally STI a. Avoid sex with unknown partner/
are transmitted from person to person during multiple partners.
intimate sexual contact with an infected partner. b. Use condoms.
Infections like Hepatitis-B and HIV are
c. In case of doubt, consult a doctor for
transmitted sexually as well as by sharing
diagnosis and get complete treatment.
According to World Health

Organization (WHO), 2017 TNHSP (Tamilnadu health
more than one million people systems project), a unit
of the Health and family
globally acquires a sexually
welfare department of the
transmitted infection every day. India has the Government of Tamilnadu
third largest HIV epidemic in the world, with does free screening for cervical and
2.1 million people living with HIV. breast cancer.

www.tntextbooks.in
Table 3.1. STD and their symptoms

Name of the Incubation
Causative agent Symptom
Disease period
Bacterial STI
Affects the urethra, rectum and throat
and in females the cervix also get
Gonorrhoea Neisseria gonorrhoeae affected. 2 to 5 days
Pain and pus discharge in the genital tract
and burning sensation during urination.
Primary stage
Formation of painless ulcer on the
external genitalia.
Secondary stage
Skin lesions, rashes, swollen joints and
fever and hair loss.
Syphilis Treponema pallidum 10 to 90 days
Tertiary stage
Appearance of chronic ulcers on nose,
lower legs and palate. Loss of movement,
mental disorder, visual impairment, heart
problems, gummas (soft non-cancerous
growths) etc.,
Trachoma , affects the cells of the
Chlamydiasis Chlamydia trachomatis columnar epithelium in the urinogenital
tract, respiratory tract and conjunctiva. 2 to 3 weeks
Cutaneous or mucosal genital damage, or upto 6
Lymphogranuloma urithritis and endocervicitis. weeks
Chlamydia trachomatis
venereum Locally harmful ulcerations and genital
elephantiasis.
Viral STI
Sores in and around the vulva, vagina,
urethra in female or sores on or around
the penis in male. 2- 21 days
Genital herpes Herpes simplex virus (average 6
Pain during urination, bleeding
days)
between periods.
Swelling in the groin nodes.
Hard outgrowths (Tumour) on
Human papilloma
Genital warts the external genitalia, cervix and 1-8 months
virus (HPV)
perianal region.
Fatigue, jaundice, fever, rashes and
stomach pain.
Hepatitis-B Hepatitis B virus (HBV) 30-80 days
Liver cirrhosis and liver failure occur in
the later stage.
Human Enlarged lymph nodes, prolonged fever, 2 to 6 weeks

AIDS immunodeficiency prolonged diarrhoea, weight reduction, even more
virus (HIV) night sweating. than 10 years

www.tntextbooks.in
Name of the Incubation

Causative agent Symptom
Disease period
Fungal STI
Attacks mouth, throat, intestinal tract
and vagina.
Candidiasis Candida albicans Vaginal itching or soreness, abnormal _
vaginal discharge and pain during
urination.
Protozoan STI
Vaginitis , greenish yellow vaginal
discharge, itching and burning
Trichomoniasis Trichomonas vaginalis 4-28 days
sensation, urethritis, epididymitis and
prostatitis
Cervical cancer 3.7. Infertility

Cervical cancer is caused by a sexually Inability to conceive or produce children
transmitted virus called Human Papilloma even after unprotected sexual cohabitation
virus (HPV). HPV may cause abnormal is called infertility. That is, the inability of a
growth of cervical cells or cervical dysplasia. man to produce sufficient numbers or quality
The most common symptoms and signs of of sperm to impregnate a woman or inability
cervical cancer are pelvic pain, increased vaginal of a woman to become pregnant or maintain
discharge and abnormal vaginal bleeding. The a pregnancy.
risk factors for cervical cancer include The causes for infertility are tumours
1. Having multiple sexual partners formed in the pituitary or reproductive organs,
2. Prolonged use of contraceptive pills inherited mutations of genes responsible for the
biosynthesis of sex hormones, malformation
Cervical cancer can be diagnosed by a
of the cervix or fallopian tubes and inadequate
Papanicolaou smear (PAP smear) combined with
nutrition before adulthood. Long-term stress
an HPV test. X-Ray, CT scan, MRI and a PET scan
damages many aspects of health especially
may also be used to determine the stage of cancer.
the menstrual cycle. Ingestion of toxins
The treatment options for cervical cancer include
(heavy metal cadmium), heavy use of alcohol,
radiation therapy, surgery and chemotherapy.
tobacco and marijuana, injuries to the gonads
Modern screening techniques can detect and aging also cause infertility.
precancerous changes in the cervix. Therefore
screening is recommended for women above Other causes of infertility
30 years once in a year. Cervical cancer can • Pelvic inflammatory disease (PID), uterine
be prevented with vaccination. Primary fibroids and endometriosis are the most
prevention begins with HPV vaccination of common causes of infertility in women.
girls aged 9 – 13 years, before they become
• Low body fat or anorexia in women. i.e. a
sexually active. Modification in lifestyle can
psychiatric eating disorder characterised
also help in preventing cervical cancer. Healthy
by the fear of gaining weight.
diet, avoiding tobacco usage, preventing early
• Undescended testes and swollen veins
marriages, practicing monogamy and regular
(varicocoele) in scrotum.
exercise minimize the risk of cervical cancer.

www.tntextbooks.in
• Tight clothing in men may raise the transferred into the woman’s uterus, where they
temperature in the scrotum and affect may implant in the uterine lining and develop.
sperm production. Excess embryos may be cryopreserved (frozen)
• Under developed ovaries or testes. for future use. Initially, IVF was used to treat
• Female may develop antibodies against women with blocked, damaged, or absent
her partner's sperm. fallopian tubes. Today, IVF is used to treat
many causes of infertility. The basic steps in an
• Males may develop an autoimmune
IVF treatment cycle are ovarian stimulation,
response to their own sperm.
egg retrieval, fertilization, embryo culture, and
embryo transfer.
All women are born with ovaries, but some
Egg retrieval is done by minor
do not have functional uterus. This condition
is called Mayer-Rokitansky syndrome. surgery under general anesthesia, using
ultrasound guide after 34 to 37 hours of hCG
(human chorionic gonadotropin) injection.
3.8. Assisted Reproductive The eggs are prepared and stripped
Technology (ART) from the surrounding cells. At the same
A collection of procedures, time, sperm preparation is done using
which includes the handling a special media. After preparing the
of gametes and/or embryos sperms, the eggs are brought together.
outside the body to achieve 10,000-1,00,000 motile sperms are needed for
pregnancy is known as Assisted each egg. Then the zygote is allowed to divide to
Reproductive Technology. form 8 celled blastomere and then transferred
It increases the chance of pregnancy in infertile into the uterus for a successful pregnancy.
couples. ART includes intra-uterine insemination The transfer of an embryo with more than
(IUI), in vitro fertilization, (IVF) Embryo 8 blastomeres stage into uterus is called
transfer (ET), Zygote intra-fallopian transfer Embryo transfer technique.
(ZIFT), Gamete intrafallopian transfer (GIFT),
Intra-cytoplasmic sperm injection
(ICSI), Cryopreservation
Preimplantation genetic diagnosis, oocyte and (or freezing) of embryos
sperm donation and surrogacy. is often used when there
Intra-Uterine Insemination (IUI) are more embryos than
This is a procedure to treat infertile men needed for a single IVF
with low sperm count. The semen is collected transfer. Embryo cryopreservation can
either from the husband or from a healthy provide an additional opportunity for
donor and is introduced into the uterus through pregnancy, through a Frozen embryo
the vagina by a catheter after stimulating the transfer (FET), without undergoing
ovaries to produce more ova. The sperms swim another ovarian stimulation and retrieval.
towards the fallopian tubes to fertilize the egg,
resulting in normal pregnancy. Zygote Intra-Fallopian Transfer (ZIFT)
In Vitro Fertilization (IVF) or As in IVF, the zygote upto 8 blastomere
Test tube baby stage is transferred to the fallopian tube by
In this technique, sperm and eggs laparoscopy. The zygote continues its natural
are allowed to unite outside the body in a divisions and migrates towards the uterus
laboratory. One or more fertilized eggs may be where it gets implanted.

www.tntextbooks.in
Intra Uterine Transfer (IUT) 3.9. Detection of foetal disorders

Embryo with more than 8 blastomeres during early pregnancy
is inserted into uterus to complete its further
development. Ultrasound scanning
Ultrasound has no known risks other
Gamete Intra-Fallopian Transfer (GIFT) than mild discomfort due to pressure from
Transfer of an ovum collected from a the transducer on the abdomen or vagina.
donor into the fallopian tube. In this the eggs No radiation is used during this procedure.
are collected from the ovaries and placed Ultrasonography is usually performed in the
with the sperms in one of the fallopian tubes. first trimester for dating, determination of
The zygote travels toward the uterus and gets the number of foetuses, and for assessment
implanted in the inner lining of the uterus. of early pregnancy complications.
Intra-Cytoplasmic Sperm Injection (ICSI) There are several types of ultrasound

In this method only one sperm is injected imaging techniques. As the most common
into the focal point of the egg to fertilize. The type, the 2-D ultrasound provides a flat
sperm is carefully injected into the cytoplasm picture of one aspect of the baby. The 3-D
of the egg. Fertilization occurs in 75 - 85% image allows the health care provider to see
of eggs injected with the sperms. The zygote the width, height and depth of the images,
is allowed to divide to form an 8 celled which can be helpful during the diagnosis.
blastomere and then transferred to the uterus The latest technology is 4-D ultrasound,
to develop a protective pregnancy. which allows the health care provider to
Surrogacy visualize the unborn baby moving in real
Surrogacy is a method of assisted time with a three-dimensional image.
reproduction or agreement whereby a woman
agrees to carry a pregnancy for another person, Amniocentesis
who will become the newborn child's parent Amniocentesis involves taking a small
after birth. Through in vitro fertilization (IVF), sample of the amniotic fluid that surrounds
embryos are created in a lab and are transferred the foetus to diagnose for chromosomal
into the surrogate mother's uterus. abnormalities (Fig. 3.1).
Male infertility
Azoospermia is defined as the absence of Ultrasound
spermatozoa in the ejaculate semen on atleast Transducer
two occasions and is observed approximately Amniotic Fluid

in 1% of the population.
Micro-Testicular Sperm Extraction Placenta
(TESE) Microsurgical sperm retrieval from the
Foetus
testicle involves a small midline incision in the
Uterus
scrotum, through which one or both testicles can
be seen. Under the microscope, the seminiferous
tubules are dilated and small amount of testicular
tissue in areas of active sperm production are
removed and improved for sperm yield compared
to traditional biopsy techniques. Fig. 3.1 Amniocentesis

www.tntextbooks.in
Amniocentesis is generally performed A hand-held doppler device is often used

in a pregnant woman between the 15th and during prenatal visits to count the foetal heart
20th weeks of pregnancy by inserting a long, rate. During labour, continuous electronic
thin needle through the abdomen into the foetal monitoring is often used.
amniotic sac to withdraw a small sample of
amniotic fluid. The amniotic fluid contains
• Vitamin E is known as anti-sterility
cells shed from the foetus.
vitamin as it helps in the normal
functioning of reproductive structures.
Chorionic Villus Sampling (CVS)
CVS is a prenatal test that involves taking • Sex hormones were discovered by
a sample of the placental tissue to test for Adolf Butenandt.
chromosomal abnormalities.
• 11th July is observed as World
Foetoscope Population Day.
Foetoscope is used to monitor the foetal
• 1st December is observed as World
heart rate and other functions during late
AIDS Day.
pregnancy and labour. The average foetal heart
rate is between 120 and 160 beats per minute. • NACO (National AIDS Control
An abnormal foetal heart rate or pattern may Organisation) was established in 1992.
mean that the foetus is not getting enough
• Syphilis and gonorrhoea are commonly
oxygen and it indicates other problems.
called as international diseases.
BREAST SELF EXAMINATION AND

EARLY DIAGNOSIS OF CANCER
1. Breast is divided Summary
into 4 quadrants Reproductive health refers to a total well-
and the center 1
5
2 being in all aspects of reproduction. Providing
(Nipple) which is medical facilities and care to the problems like
the 5th quadrant. menstrual irregularities, pregnancy related
3 4
2. Each quadrant of aspects, medical termination of pregnancy, STI,
the breast is felt birth control, infertility, post natal child and
for lumps using
maternal management are the important aspect
the palm of the opposite hand.
of the Reproductive and Child Health Care
3. The examination is done in both lying
programmes.
down and standing positions, monthly
once after the 1st week of menstrual An overall improvement in reproductive
cycle. health has taken place in our country as indicated
This way if there are lumps or any deviation by reduced maternal and infant mortality rates,
of the nipple to one side or any blood assistance to infertile couples, etc. Improved health
discharge from the nipple we can identify facilities and better living conditions promote an
cancer at an early stage. explosive growth of population. Such a growth
Mammograms are usually done for women necessitated intense propagation of contraceptive
above the age of 40 years and for young girls methods. Various contraceptive options are
and women below 40 years, ultrasound of
available now such as natural, traditional, barrier,
the breast aids in early diagnosis of breast
cancer. IUDs, pills, injectables, implants and surgical
methods. Though contraceptives are not regular

www.tntextbooks.in
requirements for reproductive health, one is 3. Identify the correct statements from
adviced to use them to avoid pregnancy or to the following
delay or space pregnancy. (a)Chlamydiasis is a viral disease.
Diseases or infections transmitted through
(b) Gonorrhoea is caused by a spirochaete
coitus are called Sexually transmitted infections
bacterium, Treponema palladium.
(STIs). Pelvic inflammatory diseases (PIDs), still
birth, infertility are some of the complications (c) T
he incubation period for syphilis is
of STDs. Early detection facilitates better cure of is 2 to 14 days in males and 7 to 21
these diseases. Avoiding coitus with unknown/ days in females.
multiple partners, use of condoms during coitus (d) B oth syphilis and gonorrhoea are
are some of the simple precautions to avoid easily cured with antibiotics.
contracting STIs.
4. A contraceptive pill prevents ovulation by
Inability to conceive or produce children even
(a) blocking fallopian tube
after unprotected sexual cohabitation is called
infertility. Various methods are now available to (b) inhibiting release of FSH and LH
help such couples. In vitro fertilization followed by (c) stimulating release of FSH and LH
transfer of embryo into the female genital tract is (d) c ausing immediate degeneration of
one such method. released ovum
Evaluation 5. The approach which does not give the

defined action of contraceptive is
1. Which of the following
(a) Hormonal Prevents entry of sperms,
is correct regarding
contraceptive prevent ovulation and
HIV, hepatitis B, fertilization
gonorrhoea and (b) Vasectomy Prevents spermatogenesis
trichomoniasis?
(c) Barrier Prevents fertilization
(a) G onorrhoea is a STD whereas
method
others are not.
(d) Intra uterine Increases phagocytosis of
(b) T richomoniasis is a viral disease device sperms, suppresses sperm
whereas others are bacterial. motility and fertilizing capacity
(c) H
IV is a pathogen whereas others of sperms
are diseases. 6. Read the given statements and select the

(d) Hepatitis B is eradicated completely correct option.
whereas others are not. Statement 1: Diaphragms, cervical caps
2. Which one of the following groups and vaults are made of rubber and are
includes sexually transmitted diseases inserted into the female reproductive
caused by bacteria only? tract to cover the cervix before coitus.
(a) S yphilis, gonorrhoea and candidiasis Statement 2: They are chemical barriers
(b) S yphilis, chlamydiasis and of conception and are reusable.
gonorrhoea (a) B oth statements 1 and 2 are correct
(c) Syphilis, gonorrhoea and and statement 2 is the correct
trichomoniasis explanation of statement 1.
(d) S yphilis, trichomoniasis and
pediculosis

www.tntextbooks.in
(b) B oth statements 1 and 2 are correct 10. Correct the following statements
but statement 2 is not the correct a) Transfer of an ovum collected from
explanation of statement 1. donor into the fallopian tube is called
(c) Statement 1 is correct but statement ZIFT.
2 is incorrect.
b) Transfering of an embryo with more
(d) Both statements 1 and 2 are incorrect. than 8 blastomeres into uterus is
7. Match column I with column II and select the called GIFT.
correct option from the codes given below.
c) Multiload 375 is a hormone releasing
Column I Column II IUD.
A. Copper releasing IUD (i) LNG-20
11. Which method do you suggest the couple
B. Hormone releasing (ii) Lippes loop IUD to have a baby, if the male partner fails to
C. Non medicated IUD (iii) Saheli inseminate the female or due to very low
D. Mini pills (iv) Multiload-375 sperm count in the ejaculate?
(a) A-(iv), B-(ii), C-(i), D-(iii) 12. Expand the following
(b) A-(iv), B-(i), C-(iii), D-(ii) a) ZIFT b) ICSI
(c) A-(i), B-(iv), C-(ii), D-(iii) 13. What are the strategies to be
(d) A-(iv), B-(i), C-(ii), D-(iii) implemented in India to attain total
reproductive health?
8. Select the incorrect action of hormonal
contraceptive pills from the following 14. Differentiate foeticide and infanticide.
(a) Inhibition of spermatogenesis. 15. Describe the major STDs and their
symptoms.
(b) Inhibition of ovulation.
16. How are STDs transmitted?
(c) Changes in cervical mucus impairing
its ability to allow passage and 17. Write the preventive measures of STDs.
transport of sperms. 18. The procedure of GIFT involves the
(d) Alteration in uterine endometrium to transfer of female gametes into the
make it unsuitable for implantation. fallopain tube, can gametes be transferred
to the uterus to achieve the same result?
9. Select the correct term from the bracket Explain.
and complete the given branching tree
Periodic abstinence 19. Amniocentesis, the foetal sex
Natural methods B
Coitus interruptus determination test, is banned in our
A Condoms, vaults, country, Is it necessary? Comment.
Caps etc.,
Birth control
methods
Oral contraceptives Pills 20. Explain the various barrier methods to
Vasectomy control human population.
Surgical methods
C
21. Open Book Assessment
IUDs D
‘Healthy reproduction, legally checked
(Barriers, Lactational amenorrhoea, CuT,
birth control measures and proper family
Tubectomy)
planning programmes are essential for
the survival of mankind’ Justify.

Concept Map

Reproductive Health
%,57+&21752/0(7+2'6
44
7HPSRUDU\ 3HUPDQHQW
PHWKRG 0HWKRG
1DWXUDO %DUULHU
PHWKRG 7XEHFWRP\
PHWKRG
&KHPLFDO 0HFKDQLFDO 2UDO +RUPRQDO ,QWUDXWHULQH

3HULRGLF EDUULHU EDUULHU FRQWUDFHSWLYHV EDUULHU 'HYLFHV 9DVHFWRP\
DEVWLQHQFH
UK\WKP
www.tntextbooks.in
PHWKRG 1RQ
&RQGRP PHGLFDWHG
)RDPLQJWDEOHWV /LSSHVORRS
PHOWLQJVXSSRVLWRULHV 0LQLSLOOV ,8'V
&RQWLQXRXV MHOOLHVDQGFUHDPV 6DKHOLFHQWFKURPDQ
DEVWLQHQFH 'LDSKUDJP 3URJHVWDVHUW +RUPRQDOUHOHDVLQJ
&HUYLFDOFDS /1* ,8'V
9DXOWV
&RLWXV
LQWHUUXSWXV &X7$
1RYD7&X &RSSHU
&X7$J UHOHDVLQJ,8'V
/DFWDWLRQDO 0XOWLORDG
$PHQRUUKRHD
18/12/2021 14:49:00
www.tntextbooks.in
4
UNIT - II
Principles of
Inheritance and
Variation
CHAPTER
Drosophila are ideal for the study of genetics

Chapter outline and development
4.1 Multiple alleles
4.2 Human blood groups
4.3 Genetic control of Rh factor
4.4 Sex determination
G enetics is a branch of biology that deals
with the study of heredity and variations. It
describes how characteristics and features pass
4.5 Sex linked inheritance on from the parents to their offsprings in each
4.6. Karyotyping successive generation. The unit of heredity is
4.7. Pedigree analysis known as the gene. Gene is the inherited factor
4.8. Mendelian disorders that determines the biological character of an
4.9. Chromosomal abnormalities organism. A variation is the degree by which
4.10. Extra chromosomal inheritance the progeny differs from their parents.
4.11. Eugenics, euphenics and euthenics In this chapter, we are going to learn about
multiple alleles with reference to the human
blood groups, sex determination in man, insects
Learning objectives and birds, sex linked inherited traits, genetic
➢ Learns the inheritance of multiple alleles disorders and extra chromosomal inheritance.
with reference to human blood groups. The betterment of human race can be achieved
➢ Understands the mechanism of sex by methods like eugenics, euthenics and
determination in human euphenics.
beings, insects and birds. 4.1 Multiple alleles
➢ Learns about sex linked The genetic segregations in Mendelian
(X and Y) inherited diseases inheritance reveal that all genes have two
in human beings. alternative forms – dominant and recessive
➢ Understands the Mendelian alleles e.g. tall versus dwarf (T and t). The
disorders and diseases associated with former is the normal allele or wild allele and
chromosomal abnormalities. the latter the mutant allele. A gene can mutate
➢ Gains knowledge on extra chromosomal several times producing several alternative
inheritance. forms. When three or more alleles of a gene
➢ Realises the significance of the applications of that control a particular trait occupy the same
genetics in the improvement of human race. locus on the homologous chromosome of an
organism, they are called multiple alleles and
their inheritance is called multiple allelism.
45

www.tntextbooks.in
4.2 Human Blood Groups determines B antigen and IO allele specifies

Multiple allelism occurs in humans, no antigen. Individuals who possess these
particularly in the inheritance of different types antigens in their fluids such as the saliva
of blood groups. The blood group inheritance are called secretors.
in human can be understood by learning about IA allele produces N-acetyl galactose
antigens and antibodies. The composition of transferase and can add N-acetyl
blood, different types of blood groups (ABO) the galactosamine (NAG) and I allele encodes
B
blood antigens and antibodies were discussed for the enzyme galactose transferase
in chapter 7 of class XI. that adds galactose to the precursor
(i.e, H substances) In the case of IO/IO allele no
4.2.1 ABO blood types terminal transferase enzyme is produced and
Multiple allele inheritance of ABO blood therefore called “null” allele and hence cannot
groups add NAG or galactose to the precursor.
Blood differs chemically from person From the phenotypic combinations it is
to person. When two different incompatible evident that the alleles IA and IB are dominant
blood types are mixed, agglutination to IO, but co-dominant to each other (IA=IB).
(clumping together) of erythrocytes Their dominance hierarchy can be given
(RBC) occurs. The basis of these chemical as (IA=IB> IO). A child receives one of three
differences is due to the presence of antigens alleles from each parent, giving rise to six
(surface antigens) on the membrane of possible genotypes and four possible blood
RBC and epithelial cells. Karl Landsteiner types (phenotypes). The genotypes are IAIA, IA
discovered two kinds of antigens called IO, IBIB, IB IO, IAIB and IO IO.
antigen ‘A’ and antigen ‘B’ on the surface
of RBC’s of human blood. Based on the
presence or absence of these antigens three • Antigens similar
kinds of blood groups, type ‘A’, type ‘B’, and to those found among
type ‘O’ (universal donor)were recognized. human beings have been
The fourth and the rarest blood group ‘AB’ recognized in the blood
(universal recipient) was discovered in 1902 of other organisms.
by two of Landsteiner’s students Von De A-type antigens have been found in
Castelle and Sturli. Chimpanzees and in Gibbons, A, B and
Bernstein in 1925 discovered that the AB antigen in Orangutans.
inheritance of different blood groups in
• New world monkeys (Platyrrhina) and
human beings is determined by a number
Lemurs have a substance similar but
of multiple allelic series. The three
not identical with B antigen in humans.
autosomal alleles located on chromosome 9
are concerned with the determination of • Three blood groups have been
blood group in any person. The gene distinguished in cats with a genetic
controlling blood type has been labelled as system similar to those in humans.
‘L’ (after the name of the discoverer, • The secretors (antigens found in the
Landsteiner) or I (from isoagglutination). body fluids) can be detected in tears,
The I gene exists in three allelic forms, IA, I B saliva, urine, semen, gastric juice and
and IO. IA specifies A antigen. I B allele in the milk of animals.
Principles of Inheritance and Variation 46

www.tntextbooks.in
Table 4.1 Genetic basis of the human ABO 4.3 Genetic control of Rh factor
blood groups
Fisher and Race hypothesis
Antigens Antibodies Rh factor involves three different pairs of
ABO blood
present on present
Genotype group alleles located on three different closely linked
red blood in blood
phenotype loci on the chromosome pair. This system is
cell plasma
more commonly in use today, and uses the 'Cde'
IAIA Type A A Anti -B nomenclature.
C or c C or c
IAIo Type A A Anti -B
IBIB Type B B Anti -A D or d D or d
IBIo Type B B Anti -A

E or e E or e
Neither
IAIB Type AB A and B Anti-A
nor
Anti-B Fig. 4.1 Fischer and Race hypothesis
In the above Fig. 4.1, three pairs of Rh alleles

Anti -A (Cc, Dd and Ee) occur at 3 different loci on
IoIo Neither
Type O and homologous chromosome pair. The possible
A nor B
anti - B genotypes will be one C or c, one D or d, one
E or e from each chromosome. For e.g. CDE/
Rhesus or Rh Factor cde; CdE/cDe; cde/cde; CDe/CdE etc., All
The Rh factor or Rh antigen is found on genotypes carrying a dominant ‘D’ allele will
the surface of erythrocytes. It was discovered produce Rh positive phenotype and double
in 1940 by Karl Landsteiner and Alexander recessive genotype ‘dd’ will give rise to Rh
Wiener in the blood of rhesus monkey, negative phenotype.
Macaca rhesus and later in human beings. Wiener Hypothesis
The term ‘Rh factor’ refers to “immunogenic Wiener proposed the existence of eight
D antigen of the Rh blood group system’’. An alleles (R1, R2, R0, Rz, r, r1, r11, r y) at a single
individual having D antigen are Rh D positive Rh locus. All genotypes carrying a dominant
(Rh+) and those without D antigen are Rh D ‘R allele’ (R1, R2 ,R0 ,Rz) will produce Rh
negative (Rh-). Rhesus factor in the blood positive phenotype and double recessive
is inherited as a dominant trait. Naturally genotypes (rr, r1r1, r11r11, r yr y) will give rise to
occurring Anti D antibodies are absent in the Rh negative phenotype.
plasma of any normal individual. However if
an Rh- (Rh negative) person is exposed to Rh+ 4.3.1 Incompatibility of Rh Factor –
(Rh positive) blood cells (erythrocytes) for Erythroblastosis foetalis
the first time, anti D antibodies are formed Rh incompatability has great significance
in the blood of that individual. On the other in child birth. If a woman is Rh negative and
hand, when an Rh positive person receives Rh the man is Rh positive, the foetus may be
negative blood no effect is seen. Rh positive having inherited the factor from
47 Principles of Inheritance and Variation

www.tntextbooks.in
its father. The Rh negative mother becomes organisms. The chromosomes other than the
sensitized by carrying Rh positive foetus within sex chromosomes of an individual are called
her body. Due to damage of blood vessels, autosomes. Sex chromosomes may be similar
during child birth, the mother’s immune (homomorphic) in one sex and dissimilar
system recognizes the Rh antigens and gets (heteromorphic) in the other. Individuals
sensitized. The sensitized mother produces Rh having homomorphic sex chromosomes
antibodies. The antibodies are IgG type which produce only one type of gametes
are small and can cross placenta and enter the (homogametic) whereas heteromorphic
foetal circulation. By the time the mother gets individuals produce two types of gametes
sensitized and produce anti ‘D’ antibodies, the (heterogametic).
child is delivered.
Usually no effects are associated with Y CHROMOSOME
exposure of the mother to Rh positive antigen The human Y chromosome
during the first child birth, subsequent Rh is only 60 Mb in size with
positive children carried by the same mother, 60 functional genes whereas
may be exposed to antibodies produced by X chromosomes are 165 Mb in size with
the mother against Rh antigen, which are about 1,000 genes.
carried across the placenta into the foetal
blood circulation. This causes haemolysis of Chromosomal basis of sex
foetal RBCs resulting in haemolytic jaundice determination
and anaemia. This condition is known as Heterogametic Sex
Erythoblastosis foetalis or Haemolytic Determination:
disease of the new born (HDN). In heterogametic sex
Prevention of Erythroblastosis foetalis determination one of the
If the mother is Rh negative and foetus sexes produces similar
is Rh positive, anti D antibodies should be gametes and the other
administered to the mother at 28th and 34th sex produces dissimilar gametes. The sex of
week of gestation as a prophylactic measure. the offspring is determined at the time of
If the Rh negative mother delivers Rh fertilization.
positive child then anti D antibodies should Heterogametic Males
be administered to the mother soon after In this method of sex determination the
delivery. This develops passive immunity and males are heterogametic producing dissimilar
prevents the formation of anti D antibodies in gametes while females are homogametic
the mothers blood by destroying the Rh foetal producing similar gametes. It is of two kinds
RBC before the mother’s immune system is XX-XO type (e.g. Bugs, cockroaches and
sensitized. This has to be done whenever the grasshoppers) and XX-XY type (e.g. Human
woman attains pregnancy. beings and Drosophila).
4.4 Sex Determination Heterogametic Females
Sex determination is the method by In this method of sex determination the
which the distinction between male and females are heterogametic producing dissimilar
female is established in a species. Sex gametes while males are homogametic
chromosomes determine the sex of the producing similar gametes. To avoid
individual in dioecious or unisexual confusion with the XX-XO and XX-XY types

www.tntextbooks.in
of sex determination, the alphabets ‘Z’ and ‘W’ during meiosis. The remaining 95% of the
are used here instead of X and Y respectively. Y chromosome is referred as the Non -
Heterogametic females are of two types, combining Region of the Y (NRY). The NRY
ZO-ZZ type (eg. Moths, butterflies and is divided equally into functional genes
domestic chickens) and ZW-ZZ type (euchromatic) and non functional genes
(eg. Gypsy moth, fishes, reptiles and birds). (heterochromatic). Within the euchromatin
regions, is a gene called Sex determining
Sex determination in human beings
region Y (SRY). In humans, absence of
Genes determining sex in human beings are
Y chromosome inevitably leads to female
located on two sex chromosomes, called
development and this SRY gene is absent in
allosomes. In mammals, sex determination is
X chromosome. The gene product of SRY is the
associated with chromosomal differences
testes determining factor (TDF) present in the
between the two sexes, typically XX females and
adult male testis.
XY males. 23 pairs of human chromosomes
include 22 pairs of autosomes (44A) and one pair
4.4.1 Genic balance in Drosophila
of sex chromosomes (XX or XY). Females are
Genic balance mechanisms of sex
homogametic producing only one type of gamete
determination in Drosophila was first studied
(egg), each containing one X chromosome while
by C.B. Bridges. In Drosophila, the presence
the males are heterogametic producing two types
of Y chromosome is essential for the fertility
of sperms with X and Y chromosomes. An
of male sex, but does not determine the male
independently evolved XX: XY system of sex
sex. The gene for femaleness is located on the
chromosomes also exist in Drosophila
X chromosome and those for maleness are
(Fig. 4.2).
located on the autosomes. When geneticist
Male Female
(Heterogametic) (Homogametic) C.B. Bridges, working with Drosophila, crossed
Parents 44A + XY 44A + XX a triploid (3n) female with a normal male, he
Gametes Sperms Ova observed many combinations of autosomes
(22A+X) (22A+Y) (22A+X) (22A+X) and sex chromosomes in the offspring. From
his results Bridges in 1921 suggested that sex
in Drosophila is determined by the balance
between the genes for femaleness located on
Offsprings/ the X chromosomes and those for maleness
Progeny (44A+XX) (44A+XY) (44A+XX) (44A+XY) located on the autosomes. Hence the sex of an
Female Male Female Male individual is determined by the ratio of its X
Fig. 4.2 Sex determination in human beings chromosome to that of its autosome sets. This
ratio is termed sex index and is expressed as:
The Y Chromosome and Male
Development X
Number of X Chromosomes
Current analysis of Y chromosomes has Sex index =
Number of Sets of Autosomes A
revealed numerous genes and regions with
potential genetic function; some genes with
or without homologous counterparts are Change in this ratio leads to a changed sex
seen on the X. Present at both ends of the phenotype. The results obtained from a cross
Y chromosome are the pseudoautosomal regions between triploid female Drosophila (3A:3X)
(PARs) that are similar with regions on the with a diploid male (2A: XY) is shown in
X chromosome which synapse and recombine tables 4.2. and 4.3.

www.tntextbooks.in
Table: 4.2 Bridges classical cross of a triploid (X/A = 0.33) and metafemales (X/A=1.50) are
(3A+XXX) female fly and a diploid (2A+XY) usually very weak and sterile.
male fly A sex–switch gene in Drosophila directs
female development. This gene, sex–lethal
Triploid Diploid (SxL) located on the X chromosome, has
Parent 3A + XXX 2A + XY two states of activity. When it is ‘on’ it directs
Gametes (2A + XX) (A + X) (A + X) (A + Y) female development and when it is ‘off ’
(2A + X) (A + XX) maleness ensures. Other genes located on the
A+X A+Y X chromosome and autosomes regulate this
2A+XX 3A + XXX 3A + XXY sex-switch gene. However, the Y- chromosome
Triploid Female Triploid Intersex of Drosophila is required for male fertility.
3A + XX 3A + XY Gynandromorphs
2A+X Triploid Intersex Super Male These individuals have parts of their
body expressing male characters and other
2A + XXX 2A + XXY
parts of the body expressing female characters.
A+XX Super female Diploid Female
The organism is made up of tissues of male
2A + XX 2A + XY
and female genotype and represents a mosaic
A+X Diploid Female Diploid Male
pattern.
• X-Chromosome was discovered by
4.4.2 Dosage compensation -
Henking (1891) Barr body
• Y-Chromosome was discovered by In 1949, Barr and Bertram first observed a
Stevens (1902) condensed body in the nerve cells of female cat
which was absent in the male. This condensed
When the X : A ratio is 1.00 as in a normal body was called sex chromatin by them and
female, or greater than 1.00, the organism is a was later referred as Barr body. In the XY
female. When this ratio is 0.50 as in a normal chromosomal system of sex determination,
male or less than 0.50 the organism is a male. males have only one X chromosome, whereas
At 0.67, the organism is an intersex. metamales females have two. A question arises: how
Table: 4.3 Different doses of X chromosomes and autosome sets and
their effect on sex determination in Drosophila`
Number of X
Number of chromosome
Number of ‘X’
Phenotype Autosome sets Sex Index =
Chromosomes (X) Number of
(A)
autosome sets
Meta female / Super female 3 2 3/2 = 1.5
Tetraploid 4 4 4/4 = 1.0
Normal
Triploid 3 3 3/3 = 1.0
Female
Diploid 2 2 2/2 = 1.0
Haploid 1 1 1/1 = 1.0
Inter sex 2 3 2/3 = 0.67
Normal male 1 2
½ = 0.50
Meta male / Super male 1 3 1/3 = 0.33

www.tntextbooks.in
does the organism compensate for this dosage 4.5 Sex Linked Inheritance
differences between the sexes? In mammals the The inheritance of a trait that is
necessary dosage compensation is accomplished determined by a gene located on one of the sex
by the inactivation of one of the X chromosome chromosomes is called sex linked inheritance.
in females so that both males and females have Genes present on the differential region of
only one functional X chromosome per cell. X or Y chromosomes are called sex linked
Mary Lyon suggested that Barr bodies genes. The genes present in the differential
represented an inactive chromosome, which region of X chromosome are called
in females becomes tightly coiled into a X linked genes. The X–linked genes have no
heterochromatin, a condensed and visible form corresponding alleles in the Y chromosome.
of chromatin (Lyon’s hypothesis). The number The genes present in the differential region
of Barr bodies observed in cell was one less than of Y chromosome are called Y- linked or
the number of X-Chromosome. XO females holandric genes. The Y linked genes have no
have no Barr body, whereas XXY males have corresponding allele in X chromosome. The
one Barr body. Y linked genes inherit along with
Y chromosome and they phenotypically express
• The number of Barr bodies follows only in the male sex. Sex linked inherited
N-1 rule (N minus one rule), where N traits are more common in males than females
is the total number of X chromosomes because, males are hemizygous and therefore
present. express the trait when they inherit one mutant
allele. The X – linked and Y – linked genes
Haplodiploidy in Honeybees in the differential region (non–homologus
In hymenopteran insects such as region) do not undergo pairing or crossing
honeybees, ants and wasps a mechanism of sex over during meiosis. The inheritance of X or
determination called haplodiploidy mechanism Y linked genes is called sex-linked inheritance.
of sex determination is common. In this
4.5.1 Inheritance of X - linked genes
system, the sex of the offspring is determined
Red-green colour blindness or daltonism,
by the number of sets of chromosomes it
haemophilia and Duchenne’s muscular dystrophy
receives. Fertilized eggs develop into females
are examples of X-linked gene inheritance in
(Queen or Worker) and unfertilized eggs
humans.
develop into males (drones) by parthenogenesis.
It means that the males have half the number 1. Haemophilia
of chromosomes (haploid) and the females Haemophilia is commonly known as
have double the number (diploid), hence the bleeder’s disease, which is more common in
name haplodiplody for this system of sex men than women. This hereditary disease
determination. was first reported by John Cotto in 1803.
This mode of sex determination facilitates Haemophilia is caused by a recessive X-linked
the evolution of sociality in which only one gene. A person with a recessive gene for
diploid female becomes a queen and lays the haemophilia lacks a normal clotting substance
eggs for the colony. All other females which are (thromboplastin) in blood, hence minor
diploid having developed from fertilized eggs injuries cause continuous bleeding, leading to
help to raise the queen’s eggs and so contribute death. The females are carriers of the disease
to the queen’s reproductive success and and would transmit the disease to 50% of
indirectly to their own, a phenomenon known their sons even if the male parent is normal.
as Kin Selection. The queen constructs their Haemophilia follows the characteristic
social environment by releasing a hormone that criss - cross pattern of inheritance.
suppresses fertility of the workers.

www.tntextbooks.in
2. Colour blindness ii) Marriage between normal visioned man

In human beings a dominant X – linked and colour blind woman
gene is necessary for the formation of colour If a colour blind woman
sensitive cells, the cones. The recessive form (X Xc) marries a normal
c
of this gene is incapable of producing colour visioned male (X+Y), all

sensitive cone cells. Homozygous recessive
F1 sons will be colourblind
females (XcXc) and hemizygous recessive males
and daughters will be
(XcY) are unable to distinguish red and green
normal visioned but are carriers.
colour. The inheritance of colour blindness
can be studied in the following two types of Marriage between F1 carrier female with a
marriages. colour blind male will produce normal visioned
carrier daughter, colourblind daughter, normal
(i) M arriage between colour blind man
and normal visioned woman visioned son and a colourblind son in the
A marriage between a colour blind man F2 generation (Fig. 4.4).
;F;F ; ;<
and a normal visioned woman will produce 3DUHQW &RORXUEOLQGIHPDOH 1RUPDOPDOH
normal visioned male and female individuals
in F1 generation but the females are carriers. ;F ;F ;
*DPHWHV <
The marriage between a F1 normal visioned
carrier woman and a normal visioned male
will produce one normal visioned female,
one carrier female, one normal visioned male
) ;F; ;F<
and one colour blind male in F2 generation.
1RUPDOEXWFDUULHU &RORXUEOLQGPDOH
Colour blind trait is inherited from the IHPDOH ;F<
male parent to his grandson through carrier ;F;
daughter, which is an example of criss-cross

*DPHWHV ; ;F ;F <
pattern of inheritance (Fig. 4.3).
;; ; ;F<
3DUHQW 1RUPDOIHPDOH &RORXUEOLQGPDOH
) ;F; ;< ;F;F ;F<
*DPHWHV 1RUPDOEXW 1RUPDO &RORXUEOLQG &RORXUEOLQG
; ; ;F < FDUULHUIHPDOH PDOH IHPDOH PDOH
Fig. 4.4 Marriage between normal visioned
man and colour blind woman
4.5.2 Inheritance of Y- linked genes
) ;;F ;< Genes in the non-homologous region
1RUPDOEXWFDUULHU 1RUPDOPDOH of the Y-chromosome are inherited directly
IHPDOH
from male to male. In humans, the Y-linked or
;;F ; ;<
holandric genes for hypertrichosis (excessive
*DPHWHV ; ;F ; < development of hairs on pinna of the ear) are
transmitted directly from father to son, because
males inherit the Y chromosome from the
) ;; ;< ;F; ;F< father. Female inherits only X chromosome
1RUPDO 1RUPDO 1RUPDOEXW &RORXUEOLQG from the father and are not affected.
IHPDOH PDOH FDUULHUIHPDOH PDOH
1RUPDOYLVLRQFDUULHUFRORXUEOLQG 4.6 Karyotyping
Fig. 4.3 Marriage between colour blind man Karyotyping is a technique through which
and normal visioned woman
a complete set of chromosomes is separated

www.tntextbooks.in
from a cell and the chromosomes are arranged Human Karyotype

in pairs. An idiogram refers to a diagrammatic Depending upon the position of the
representation of chromosomes. centromere and relative length of two arms,
Preparation of Karyotype human chromosomes are of three types:
Tjio and Levan (1960) described a simple Metacentric, sub metacentric and acrocentric.
method of culturing lymphocytes from the The photograph of chromosomes are arranged
human blood. Mitosis is induced followed by in the order of descending length in groups
addition of colchicine to arrest cell division from A to G (Fig. 4.5).
at metaphase stage and the suitable spread of 4.7 Pedigree Analysis
metaphase chromosomes is photographed. Pedigree is a “family tree”, drawn with
The individual chromosomes are cut from the standard genetic symbols, showing the
photograph and are arranged in an orderly inheritance pathway for specific phenotypic
fashion in homologous pairs. This arrangement characters.(Fig. 4.6). Pedigree analysis is the
is called a karyotype. Chromosome banding study of traits as they have appeared in a given
permits structural definitions and differentiation family line for several past generations.
of chromosomes.
Applications of Karyotyping
• It helps in gender identification.
• It is used to detect the chromosomal
aberrations like deletion, duplication,
translocation, nondisjunction of
chromosomes.
• It helps to identify the abnormalities of
chromosomes like aneuploidy.
• It is also used in predicting the evolutionary
relationships between species.
• Genetic diseases in human beings can be
detected by this technique.

$ %
Fig. 4.6 Symbols commonly used in pedigree charts
Genetic Disorders
A genetic disorder is a disease or syndrome
& that is caused by an abnormality in an individual
DNA. Abnormalities can range from a small

' ( mutation in a single gene to the addition or
subtraction of an entire chromosome or even
; < a set of chromosomes. Genetic disorders are
) * & *
of two types namely, Mendelian disorders and
Fig. 4.5 Human karyotype (male)
)LJ+XPDQNDU\RW\SHPDOH
chromosomal disorders.

www.tntextbooks.in
4.8 Mendelian disorders so phenylalanine accumulates and gets converted

Alteration or mutation in a single gene to phenylpyruvic acid and other derivatives. It is
causes Mendelian disorders. These disorders characterized by severe mental retardation, light
are transmitted to the offsprings on the same pigmentation of skin and hair. Phenylpyruvic acid
line as the Mendelian pattern of inheritance. is excreted in the urine.
Some examples for Mendelian disorders are
phenylalanine
Thalassemia, albinism, phenylketonuria, sickle hydroxylase
Phenylalanine Tyrosine
cell anaemia, Huntington's chorea, etc., These
disorders may be dominant or recessive and Albinism
autosomal or sex linked. Albinism is an inborn error of metabolism,
Thalassemia caused due to an autosomal recessive gene.
Thalassemia is an autosomal recessive Melanin pigment is responsible for skin colour.
disorder. It is caused by gene mutation resulting Absence of melanin results in a condition called
in excessive destruction of RBC’s due to the albinism. A person with the recessive allele
formation of abnormal haemoglobin molecules. lacks the tyrosinase enzyme system, which is
Normally haemoglobin is composed of four required for the conversion of dihydroxyphenyl
polypeptide chains, two alpha and two beta alanine (DOPA) into melanin pigment inside
globin chains. Thalassemia patients have defects the melanocytes. In an albino, melanocytes are
in either the alpha or beta globin chain causing present in normal numbers in their skin, hair,
the production of abnormal haemoglobin iris, etc., , but lack melanin pigment.
molecules resulting in anaemia.
3, 4 dihydroxy
Thalassemia is classified into alpha and beta Tyrosinase
phenylalanine Melanin
based on which chain of haemoglobin molecule
(DOPA)
is affected. It is controlled by two closely linked
genes HBA1 and HBA2 on chromosome 16. Huntington’s chorea
Mutation or deletion of one or more of the four It is inherited as an autosomal dominant
alpha gene alleles causes Alpha Thalassemia. lethal gene in man. It is characterized by
In Beta Thalassemia, production of beta globin involuntary jerking of the body and progressive
chain is affected. It is controlled by a single degeneration of the nervous system,
gene (HBB) on chromosome 11. It is the most accompanied by gradual mental and physical
common type of Thalassemia and is also known deterioration. The patients with this disease
as Cooley’s anaemia. In this disorder the alpha usually die between the age of 35 and 40.
chain production is increased and damages the 4.9 Chromosomal Abnormalities
membranes of RBC. Each human diploid (2n) body cell has
46 chromosomes (23 pairs). Chromosomal
Phenylketonuria disorders are caused by errors in the number
It is an inborn error of Phenylalanine
or structure of chromosomes. Chromosomal
metabolism caused due to a pair of autosomal anomalies usually occur when there is an
recessive genes. It is caused due to mutation error in cell division. Failure of chromatids
in the gene PAH (phenylalanine hydroxylase to segregate during cell division resulting in
gene) located on chromosome 12 for the hepatic the gain or loss of one or more chromosomes
enzyme “phenylalanine hydroxylase” This enzyme is called aneuploidy. It is caused by non-
is essential for the conversion of phenylalanine to disjunction of chromosomes. Group of
tyrosine. Affected individual lacks this enzyme, signs and symptoms that occur together and

www.tntextbooks.in
characterize a particular abnormality is called 2. Turner’s Syndrome (XO Females)

a syndrome. In humans, Down’s syndrome, This genetic disorder is due to the loss
Turner’s syndrome, Klinefelter's syndrome,
of a X chromosome resulting in a karyotype
Patau’s syndrome are some of the examples of
of 45,X. Persons with this syndrome have
chromosomal disorders.
45 chromosomes (44 autosomes and one X
a. Autosomal aneuploidy in human chromosome) (44AA+XO) and are sterile
beings females. Low stature, webbed neck, under
Several autosomal aneuploidies have been developed breast, rudimentary gonads lack of
reported in human beings. eg. Down’s syndrome menstrual cycle during puberty, are the main
(21-Trisomy), Patau’s syndrome (13-Trisomy). symptoms of this syndrome.
1. Down’s Syndrome/Trisomy – 21
Trisomic condition of chromosome - 21
4.10 E
xtra chromosomal /
results in Down’s syndrome. It is characterized by Cytoplasmic inheritance
severe mental retardation, defective development Certain characters are
of the central nervous system, increased separation controlled by non- nuclear
between the eyes, flattened nose, ears are malformed, genomes found in chloroplast,
mouth is constantly open and the tongue protrudes. mitochondria, infective agents
and plasmids. These characters
2. Patau’s Syndrome/Trisomy-13
do not reveal Mendelian
Trisomic condition of chromosome 13 pattern of inheritance. The inheritance of the
results in Patau’s syndrome. Meiotic non extra chromosomal genes are found to exhibit
disjunction is thought to be the cause for this maternal influence. Maternal effect is due to the
chromosomal abnormality. It is characterized
asymmetric contribution of the female parent
by multiple and severe body malformations as
to the development of zygote. Although both
well as profound mental deficiency. Small head
male and female parents contribute equally to
with small eyes, cleft palate, malformation of
the zygote in terms of chromosomal genes, the
the brain and internal organs are some of the
female parent usually contributes the zygote’s
symptoms of this syndrome.
initial cytoplasm and organelles, since the
b. Allosomal abnormalities in human sperms contain very little cytoplasm. If there are
beings hereditary units in the cytoplasm, these will be
Mitotic or meiotic non-disjunction of sex transmitted to the offsprings through the egg, so
chromosomes causes allosomal abnormalities. the offsprings exhibit maternal effect.
Several sex chromosomal abnormalities have
been detected. Eg. Klinefelter’s syndrome and The cytoplasmic extranuclear genes
Turner’s syndrome. have a characteristic pattern of inheritance
which do not resemble the genes of nuclear
1. Klinefelter’s Syndrome (XXY Males)
chromosomes and is known as extra
This genetic disorder is due to the presence chromosomal or extra nuclear or cytoplasmic
of an additional copy of the X chromosome inheritance and exhibit maternal influence.
resulting in a karyotype of 47,XXY. Persons In extra nuclear inheritance, male and female
with this syndrome have 47 chromosomes parents contribute equally their nuclear
(44AA+XXY). They are usually sterile males, genes to the progeny but do not make equal
tall, obese, with long limbs, high pitched voice, contribution of extra chromosomal genes
under developed genitalia and have feeble breast hence, the crosses can yield different (or) non
(gynaecomastia) development. Mendelian results. Cytoplasmic inheritance

www.tntextbooks.in
in animals can be studied with reference to Euphenics

shell coiling in Limnaea and kappa particles in The symptomatic treatment of genetic
Paramecium. disease of man is called Euphenics or Medical
4.11 Eugenics, Euphenics And engineering. In 1960 Joshua Lederberg coined
Euthenics the term Euphenics. It means normal appearing.
Eugenics It deals with the control of several inherited
human diseases especially the inborn errors of
Application of the laws of genetics for
metabolism. Eg. Phenylketonuria (PKU)
the improvement of human race is called
eugenics. The term eugenics means “well Euthenics
born” and was coined by Francis Galton in The science of improvement of existing
1885. For the betterment of future generations human race by improving the environmental
it is necessary to increase the population conditions is called euthenics. It can be
of outstanding people and to decrease the
achieved by subjecting them to better nutrition,
population of abnormal and defective people
better unpolluted ecological conditions, better
by applying the principles of eugenics.
education and sufficient medical facilities.
Two methods of Eugenics
(i) Constructive method or Positive eugenics Summary
(ii) Restrictive method or Negative eugenics Genetics is a branch of biology that deals
(i) Positive eugenics with the study of heredity and variation. It
describes how characteristics and features
Positive eugenics attempts to increase
pass on from the parents to their offsprings in
consistently better or desirable germplasm
successive generations. Variation is the degree by
and to preserve the best germplasm of the
which progeny differ from their parents. A set of
society. The desirable traits can be increased by
three or more alleles of the same gene occupying
adopting the following measures:
the same locus in a given pair of homologous
(i)
Early marriage of those having
chromosomes controlling a particular trait is
desirable traits
called Multiple allele. ABO blood grouping in
(ii) Subsiding the fit and establishing sperm man is a good example for multiple allelism.
and egg banks of precious germplasm Apart from A and B antigens, the RBC’s of
(iii)
Educating the basic principles of humans contain a special type of antigen called
genetics and eugenics Rh antigen/Rh factors. Erythroblastosis foetalis,
(iv)
Improvement of environmental also called haemolytic disease of the newborn,
conditions in which the red blood cells of a foetus are
(v) Promotion of genetic research destroyed due to maternal immune reaction
resulting from a blood group incompatibility
(ii) Negative eugenics
between the foetus and the mother.
Negative Eugenics attempts to eliminate the
defective germplasm of the society by adopting The mechanism of determination of male
the following measures: and female individuals in a species is called sex
(i) Sexual separation of the defectives determination. The chromosomes are different
in two sexes and referred to as allosomes; the
(ii) Sterilization of the defectives
remaining chromosomes are named autosomes.
(iii) Control of immigration and The inheritance of a trait that is determined by
(iv) Regulation of marriages a gene located on one of the sex chromosomes

www.tntextbooks.in
is called sex linked inheritance. Haemophilia, 2. ABO blood group in man is controlled by
colourblindness, muscular dystrophy are some a) Multiple alleles
examples for X linked inheritance in human b) Lethal genes
beings. c) Sex linked genes
d) Y-linked genes
Pedigree analysis is the study of traits as
they have appeared in a given family line for 3. Three children of a family have blood
several generations. The genetic disorders are groups A, AB and B. What could be the
of two types- Mendelian and chromosomal. genotypes of their parents?
Alternations or mutation in single gene causes a) IA IB and Io Io b) IA Io and IBIo
Mendelian disorders like, thalassemia, albinism, c) IB IB and IA IA d) IA IA and Io Io
phenylketonuria, and Huntington’s chorea. 4. Which of the following is not correct?
Chromosomal abnormalities arise due to a) Three or more alleles of a trait in the
chromosomal non-disjunction, translocation, population are called multiple alleles.
deletion, duplication and inversion. Downs b) A normal gene undergoes mutations
syndrome, Klinefelter’s syndrome, Turner’s to form many alleles.
syndrome and Patau’s syndrome are some of the c) Multiple alleles map at different loci
chromosomal disorders. Downs syndrome is of a chromosome.
due to trisomy of chromosome 21. Presence of d) A diploid organism has only two
trisomic condition of chromosome 13 results in alleles out of many in the population.
Patau’s syndrome. In Turner’s syndrome the sex 5. Which of the following phenotypes in the
chromosome is XO and in Klinefelter’s syndrome progeny are possible from the parental
the condition is XXY. An idiogram refers to a combination AxB?
diagrammatic representation of chromosomes. a) A and B only
The cytoplasmic extra nuclear genes have a b) A,B and AB only
characteristic pattern of inheritance which does c) AB only
not resemble genes of nuclear chromosomes d) A,B,AB and O
and are known as Extrachromosomal/ 6. Which of the following phenotypes is not
Cytoplasmic inheritance. The betterment of possible in the progeny of the parental
genotypic combination IAIO X IAIB?
human race can be achieved by methods like
Eugenics, Euthenics and Euphenics. a) AB b) O
c) A d) B
Evaluation 7. Which of the following is true about
1. Haemophilia is more Rh factor in the offspring of a parental
common in males combination DdxDd (both Rh positive)?
because it is a a) All will be Rh-positive
a) Recessive character b) Half will be Rh positive
carried by Y-chromosome c) About ¾ will be Rh negative
b)
Dominant character carried by d) A
bout one fourth will be Rh
Y-chromosome negative
c)
Dominant trait carried by 8. What can be the blood group of offspring
X-chromosome when both parents have AB blood group?
d)
Recessive trait carried by a) AB only b) A, B and AB
X-chromosome c) A, B, AB and O d) A and B only

www.tntextbooks.in
9. If the childs blood group is ‘O’ and fathers 16. Females with Turners’ syndrome have
blood group is ‘A’ and mother’s blood a) Small uterus
group is ‘B’ the genotype of the parents b) Rudimentary ovaries
will be c) Underdeveloped breasts
d) All of these
a) IA IA and IB Io b) IA Io and IB Io
c) IA Io and IoIo d) IoIo and IB IB 17. Pataus’ syndrome is also referred to as
10. XO type of sex determination and XY type a) 13-Trisomy b) 18-Trisomy
of sex determination are examples of c) 21-Trisomy d) None of these
a) Male heterogamety 18. “Universal Donor” and “Universal

b) Female heterogamety Recipients” blood group are _____
c) Male homogamety and_______respectively
d) Both (b) and (c) a) AB, O b) O, AB
11. In an accident there is great loss of c) A, B d) B, A
blood and there is no time to analyse the 19. ZW-ZZ system of sex determination
blood group which blood can be safely occurs in
transferred? a) Fishes b) Reptiles
a) O and Rh negative c) Birds d) All of these
b) O and Rh positive 20. Co-dominant blood group is
c)B and Rh negative a) A b) AB
d) AB and Rh positive c) B d) O
12. Father of a child is colourblind and
21. Which of the following is incorrect
mother is carrier for colourblindness, the
regarding ZW-ZZ type of sex
probability of the child being colourblind
determination?
is
a) 25% b) 50% a) It occurs in birds and some reptiles
c) 100% d) 75% b) Females are homogametic and
males are heterogametic
13. A marriage between a colourblind man c) Male produce two types of gametes
and a normal woman produces d) It occurs in gypsy moth
a)
All carrier daughters and normal 22. Who is the founder of Modern Eugenics
sons movement?
b) 50% carrier daughters and 50% a) Mendel b) Darwin
normal daughters c) Francis Galton d) Karl Pearson
c) 50% colourblind sons and 50% normal 23. Improvement of human race by
sons encouraging the healthy persons to marry
d) All carrier offsprings early and produce large number of children
14. Down's syndrome is a genetic disorder is called
which is caused by the presence of an
a) Positive eugenics
extra chromosome number
b) Negative eugenics
a) 20 b) 21 c) Positive euthenics
c) 4 d) 23 d) Positive euphenics
15. Klinefelters’ syndrome is characterized by 24. The _______deals with the control
a karyotype of of several inherited human diseases
a) XYY b) XO especially inborn errors of metabolism
c) XXX d) XXY a) Euphenics b) Eugenics
c) Euthenics d) All of these

www.tntextbooks.in
25. What is haplodiploidy? 36. Brief about female heterogamety.

26. Distinguish between heterogametic and 37. Give an account of genetic control of Rh
homogametic sex determination systems. factor.
27. What is Lyonisation? 38. Explain the mode of sex determination in
28. What is criss-cross inheritance? honeybees.
29. Why are sex linked recessive characters 39. What are the applications of Karyotyping?
more common in the male human beings? 40. Explain the inheritance of sex linked
30. What are holandric genes? characters in human being.
31. Mention the symptoms of Phenylketonuria. 41. What is extra chromosomal inheritance?
32. Mention the symptoms of Down's 42. Differentiate Intersexes from Supersexes.
syndrome. 43. Discuss the genic balance mechanism
33. Explain the genetic basis of ABO blood of sex determination with reference to
grouping in man. Drosophila.
34. How is sex determined in human beings? 44. Comment on the methods of Eugenics.
35. What is male heterogamety?

www.tntextbooks.in
Concept Map
6LPSOH
0XOWLSOHDOOHOHV GRPLQDQFH
(J$%2EORRG
JURXSLQJLQ
KXPDQEHLQJ &RGRPLQDQFH
;OLQNHG(J
+DHPRSKLOLD
&RORXUEOLQGQHVV
6H[OLQNHG
,QKHULWDQFH <OLQNHG(J
+\SHUWULFKRVLV
.DU\RW\SLQJ 3HGLJUHHDQDO\VLV
([WUD
FKURPRVRPDO
&\WRSODVPLF
LQKHULWDQFH
(J.DSSD
SDUWLFOHV
LQSDUDPLFLXP
6KHOOFRLOLQJLQ
VQDLOV
;;)HPDOH;20DOH
3ULQFLSOHVRI (J%XJVFRFNURDFKHV
*UDVVKRSSHUV
LQKHULWDQFH
DQGYDULDWLRQ 0DOH
KHWHURJDPHW\ ;;)HPDOH;<0DOH
(J0DQ%DUUERGLHV;
LQDFWLYDWLRQ'URVRSKLOD
*HQLFEDODQFHPHFKDQLVP
6H[ =2)HPDOH==0DOH
GHWHUPLQDWLRQ (J0RWKV
%XWWHUIOLHV'RPHVWLFFKLFNHQV
)HPDOH
KHWHURJDPHW\
=:)HPDOH==0DOH
(J%LUGV5HSWLOHV
VRPH)LVKHV
+DSORGLSORLG\

(J+RQH\EHHV
7KDODVVHPLD$OELQLVP
0HQGHOLDQ 3KHQ\ONHWRQXULD
GLVRUGHUV +XQWLQJWRQ
VFKRUHD
*HQHWLF
GLVRUGHUV
'RZQ
VV\QGURPH.OLQHIHWHU
V
&KURPRVRPDO
V\QGURPH7XUQHU
VV\QGURPH
GLVRUGHUV
3DWDX
VV\QGURPH
9DULDWLRQ (XJHQLFV(XSKHQLFV
(XWKHQLFV

www.tntextbooks.in
5
UNIT - II
Molecular
Genetics
CHAPTER
New life for Woolly Mammoth DNA-researchers

Chapter Outline can now re-create the genes of mammoth and
study the proteins they encoded
5.1 Gene as the functional unit of inheritance
5.2 In search of the genetic material
M
5.3 DNA is the genetic material endel’s theory dispelled the mystery
5.4 Chemistry of nucleic acids
of why traits seemed to appear and
5.5 RNA world
5.6 Properties of genetic material disappear magically from one generation to
5.7 Packaging of DNA helix the next. Mendel’s work reveals the patterns of
5.8 DNA Replication heredity and reflect the transmission of evolved
5.9 Transcription information from parents to offspring. This
5.10 Genetic code information is located on the chromosomes.
5.11 tRNA – the adapter molecule One of the most advanced realizations of
5.12 Translation
human knowledge was that our unique
5.13 Regulation of Gene expression
5.14 Human Genome Project (HGP) characteristics are encoded within molecules
5.15 DNA finger printing technique of DNA. The discovery that DNA is the genetic
material left several questions unanswered.
How is the information in DNA used? Scientists
Learning Objectives
now know that DNA directs the construction
➢ Identifies DNA as the genetic material. of proteins. Proteins determine the shapes of
➢ Understands the organization of prokaryotic cells and the rate of chemical reactions, such
and eukaryotic genome. as those that occur during metabolism and
➢ Learns to differentiate the nucleotides of DNA photosynthesis. The hereditary nature of every
and RNA. living organism is defined by its genome,
➢ Understands gene expression - which consists of a long sequence of nucleic
Replication, Transcription and
acids that provide the information needed to
Translation.
construct the organism. The genome contains
➢ Learns about codons and the
salient features of genetic code. the complete set of hereditary information for
➢ Understands the gene regulation any organism. The genome may be divided into
through Lac operon model. a number of different nucleic acid molecules.
➢ Realizes the importance of Human Genome Each of the nucleic acid molecule may contain
Project. large number of genes. Each gene is a sequence
➢ Illustrates the applications of DNA finger within the nucleic acid that represents a single
printing technique.
protein. In this chapter we will discuss the
61

www.tntextbooks.in
structure of DNA, its replication, the process

of making RNA from DNA (transcription), the One gene-one enzyme hypothesis
genetic code that determines the sequence of The experiments of George Beadle
amino acid in protein synthesis (translation), and Edward Tatum in the early 1940’s
regulation of gene expression and the essentials on Neurospora crassa (the red bread
of human genome sequencing. mould) led them to propose one gene-
one enzyme hypothesis, which states that
5.1 Gene as the functional unit one gene controls the production of one
of inheritance enzyme.
A gene is a basic physical and functional One gene-one polypeptide hypothesis
unit of heredity. The concept of the gene It was observed that an enzyme
was first explained by Gregor Mendel in may be composed of more than one
1860’s. He never used the term ‘gene’. He polypeptide chain and a gene can code
called it ‘factor’. In 1909, the Danish biologist for only one polypeptide chain. Thus one
Wilhelm Johannsen, coined the term ‘gene’, gene-one polypeptide hypothesis states
that was referred to discrete determiners of that one gene controls the production of
inherited characteristics. only one polypeptide chain of an enzyme
molecule.
According to the classical concept of
gene introduced by Sutton in 1902, genes 5.2 In search of the genetic material
have been defined as discrete particles that
As early as 1848, Wilhelm Hofmeister,
follow Mendelian rules of inheritance,
a German botanist, had observed that cell
occupy a definite locus in the chromosome nuclei organize themselves into small,
and are responsible for the expression of rod like bodies during mitosis called
specific phenotypic character. They show the chromosomes. In 1869, Friedrich Miescher,
following properties: a Swiss physician, isolated a substance from
• Number of genes in each organism is the cell nuclei and called it as nuclein. It
more than the number of chromosomes; was renamed as nucleic acid by Altman
hence several genes are located on the (1889), and is now known as DNA. By 1920,
it became clear that chromosomes are made
same chromosome.
up of proteins and DNA. Many experiments
• The genes are arranged in a single linear were carried out to study the actual carriers
order like beads on a string. of genetic information. Griffith's experiment
• Each gene occupies a specific position proved that DNA is the genetic material
which has been dealt in class XI. Bacterial
called locus.
transformation experiments provided the
• Genes may exist in several alternate forms first proof that DNA is the genetic material.
called alleles. However, he could not understand the
• Genes may undergo sudden change cause of bacterial transformation, and the
in positions and composition called biochemical nature of genetic material was
not defined from his experiments.
mutations.
Later, Oswald Avery, Colin Macleod and
• Genes are capable of self-duplication Maclyn McCarty in 1944 repeated Griffith’s
producing their own copies. experiments in an ‘in vitro’ system in order
Molecular Genetics 62

www.tntextbooks.in
+\SRWKHVLV7KHJHQHWLFPDWHULDORIWKHFHOOLVHLWKHUSURWHLQRUQXFOHLFDFLG'1$RU51$
5HPRYHOLSLGVDQG
VXJDUVIURPDVROXWLRQRI
+HDWNLOOHG /LSLGV KHDWNLOOHG6FHOOV
6FHOOV 6XJDUV 3URWHLQV51$DQG'1$
UHPDLQ
$GGSURWHLQDVH $GG51DVH $GG'1DVH 7UHDWVROXWLRQVZLWK

HQ]\PHVWRGHVWUR\
SURWHLQ51$RU'1$
123527(,1 1251$ 12'1$
$GGWRFXOWXUHFRQWDLQLQJ
$GG5FHOOV $GG5FHOOV $GG5FHOOV
OLYLQJ5FHOOV2EVHUYHIRU
WUDQVIRUPDWLRQE\WHVWLQJ
IRUWKHSUHVHQFHRI
YLUXOHQW6FHOOV
6FHOOVDSSHDU 6FHOOVDSSHDU 1R6FHOOV
&RQFOXVLRQ7UDQVIRUPDWLRQUHTXLUHV'1$WKHUHIRUHLWLVWKHJHQHWLFPDWHULDORIWKHFHOO
Fig. 5.1 Transformation experiment of Avery et. al., (1944)
to identify the nature of the transforming proteases (an enzyme which destroys protein)
substance responsible for converting a non- did not affect the transformation. Digestion
virulent strain into virulent strain. They with DNase inhibited transformation
observed that the DNA, RNA and proteins suggesting that the DNA caused the
isolated from the heat-killed S-strain transformation. These experiments suggested
when added to R-strain changed their that DNA and not proteins is the genetic
surface character from rough to smooth material. The phenomenon, by which DNA
and also made them pathogenic (Fig. 5.1). isolated from one type of cell (S – strain),
But when the extract was treated with when introduced into another type (R-strain),
DNase (an enzyme which destroys DNA) is able to retain some of the properties of the
the transforming ability was lost. RNase S - strain is referred to as transformation.
(an enzyme which destroys RNA) and
63 Molecular Genetics

www.tntextbooks.in
Radioactive Sulfur (35S)

Bacteriophages Radioactive Phosphorus (32 P)
labelled DNA (red)
labelled protein capsule (red)
Infection
Blending
Radioactive Sulfur (35S)

No Radioactivity detected
detected in supernatant
in supernatant
Centrifugation
After centrifugation After centrifugation Radioactive

no Radioactive Sulfur (35S) Phosphorus (32 P)
detected in cells. detected in cells.
Fig. 5.2 The Hershey-Chase (blender) experiment
5.3 DNA is the genetic material phages (virus) are added to bacteria, they
Many biologists despite the earlier adsorb to the outer surface, some material
experiments of Griffith, Avery and others, enters the bacterium, and then later each
still believed that protein, not DNA, was the bacterium lyses to release a large number of
hereditary material in a cell. As eukaryotic progeny phage. Hershey and Chase wanted to
chromosomes consist of roughly equal observe whether it was DNA or protein that
amounts of protein and DNA, it was said entered the bacteria. All nucleic acids contain
that only a protein had sufficient chemical phosphorus, and proteins contain sulphur
diversity and complexity to encode the (in the amino acid cysteine and methionine).
information required for genetic material. Hershey and Chase designed an experiment
In 1952, however, the results of the using radioactive isotopes of Sulphur (35S)
Hershey-Chase experiment finally provided and phosphorus (32P) to keep separate track of
convincing evidence that DNA is the genetic the viral protein and nucleic acids during the
material. infection process. The phages were allowed
5.3.1 Hershey and Chase experiment to infect bacteria in culture medium which
on T2 bacteriophage containing the radioactive isotopes 35S or 32P.
The bacteriophage that grew in the presence of
Alfred Hershey and Martha Chase (1952) 35
S had labelled proteins and bacteriophages
conducted experiments on bacteriophages
grown in the presence of 32P had labelled DNA.
that infect bacteria. Phage T2 is a virus that
infects the bacterium Escherichia coli. When

www.tntextbooks.in
The differential labelling thus enabled them to Nitrogenous bases

identify DNA and proteins of the phage. The bases are nitrogen containing
Hershey and Chalse mixed the labelled molecules having the chemical properties
phages with unlabelled E. coli and allowed of a base (a substance that accepts H+ ion or
bacteriophages to attack and inject their proton in solution). DNA and RNA both have
genetic material. Soon after infection four bases (two purines and two pyrimidines)
(before lysis of bacteria), the bacterial cells in their nucleotide chain. Two of the bases,
were gently agitated in a blender to loosen the Adenine (A) and Guanine (G) have double
adhering phase particles. It was observed that carbon–nitrogen ring structures and are
only 32P was found associated with bacterial called purines. The bases, Thymine (T),
cells and 35S was in the surrounding medium Cytosine (C) and Uracil (U) have single ring
and not in the bacterial cells. When phage structure and these are called pyrimidines.
progeny was studied for radioactivity, it was Thymine is unique for DNA, while Uracil is
found that it carried only 32P and not 35S unique for RNA.
(Fig. 5.2). These results clearly indicate
that only DNA and not protein coat entered The phosphate functional group
the bacterial cells. Hershey and Chase It is derived from phosphoric acid
thus conclusively proved that it was DNA, (H3PO4), has three active OH- groups of which
not protein, which carries the hereditary two are involved in strand formation. The
information from virus to bacteria. phosphate functional group (PO4) gives DNA
and RNA the property of an acid (a substance
5.4 Chemistry of Nucleic Acids that releases an H+ ion or proton in solution)
Having identified the genetic material as at physiological pH, hence the name nucleic
the nucleic acid DNA (or RNA), we proceed acid. The bonds that are formed from
to examine the chemical structure of these phosphates are esters. The oxygen atom of the
molecules. Generally nucleic acids are a phosphate group is negatively charged after
long chain or polymer of repeating subunits the formation of the phosphodiester bonds.
called nucleotides. Each nucleotide subunit is This negatively charged phosphate ensures
composed of three parts: a nitrogenous base, the retention of nucleic acid within the cell or
a five carbon sugar (pentose) and a phosphate nuclear membrane.
group.
Nucleoside and nucleotide
Pentose sugar The nitrogenous base is chemically
There are two types of nucleic acids linked to one molecule of sugar (at the
depending on the type of pentose sugar. 1-carbon of the sugar) forming a nucleoside.
Those containing deoxyribose sugar are called When a phosphate group is attached to the
Deoxyribo Nucleic Acid (DNA) and those 5' carbon of the same sugar, the nucleoside
with ribose sugar are known as Ribonucleic becomes a nucleotide. The nucleotides are
Acid (RNA). DNA is found in the nucleus joined (polymerized) by condensation
of eukaryotes and nucleoid of prokaryotes. reaction to form a polynucleotide chain. The
The only difference between these two hydroxyl group on the 3' carbon of a sugar of
sugars is that there is one oxygen atom less in one nucleotide forms an ester with the
deoxyribose. phosphate of another nucleotide. The
chemical bonds that link the sugar

www.tntextbooks.in
components of adjacent nucleotides are called separated RNA from the protein of TMV
phosphodiester bond (5' 3'), indicating viruses. Three molecular biologists in the early
the polarity of the strand. 1980’s (Leslie Orgel, Francis Brick and Carl
The ends of the DNA or RNA are distinct. Woese) independently proposed the ‘RNA
The two ends are designated by the symbols world’ as the first stage in the evolution of
5' and 3'. The symbol 5' refers to carbon in the life, a stage when RNA catalysed all molecules
sugar to which a phosphate (PO4) functional necessary for survival and replication. The
group is attached. The symbol 3' refers to term ‘RNA world’ first used by Walter Gilbert
carbon in the sugar to which hydroxyl (OH) in 1986, hypothesizes RNA as the first genetic
functional group is attached. In RNA, every material on earth. There is now enough
nucleotide residue has an additional –OH evidence to suggest that essential life processes
group at 2' position in the ribose. (such as metabolism, translation, splicing etc.,)
Understanding the 5' 3' direction of a evolved around RNA. RNA has the ability to act
nucleic acid is critical for understanding the as both genetic material and catalyst. There are
aspects of replication and transcription. several biochemical reactions in living systems
Based on the X - ray diffraction analysis of that are catalysed by RNA. This catalytic
Maurice Wilkins and Rosalind Franklin, the RNA is known as ribozyme. But, RNA being
double helix model for DNA was proposed by a catalyst was reactive and hence unstable.
James Watson and Francis Crick in 1953. The This led to evolution of a more stable form of
highlight was the base pairing between the DNA, with certain chemical modifications.
two strands of the polynucleotide chain. This Since DNA is a double stranded molecule
proposition was based on the observations having complementary strand, it has resisted
of Erwin Chargaff that Adenine pairs with changes by evolving a process of repair. Some
Thymine (A = T) with two hydrogen bonds RNA molecules function as gene regulators by
and Guanine pairs with Cytosine (G ≡ C) binding to DNA and affect gene expression.
with three hydrogen bonds. The ratios Some viruses use RNA as the genetic material.
between Adenine with Thymine and Guanine Andrew Fire and Craig Mellow (recipients of
with Cytosine are constant and equal. The Nobel Prize in 2006) were of the opinion that
base pairing confers a unique property to RNA is an active ingredient in the chemistry of
the polynucleotide chain. They are said to be life. The types of RNA and their role have been
complementary to each other, that is, if the discussed in class XI.
sequence of bases in one strand (template) is
known, then the sequence in the other strand 5.6 Properties of genetic material
can be predicted. The salient features of DNA The experiment by Hershey and Chase
structure has already been dealt in class XI. clearly indicates that it is DNA that acts
as a genetic material. However, in some
5.5 RNA world viruses like Tobacco mosaic virus (TMV),
A typical cell contains about ten times as bacteriophage θB, RNA acts as the genetic
much RNA as DNA. The high RNA content material. A molecule that can act as a genetic
is mainly due to the variety of roles played by material should have the following properties:
RNA in the cell. Fraenkel-Conrat and Singer S elf Replication: It should be able to
•
(1957) first demonstrated that RNA is the replicate. According to the rule of base
genetic material in RNA containing viruses pairing and complementarity, both nucleic
like TMV (Tobacco Mosaic Virus) and they acids (DNA and RNA) have the ability to

www.tntextbooks.in
direct duplications. Proteins fail to fulfill RNA genome with shorter life span can
this criteria. mutate and evolve faster.
• Stability: It should be stable structurally and The above discussion indicates that both
chemically. The genetic material should be RNA and DNA can function as a genetic
stable enough not to change with different material. DNA is more stable, and is preferred
stages of life cycle, age or with change in for storage of genetic information.
physiology of the organism. Stability as one
of property of genetic material was clearly 5.7 Packaging of DNA helix
evident in Griffith’s transforming principle.
The distance between two consecutive
Heat which killed the bacteria did not
base pairs is 0.34nm (0.34×10-9m) of the
destroy some of the properties of genetic
DNA double helix in a typical mammalian
material. In DNA the two strands being
cell. When the total number of base pairs is
complementary, if separated (denatured) by
multiplied with the distance between two
heating can come together (renaturation)
consecutive base pairs (6.6 × 109 × 0.34 ×10-9
when appropriate condition is provided.
m/bp), the length of DNA double helix is
Further 2' OH group present at every
approximately 2.2 m. (The total length of the
nucleotide in RNA is a reactive
group that makes RNA liable and
$
easily degradable. RNA is also
known to be catalytic and reactive.
Hence, DNA is chemically more
stable and chemically less reactive
when compared to RNA. Presence 1XFOHRVRPH
of thymine instead of uracil in &RUH'1$
DNA confers additional stability +$ +% + +
to DNA. /LQNHU'1$
% +
• Information storage: It should be
able to express itself in the form
of ‘Mendelian characters’. RNA $
can directly code for protein $ &
synthesis and can easily express '
the characters. DNA, however

depends on RNA for synthesis
of proteins. Both DNA and RNA
can act as a genetic material, but )
DNA being more stable stores (
the genetic information and RNA

transfers the genetic information. +
'1$
+$+%+
DQG+WZR +LVWRQHRFWDPHU
• Variation through mutation: It PROHFXOHVHDFK
+ +LVWRQHSURWHLQ
should be able to mutate. Both

1XFOHRVRPH
DNA and RNA are able to mutate.
RNA being unstable, mutates at a Fig. 5.3 Condensation of DNA - A - DNA, B-Nucleosomes
faster rate. Thus viruses having and Histones, C- Chromatin fiber, D- Coiled chromatin
fiber, E- Coiled coil, F- metaphase chromatid

www.tntextbooks.in
double helical DNA = total number of base octameres and the two turns are sealed off by
pairs × distance between two consecutive an H1 molecule. Chromatin lacking H1 has a
base pairs). If the length of E. coli DNA is beads-on-a-string appearance in which DNA
1.36 mm, the number of base pairs in E. coli is enters and leaves the nucleosomes at random
4 ×106bp (1.36 × 103 m/0.34 ×10-9). The places. H1 of one nucleosome can interact
length of the DNA double helix is far greater with H1 of the neighbouring nucleosomes
than the dimension of a typical mammalian resulting in the further folding of the fibre.
nucleus (approximately 10-6 m). How is such a The chromatin fiber in interphase nuclei and
long DNA polymer packaged in a cell? mitotic chromosomes have a diameter that
Chromosomes are carriers of genes which vary between 200-300 nm and represents
are responsible for various characters from inactive chromatin. 30 nm fibre arises from the
generation to generation. Du Praw (1965) folding of nucleosome, chains into a solenoid
proposed a single stranded model (unineme), structure having six nucleosomes per turn. This
as a long coiled molecule which is associated structure is stabilized by interaction between
with histone proteins in eukaryotes. Plants different H1 molecules. DNA is a solenoid and
and animals have more DNA than bacteria packed about 40 folds. The hierarchical nature
and must fold this DNA to fit into the cell of chromosome structure is illustrated in
nucleus. In prokaryotes such as E. coli though (Fig. 5.3). Additional set of proteins are
they do not have defined nucleus, the DNA required for packing of chromatin at higher
is not scattered throughout the cell. DNA level and are referred to as non-histone
(being negatively charged) is held with some chromosomal proteins (NHC). In a typical
proteins (that have positive charges) in a nucleus, some regions of chromatin are
region called the nucleoid. The DNA as a loosely packed (lightly stained) and are
nucleoid is organized into large loops held referred to as euchromatin. The chromatin
by protein. DNA of prokaryotes is almost that is tightly packed (stained darkly) is
circular and lacks chromatin organization, called heterochromatin. Euchromatin is
hence termed genophore. transcriptionally active and heterochromatin
is transcriptionally inactive.
In eukaryotes, this organization is much more
complex. Chromatin is formed by a series of
repeating units called nucleosomes. Kornberg 5.8 DNA Replication
proposed a model for the nucleosome, in Replication of DNA takes place during the
which 2 molecules of the four histone proteins S phase of cell cycle. During replication, each
H2A, H2B, H3 and H4 are organized to DNA molecule gives rise to two DNA strands,
form a unit of eight molecules called histone identical to each other as well as to the parent
octamere. The negatively charged DNA strand. Three hypotheses of DNA replication
is wrapped around the positively charged have been proposed. They are conservative
histone octamere to form a structure called replication, dispersive replication, and semi-
nucleosome. A typical nucleosome contains conservative replication.
200 bp of DNA helix. The histone octameres In conservative replication, the original
are in close contact and DNA is coiled on double helix serves as a template. The original
the outside of nucleosome. Neighbouring molecule is preserved intact and an entirely
nucleosomes are connected by linker DNA new double stranded molecule is synthesized.
(H1) that is exposed to enzymes. The DNA In dispersive replication, the original molecule
makes two complete turns around the histone is broken into fragments and each fragment

www.tntextbooks.in
3' 5'
Semi-conservative replication was
T A
proposed by Watson and Crick in 1953. This
C G mechanism of replication is based on the
A T
Parent DNA model. They suggested that the two
C G polynucleotide strands of DNA molecule
C G
G C unwind and start separating at one end.
T A
During this process, covalent hydrogen bonds
C G are broken. The separated single strand then
T A
C G acts as template for the synthesis of a new
T A
strand. Subsequently, each daughter double
T A
Parental Parental helix carries one polynucleotide strand from
A T
strand A T strand the parent molecule that acts as a template
C 3' 5' C
C G C G
and the other strand is newly synthesised
G C and complementary to the parent strand
G C TA
T A (Fig. 5.4).
C G
C G T A
T A
T A
C G C G 5.8.1 Experimental proof of
A T
T A
DNA replication
T A
A T A T The mode of DNA replication was
5'
3'
3'
determined in 1958 by Meselson and Stahl.
5'
They designed an experiment to distinguish
Daughter
strands between semi conservative, conservative and
dispersive replications. In their experiment,
Fig. 5.4 Semiconservative DNA replication they grew two cultures of E.coli for many
serves as a template for the synthesis of generations in separate media. The ‘heavy’
complementary fragments. Finally two new culture was grown in a medium in which
molecules are formed which consist of both the nitrogen source (NH4Cl) contained the
old and new fragments. heavy isotope 15N and the ‘light’ culture was
grown in a medium in which the nitrogen
Generation I Generation II
15 14
N-DNA N-DNA 14
N-DNA
15
N-DNA 15
N-DNA
14
20 min 40 min N-DNA
14
Gravitational force N-DNA
15 15 14 15 14 14 14 15
N N N N N N N N
Heavy Hybrid Light Hybrid
Fig. 5.5 Meselson and Stahl experiment to support semiconservative mode of DNAreplication

www.tntextbooks.in
source contained light isotope 14N for many to mutation. However replication errors are
generations. At the end of growth, they corrected by repair enzymes such as nucleases.
observed that the bacterial DNA in the heavy Deoxy nucleoside triphosphate acts as substrate
culture contained only 15N and in the light and also provides energy for polymerization
culture only 14N. The heavy DNA could be reaction.
distinguished from light DNA (15N from 14N) Replication begins at the initiation site called
with a technique called Cesium Chloride the site of ‘origin of replication’ (ori). In
(CsCl) density gradient centrifugation. In prokaryotes, there is only one origin of
this process, heavy and light DNA extracted replication, whereas in eukaryotes with giant
from cells in the two cultures settled into two DNA molecules, there can be several origins of
distinct and separate bands (hybrid DNA) replication (replicons). Since the two strands of
(Fig. 5.5). DNA cannot be separated throughout at a time
The heavy culture (15N) was then transferred (due to large requirement of energy) the
into a medium that had only NH4Cl, and took replication occurs within a small opening of the
samples at various definite time intervals DNA helix called as replication fork. Unwinding
(20 minutes duration). After the first replication, of the DNA strand is carried out by DNA
they extracted DNA and subjected it to density helicase. Thus, in one strand (template strand
gradient centrifugation. The DNA settled with polarity 3' 5') the replication is
into a band that was intermediate in position continuous and is known as the leading strand
between the previously determined heavy while in the other strand (coding strand with
and light bands. After the second replication polarity 5' 3') replication is discontinuous,
(40 minutes duration), they again extracted known as the lagging strand (Fig. 5.6). The
DNA samples, and this time found the DNA discontinuously synthesized fragments of the
settling into two bands, one at the light band lagging strand (called the Okazaki fragments)
position and one at intermediate position. are joined by the enzyme DNA ligase.
These results confirm Watson and Crick’s semi
conservative replication hypothesis.
5.8.2 Enzymes and mechanism

of replication
In prokaryotes, replication process
requires three types of DNA polymerases
(DNA polymerase I, II, and III). DNA
polymerase III is the main enzyme involved
in DNA replication. DNA polymerase I
(also known as Kornberg enzyme) and
DNA polymerase II are involved in DNA
repair mechanism. Eukaryotes have five
types of DNA polymerases that catalyses
the polymerization of nucleotides at the
3' OH of the new strand within a short
period of time. E.coli that has 4.6 X 106 bp
completes its replication process within 38
minutes. Replication takes place faster at the Fig 5.6 Mechanism of replication showing a
same time accurately. Any error will lead replication fork

www.tntextbooks.in
As they move away in both directions, newly of information is reversed. RNA synthesizes
synthesized complementary nucleotides are DNA by reverse transcription, then transcribed
paired with the existing nucleotides on the into mRNA by transcription and then into
parent strand and covalently bonded together proteins by translation.
by DNA polymerase. Formation of new strand For a cell to operate, its genes must be
requires a primer (a short stretch of RNA)for expressed. This means that the gene products,
initiation. The primer produces a 3'-OH end on whether proteins or RNA molecules must be
the sequence of ribonucleotides, to which deoxy made. The RNA that carries genetic information
ribonucleotides are added. The RNA primer is encoding a protein from genes into the cell is
ultimately removed leaving a gap in the newly known as messenger RNA (mRNA). For a gene
synthesized DNA strand. It is removed from to be transcribed, the DNA which is a double
5' end one by one by the exonuclease activity helix must be pulled apart temporarily, and
of DNA polymerase. Finally, when all the RNA is synthesized by RNA polymerase. This
nucleotides are in position, gaps are sealed by enzyme binds to DNA at the start of a gene and
the enzyme DNA ligase. opens the double helix. Finally, RNA molecule
is synthesized. The nucleotide sequence in the
At the point of origin of replication, the
RNA is complementary to the DNA template
helicases and topoisomerases (DNA gyrase)
strand from which it is synthesized.
unwind and pull apart the strands, forming a
Y-Shaped structure called the replication fork. Both the strands of DNA are not copied
There are two replication forks at each origin. during transcription for two reasons. 1. If both
The two strands of a DNA helix have an the strands act as a template, they would code
antiparallel orientation. The enzyme DNA for RNA with different sequences. This in turn
polymerase can only catalyse the addition of a would code for proteins with different amino
nucleotide to the new strands in the 5' 3' acid sequences. This would result in one segment
of DNA coding for two different proteins, hence
direction, as it can only add nucleotides to the
complicate the genetic information transfer
3' carbon position.
machinery. 2. If two RNA molecules were
5.9 Transcription produced simultaneously, double stranded RNA
Francis Crick proposed the Central dogma complementary to each other would be formed.
of protein synthesis in molecular biology This would prevent RNA from being translated
states that genetic information flows as into proteins.
follows: 5.9.1 Transcription unit and gene
A transcriptional unit in DNA is defined by
three regions, a promoter, the structural gene
and a terminator. The promoter is located
towards the 5' end of the coding strand. It is a
DNA sequence that provides binding site for
RNA polymerase. The presence of promoter
The process of copying genetic information in a transcription unit, defines the template
from one strand of DNA into RNA is and coding strands. The terminator region
termed transcription. This process takes located towards the 3' end of the coding strand
place in presence of DNA dependent RNA contains a DNA sequence that causes the RNA
polymerase. In some retroviruses that contain polymerase to stop transcribing. In eukaryotes
the promoter has AT rich regions called
RNA as the genetic material (e.g, HIV), the flow
TATA box (Goldberg-Hogness box) and in

www.tntextbooks.in
Fig. 5. 7 Schematic structure of a transcription unit

prokaryotes this region is called Pribnow box. up the DNA to form the transcription bubble.
Besides promoter, eukaryotes also require an The core enzyme moves ahead, manufacturing
enhancer. RNA leaving the sigma subunit behind at the
The two strands of the DNA in the structural promoter region. The end of a gene is marked
gene of a transcription unit have opposite by a terminator sequence that forms a hair
polarity. DNA dependent RNA polymerase pin structure in the RNA. The sub-class of
catalyses the polymerization in only one terminators require a recognition protein,
direction, the strand that has the polarity known as rho (ρ), to function.
3' 5' acts as a template, and is called the
5.9.2 Process of transcription
template strand. The other strand which has
In prokaryotes, there are three major types of
the polarity 5' 3' has a sequence same as
RNAs: mRNA, tRNA, and rRNA. All three RNAs
RNA (except thymine instead of uracil) and is
are needed to synthesize a protein in a cell. The
displaced during transcription. This strand is
mRNA provides the template, tRNA brings amino
called coding strand (Fig. 5.7).
acids and reads the genetic code, and rRNAs play
The structural gene may be monocistronic
structural and catalytic role during translation.
(eukaryotes) or polycistronic (prokaryotes).
There is a single DNA-dependent RNA polymerase
In eukaryotes, each gene transcribes a single
that catalyses transcription of all types of RNA.
mRNA and encodes information for only a single
It binds to the promoter and initiates transcription
protein and is called monocistronic mRNA. In
(Initiation). The polymerases binding sites are
prokaryotes, clusters of related genes, known as
called promoters. It uses nucleoside triphosphate
operon, often found next to each other on the
as substrate and energy source and polymerases
chromosome are transcribed together to give a
in a template depended fashion following the
single mRNA and hence are polycistronic.
rule of complementarity. After the initiation
Before starting transcription, RNA polymerase of transcription, the polymerase continues to
binds to the promoter, a recognition sequence in elongate the RNA, adding one nucleotide after
front of the gene. Bacterial (prokaryotic) RNA another to the growing RNA chain. Only a short
polymerase consists of the core enzyme and the stretch of RNA remains bound to the enzyme,
sigma subunit. The core enzyme (2α, β, β1 and when the polymerase reaches a terminator at the
ω) is responsible for RNA synthesis whereas end of a gene, the nascent RNA falls off, so also the
a sigma subunit is responsible for recognition RNA polymerase.
of the promoter. Promoter sequences vary in
The question is, how the RNA polymerases
different organisms. RNA polymerase opens
are able to catalyse the three steps initiation,

www.tntextbooks.in
Initiation
3' 3'
5' 5'
Promoter σ RNA polymerase DNA helix
Sigma factor
In Eukaryotes, there are at
Elongation least three RNA polymerases
3'
in the nucleus (in addition
3'
to RNA polymerase found
5' 5' in the organelles). There is
Terminator
RNA σ a clear division of labour.
The RNA polymerase I
Termination transcribes rRNAs (28S, 18S
3' 3'
and 5.8S), whereas the RNA
polymerase III is responsible
5' 5'
for transcription of tRNA,
Rho factor ρ 5S rRNA and snRNA.
RNA The RNA polymerase
RNA Polymerase II transcribes precursor
Fig. 5. 8 Process of transcription in prokaryotes of mRNA, the
hnRNA (heterogenous nuclear RNA). In
elongation and termination? The RNA eukaryotes, the monocistronic structural
polymerase is only capable of catalyzing the genes have interrupted coding sequences
process of elongation. The RNA polymerase known as exons (expressed sequences) and non-
associates transiently with initiation factor sigma coding sequences called introns (intervening
(σ) and termination factor rho (r) to initiate sequences). The introns are removed by a process
and terminate the transcription, respectively. called splicing. hnRNA undergoes additional
Association of RNA with these factors instructs processing called capping and tailing. In capping
the RNA polymerase either to initiate or an unusual nucleotide, methyl guanosine
terminate the process of transcription (Fig. 5.8). triphosphate is added at the 5' end, whereas
adenylate residues (200-300) (Poly A) are added
In bacteria, since the mRNA does not
at the 3' end in tailing (Fig. 5.9). Thereafter,
require any processing to become active
this processed hnRNA, now called mRNA is
and also since transcription and translation
transported out of the nucleus for translation.
take place simultaneously in the same
compartment (since there is no separation of The split gene feature of eukaryotic genes
cytosol and nucleus in bacteria), many times is almost entirely absent in prokaryotes.
the translation can begin much before the Originally each exon may have coded for
mRNA is fully transcribed. This is because a single polypeptide chain with a specific
the genetic material is not separated from function. Since exon arrangement and intron
other cell organelles by a nuclear membrane removal are flexible, the exon coding for
consequently; transcription and translation these polypeptide subunits act as domains
can be coupled in bacteria. combining in various ways to form new genes.
Single genes can produce different functional

www.tntextbooks.in
DNA molecule? Are

5' 5' they written in
coded language on
3' 3' a DNA molecule?
Capping If they occur in the
3' m RNA
Intron language of codes
Cap Exon what is the nature
of genetic code?
m
Gppp Polyadenylation The translation of
5'
RNA splicing proteins follows
3' the triplet rule;
m
Gppp
5' a sequence of
Poly A tail three mRNA base
m
Gppp
(a codon) designates
5' one of the 20
3' different kinds of
Messenger 5'
m
Gppp
amino acids used in
RNA (m RNA)
protein synthesis.
Genetic code is the
Fig. 5.9 Process of transcription in eukaryotes
sequence relationship
proteins by arranging their exons in several
between nucleotide in genes (or mRNA) and
different ways through alternate splicing
the amino acids in the proteins they encode.
patterns, a mechanism known to play an
There are 64 possible triplets, and 61 of them are
important role in generating both protein and
used to represent amino acids. The remaining
functional diversity in animals. Introns would
three triplet codons are termination signals
have arosen before or after the evolution of
for polypeptide chains. Since there are only 20
eukaryotic gene. If introns arose late how did
amino acids involved in protein synthesis, most
they enter eukaryotic gene? Introns are mobile
of them are encoded by more than one triplet.
DNA sequences that can splice themselves out
Two things make this multiple (degenerate)
of, as well as into, specific ‘target sites’ acting
coding possible. First, there is more than one
like mobile transposon-like elements (that
tRNA for most amino acids. Each tRNA has
mediate transfer of genes between organisms
a different anticodon. Second, this pairing is
– Horizontal Gene Transfer - HGT). HGT
highly specific for the first two portions on the
occurs between lineages of prokaryotic
codon, permitting Watson and Crick base pairs
cells, or from prokaryotic to eukaryotic cells
(A – U and G - C) to be formed. But at the third
and between eukaryotic cells. HGT is now
position there is a great deal of flexibility as to
hypothesized to have played a major role in
which base pairs are acceptable. Most part of
the evolution of life on earth.
the genetic code is universal, being the same in
5.10 Genetic Code prokaryotes and eukaryotes.
DNA is the genetic material that carries The order of base pairs along DNA molecule
genetic information in a cell and from controls the kind and order of amino acids
generation to generation. At this stage, an found in the proteins of an organism. This
attempt will be made to determine in what specific order of base pairs is called genetic
manner the genetic information exists in code, the blue print establishing the kinds of

www.tntextbooks.in
proteins to be synthesized which makes an chloroplast genomes. However similarities

organism unique. are more common than differences.
Marshall Nirenberg, Severo Ochoa • A non-overlapping codon means that the
(enzyme polynucleotide phosphorylase called same letter is not used for two different
Ochoa’s enzyme), Hargobind Khorana, Francis codons. For instance, the nucleotide
Crick and many others have contributed sequence GUU GUC represents only two
significantly to decipher the genetic code. The codons.
order in which bases are arranged in mRNA • It is comma less, which means that the
decides the order in which amino acids are message would be read directly from one
arranged in proteins. Finally a checker board end to the other i.e., no punctuation are
for genetic code was prepared (table 5.1). needed between two codes.
The salient features of genetic code are as • A degenerate code means that more than
follows: one triplet codon could code for a specific
• The genetic codon is a triplet code and amino acid. For example, codons GUU,
61 codons code for amino acids and 3 GUC, GUA and GUG code for valine.
codons do not code for any amino acid and • Non-ambiguous code means that one
function as stop codon (Termination). codon will code for one amino acid.
• The genetic code is universal. It means • The code is always read in a fixed direction
that all known living systems use nucleic i.e. from 5'→3' direction called polarity.
acids and the same three base codons
• AUG has dual functions. It acts as a
(triplet codon) direct the synthesis of protein
initiator codon and also codes for the
from amino acids. For example, the mRNA
amino acid methionine.
(UUU) codon codes for phenylalanine in all
cells of all organisms. Some exceptions are
reported in prokaryotic, mitochondrial and
Table 5.1 Genetic code dictionary

6HFRQG1XFOHRWLGHLQ&RGRQ
8 & $ *
8883KH)3KHQ\ODODQLQH 8&86HU66HULQH 8$87\U<7\URVLQH 8*8&\V&&\VWHLQH 8
88&3KH)3KHQ\ODODQLQH 8&&6HU66HULQH 8$&7\U<7\URVLQH 8*&&\V&&\VWHLQH &
8 8&$6HU66HULQH 8$$7HUPLQDWLRQ 8*$7HUPLQDWLRQ
88$/HX//HXFLQH $
8&*6HU66HULQH 8$*7HUPLQDWLRQ 8**7US:7U\SWRSKDQ
7KLUGQXFOHRWLGHLQFRGRQ¶HQG
88*/HX//HXFLQH
)LUVWQXFOHRWLGHLQFRGRQ¶HQG
&88/HX//HXFLQH &&83UR33UROLQH &$8+LV++LVWLGLQH &*8$UJ5$UJLQLQH 8

&$&+LV++LVWLGLQH &*&$UJ5$UJLQLQH
& &8&/HX//HXFLQH &&&3UR33UROLQH &
&8$/HX//HXFLQH &&$3UR33UROLQH &$$*OQ4*OXWDPLQH &*$$UJ5$UJLQLQH $
&8*/HX//HXFLQH &&*3UR33UROLQH &$**OQ4*OXWDPLQH &**$UJ5$UJLQLQH *
$88,OH,,VROHXFLQH $&87KU77KUHRQLQH $$8$VQ1$VSDUDJLQH $*86HU66HULQH 8

$ $8&,OH,,VROHXFLQH $&&7KU77KUHRQLQH $$&$VQ1$VSDUDJLQH $*&6HU66HULQH &
$8$,OH,,VROHXFLQH $&$7KU77KUHRQLQH $$$/\V./\VLQH $*$$UJ5$UJLQLQH $
$8*0HW00HWKLRQLQH $&*7KU77KUHRQLQH $$*/\V./\VLQH $**$UJ5$UJLQLQH *
*889DO99DOLQH *&8$OD$$ODQLQH *$8$VS'$VSDUWLFDFLG **8*O\**O\FLQH 8

* *8&9DO99DOLQH *&&$OD$$ODQLQH *$&$VS'$VSDUWLFDFLG **&*O\**O\FLQH &
*8$9DO99DOLQH *&$$OD$$ODQLQH *$$*OX(*OXWDPLFDFLG **$*O\**O\FLQH $
*8*9DO99DOLQH *&*$OD$$ODQLQH *$**OX(*OXWDPLFDFLG ****O\**O\FLQH *
&RGRQ 7KUHHOHWWHUDQGVLQJOHOHWWHUDEEUHYLDWLRQV

www.tntextbooks.in
• UAA, UAG and UGA) codons are

designated as termination (stop) codons Wobble Hypothesis
and also are known as “non-sense” codons. It is a hypothesis proposed by Crick
(1966) which states that tRNA anticodon
5.10.1 Mutation and genetic code has the ability to wobble at its 5’ end by
Comparative studies of mutations (sudden pairing with even non-complementary
change in a gene) and corresponding base of mRNA codon. According to this
alteration in amino acid sequence of specific hypothesis, in codon-anticodon pairing
protein have confirmed the validity of the the third base may not be complementary.
genetic code. The relationship between genes The third base of the codon is called
and DNA are best understood by mutation wobble base and this position is called
studies. The simplest type of mutation at the wobble position. The actual base pairing
molecular level is a change in nucleotide that occurs at first two positions only. The
substitutes one base for another. Such changes importance of Wobbling hypothesis
are known as base substitutions which may is that it reduces the number of tRNAs
occur spontaneously or due to the action of required for polypeptide synthesis and it
mutagens. A well studied example is sickle overcomes the effect of code degeneracy.
cell anaemia in humans which results from a
point mutation of an allele of β-haemoglobin
gene (βHb). A haemoglobin molecule
consists of four polypeptide chains of two
types, two α chains and two β-chains. Each
chain has a heme group on its surface. The
heme groups are involved in the binding of
oxygen. The human blood disease, sickle cell
anaemia is due to abnormal haemoglobin. In the above example though the
This abnormality in haemoglobin is due to a codon and the anti codon do not match
single base substitution at the sixth codon of perfectly, yet the required amino acid
the beta globin gene from GAG to GTG in β is brought perfectly. This enables the
-chain of haemoglobin. It results in a change economy of tRNA, GUU, GUC, GUA and
of amino acid glutamic acid to valine at the 6th GUG code for the amino acid - Valine.
position of the β -chain. This is the classical
DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G A G G A G
(coding) strand
Amino acid Glutamic Glutamic

sequence Valine Histidine Leucine Threonine Proline acid Normal red blood cells
acid
DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G T G G A G
(coding) strand
Amino acid Glutamic

Valine Histidine Leucine Threonine Proline Valine
sequence acid
Mutant Sickled red blood cells
DNA point mutation can lead to a different amino acid sequence Phenotype
Fig. 5. 10 DNA point mutation

www.tntextbooks.in
example of point mutation that results in the as amino acyl binding loop, anticodon loop
change of amino acid residue glutamic acid to and ribosomal binding loop at their ends.
valine (Fig. 5.10). The mutant haemoglobin In addition it also shows a small lump called
undergoes polymerisation under oxygen variable loop or extra arm. The amino acid
tension causing the change in the shape of is attached to one end (amino acid acceptor
the RBC from biconcave to a sickle shaped end) and the other end consists of three
structure. anticodon nucleotides. The anticodon pairs
with a codon in mRNA ensuring that the
The effect of point mutation can be
correct amino acid is incorporated into the
understood by the following example.
growing polypeptide chain. Four different
ABC DEF GHI JKL regions of double-stranded RNA are formed
during the folding process. Modified bases
If we insert a letter O between DEF are especially common in tRNA. Wobbling
and GHI the arrangement would be between anticodon and codon allows some
ABC DEF OGH IJK L tRNA molecules to read more than one codon.
The process of addition of amino acid
If we insert OQ at the same place the to tRNA is known as aminoacylation or
arrangement would be charging and the resultant product is called
aminoacyl- tRNA (charged tRNA). Without
ABC DEF OQG HIJ KL
aminoacylation tRNA is known as uncharged
The above information shows that insertion tRNA (Fig. 5.12). If two such tRNAs are
or deletion of one or two bases, changes the brought together peptide bond formation is
reading frame from the point of insertions or favoured energetically. Numbers of amino
deletions. Such mutations are referred to as acids are joined by peptide bonds to form a
frame shift insertion or deletion mutations. polypeptide chain. This aminoacylation is
This forms the genetic basis of proof that codon
$PLQRDFLGDWWDFKHGKHUH
is a triplet and is read in a continuous manner
$
HQG
&
5.11. tRNA – the adapter molecule &
$ 6WHP
The transfer RNA, (tRNA) molecule of a
HQG & *
* &
cell acts as a vehicle that picks up the amino & *
$ 8
acids scattered through the cytoplasm and 8 $
& * 7ORRS7\&
also reads specific codes of mRNA molecules. 'ORRS'+8 $ 8 8
Hence it is called an adapter molecule. This ' * $ & 8 & * $8 *$ & $& & $
& *
term was postulated by Francis Crick. * & 8* 8* 7 \ &
* ' $ * $ * &* &
8 7K\PLGLQH3VHXGRXULGLQH
The two dimensional clover leaf model of
'LK\GURXULGLQH & *$ * DQG&\WLGLQH
tRNA was proposed by Robert Holley. The * & * 9DULDEOHORRS
$ 8
secondary structure of tRNA depicted in & *
Fig. 5.11 looks like a clover leaf. In actual $ \
& $
structure, the tRNA is a compact molecule 8 < $QWLFRGRQORRS
*$ $
which looks like an inverted L. The clover
leaf model of tRNA shows the presence of $QWLFRGRQ
three arms namely DHU arm, middle arm Fig. 5.11 Holley’s two-dimensional clover
and TΨC arm. These arms have loops such leaf model of transfer RNA

www.tntextbooks.in
catalyzed by an enzyme aminoacyl – tRNA read by an anticodon on the

synthetase. This is an endothermic reaction corresponding tRNA. Hence
and is associated with ATP hydrolysis. 20 the order and sequence of
different aminoacyl – tRNA synthetases are amino acids are defined by
known. The power to recognize codon on the the sequence of bases in the
mRNA lies in the tRNA and not in the attached mRNA.
amino acid molecule.
5.12.1 Mechanism of Translation
The cellular factory responsible for
synthesizing protein is the ribosome. The
ribosome consists of structural RNAs and
about 80 different proteins. In inactive state,
it exists as two subunits; large subunit and
small subunit. When the subunit encounters
an mRNA, the process of translation of the
mRNA to protein begins. The prokaryotic
ribosome (70 S) consists of two subunits,
the larger subunit (50 S) and smaller subunit
(30 S). The ribosomes of eukaryotes (80 S) are
larger, consisting of 60 S and 40 S sub units. ‘S’
denotes the sedimentation coefficient which
is expressed as Svedberg unit (S).
One of the alternative ways of dividing
up a sequence of bases in DNA or RNA
into codons is called reading frame. Any
sequence of DNA or RNA, beginning with
a start codon and which can be translated
into a protein is known as an Open Reading
Fig. 5.12 Steps involved in charging tRNA. Frame (ORF). A translational unit in mRNA
The ‘X’ denotes that for each amino acid is the sequence of RNA that is flanked by
only the corresponding specific tRNA and the start codon (AUG) and the stop codon
specific aminoacyl tRNA synthetase enzyme and codes for polypeptides. mRNA also
are involved in the charging process. have some additional sequences that are not
translated and are referred to as Untranslated
5.12 Translation Regions (UTR). UTRs are present at both
Translation refers to the process of 5' end (before start codon) and at 3' end
polymerization of amino acids to form poly (after stop codon). The start codon (AUG)
peptide chain. The decoding process is carried begins the coding sequence and is read by a
out by ribosomes that bind mRNA and charged special tRNA that carries methionine (met).
tRNA molecules. The mRNA is translated, The initiator tRNA charged with methionine
starting at the 5' end. After binding to mRNA, binds to the AUG start codon. In prokaryotes,
the ribosomes move along it, adding new N - formyl methionine (f met) is attached to
amino acids to the growing polypeptide chain the initiator tRNA whereas in eukaryotes
each time it reads a codon. Each codon is unmodified methionine is used. The 5' end

www.tntextbooks.in
in response to the AUG triplet. This step

‘sets’ the reading frame so that all subsequent
groups of three ribonucleotides are translated
accurately.
The assembly of ribosomal subunits,
mRNA and tRNA represent the initiation
complex. Once initiation complex has been
assembled, IF3 is released and allows the
Fig. 5.13 a-Translation components
of the mRNA of prokaryotes has a special

sequence which precedes the initial AUG
start codon of mRNA. This ribosome binding
site is called the Shine – Dalgarno sequence
or S-D sequence. This sequences base-pairs
with a region of the 16Sr RNA of the small
ribosomal subunit facilitating initiation. The
subunits of the ribosomes (30 S and 50 S) are
usually dissociated from each other when not
involved in translation (Fig. 5.13a).
Initiation of translation in E. coli begins
with the formation of an initiation complex,
consisting of the 30S subunits of the ribosome,
a messenger RNA and the charged N-formyl
methionine tRNA (fmet – t RNA fmet), three
proteinaceous initiation factors (IF1, IF2, IF3),
GTP(Guanine Tri Phosphate) and Mg 2+.
The components that form the initiation
complex interact in a series of steps. IF3
binds to the 30S and allows the 30S subunit
to bind to mRNA. Another initiation protein
(IF2) then enhances the binding of charged
formyl methionine tRNA to the small subunit
Fig. 5.13 b- Initiation

www.tntextbooks.in
initiation complex to combine

with the 50S ribosomal subunit
to form the complete ribosome
(70S). In this process a
molecule of GTP is hydrolyzed
providing the required energy
and the initiation factors
(IF1 and IF2 and
GDP) are released
(Fig. 5.13 b).
Elongation is the next phase
of translation. Once both
subunits of the ribosomes are
assembled with the mRNA,
binding sites for two charged
tRNA molecules are formed.
The sites in the ribosome are
referred to as the aminoacyl
site (A site), the peptidyl site (P
site) and the exit site (E site).
The charged initiator tRNA
binds to the P site. The next
step in prokaryotic translation
is to position the second tRNA
at the ‘A’ site of the ribosome
to form hydrogen bonds
between its anticodon and the
second codon on the mRNA
(step1). This step requires the
correct transfer RNA, another
GTP and two proteins called
elongation factors (EF-Ts and
Fig. 5.13 c- Elongation of the growing polypeptide chain
EF-Tu).
during translation
Once the charged tRNA molecule
from the large subunit. The uncharged tRNA
is positioned at the A site, the enzyme peptidyl
moves through the ‘E’ site on the ribosome.
transferase catalyses the formation of peptide
bonds that link the two amino acids together The entire mRNA-tRNA-aa1-aa2 complex
(step 2). At the same time, the covalent bond shifts in the direction of the ‘P’ site by a distance
between the amino acid and tRNA occupying of three nucleotides (step 3). This step requires
the P site is hydrolyzed (broken). The product several elongation factors (EFs) and the energy
of this reaction is a dipeptide which is attached derived from hydrolysis of GTP. This results in the
to the 3' end of tRNA still residing in the A site. third triplet of mRNA to accept another charged
For elongation to be repeated, the tRNA attached tRNA into the A site (step 4). The sequence of
to the P site, which is now uncharged is released elongation is repeated over and over (step 5 and

www.tntextbooks.in
step 6). An additional amino acid is added to the is expressed. We now consider the most
growing polypeptide, each time mRNA advances fundamental issues in molecular genetics.
through the ribosome. Once a polypeptide chain How is genetic expression regulated? Evidence
is assembled, it emerges out from the base of the in support of the idea that genes can be turned
large subunit (Fig. 5.13 c). on and off is very convincing. Regulation of
Termination is the final phase of translation. gene expression has been extensively studied
Termination of protein synthesis occurs when in prokaryotes, especially in E. coli. Gene
one of the three stop codons appears in the expression can be controlled or regulated
‘A’ site of the ribosome. The terminal codon at transcriptional or post transcriptional or
signals the action of GTP – dependent release translational level. Here, we are going to discuss
factor, which cleaves the polypeptide chain regulation of gene expression at transcriptional
from the terminal tRNA releasing it from level. Usually, small extracellular or intracellular
the translational complex (step 1). The tRNA metabolites trigger initiation or inhibition
is then released from the ribosome, which of gene expression. The clusters of gene with
then dissociates into its subunits (step 2) related functions are called operons. They
(Fig. 5.13 d). usually transcribe single mRNA molecules.
In E.coli, nearly 260 genes are grouped into
75 different operons.
Many antibiotics do not allow pathogenic

bacteria to flourish in animal host because
they inhibit one or the other stage of bacterial
protein synthesis. The antibiotic tetracycline
inhibits binding between aminoacyl
tRNA and mRNA. Neomycin inhibits the
interaction between tRNA and mRNA.
Erythromycin inhibits the translocation of
mRNA along the ribosome. Streptomycin
inhibits the initiation of translation and
causes misreading. Chloramphenicol
inhibits peptidyl transferase and formation
of peptide bonds.
Structure of the operon: Each operon is a unit

of gene expression and regulation and consists
of one or more structural genes and an adjacent
operator gene that controls transcriptional
activity of the structural gene.
Fig. 5.13 d- Termination of the process of i) The structural gene codes for proteins,
translation rRNA and tRNA required by the cell.
5.13 R
egulation of gene expression ii) Promoters are the signal sequences in
DNA that initiate RNA synthesis. RNA
We have previously established how DNA
polymerase binds to the promoter prior
is organized into genes, how genes store
to the initiation of transcription.
genetic information, and how this information

www.tntextbooks.in
iii)
The operators are present 51$3RO\PHUDVH
between the promoters and XQDEOHWRELQGWR
SURPRWRU
structural genes. The repressor S L S R ] \ D
,QDEVHQFH
RILQGXFHU
protein binds to the operator
region of the operon. 5HSUHVVRUELQGVWRWKHRSHUDWRU
UHJLRQRDQGSUHYHQWV51$
The Lac (Lactose) operon: The 5HSUHVVRUP51$
SRO\PHUDVHIURPWUDQVFULELQJ
metabolism of lactose in E.coli WKHRSHURQ
requires three enzymes – permease,

5HSUHVVRU
β-galactosidase (β-gal) and
transacetylase. The enzyme permease 51$3RO\PHUDVHELQGWRSURPRWRU
,QSUHVHQFH
is needed for entry of lactose into the S L S R ] \ D RILQGXFHU
cell, β-galactosidase brings about
7UDQVFULSWLRQ
hydrolysis of lactose to glucose
and galactose, while transacetylase 5HSUHVVRUP51$ ODFP51$
transfers acetyl group from acetyl Co
A to β-galactosidase. ] \ D
,QGXFHU 7UDQVODWLRQ
The lac operon consists of one
regulator gene (‘i’ gene refers to βJDODFWRVLGDVHSHUPHDVHWUDQVDFHW\ODVH
inhibitor) promoter sites (p), and ,QDFWLYHUHSUHVVRU
operator site (o). Besides these, it Fig. 5.14 Lac Operon model
has three structural genes namely site and transcribe the operon to produce lac
lac z,y and lac a. The lac ‘z’ gene codes for mRNA which enables formation of all the required
β-galactosidase, lac ‘y’ gene codes for permease enzymes needed for lactose metabolism (Fig.
and ‘a’ gene codes for transacetylase. 5.14). This regulation of lac operon by the repressor
Jacob and Monod proposed the classical model is an example of negative control of transcription
of Lac operon to explain gene expression and initiation. Lac operon is also under the control of
regulation in E.coli. In lac operon, a polycistronic positive regulation as well.
structural gene is regulated by a common
promoter and regulatory gene. When the cell is
5.14 Human Genome
using its normal energy source as glucose, the
Project (HGP)
‘i’ gene transcribes a repressor mRNA and after The international human genome project
its translation, a repressor protein is produced. was launched in the year 1990. It was a mega
It binds to the operator region of the operon and project and took 13 years to complete. The
prevents transcription, as a result, β-galactosidase human genome is about 25 times larger than the
is not produced. In the absence of glucose, if genome of any organism sequenced to date and
lactose is available as an energy source for the is the first vertebrate genome to be completed.
bacteria then lactose enters the cell as a result of Human genome is said to have approximately
permease enzyme. Lactose acts as an inducer and 3×109 bp. HGP was closely associated with the
interacts with the repressor to inactivate it. rapid development of a new area in biology
called bioinformatics.
The repressor protein binds to the operator
of the operon and prevents RNA polymerase
5.14.1 Goals and methodologies of
from transcribing the operon. In the presence of
Human Genome Project
inducer, such as lactose or allolactose, the repressor
The main goals of Human Genome Project
is inactivated by interaction with the inducer. This
are as follows
allows RNA polymerase to bind to the promotor

www.tntextbooks.in
• Identify all the genes (approximately 30000) sequences, called microsatellites. The latest
in human DNA. method of sequencing even longer fragments
• Determine the sequence of the three billion is by a method called Shotgun sequencing
chemical base pairs that makeup the human using super computers, which has replaced
DNA. the traditional sequencing methods.
• To store this information in databases.
5.14.2 Salient features of Human
• Improve tools for data analysis.
Genome Project:
• Transfer related technologies to other
sectors, such as industries. • The human genome contains 3 billion
nucleotide bases.
• Address the ethical, legal and social issues
(ELSI) that may arise from the project. • An average gene consists of 3000 bases,
The methodologies of the Human Genome the largest known human gene being
Project involved two major approaches. dystrophin with 2.4 million bases.
One approach was focused on identifying
• The chromosomal organization of human
all the genes that are expressed as RNA
genes shows diversity.
(EST S – Expressed Sequence Tags). The
other approach was sequence annotation. • There may be 35000-40000 genes in the
Here, sequencing the whole set of genome genome and almost 99.9 nucleotide bases
was taken, that contains all the coding and are exactly the same in all people.
non-coding sequences and later assigning
different regions in the sequences with • Functions for over 50 percent of the
functions. For sequencing, the total DNA discovered genes are unknown.
from a cell is isolated and converted into
random fragments of relatively smaller sizes • Less than 2 percent of the genome codes
and cloned in suitable hosts using specialized for proteins.
vectors. This cloning results in amplification • Repeated sequences make up very large
of pieces of DNA fragments so that it could portion of the human genome. Repetitive
subsequently be sequenced with ease. sequences have no direct coding functions
Bacteria and yeast are two commonly used but they shed light on chromosome
hosts and these vectors are called as BAC structure, dynamics and evolution
(Bacterial Artificial Chromosomes) and (genetic diversity).
YAC (Yeast Artificial Chromosomes). The
fragments are sequenced using automated • Chromosome 1 has 2968 genes whereas
DNA sequencers (developed by Frederick chromosome Y has 231 genes.
Sanger). The sequences are then arranged
based on few overlapping regions, using • Scientists have identified about
specialized computer based programs. These 1.4 million locations where single
sequences were subsequently annotated base DNA differences (SNPs – Single
and are assigned to each chromosome. nucleotidepolymorphism – pronounce as
The genetic and physical maps on the ‘snips’) occur in humans. Identification of
genome are assigned using information on ‘SNIPS’ is helpful in finding chromosomal
polymorphism of restriction endonuclease locations for disease associated sequences
recognition sites and some repetitive DNA and tracing human history.

www.tntextbooks.in
5.14.3 Applications and 5.15 DNA fingerprinting technique

future challenges The DNA fingerprinting technique was first
The mapping of human chromosomes is developed by Alec Jeffreys in 1985 (Recipient
possible to examine a person’s DNA and to of the Royal Society’s Copley Medal in 2014).
identify genetic abnormalities. This is extremely Each of us have the same chemical structure of
useful in diagnosing diseases and to provide DNA. But there are millions of differences in
genetic counselling to those planning to have the DNA sequence of base pairs. This makes
children. This kind of information would also the uniqueness among us so that each of us
create possibilities for new gene therapies. Besides except identical twins is different from each
providing clues to understand human biology, other genetically. The DNA of a person and
learning about non-human organisms, DNA finger prints are unique. There are 23 pairs of
sequences can lead to an understanding of their human chromosomes with 1.5 million pairs
natural capabilities that can be applied towards of genes. It is a well known fact that genes are
solving challenges in healthcare, agriculture, segments of DNA which differ in the sequence
energy production and environmental of their nucleotides. Not all segments of
remediation. A new era of molecular medicine, DNA code for proteins, some DNA segments
characterized by looking into the most have a regulatory function, while others are
fundamental causes of disease than treating the intervening sequences (introns) and still
symptoms will be an important advantage. others are repeated DNA sequences. In DNA
• Once genetic sequence becomes easier fingerprinting, short repetitive nucleotide
to determine, some people may attempt sequences are specific for a person. These
to use this information for profit or for nucleotide sequences are called as variable
political power. number tandem repeats (VNTR).The
VNTRs of two persons generally show
• Insurance companies may refuse to insure
variations and are useful as genetic markers.
people at ‘genetic risk’ and this would save
the companies the expense of future medical DNA finger printing involves identifying
bills incurred by ‘less than perfect’ people. differences in some specific regions in DNA
sequence called repetitive DNA, because
• Another fear is that attempts are being in these sequences, a small stretch of DNA
made to “breed out” certain genes of is repeated many times. These repetitive
people from the human population in DNA are separated from bulk genomic DNA
order to create a ‘perfect race’. as different peaks during density gradient
centrifugation. The bulk DNA forms a major
Pharmacogenomics is peak and the other small peaks are referred
the study of how genes to as satellite DNA. Depending on base
affect a person’s response composition (A : T rich or G : C rich), length
to drugs. This relatively of segment and number of repetitive units,
the satellite DNA is classified into many sub
new field combines pharmacology (the
categories such as micro-satellites, mini-
science of drugs) and genomics (the
satellites, etc., These sequences do not code for
study of genes and their functions) to any proteins, but they form a large portion of
develop effective, safe medications and human genome. These sequences show high
doses that will be tailored to a person’s degree of polymorphism and form the basis of
genetic makeup. DNA fingerprinting (Fig. 5.15). DNA isolated

www.tntextbooks.in
2 Chromosome 7 Chromosome 7
Chromosome 2 Chromosome 2
Chromosome 16 Chromosome 16
1 Paternal Chromosome DNA from individual (A)
2 Maternal Chromosome DNA from individual (B)

C A B
0 11
Number of short tandem repeats

12
11
Chromosome 7 10
9
8
7
Chromosome 2 6
5
4
3
2
Chromosome 16 1
DNA from crime scene (c) Amplified repeats, separated by size on

a gel, give a DNA fingerprint
Fig. 5.15 Schematic representation of DNA fingerprinting : Few representative chromosomes

have been shown to contain different copy number of VNTR
from blood, hair, skin cells, or other genetic DNA is treated with restriction enzymes
evidences left at the scene of a crime can be which cut the DNA into smaller fragments
compared through VNTR patterns, with the at specific sites.
DNA of a criminal suspect to determine guilt 4. Separation of DNA by electrophoresis
or innocence. VNTR patterns are also useful in During electrophoresis in an agarose gel, the
establishing the identity of a homicide victim, DNA fragments are separated into bands
either from DNA found as evidence or from the of different sizes. The bands of separated
body itself. DNA are sieved out of the gel using a nylon
The Steps in DNA Fingerprinting technique is membrane (treated with chemicals that
as follows: allow for it to break the hydrogen bonds of
DNA so there are single strands).
1. Extraction of DNA
5. Denaturing DNA
The process of DNA fingerprinting starts
The DNA on gels is denatured by using
with obtaining a sample of DNA from
alkaline chemicals or by heating.
blood, semen, vaginal fluids, hair roots,
teeth, bones, etc., 6. Blotting
The DNA band pattern in the gel is
2. Polymerase chain reaction (PCR)
transferred to a thin nylon membrane placed
In many situations, there is only a small
over the ‘size fractionated DNA strand’ by
amount of DNA available for DNA
Southern blotting.
fingerprinting. If needed many copies
7. Using probes to identify specific DNA
of the DNA can be produced by PCR
A radioactive probe (DNA labeled with
(DNA amplification).
a radioactive substance) is added to the
3. Fragmenting DNA DNA bands. The probe attaches by base

www.tntextbooks.in
pairing to those restriction fragments Wilkins and Rosalind Franklin. Nucleotides

that are complementary to its sequence. are the structural units of nucleic acids. Each
The probes can also be prepared by using nucleotide has three components, i) pentose sugar
either ‘fluorescent substance’ or ‘radioactive ii) nitrogenous base and iii) phosphate. DNA
isotopes’. and RNA are polynucleotides. DNA has double
8. Hybridization with probe stranded helical structure while RNA is a single
stranded structure. DNA acts as genetic material of
After the probe hybridizes and the excess
almost all the living organism except few viruses.
probe washed off, a photographic film is
placed on the membrane containing ‘DNA The non genetic RNAs are of three types;
hybrids’. m-RNA, r-RNA and t-RNA. They help in protein
synthesis. DNA has capacity of replication, while
9. Exposure on film to make a genetic/DNA the three types of RNA are transcribed on DNA.
Fingerprint Meselson and Stahl (1958) proved experimentally
The radioactive label exposes the film to form the semi-conservative nature of DNA replication
an image (image of bands) corresponding using heavy isotope of nitrogen N15 in E.coli.
to specific DNA bands. The thick and thin In 1958 Crick proposed that DNA determines
dark bands form a pattern of bars which the sequence of amino acids in a polypeptide
constitutes a genetic fingerprint. (protein) through mRNA, and proposed the
central dogma of protein synthesis which
Application of DNA finger printing
involves transcription and translation. The
• Forensic analysis - It can be used in the
process of copying genetic information from one
identification of a person involved in
strand of DNA into RNA is termed transcription.
criminal activities, for settling paternity
The DNA transcribed RNA molecules serve as a
or maternity disputes, and in determining
template for the synthesis of polypeptides by a
relationships for immigration purposes.
process termed translation. Each amino acid in
• Pedigree analysis – inheritance pattern of a polypeptide chain is represented by a sequence
genes through generations and for detecting of three nucleotides in the RNA known as the
inherited diseases. genetic code. RNA transfers genetic message
• Conservation of wild life – protection of from nucleus to the cytoplasm. DNA is always
endangered species. By maintaining DNA present in the nucleus and synthesis is also
records for identification of tissues of the confined to the nucleus
dead endangered organisms. Jacob and Monod proposed the classical model
of Lac operon to explain gene expression and
• Anthropological studies–It is useful in
regulation in E. coli. In lac operon a polycistronic
determining the origin and migration of
structural gene is regulated by a common
human populations and genetic diversities.
promoter and regulator. It is an example of
Summary negative control of transcription initiation.
In the twentieth century, one of the landmark Human genome project, a mega project was
discovery in biology was the identification of aimed to sequence every gene in the human
DNA, as genetic material of living organisms. genome. Polymerase chain reaction is an in vitro
Gene may be defined as a segment of DNA which method of synthesis of nucleic acids wherein,
is responsible for inheritance and expression of a a specific DNA segment is amplified rapidly
particular character. without concomitant replication of the rest of
In 1953, James Watson and Francis Crick the DNA molecule. DNA fingerprinting is a
proposed DNA structure based on X-ray technique to identify variations in individuals of
crystallographic studies provided by Maurice a population at the DNA level. It has immense

www.tntextbooks.in
applications in the field of forensic analysis, (d)

One low and one intermediate
pedigree analysis, anthropological studies, and density band.
conservation of wild life.
6. What is the basis for the difference in the
synthesis of the leading and lagging strand
Evaluation of DNA molecules?
1. Hershey and Chase (a) Origin of replication occurs only at the

experiment with 5' end of the molecules.
bacteriophage showed (b) DNA ligase works only in the 3' → 5'
that direction.
(c)
DNA polymerase can join new
a) Protein gets into the bacterial cells
nucleotides only to the 3' end of the
b) DNA is the genetic material
growing stand.
c) DNA contains radioactive sulphur (d) Helicases and single-strand binding
d) Viruses undergo transformation proteins that work at the 5' end.
2. DNA and RNA are similar with respect to
7. Which of the following is the correct
a) Thymine as a nitrogen base sequence of event with reference to the
b) A single-stranded helix shape central dogma?
c) Nucleotide containing sugars, nitrogen (a) Transcription, Translation, Replication
bases and phosphates
(b) Transcription, Replication, Translation
d) The same sequence of nucleotides for the
amino acid phenyl alanine (c) Duplication, Translation, Transcription
(d) Replication, Transcription, Translation
3. A mRNA molecule is produced by
a) Replication b) Transcription 8. Which of the following statements about
c) Duplication d) Translation DNA replication is not correct?
4. The total number of nitrogenous bases in (a) Unwinding of DNA molecule occurs
human genome is estimated to be about as hydrogen bonds break.
a) 3.5 million b) 35000 (b) Replication occurs as each base is
c) 35 million d) 3.1 billion paired with another exactly like it.
(c) Process is known as semi conservative
5. E. coli cell grown on 15N medium are replication because one old strand is
transferred to 14N medium and allowed to conserved in the new molecule.
grow for two generations. DNA extracted (d) C omplementary base pairs are held
from these cells is ultracentrifuged in a together with hydrogen bonds.
cesium chloride density gradient. What
density distribution of DNA would you 9. Which of the following statements is not
expect in this experiment? true about DNA replication in eukaryotes?
(a) One high and one low density band. (a) Replication begins at a single origin of
(b) One intermediate density band. replication.
(b) Replication is bidirectional from the
(c) One high and one intermediate density
origins.
band.

www.tntextbooks.in
(c) Replication occurs at about 1 million 16. Name the parts marked ‘A’ and ‘B’ in the
base pairs per minute. given transcription unit:
(d) There are numerous different
bacterial chromosomes, with 3’
replication ocurring in each at the A
same time.
3’
10.
The first codon to be deciphered was
__________ which codes for ________. B
(a) AAA, proline (b) GGG, alanine
(c) UUU, Phenylalanine (d)TTT, arginine 17. Differentiate - Leading stand and lagging
strand
11. Meselson and Stahl’s experiment proved
18.
Differentiate - Template strand and
(a)Transduction coding strand.
(b) Transformation
(c) DNA is the genetic material 19. Mention any two ways in which single
(d)
S emi-conservative nature of DNA nucleotide polymorphism (SNPs)
replication identified in human genome can bring
12. Ribosomes are composed of two subunits; revolutionary change in biological and
the smaller subunit of a ribosome has a medical science.
binding site for _________ and the larger 20. State any three goals of the human genome
subunit has two binding sites for two project.
__________. (mRNA, tRNA)
21. In E.coli, three enzymes β- galactosidase,
13. An operon is a: permease and transacetylase are produced
(a) Protein that suppresses gene expression in the presence of lactose. Explain why
(b) P rotein that accelerates gene expression the enzymes are not synthesized in the
(c)
C luster of structural genes with absence of lactose.
related function
(d) Gene that switched other genes on or off 22.
Distinguish between structural gene,
regulatory gene and operator gene.
14. When lactose is present in the culture
medium: 23. A low level of expression of lac operon
(a) Transcription of lac y, lac z, lac a genes occurs at all the time. Justify the statement.
occurs.
24. HGP is the windows for treatment of
(b) Repressor is unable to bind to the
various genetic disorders. Justify the
operator.
statement.
(c) Repressor is able to bind to the
operator. 25. Why the human genome project is called
(d) Both (a) and (b) are correct. a mega project?
15. Give reasons: Genetic code is ‘universal’. 26. From their examination of the structure
of DNA, What did Watson and Crick

www.tntextbooks.in
infer about the probable mechanism of c)

Write the source of energy for this
DNA replication, coding capability and replication and name the enzyme
mutation? involved in this process.
27. Why tRNA is called an adapter molecule? d) Mention the differences in the synthesis
of protein, based on the polarity of the
28. What are the three structural differences two template strands.
between RNA and DNA? 31. If the coding sequence in a transcription
29. Name the anticodon required to recognize unit is written as follows:
the following codons: AAU, CGA, UAU, 5' TGCATGCATGCATGCATGCATGCATGC 3'
and GCA. Write down the sequence of mRNA.
32. How is the two stage process of protein
30. a) Identify the figure given below
synthesis advantageous?
b) Redraw the structure as a replicating
33.Why did Hershey and Chase use
fork and label the parts
radioactively labelled phosphorous
3' and sulphur only? Would they have got
the same result if they use radiolabelled
carbon and nitrogen?
5'
34. Explain the formation of a nucleosome.
3'
35. It is established that RNA is the first
5' genetic material. Justify giving reasons.

Concept Map
&RQFOXVLYHO\
'1$LVWKH 'RXEOHKHOL[ 6SOLFLQJ
6LQJOHVWUDQG

QXFOHRVLGHV
Molecular Genetics
JHQHWLFPDWHULDO P51$ FDSSLQJ
QXFOHRWLGHV +HOLFDVH WDLOLQJ
W51$U51$
SRODULW\ LVRPHUDVH
%LRORJLVW
QRW SRO\PHUDVH
+HUVKH\
FRQYLQFHG
90
DQG&KDVH
H[SHULPHQW &LVWURQ
([RQ,QWURQ
'1$LVWKH 51$
*ULIILWK¶V
JHQHWLF
H[SHULPHQW
PDWHULDO 7UDQVFULSWLRQ
5HSOLFDWLRQ XQLW3URPRWRU
'1$ 6WUXFWXUDOJHQH
%DFWHULDO 7HUPLQDWRU
WUDQVIRUPDWLRQ
6HDUFKLQJ
IRUJHQHWLF
PDWHULDO 7UDQVFULSWLRQ
FRGRQVVWRS
0ROHFXODU FRGRQV8QDPELJXRXV
'1$)LQJHU *HQHWLFV VSHFLILFGHJHQHUDWH
www.tntextbooks.in
*HQHWLF XQLYHUVDO$8*
SULQWLQJ
FRGH LQLWLDWRUFRGRQ
+XPDQ
9175DV JHQRPH 7UDQVODWLRQ
SUREH SURMHFW 5HJXODWLRQ
RIJHQH
H[SUHVVLRQ
&KDUJLQJRIW51$
$PLQRDF\ODWLRQ
,QHXNDU\RWHV± RIW51$8QUHODWHG
WUDQVFULSWLRQDOOHYHO UHJLRQVDQG
,GHQWLI\GHWHUPLQHWKH
3URFHVVLQJOHYHO 5HOHDVHIDFWRU
VHTXHQFHVWRUHGDWD
DQDO\VLVWUDQVIHUDQG 7UDQVSRUWRIP51$
(/6, DQG7UDQVODWLRQDO
OHYHO
18/12/2021 14:51:59
www.tntextbooks.in
ICT CORNER
MOLECULAR GENETICS
Lets us explore the gene

expression
Procedure :
Step 1: Use the URL or scan the QR Code to launch the “Gene Expression Essentials” activity
page.
Step 2:
Click “Expression” pick the genetic material from the Biomolecule Toolbox,
understand the changes for the three different genes.
Step 3: C
lick “mRNA” and slide through the slider in Positive Transcription factors and
Negative Transcription factors such as Concentration, Affinity. Also Slide through
“Affinity” in RNA Polymerase.
Step 4: Click “Multiple Cells” and find the average protein level vs Time in the graph indicated
above.
Step 4
Molecular Genetics URL:

https://phet.colorado.edu/sims/html/gene-expression-essentials/
latest/gene-expression-essentials_en.html

*Allow flash player

www.tntextbooks.in
6
UNIT - II
Evolution
CHAPTER
"Each has his own tree of ancestors, but at the top

Chapter Outline of all sits probably arboreal"
6.1 Origin of life - Evolution of life forms

6.2 Geological time scale
6.3 Biological evolution
6.4 Evidences for biological evolution
T he term evolution is used to describe
heritable changes in one or more
characteristics of a population of species from
6.5 Theories of biological evolution
one generation to the other. The present state
6.6 Mechanism of evolution
of mankind on earth is the outcome of three
6.7 Hardy Weinberg principle kinds of evolution - chemical, organic and
6.8 Origin and evolution of man social or cultural evolution.
6.9 Isolating mechanisms Radiometric dating of meteorites yields
6.10 Speciation an estimated age for the solar system and for
6.11 Extinction of animals earth as around 4.5 – 4.6 billion years. The
new born earth remained inhospitable for at
least few hundred millions years. At first it
Learning Objectives was too hot. This is because the collisions of
the planetesimals that coalesced to form earth
➢ Understands the evolution of life on earth. released much heat to melt the entire planet.
➢ Gains knowledge on theories of evolution. Eventually outer surface of the earth cooled
and solidified to form a crust. Water vapour
➢ Interprets evidences
released from the planet’s interior cooled
(anatomical, embryological and and condensed to form oceans. Hence origin
geological) of evolution. of life can be reconstructed using indirect
➢ Learns the principles of evidences. Consequently, biologists have
biological evolution. turned to gather disparate bits of information
and filling them together like pieces of jig saw
➢ Understands the importance of
puzzle. Many theories have been proposed
gene frequencies in a population. to explain the origin of life. Few have been
➢ Studies the geological time scale. discussed in this chapter.
➢ Understands the importance of isolating
mechanisms in speciation.
92

www.tntextbooks.in
6.1 Origin of life – Evolution of physical forces such, as lightning, UV radiations,

life forms volcanic activities, etc.,., Oparin (1924)
suggested that the organic compounds could
Theory of special creation states that
have undergone a series of reactions leading
life was created by a supernatural power,
to more complex molecules. He proposed that
respectfully referred to as “God”. According
the molecules formed colloidal aggregates or
to Hinduism, Lord Brahma created the Earth.
‘coacervates’ in an aqueous environment. The
Christianity, Islam and most religions believe
coacervates were able to absorb and assimilate
that God created the universe, the plants and
organic compounds from the environment.
the animals.
Haldane (1929) proposed that the primordial
According to the theory of spontaneous
sea served as a vast chemical laboratory
generation or Abiogenesis, living organisms
powered by solar energy. The atmosphere
originated from non-living materials and
was oxygen free and the combination of CO2,
occurred through stepwise chemical and
NH3 and UV radiations gave rise to organic
molecular evolution over millions of years.
compounds. The sea became a ‘hot’ dilute
Thomas Huxley coined the term abiogenesis.
soup containing large populations of organic
Big bang theory explains the origin monomers and polymers. They envisaged that
of universe as a singular huge explosion groups of monomers and polymers acquired
in physical terms. The primitive earth had lipid membranes and further developed into
no proper atmosphere, but consisted of the first living cell. Haldane coined the term
ammonia, methane, hydrogen and water prebiotic soup and this became the powerful
vapour. The temperature of the earth was symbol of the Oparin-Haldane view on the
extremely high. UV rays from the sun split origin of life (1924-1929).
up water molecules into hydrogen and
Oparin and Haldane independently
oxygen. Gradually the temperature cooled
suggested that if the primitive atmosphere was
and the water vapour condensed to form rain.
reducing and if there was appropriate supply
Rain water filled all the depressions to form
of energy such as lightning or UV light then
water bodies. Ammonia and methane in the
a wide range of organic compounds can be
atmosphere combined with oxygen to form
synthesized.
carbon-dioxide and other gases.
6.2 Geological time scale
Coacervates (large colloidal particles The duration of the earth’s history has been
that precipitate out in aqueous medium) divided into eras that include
are the first pre-cells which gradually the Paleozoic, Mesozoic,
transformed into living cells. and Cenozoic. Recent eras
are further divided into
According to the theory of biogenesis periods, which are split into
life arose from pre-existing life. The term epochs. The geological time
biogenesis also refers to the biochemical scale with the duration of the
process of production of living organisms eras and periods with the dominant forms of
This term was coined by Henry Bastian. life is shown in Table 6.1.
According to the theory of chemical The Paleozoic era is characterized by
evolution primitive organisms in the abundance of fossils of marine invertebrates.
primordial environment of the earth evolved Towards the later half, other vertebrates (marine
spontaneously from inorganic substances and and terrestrial) except birds and mammals
93 Evolution

www.tntextbooks.in
appeared. The six periods of Paleozoic era ray finned fishes), Mississippian (earliest
in order from oldest to the youngest are amphibians, Echinoderms), Pennsylvanian
Cambrian (Age of invertebrates), Ordovician (earliest reptiles), Permian (mammal like
(fresh water fishes, Ostracoderms, various reptiles).
types of Molluscs), Silurian (origin of fishes), Mesozoic era (dominance of reptiles)
Devonian (Age of fishes, many types of fishes called the Golden age of reptiles, is
such as lung fishes, lobe finned fishes and divided into three periods namely,
Triassic (origin of egg laying mammals),
Table 6.1 Geological Time Scale
YEARS IN
ERA
PERIOD EPOCH FAUNA FLORA

MILLION
Recent Angiosperms
1 Age of Mammals
Quaternary (Holocene) Monocotyledons
6 Pleistocene Age of Human beings
Cenozoic
10 Pliocene Human evolution

15 Miocene Age of
Angiosperms -
20 Tertiary Oligocene Dicotyledons
Mammals and birds
Eocene
100
Paleocene
Sphenopsides,
125 Cretaceous Ginkgos, Gnetales,
(Dicotyledons)
Mesozoic
(Golden age of Reptiles)

Rise of Dinesurs Herbaceous
150 Jurassic lycopods, Ferns,
Conifers, Cycads
180 Triassic
Arborescent
205 Permian Mammal like reptiles
lycopods
Seed ferns and
230 Pennsylvanian Earliest reptiles
Bryophytes
Carboniferous
Earliest Amphibians and
Paleozoic
255 Mississippian
abundant Echinoderms
315 Devonian Age of fishes Progymnosperms
Earliest fishes and land
350 Silurian Zosterophyllum
invertebrates
Dominance of Appearance of
430 Ordovician
invertebrates first land plants
510 Cambrian Fossil invertebrates Origin of algae
Upper Multicellular organisms
Precambrian
3000 Middle Appearance of eukaryotes

Planktons
Lower
prokaryotes
Evolution 94

www.tntextbooks.in
Jurassic (Dinosaurs were dominant on the viruses. Two major cell types that appeared
earth, fossil bird – Archaeopteryx) and during this time were significant. One form of the
Cretaceous (extinction of toothed birds and earliest cell contained clumps of nucleoproteins
dinosaurs, emergence of modern birds). embedded in the cell substance. Such cells were
Cenozoic era (Age of mammals) similar to the Monera. They are considered as
ancestral to the modern bacteria and blue green
is subdivided into two periods namely
algae. The other form of earliest cells contained
Tertiary and Quaternary. Tertiary period is
nucleoprotein clumps that condensed into a
characterized by abundant mammalian fauna.
central mass surrounded by a thin membrane.
This period is subdivided into five epochs This membrane separated nucleoproteins from
namely, Paleocene (placental mammals, the cell substances. Such cells were referred
Eocene (Monotremes except duck billed to as Protista. When the natural sources of
Platypus and Echidna, hoofed mammals and food in the ocean declined in course of time
carnivores), Oligocene (higher placental the ancestors of Monera and Protista had to
mammals appeared), Miocene (origin of evolve different methods for food procurement.
first man like apes) and Pliocene (origin of These may be summarized as parasitism,
man from man like apes).Quaternary period saprophytism, predator or animalism and
witnessed decline of mammals and beginning chemosynthesis or photosynthesis. When the
of human social life. number of photosynthetic organisms increased
The age of fossils can be determined there was an increase in the free O2 in the sea
and atmosphere.
using two methods namely, relative dating
and absolute dating. Relative dating is used to CH4+2O2 → CO2 +2H2O
determine a fossil by comparing it to similar 4NH3+3O2 → 2N2+6H2O
rocks and fossils of known age. Absolute The atmospheric oxygen combined with
dating is used to determine the precise age methane and ammonia to form CO2 and free
of a fossil by using radiometric dating to nitrogen. The presence of the free O2 brought
measure the decay of isotopes. about the evolution of aerobic respiration
which could yield large amounts of energy
6.3 Biological evolution by oxidation of food stuffs. Thus Prokaryotes
and Eukaryotes evolved.
Formation of protobionts
Abiotically produced molecules can Experimental approach to the origin
spontaneously self assemble into droplets of life
that enclose a watery solution and maintain Urey and Miller (1953), paved way
a chemical environment different from their
for understanding the possible synthesis of
surroundings. Scientists call these spheres
organic compounds that led to the appearance
as ‘protobionts’. Liposomes are lipids in a
of living organisms is depicted in the Fig. 6.1.
solution that can self assemble into a lipid
bilayer. Some of the proteins inside the In their experiment, a mixture of gases was
liposomes acquired the properties of enzymes allowed to circulate over electric discharge
resulting in fast multiplication of molecules. from an tungsten electrode. A small flask was
The coacervates with nucleoprotein and kept boiling and the steam emanating from
nutrients had a limiting surface membrane that it was made to mix with the mixture of gases
had the characters of a virus or free living genes. (ammonia, methane and hydrogen) in the large
Sub sequently number of genes united to form chamber that was connected to the boiling
‘proto viruses’ somewhat similar to present day water. The steam condensed to form water
95 Evolution

www.tntextbooks.in
of various geological strata of

Tungsten electrode evolution. Fossilization is the
process by which plant and
Spark discharge animal remains are preserved
Flask
in sedimentary rocks. They fall
under three main categories.
Gaseous mixture
(CH4 + NH3 + H2 + H2O) i) Actual remains – The
Water out original hard parts such as bones,
Condenser teeth or shells are preserved as
Cold water in such in the earth’s atmosphere.
This is the most common method
of fossilization. When marine
animals die, their hard parts such
as bones, shells, etc., are covered
with sediments and are protected
Aqueous medium from further deterioration. They
Boiling water containing organic get preserved as such as they
compounds
are preserved in vast ocean; the
salinity in them prevents decay.
Tap for
withdrawing The sediments become hardened
sample
to form definite layers or strata.
For example, Woolly Mammoth
that lived 22 thousand years ago
were preserved in the frozen
coast of Siberia as such. Several
Fig. 6.1 Diagrammatic representation of Urey-Miller’s human beings and animals living
experiment in the ancient city of Pompeii were
which ran down the ‘U’ tube. Experiment was preserved intact by volcanic ash
conducted continuously for a week and the which gushed out from Mount Vesuvius.
liquid was analysed. Glycine, alanine, beta ii) Petrifaction – When animals die
alanine and aspartic acid were identified. Thus the original portion of their body may be
Miller’s experiments had an insight as to the replaced molecule for molecule by minerals
possibility of abiogenetic synthesis of large and the original substance being lost through
amount of variety of organic compounds in disintegration. This method of fossilization
nature from a mixture of sample gases in which is called petrifaction. The principle minerals
the only source of carbon was methane. Later
involved in this type fossilization are iron
in similar experiments, formation of all types of
pyrites, silica, calcium carbonate and
amino acids, and nitrogen bases were noticed.
bicarbonates of calcium and magnesium.
6.4 Evidences for iii) Natural moulds and casts – Even
biological evolution after disintegration, the body of an animal
might leave indelible impression on the soft
6.4.1 Paleontological evidences mud which later becomes hardened into
Paleontology is the study of prehistoric
stones. Such impressions are called moulds.
life through fossils. Fossils are described as
The cavities of the moulds may get filled up
the true witnesses of evolution or documents
Evolution 96

www.tntextbooks.in
by hard minerals and get fossilized, which are homologous structures that brings about
called casts. Hardened faecal matter termed divergent evolution (Fig 6.2).
as coprolites occur as tiny pellets. Analysis of Similarly the thorn of Bougainvillea and
the coprolites enables us to understand the the tendrils of Curcurbita and Pisum sativum
nature of diet the pre-historic animals thrived represent homology. The thorn in former is
on. used as a defence mechanism from grazing
animals and the tendrils of latter is used as a
Visit any museum nearer to your
support for climbing.
school with your teacher and identify
the bones of different animals including Analogous structures
mammals. The famous Egmore Museum Organisms having different structural
is in Chennai. patterns but similar function are termed as
analogous structures. For example, the wings
6.4.2 Evidences from of birds and insects are different structurally
comparative anatomy but perform the same function of flight that
Similarities in structure between groups brings about convergent evolution (Fig. 6.3).
of organisms are accepted as indicators of
relationship. For example, a comparative study
of the forelimbs of different vertebrates exhibits Ulna
Carpals
a fundamental plan of similarity in structure.
Radius
These relationships can be studied under Humerus
homologous organs, analogous organs, vestigial
organs, connecting links and atavistic organs.
Homologous structures
In vertebrates, comparative anatomical
studies reveal a basic plan in various
structures such as fore limbs and hind limbs.
Fore limbs of vertebrates exhibit anatomical
similarity with each other and is made of
similar bones such as humerus, radius, ulna,
carpals, metacarpals and phalanges. Forewing
Bird Bat
Human
Hindwing
Whale Cat Horse
Humerus Ulna Radius Carpals Phalanges
Fig. 6.2 Forelimbs of terrestrial vertebrates to Fig. 6.3 Comparison of insect and bird wing
show homology to show their analogy
Structures which are similar in origin Other examples of analogous organs
but perform different functions are called include the eyes of the Octopus and of
97 Evolution

www.tntextbooks.in
mammals and the flippers of Penguins include coccyx, wisdom teeth, ear muscles,
and Dolphins. Root modification in sweet body hair, mammae in male, nictitating
potato and stem modification in potato are membrane of the eye, etc.,
considered as analogous organs. Both of these
plants have a common function of storage of
Connecting link
food. The organisms which possess the
characters of two different groups (transitional
Vestigial organs stage) are called connecting links. Example
Peripatus (connecting link between Annelida
Structures that are of no use to the
and Arthropoda), Archeopteryx (connecting
possessor, and are not necessary for their
link between Reptiles and Aves).
existence are called vestigial organs. Vestigial
organs may be considered as remnants of Atavistic organs
structures which were well developed and Sudden appearance of vestigial organs in
functional in the ancestors, but disappeared highly evolved organisms is called atavistic
in course of evolution due to their non- organs. Example, presence of tail in a human
utilization. Human appendix is the remnant baby is an atavistic organ.
of caecum which is functional in the digestive 6.4.3 Embryological evidences
tract of herbivorous animals like rabbit. Embryology deals with the study of the
Cellulose digestion takes place in the caecum development of individual from the egg to the
of these animals. Due to change in the diet adult stage. A detailed study of the embryonic
containing less cellulose, caecum in human development of different forms makes us to
became functionless and is reduced to a think that there is a close resemblance during
vermiform appendix, which is vestigial. Other development.
examples of vestigial organs in human beings The development of heart in all vertebrates
follows the same pattern of development as a
pair of tubular structures
)LVK 6DODPDQGHU 7RUWRLVH &KLFN +XPDQ that later develop into
two chambered heart in
fishes, three chambered in
amphibians and in most
3KDU\QJHDO 3RVWDQDO reptiles and four chambered
SRXFKHV WDLO
in crocodiles, birds and
mammals; indicating a
common ancestry for all the
vertebrates,
Hence scientists in the
19th century concluded that
higher animals during their
embryonic development
pass through stages of lower
animals (ancestors). Ernst
Von Haeckel, propounded
the “biogenetic law or
Fig 6.4 Embryological evidences
Evolution 98

www.tntextbooks.in
theory of recapitulation” which states 6.5 Theories of biological

that the life history of an individual evolution
(ontogeny) briefly repeats or recapitulates the
evolutionary history of the race (phylogeny). 6.5.1 Lamarck’s theory
In other words “Ontogeny recapitulates Jean Baptiste de Lamarck, was the first to
Phylogeny”. The embryonic stages of a postulate the theory of evolution in his famous
higher animal resemble the adult stage of its book ‘Philosophie Zoologique’ in the year
ancestors. Appearance of pharyngeal gill slits, 1809. The two principles of Lamarckian theory
yolk sac and the appearance of tail in human are:
embryos are some of the examples (Fig. 6.4). i. The theory of use and disuse - Organs
The biogenetic law is not universal and it is that are used often will increase in size and
now thought that animals do not recapitulate those that are not used will degenerate. Neck in
the adult stage of any ancestors. The human giraffe is an example of use and absence of limbs
embryo recapitulates the embryonic history in snakes is an example for disuse theory.
and not the adult history of the organisms.
ii. The theory of inheritance of acquired
The comparative study of the embryo of characters - Characters that are developed
different animals shows structural similarities during the life time of an organism are called
among themselves. The embryos of fish, acquired characters and these are then inherited.
salamander, tortoise, chick and human start
life as a single cell, the zygote, and undergo
The main objection to Lamarckism
cleavage to produce the blastula, change to Lamarck’s “Theory of Acquired characters”
gastrula and are triploblastic. This indicates was disproved by August Weismann who
that all the above said animals have evolved conducted experiments on mice for twenty
from a common ancestor. generations by cutting their tails and breeding
them. All mice born were with tail. Weismann
Molecular evidences
proved his germplasm theory that change in the
Molecular evolution is the process
somatoplasm will not be transferred to the next
of change in the sequence composition of
generation but changes in the germplasm will
molecules such as DNA, RNA and proteins
be inherited.
across generations. It uses principles of
evolutionary biology and population genetics Neo-Lamarckism
to explain patterns in the changes of molecules. The followers of Lamarck
One of the most useful advancement in the (Neo-Lamarckists) like Cope, Osborn, Packard
development of molecular biology is proteins and and Spencer tried to explain Lamarck’s theory
other molecules that control life processes are on a more scientific basis. They considered that
conserved among species. A slight change that adaptations are universal. Organisms acquire
occurs over time in these conserved molecules new structures due to their adaptations to
(DNA, RNA and protein) are often called the changed environmental conditions. They
molecular clocks. Molecules that have been used argued that external conditions stimulate the
to study evolution are cytochrome c (respiratory somatic cells to produce certain ‘secretions’
pathway) and rRNA (protein synthesis). which reach the sex cells through the blood and
bring about variations in the offspring.
99 Evolution

www.tntextbooks.in
6.5.2 Darwin’s theory of Natural found in an organism help them to overcome

Selection struggle and such variations are passed on to the
Charles Darwin explained the theory of next generation.
evolution in his book ‘The Origin of Species by 4. Origin of species by Natural Selection
Natural Selection’. During his journey around According to Darwin, nature is the most
the Earth, he made extensive observations of powerful selective force. He compared origin
plants and animals. He noted a huge variety
of species by natural selection to a small
and remarkable similarities among organisms
isolated group. Darwin believed that the
and their adaptive features to cope up to their
struggle for existence resulted in the survival
environment. He proved that fittest organisms
of the fittest. Such organisms become better
can survive and leave more progenies than the
unfit ones through natural selection. adapted to the changed environment.
Darwin’s theory was based on several facts, Objections to Darwinism
observations and influences. They are:
Some objections raised against Darwinism
1. Over production (or) prodigality of
were –
production
• D
arwin failed to explain the mechanism
All living organisms increase their
population in larger number. For example, of variation.
Salmon fish produces about 28 million eggs • D
arwinism explains the survival of the
during breeding season and if all of them hatch, fittest but not the arrival of the fittest.
the seas would be filled with salmon in few • H
e focused on small fluctuating variations
generations. Elephant, the slowest breeder that that are mostly non-heritable.
can produce six young ones in its life time can
• H
e did not distinguish between somatic
produce 6 million descendants at the end of 750
and germinal variations.
years in the absence of any check.
2. Struggle for existence • H
e could not explain the occurrence of
Organisms struggle for food, space and vestigial organs, over specialization of
mate. As these become a limiting factor, some organs like large tusks in extinct
competition exists among the members of mammoths, oversized antlers in the
the population. Darwin denoted struggle for extinct Irish deer, etc.,
existence in three ways –
Neo Darwinism
Intra specific struggle between the same
species for food, space and mate. Neo Darwinism is the interpretation
Inter specific struggle with different species of Darwinian evolution through Natural
for food and space. Selection as it has been modified since it
Struggle with the environment to cope was proposed. New facts and discoveries
with the climatic variations, flood, earthquakes, about evolution have led to modifications
drought, etc., of Darwinism and is supported by Wallace,
3. Universal occurrence of variations Heinrich, Haeckel, Weismann and Mendel.
No two individuals are alike. There are This theory emphasizes the change in the
variations even in identical twins. Even the frequency of genes in population arises due
children born of the same parents differ in colour, to mutation, variation, isolation and Natural
height, behavior, etc., The useful variations selection.
Evolution 100

www.tntextbooks.in
6.5.3 Mutation theory ii. Chromosomal mutation refers to the

Hugo de Vries put forth the Mutation changes in the structure of chromosomes
theory. Mutations are sudden random changes due to deletion, addition, duplication,
that occur in an organism that is not heritable. De inversion or translocation. This too
Vries carried out his experiments in the Evening alters the phenotype of an organism and
Primrose plant (Oenothera lamarckiana) and produces variations in their offspring.
observed variations in them due to mutation. iii. Genetic recombination is due to crossing
According to de Vries, sudden and large over of genes during meiosis. This brings
variations were responsible for the origin of new about genetic variations in the individuals
species whereas Lamarck and Darwin believed of the same species and leads to heritable
in gradual accumulation of all variations as the variations.
causative factors in the origin of new species. iv. Natural selection does not produce any
Hugo de Vries believed that Mutations genetic variations but once such variations
are random and directionless, but Darwinian occur it favours some genetic changes
variations are small and directional. while rejecting others (driving force of
evolution).
Hugo de Vries believed that speciation
v. Reproductive isolation helps in
are due to Mutation and called saltation
preventing interbreeding between related
(single step large Mutation).
organisms.
Salient features of Mutation Theory 6.5.5 Evolution by anthropogenic

sources
• M utations or discontinuous variation are
transmitted to other generations. Natural Selection (Industrial melanism)
• In naturally breeding populations, mutations Natural selection can be explained
occur from time to time. clearly through industrial melanism.
• There are no intermediate forms, as they are Industrial melanism is a classical case of
fully fledged. Natural selection exhibited by the peppered
• They are strictly subjected to natural moth, Biston betularia. These were available
selection. in two colours, white and black. Before
industrialization peppered moth both
6.5.4 Modern synthetic theory
white and black coloured were common in
Sewell Wright, Fisher, Mayer, Huxley,
England. Pre-industrialization witnessed
Dobzhansky, Simpson and Haeckel explained
white coloured background of the wall of
Natural Selection in the light of Post-Darwinian
the buildings hence the white coloured
discoveries. According to this theory gene
moths escaped from their predators. Post
mutations, chromosomal mutations, genetic
industrialization, the tree trunks became
recombinations, natural selection and
dark due to smoke and soot let out from the
reproductive isolation are the five basic factors
industries. The black moths camouflaged on
involved in the process of organic evolution.
the dark bark of the trees and the white moths
i. Gene mutation refers to the changes in the
were easily identified by their predators.
structure of the gene. It is also called gene/
Hence the dark coloured moth population
point mutation. It alters the phenotype of
was selected and their number increased
an organism and produces variations in
when compared to the white moths. Nature
their offspring.
offered positive selection pressure to the
101 Evolution

www.tntextbooks.in
black coloured moths. The above proof shows that time, Darwin's finches have evolved into
that in a population, organisms that can adapt 14 recognized species differing in body size,
will survive and produce more progenies beak shape and feeding behavior. Changes in
resulting in increase in population through the size and form of the beak have enabled
natural selection. different species to utilize different food
Artificial selection is a byproduct of resources such as insects, seeds, nectar from
human exploitation of forests, oceans and cactus flowers and blood from iguanas, all
fisheries or the use of pesticides, herbicides driven by Natural selection. Fig. 6.5 represents
or drugs. For hundreds of years humans have some of the finches observed by Darwin.
selected various types of dogs, all of which are Genetic variation in the ALX1 gene in the
variants of the single species of dog. If human DNA of Darwin finches is associated with
beings can produce new varieties in short variation in the beak shape. Mild mutation in
period, then “nature” with its vast resources the ALX1 gene leads to phenotypic change in
and long duration can easily produce new the shape of the beak of the Darwin finches.
species by selection. Marsupials in Australia and placental
mammals in North America are two
6.5.6 Adaptive Radiation
subclasses of mammals they have adapted
The evolutionary process which produces
in similar way to a particular food resource,
new species diverged from a single ancestral
locomotory skill or climate. They were
form becomes adapted to newly invaded
separated from the common ancestor more
habitats is called adaptive radiation. Adaptive
than 100 million year ago and each lineage
radiations are best exemplified in closely
continued to evolve independently. Despite
related groups that have evolved in relatively
temporal and geographical separation,
short time. Darwin’s finches and Australian
marsupials in Australia and placental
marsupials are best examples for adaptive
mammals in North America have produced
radiation. When more than one adaptive
varieties of species living in similar habitats
radiation occurs in an isolated geographical
with similar ways of life. Their overall
area, having the same structural and
resemblance in shape, locomotory mode,
functional similarity it is due to convergent
feeding and foraging are superimposed
evolution.
upon different modes of reproduction. This
Darwin’s finches feature reflects their distinctive evolutionary
Their common ancestor arrived on the relationships.
Galapagos about 2 million years ago. During Over 200 species of marsupials live in
Australia along with many
Warbler finch
(Certhidea olivacea) Cactus ground finch
fewer species of placental
Woodpecker finch
(Geospiza scandens)
mammals. The marsupials
(Cactospiza pallida) Warbler Sharp-beaked ground
finch finch (Geospiza difficilis) have undergone adaptive
Small insectivorous
tree finch Small ground
radiation to occupy
(Camarhynchus
parvulus) Pro
bing bills G ro
u
finch (Geospiza
fuliginosa)
the diverse habitats in
C
r
Australia, just as the

s eate
pin ches
nd
Large insectivorous
ills
ru
fin
Medium
in
sh
gb
Insect
ch
tree finch
ef
placental mammals have

Cactu
ing
ground finch
es
(Camarhynchus eaters
Tre
(Geospiza fortis)
bills
Gras
psittacula) Seed
eaters radiated across North
Bud eater Large ground
Vegetarian tree finch (Geospiza America.
finch (Platyspiza Parrot-like bill magnirostris)
crassirostris)
Fig 6.5 Darwin’s finches
Evolution 102

www.tntextbooks.in
6.6 Mechanism of evolution environment (Fig. 6.7a). The organisms

Microevolution (evolution on a with average phenotypes survive whereas
small scale) refers to the changes in allele the extreme individuals from both the ends
frequencies within a population. Allele are eliminated. There is no speciation but the
frequencies in a population may change due to phenotypic stability is maintained within the
four fundamental forces of evolution such as population over generation. For example,
natural selection, genetic drift, mutation and measurements of sparrows that survived
gene flow. the storm clustered around the mean, and
the sparrows that failed to survive the
6.6.1 Natural selection storm clustered around the extremes of the
It occurs when one allele (or combination variation showing stabilizing selection.
of alleles of differences) makes an organism
more or less fit to survive and reproduce ii. Directional Selection: The environment
in a given environment. If an allele reduces which undergoes gradual change is subjected
fitness, its frequencies tend to drop from one to directional selection (Fig. 6.7b). This type
generation to the next. of selection removes the individuals from
one end towards the other end of phenotypic
The evolutionary path of a given gene
distribution. For example, size differences
i.e., how its allele's change in frequency in the
between male and female sparrows. Both
population across generation, may result from
male and female look alike externally
several evolutionary mechanisms acting at
but differ in body weight. Females show
once. For example, one gene’s allele frequencies
directional selection in relation to body
might be modified by both gene flow and
weight.
genetic drift, for another gene, mutation
may produce a new allele, that is favoured by iii. Disruptive Selection (centrifugal selection):
natural selection (Fig. 6.6). When homogenous environment changes
Selection into heterogenous environment this type
of selection is operational (Fig. 6.7c). The
There are mainly three types of natural
organisms of both the extreme phenotypes
selection
are selected whereas individuals with
i. Stabilising Selection (centipetal selection): average phenotype are eliminated. This
This type of selection operates in a stable results in splitting of the population into
Dark rock environment Next generation
light grey beetles

are spotted and eaten
Aa by birds more often Aa
AA
AA
than dark ones
Aa AA
aa aa If ‘X’ is eaten by aa AA Aa
aa AA
Aa birds then only
Aa survivors reproduce
aa aa Aa aa Aa
Fig 6.6 Natural selection
103 Evolution

www.tntextbooks.in
Medium-sized
Number of individuals
Phenotypes individuals
are favoured
with phenotype
favoured
by natural
selection
Peak gets higher Peak shifts in

and narrower one direction
Two peaks form
(a) (b) (c)
Fig 6.7 Operation of natural selection on different traits (a) Stabilising (b) Directional and (c) Disruptive
sub population/species. This is a rare form
of selection but leads to formation of two
6.6.3 Genetic drift / Sewall
or more different species. It is also called Wright Effect
adaptive radiation. E.g. Darwin's finches- Genetic drift is a mechanism of evolution in
beak size in relation to seed size inhabiting which allele frequencies of a population change
Galapagos islands. over generation due to chance (sampling error).
Group selection and sexual selection are Genetic drift occurs in all population sizes,
other types of selection. The two major group but its effects are strong in a small population
selections are Altrusim and Kin selection.
(Fig. 6.9). It may result in a loss of some
6.6.2 Gene flow alleles (including beneficial ones) and fixation
Movement of genes through gametes or of other alleles. Genetic drift can have major
movement of individuals in (immigration) and effects, when the population is reduced in size
out (emigration) of a population is referred to as by natural disaster due to bottle neck effect or
gene flow. Organisms and gametes that enter the when a small group of population splits from
population may have new alleles or may bring
the main population to form a new colony due
in existing alleles but in different proportions
to founder’s effect.
than those already in the population. Gene flow
can be a strong agent of evolution (Fig 6.8). 'XHWRFKDQFH
HYHQWVRQO\
AA
WKHVHEHHWOHV
$D JLYHVULVHWR 1H[WJHQHUDWLRQ
$$ RIIVSULQJV
Migration $D
DD DD
AA AA
DD $D
$D
aa
AA DD DD
aa
aa )UHTXHQF\RI$ )UHTXHQF\RI$
AA )UHTXHQF\RID )UHTXHQF\RID
aa
Fig 6.9 Genetic drift
Fig 6.8 Gene flow
Evolution 104

www.tntextbooks.in
6.6.4 Mutation If a population is in Hardy Weinberg

Although mutation is the original source equilibrium, the genotype frequency can
of all genetic variation, mutation rate for be estimated by Hardy Weinberg equation.
most organisms is low. Hence new mutations (p + q)2 = p2 + 2pq + q2
on an allele frequencies from one generation p2 = frequency of AA
to the next is usually not large. 2pq= frequency of Aa
6.7 Hardy - Weinberg Principle q2= frequency of aa
In nature, populations are usually p = 0.3, q = 0.7 then,
evolving such as the grass in an open meadow, p2 = (0.3)2 = 0.09 = 9 % AA
wolves in a forest and bacteria in a person’s
2pq = 2(0.3) (0.7) = 0.42 = 42 % Aa
body are all natural populations. All of these
populations are likely to be evolving some q2 = (0.7)2 0.49 = 49 % aa
of their genes. Evolution does not mean that Hence the beetle population appears to
the population is moving towards perfection be in Hardy- Weinberg equilibrium. When
rather the population is changing its genetic the beetles in Hardy- Weinberg equilibrium
makeup over generations. For example in a reproduce, the allele and genotype frequency
wolf population, there may be a shift in the in the next generation would be: Let’s assume
frequency of a gene variant for black fur than that the frequency of ‘A’ and ‘a’ allele in the
grey fur. Sometimes, this type of change is pool of gametes that make the next generation
due to natural selection or due to migration would be the same, then there would be
or due to random events. no variation in the progeny. The genotype
First we will see the set of conditions frequencies of the parent appears in the next
required for a population not to evolve. Hardy generation. (i.e. 9% AA, 42% Aa and 49% aa).
of UK and Weinberg of Germany stated that If we assume that the beetles mate
the allele frequencies in a population are randomly (selection of male gamete and
stable and are constant from generation female gamete in the pool of gametes), the
to generation in the absence of gene flow, probability of getting the offspring genotype
genetic drift, mutation, recombination and depends on the genotype of the combining
natural selection. If a population is in a state parental gametes.
of Hardy Weinberg equilibrium, the frequencies
Hardy Weinberg’s assumptions include
of alleles and genotypes or sets of alleles in that
population will remain same over generations. No mutation – No new alleles are generated
Evolution is a change in the allele frequencies by mutation nor the genes get duplicated or
in a population over time. Hence population in deleted.
Hardy Weinberg is not evolving. Random mating – Every organism gets a
Suppose we have a large population of chance to mate and the mating is random
beetles, (infinitely large) and appear in two with each other with no preferences for a
colours dark grey (black) and light grey, and particular genotype.
their colour is determined by ‘A’ gene. ‘AA’ No gene flow - Neither individuals nor
and ‘Aa’ beetles are dark grey and ‘aa’ beetles their gametes enter (immigration) or exit
are light grey. In a population let’s say that ‘A’ (emigration) the population.
allele has frequency (p) of 0.3 and ‘a’ allele has Very large population size - The population
a frequency (q ) of 0.7. Then p+q=1. should be infinite in size.
105 Evolution

www.tntextbooks.in
No natural selection- All alleles are fit to Australian ape man. He was about 1.5 meters
survive and reproduce. tall with bipedal locomotion, omnivorous,
If any one of these assumptions were not semi erect, and lived in caves. Low forehead,
met, the population will not be in Hardy- brow ridges over the eyes, protruding face,
Weinberg equilibrium. Only if the allele lack of chin, low brain capacity of about 350 –
frequencies changes from one generation to 450 cc, human like dentition, lumbar curve in
the other, evolution will take place. the vertebral column were his distinguishing
features.
6.8 Origin and Evolution of Man Homo habilis lived about 2 mya. Their
Mammals evolved in the brain capacity was between 650 – 800cc, and
early Jurassic period, about was probably vegetarian. They had bipedal
210 million years ago (mya). locomotion and used tools made of chipped
Hominid evolution occurred stones.
in Asia and Africa. Hominids Homo erectus the first human like being was
proved that human beings around 1.7 mya and was much closer to human
are superior to other animals and efficient in in looks, skull was flatter and thicker than the
making tools and culture. modern man and had a large brain capacity of
The earliest fossils of the prehistoric man around 900 cc. Homo erectus probably ate meat
like Ramapithecus and Sivapithecus lived Homo ergaster and Homo erectus were the first
some 14 mya and were derived from ape like to leave Africa.
Dryopithecus. Dryopithecus and Ramapithecus Neanderthal human was found in Neander
were hairy and walked like gorillas and Valley, Germany with a brain size of 1400 cc
chimpanzees. Ramapithecus is regarded as and lived between 34,000 - 1,00,000 years
a possible ancester of Australopithecus and ago. They differ from the modern human in
therefore of modern humans. They were having semierect posture, flat cranium, sloping
vegetarians (Fig 6.10). forehead, thin large orbits, heavy brow ridges,
Australopithecus lived in East African protruding jaws and no chin. They used animal
grasslands about 5 mya and was called the hides to protect their bodies, knew the use of
Ramapithecus Australopithecus Homo habilis Homo erectus Neanderthal man Homo sapiens
Fig 6.10 Evolution of Man
Evolution 106

www.tntextbooks.in
fire and buried their dead. They did not practice ii. Seasonal isolation – In this type of isolation,
agriculture and animal domestication. difference in the breeding seasons prevents
Cro-Magnon was one of the most talked interbreeding. E.g. Toad, Bufo americanus
forms of modern human found from the rocks breeds much early in the spring; whereas
of Cro-Magnon, France and is considered as Bufo fowleri breeds very late in the season.
the ancestor of modern Europeans. They were They are able to maintain their species
not only adapted to various environmental identity because of the differences in the
conditions, but were also known for their cave breeding seasons.
paintings, figures on floors and walls. iii. Sexual or ethological isolation/
Homo sapiens or modern human arose Behavioural isolation – Prevents mating
in Africa some 25,000 years ago and moved due to the difference in their sexual
to other continents and developed into behavior. The species are not separated from
distinct races. They had a brain capacity of one another either in time or in space. The
1300 – 1600 cc. They started cultivating crops mating calls of two closely related species
and domesticating animals. of frogs, Hyla versicolor (grey tree frog) and
6.9 Isolating Mechanism Hyla femoralis (pine wood tree frog) are
Isolation is the separation of the members different which prevents interbreeding.
of a single population into sub populations so iv. Morphological isolation or mechanical
that genetic integrity of the subpopulation can isolation – This type of isolation is due to
be maintained. Closely related species living in the differences in their external genitalia
the same area do not breed together; they are that is seen in two different species. The size
prevented by isolating barriers. An isolating difference between the toad species Bufo
barrier is any evolved character of the two species quercicus and Bufo valliceps, prevents their
that stops them from interbreeding. Several interbreeding.
kinds of isolating barriers are distinguished. The v. Physiological isolation –Though mating
most important distinction is Prezygotic and may occur, the gametes are prevented
post zygotic isolation. Prezygotic mechanisms from fertilization due to mechanical or
include those which prevent two species from physiological factors. E.g. The sperms of
coming into contact. This includes ecological, Drosophila virilis survive only for about
seasonal, ethological and morphological. Post a day when introduced into the sperm
zygotic mechanisms are those which act after receptacle of Drosophila americana while
fertilization that include hybrid sterility, hybrid
the sperms of Drosophila americana live for
inviability and hybrid breakdown.
a longer time.
Pre-zygotic Mechanism vi. Cytological isolation – Fertilization does
i. Ecological isolation or habitat isolation – not take place due to the differences in the
the members of the same population may be chromosome numbers between the two
separated from one another by a differences species, the bull frog Rana catesbiana and
in their habitat. For example Rana areolata gopher frog Rana areolata.
occupies burrows dug by mammals and
tortoises during the day and breeds in
Post-zygotic Mechanism
grassy shallow ponds whereas Rana grylio i. Hybrid inviability – In this type, the sperm
breeds in deep waters. Due to the difference enters the egg, fertilization occurs and the
in their habitat the two species are able to embryo develops into the adult but it dies
maintain their respective species identities. before reaching maturity. In certain fishes,
107 Evolution

www.tntextbooks.in
frogs, beetles, even if fertilization takes domestica) that grew in the same area. This small
place between two species, due to genetic group of apple maggot flies selected a different
incompatibility they do not leave any host species from the rest of the population and its
surviving offspring. offsprings became accustomed to domesticated
ii. Hybrid sterility – In this type, hybrids are apples.
formed due to inter specific crosses but
Phenotypic plasicity is the ability of
they are sterile due to the failure of the
single genotype to produce more than
chromosomes to segregate normally during
one phenotype. When this plasticity is
meiosis, example Mule (inter specific cross
expressed seasonally in planktons, it is
between a horse and a donkey).
referred to as cyclomorphosis.
iii. Hybrid breakdown – F1 Hybrids are viable
and fertile, but F2 hybrids may be inviable
or sterile. 6.10.2 Allopatric speciation/
Geographical speciation
6.10 Speciation
It is a mode of speciation that occurs
The process by which one species evolves into
one or more different species is called speciation. when biological populations of similar species
A.E. Emerson defines species as a ‘genetically become isolated from each other that prevents
distinctive, reproductively isolated natural gene flow. One species becomes two species
population’. Speciation is a fundamental process in due to geographical barriers hence new species
evolution. Evolution of a new species in a single is evolved e.g. Darwin's finches. The barriers
lineage is called an agenesis / phyletic speciation. are land separation, migration or mountain
If one species diverges to become two or more formation. When barriers occur between species,
species it is cladogenesis or divergent evolution. change in ecological conditions and environment
leads to adaptations that produce differences. If
6.10.1 Sympatric speciation/
there are no adaptations, they will not survive.
Reproductive isolation
Sexual isolation is weakest.
It is a mode of speciation through which
new species form from a single ancestral 6.11 Extinction of Animals
species while both species continue to inhabit Extinction
the same geographical region. Two or more Extinction was common if not inevitable
species are involved. New species formed due because species could not always adapt to large
to genetic modification in the ancestor that is or rapid environmental changes. The impact of
naturally selected can no longer breed with the extinction can conveniently be considered at
parent population. Sexual isolation is strongest.
three levels.
Phenotypic plasticity has emerged as potentially
Species extinction eliminates an entire
important first step in speciation initiated
species, by an environmental event (flood
within an isolated population.
etc.,) or by biological event (disease or non
A well studied example is the adaptation availability of food resource half or more).
of Apple maggots that feed on apples in North Mass extinction eliminates half or more
America. When the apple trees were imported to species in a region or ecosystem, as might occur
North America, Apple maggot flies (Rhagoletis following a volcanic eruption. Five major mass
pomonella) a parasitic insect that normally laid extinction that occurred since the Cambrian
its eggs in the fruit of wild hawthorns until period. This mass extinction is often referred to
one subset of population began to lay its eggs as K-T extinction. Table 6.2 represents the K-T
in the fruit of domesticated apple trees (Malus extinction.
Evolution 108

www.tntextbooks.in
Table 6.2 Details of the five major mass Human evolution states that humans
extinctions since the Cambrian period developed from primates or ape like ancestors.
Estimated The emergence of Homo sapiens as a distinct
% of Marine species from apes and placental mammals in
Date
Extinction Period Animal brain size, eating habit and other behavior
(Mya)
Extinction proves that ‘Ontogeny recapitulates Phylogeny’.
Genera Species
Separation of a single population into its
End of the
440 61 85 subunits preserves the genetic integrity. Types
Ordovician of isolating mechanism and speciation prevent
End of the Devonian 365 55 82 interbreeding of different species. Various
End of the Permian 245 84 96 causes of extinction of animals and the levels of
End of the Triassic 208 50 76 impact are dealt with in the lesson.
End of the Cretaceous 65 50 76
Evaluation
K-T Extinction refers to the German
word Cretaceous and Tertiary periods. 1) Th
e first life on earth
originated
Global extinction eliminates most of the a) in air b) on land
species on a large scale or larger taxonomic c) in water d) on mountain
groups in the continent or the Earth. Snow ball 2) Who published the book “Origin of species
Earth and extinction following elevation in CO2 by Natural Selection” in 1859?
levels are example. Extinction events opens up
a) Charles Darwin b) Lamarck
new habitats and so can facilitate the radiation
of organisms that survived the mass extinction. c) Weismann d) Hugo de Vries
3) Which of the following was the contribution
Summary of Hugo de Vries?
Evolutionary Biology is the study of history a) Theory of mutation
of life forms on Earth which originated on Earth b) Theory of natural Selection
millions of years ago. How Earth originated, how c)
Theory of inheritance of acquired
life originated, what is the place of man in the characters
universe are all general questions. This chapter d) Germplasm theory
deals with several theories to explain the life 4) The wings of birds and butterflies is an
on Earth. Evidence from the fossil record and
example of
many other areas of biology like embryology,
a) Adaptive radiation
anatomy and molecular biology indicates a
b) convergent evolution
common ancestry.
c) divergent evolution
The theories advanced by Lamarck, d) variation
Darwin, Hugo de Vries explained the intricate
evolutionary process. Geological time scale 5) The phenomenon of “ Industrial Melanism”
with different eras, periods and epochs gives demonstrates
an idea about the dominant species in those a) Natural selection
days. The mathematical distribution of gene b) induced mutation
and genotype frequencies remains constant in c) reproductive isolation
a small population was contributed by Hardy d) geographical isolation
and Weinberg in 1608. Natural Selection and 6) Darwin’s finches are an excellent example of
gene pool are the important factors those affect a) connecting links b) seasonal migration
Hardy Weinberg equilibrium. c) adaptive radiation d) parasitism
109 Evolution

www.tntextbooks.in
7) W ho proposed the Germplasm theory? 19) Differentiate between divergent evolution

a ) Darwin b) August Weismann and convergent evolution with one example
c) Lamarck d) Alfred Wallace for each.
8) The age of fossils can be determined by 20) How does Hardy-Weinberg’s expression
a) electron microscope (p2+2pq+q2=1) explain that genetic
b) weighing the fossils equilibrium is maintained in a population?
c) carbon dating List any four factors that can disturb the
d) analysis of bones genetic equilibrium.
9) Fossils are generally found in 21) Explain how mutations, natural selection
a) igneous rocks b) metamorphic rocks and genetic drift affect Hardy Weinberg
c) volcanic rocks d) sedimentary rocks equilibrium.
10) Evolutionary history of an organism is called 22) How did Darwin explain fitness of
a) ancestry b) ontogeny
organisms?
c) phylogeny d) paleontology
23) Mention the main objections to Darwinism.
11) The golden age of reptiles was
a) Mesozoic era b) Cenozoic era 24) Taking the example of Peppered moth,
c) Paleozoic era d) Proterozoic era explain the action of natural selection.
What do you call the above phenomenon?
12) Which period was called “Age of fishes”?
a) Permian b) Triassic 25) Darwin's finches and Australian marsupials
c) Devonian d) Ordovician are suitable examples of adaptive radiation
13) Modern man belongs to which period? – Justify the statement.
a) Quaternary b) Cretaceous 26) Who disproved Lamarck’s Theory of
c) Silurian d) Cambrian acquired characters? How?
14) The Neanderthal man had the brain capacity 27) How does Mutation theory of De Vries
of differ from Lamarck and Darwin’s view in
a) 650 – 800cc b) 1200cc the origin of new species.
c) 900cc d) 1400cc
28) Explain stabilizing, directional and
15) According to Darwin, the organic evolution disruptive selection with examples.
is due to
29) Rearrange the descent in human evolution
a) Intraspecific competition
b) Interspecific competition ustrolopithecus → Homo erectus → Homo
A
c) Competition within closely related sapiens → Ramapithecus → Homo habilis.
species. 30) How does Neanderthal man differ from
d) Reduced feeding efficiency in one species the modern man in appearance?
due to the presence of interfering species. 31) Define isolating mechanism and explain its
16) A population will not exist in Hardy- types with suitable examples.
Weinberg equilibrium if 32) Define speciation according to
a) Individuals mate selectively A.E. Emerson and explain its types giving
b) There are no mutations suitable examples.
c) There is no migration
33) Give an account on the major causes for the
d) The population is large
extinction of a particular species on earth.
17) List out the major gases seems to be found in 34) Explain the three level of impact of
the primitive earth. extinction of species.
18) Explain the three major categories in which
fossilization occur?
Evolution 110

Concept Map
3DQVSHUPLD 0XWDWLRQ

6SRQWDQHRXV
JHQHUDWLRQ 6WDELOLVLQJ
6SHFLDWLRQ
6SHFLDO
FUHDWLRQ 1DWXUDOVHOHFWLRQ 'LVUXSWLYH
2ULJLQRIOLIH
'LUHFWLRQDO
$ELRJHQHVLV
(92/87,21 $FTXLUHG
FKDUDFWHUV
+XPDQHYROXWLRQ 3RSXODWLRQ
(PEU\RORJLFDO
'U\RSLWKHFXV +DUG\:HLQEHUJ
HTXLOLEULXP
www.tntextbooks.in
(YLGHQFHV
5DPDSLWKHFXV
)DFWRUVDIIHFWLQJ
0RUSKRORJLFDO *HQHIORZ +DUG\:HLQEHUJ 5HFRPELQDWLRQ
DQG$QDWRPLFDO HTXLOLEULXP
$XVWUDORSLWKHFXV %LRFKHPLFDO
0XWDWLRQ
111
+RPRKDELOLV *HQHWLFGULIW
'LYHUJHQW 1DWXUDOVHOHFWLRQ
HYROXWLRQ
+RPRORJ\
+RPRHUHFWXV 3DOHRQWRORJLFDO
&RQYHUJHQW
HYROXWLRQ
+RPRVDSLHQV $QDORJ\
Evolution
18/12/2021 14:52:53
www.tntextbooks.in
7
UNIT - III
Human Health
and Diseases
CHAPTER
Sneezing spreads diseases through the droplets

Chapter outline of mucus

7.1 Common diseases in human beings
7.2 Maintenance of personal and public
hygiene
7.3 Adolescence – Drug and alcohol
abuse
T he World Health Organization [WHO]
defines health as ‘a state of complete
physical, mental and social wellbeing and not
7.4 Mental health – Depression merely absence of diseases’. We can also say
“HEALTH IS WEALTH”, when people are
7.5 Lifestyle disorders in human beings
healthy they are more efficient at work. Health
increases longevity of people and reduces
infant and adult mortality. Personal hygiene,
regular exercise and balanced diet are very
important to maintain good health.
Learning Objectives
7.1 C
ommon diseases in
➢➢ Learns about various bacterial, human beings
viral, fungal, protozoan and Disease can be defined as a disorder or
helminth diseases.
malfunction of the mind or body. It involves
➢➢ Understands the life cycle of morphological, physiological and psychological
malarial parasite. disturbances which may be due to environmental
factors or pathogens or genetic anomalies or life
➢➢ Learns the ill effects of drugs style changes. Diseases can be broadly grouped
and alcohol. into infectious and non infectious types.
➢➢ Realizes the responsibility Diseases which are transmitted from one
for their behaviour, health person to another are called infectious diseases
care and life styles. or communicable diseases. Such disease
causing organisms are called pathogens
➢➢ Understands the importance of and are transmitted through air, water, food,
mental health and life style physical contact and vectors. The disease
modifications to be followed for
causing pathogen may be virus, bacteria, fungi,
their well being.
protozoan parasites, helminthic parasites, etc.,
Infectious diseases are common and everyone
112

www.tntextbooks.in
Common human diseases
Bacterial diseases Viral diseases Fungal diseases Protozoan Helminthic

• Dysentery • Common cold • Candidiasis diseases diseases
• Plague • Mumps • Athlete’s foot • Malaria • Ascariasis
• Diphtheria • Measles • Amoebiasis • Filariasis
• Cholera • Viral hepatitis • African
• Typhoid • Dengue fever sleeping
• Pneumonia • Chikungunya sickness
• Chicken pox • Kala-azar
• Poliomyelitis
suffers from such diseases at some time or the

Bacterial resistance
other. Most of the bacterial diseases are curable
If an antibiotic is used too often to
but all viral diseases are not. Some infectious
fight a specific bacterial infection, the
disease like AIDS may be fatal.
bacteria may become resistant to the
Non-infectious diseases are not
specific antibiotic. Hence the specific
transmitted from an infected person
antibiotic can no longer be used to
to a healthy person. In origin they may
treat the bacterial infection. Some
be genetic (cystic fibrosis), nutritional
(vitamin deficiency diseases) and degenerative bacteria have developed resistance to
(arthritis, heart attack, stroke). Among non - many antibiotics. Therefore, infections
infectious diseases, cancer is one of the major caused by these bacteria are difficult to
causes of death. be cured.
Risk of bacterial resistance can be
7.1.1 Bacterial and viral diseases reduced by observing the following steps
Bacterial diseases
• Avoid using antibiotics to treat minor
Though the number of bacterial
infections that can be taken care by our
species is very high, only a few bacteria are
immune system.
associated with human diseases and are called
pathogenic bacteria. Such pathogens may • Do not use an antibiotic to treat viral
emit toxins and affects the body. Common infections such as common cold or flu.
pathogenic bacteria and the bacterial diseases • Always follow the prescription.
are given in table 7.1. Skipping doses or failing to complete
Bacteria spread through air, water or the prescription may allow antibiotic
by inhaling the droplets/aerosols or even resistance to develop.
by sharing utensils, dresses with an infected
person. Typhoid fever can be confirmed by living cells. Outside the living cells they
Widal test. cannot carry out the characteristics of a
living organism. Viruses invade living cells,
Viral diseases forcing the cells to create new viruses. The
Viruses are the smallest intracellular new viruses break out of the cell, killing it
obligate parasites, which multiply within and invade other cells in the body, causing
113 Human Health and Diseases

www.tntextbooks.in
Table 7.1. Bacterial diseases in human beings

S. Diseases Causative agent Site of Mode of Symptoms
No infection transmission
1 Shigellosis Shigella sp. Intestine Food and water Abdominal pain,
(Bacillary contaminated dehydration, blood
dysentery) by faeces / and mucus in the
faecal oral route stools
2 Bubonic Yersinia pestis Lymph Rat flea vector- Fever, headache,

plague nodes Xenopsylla and swollen lymph
( Black death) cheopis nodes
3 Diphtheria Corynebacterium Larynx, Droplet Fever, sore throat,
diphtheriae skin, nasal infection hoarseness and
and genital difficulty in
passage breathing
4 Cholera Vibrio cholerae Intestine Contaminated Severe diarrhoea
food and water/ and dehydration
faecal oral route
5 Tetanus Clostridium Spasm of Through wound Rigidity of jaw
( Lock jaw) tetani muscles infection muscle, increased
heart beat rate
and spasm of the
muscles of the jaw
and face
6 Typhoid Salmonella typhi Intestine Through Headache,
( Enteric fever) contaminated abdominal
food and water discomfort, fever
and diarrhoea
7 Pneumonia Streptococcus Lungs Droplet Fever, cough,
pneumoniae infection painful breathing
and brown sputum
8 Tuberculosis Mycobacterium Lungs Droplet Thick
tuberculosis infection mucopurulant
nasal discharge
diseases in human beings. Rhino viruses cause

Common cold is caused by more than
one of the most infectious human ailment
150 different strains of Rhino viruses.
called the “Common cold”.
More over their RNA genome keeps
Viral diseases are generally grouped
changing due to mutation. Hence it is very
into four types on the basis of the symptoms
difficult to prepare a common vaccine for
produced in the body organs.
the disease.
Human Health and Diseases 114

www.tntextbooks.in
Table: 7.2 Viral diseases in human beings

S. Diseases Causative Site of Mode of Symptoms
No agent infection transmission
1 Common cold Rhino viruses Respiratory Droplet Nasal congestion
tract infection and discharge, sore
throat, cough and
headache
2 Mumps Mumps virus Salivary glands Saliva and Enlargement of the
(RNA virus), droplet parotid glands
Paramyxo infection
virus
3 Measles Rubella virus Skin and Droplet Sore throat,
(RNA virus), respiratory infection running nose,
Paramyxo tract cough and fever,
virus reddish rashes on
the skin, neck and
ears
4 Viral hepatitis Hepatitis - B Liver Parenteral Liver damage,
virus route, blood jaundice, nausea,
transfusion yellowish eyes,
fever and pain in
the abdomen
5 Chicken pox Varicella Respiratory Droplet Mild fever with
-Zoster virus tract, skin and infection and itchy skin, rash and
(DNA Virus ) nervous system direct contact blisters
6 Poliomyelitis Polio virus Intestine, Droplet Fever, muscular
(RNA virus) brain, spinal infection stiffness and
cord through weakness, paralysis
faecal oral and respiratory
route failure
7 Dengue fever Dengue virus Skin and blood Mosquito Severe flu like
(Break bone or Flavi virus vector illness with a
fever) (DENV 1-4 Aedes aegypti sudden onset of
virus) fever and painful
headache, muscle
and joint pain
8 Chikungunya Alpha virus Nervous Mosquito Fever and joint
(Toga virus) system vector pain, headache and
Aedes aegypti joint swelling

www.tntextbooks.in
Amoebiasis also called amoebic dysentery

Nipah virus is a zoonotic virus
or amoebic colitis is caused by Entamoeba
(transmitted from animals to humans) and
histolytica, which lives in the human large
also transmitted through contaminated
intestine and feeds on mucus and bacteria
food. In infected people, it causes a range
(Fig. 7.1). Infective stage of this parasite is the
of illness from asymptomatic infection trophozoite, which penetrates the walls of the
to acute respiratory illness and fatal host intestine (colon) and secretes histolytic
encephalitis. enzymes causing ulceration, bleeding,
abdominal pain and stools with excess mucus.
Symptoms of amoebiasis can range from
diarrhoea to dysentery with blood and mucus
in the stool. House flies (Musca domestica)
acts as a carrier for transmitting the parasite
from contaminated faeces and water.
Endosome Food vacuole
i. Pneumotropic diseases (respiratory Plasmalemma

tract infected by influenza)
ii. Dermotropic diseases (skin and
subcutaneous tissues affected by chicken pox Ectoplasm
and measles) Endoplasm
iii. Viscerotropic diseases (blood and

visceral organs affected by yellow fever and Nucleus
dengue fever) Fig. 7.1 Entamoeba histolytica

iv. Neurotropic diseases (central African sleeping sickness is caused
nervous system affected by rabies and polio). by Trypanosoma species. Trypanosoma is
Some common viral diseases of human beings generally transmitted by the blood sucking
are given in table 7.2. Tsetse flies. Three species of Trypanosoma
cause sleeping sickness in man.
Swine flu was first 1. T. gambiense is transmitted by Glossina
recognised in the 1919 palpalis (Tsetse fly) and causes Gambian or
pandemic and still circulates Central African sleeping sickness (Fig. 7.2).
as a seasonal flu virus. Swine 2. T. rhodesiense is transmitted by Glossina
flu is caused by the H1N1 morsitans causing Rhodesian or East
virus strain. Symptoms include fever, cough, African sleeping sickness.
sore throat, chills, weakness and body aches.
3. T. cruzi is transmitted by a bug called
Children, pregnant women and the elderly
Triatoma megista and causes Chagas disease
are at risk from severe infection.
or American trypanosomiasis.
Kala – azar or visceral leishmaniasis
7.1.2 Protozoan diseases is caused by Leishmania donovani, which
About 15 genera of protozoans live as
is transmitted by the vector Phlebotomus
parasites within the human body and cause
(sand fly). Infection may occur in the endothelial
diseases.
cells, bone marrow, liver, lymph glands and

www.tntextbooks.in
Free flagellum the liver they undergo multiple asexual fission

(schizogony) and produce merozoites. After
being released from liver cells, the merozoites
Attached
flagellum penetrate the RBC’s.
Inside the RBC, the merozoite begins
Undulating to develop as unicellular trophozoites. The
membrane
trophozoite grows in size and a central vacuole
Pellicle develops pushing them to one side of cytoplasm
and becomes the signet ring stage. The
trophozoite nucleus then divides asexually to
Nucleus produce the schizont. The large schizont shows
yellowish - brown pigmented granules called
Reserve
food Schuffners granules. The schizont divides
granules and produces mononucleated merozoites.
Eventually the erythrocyte lyses, releasing the
merozoites and haemozoin toxin into the blood
Basal granule stream to infect other erythrocytes. Lysis of
Kinetoplast red blood cells results in cycles of fever and
Fig. 7.2. Trypanosoma gambiense other symptoms. This erythrocytic stage is
blood vessels of the spleen. Symptoms of Kala cyclic and repeats itself approximately every
azar are weight loss, anaemia, fever, enlargement 48 to 72 hours or longer depending on
of spleen and liver. the species of Plasmodium involved. The
sudden release of merozoites triggers an
Malaria is caused by different types of
attack on the RBCs. Occasionally, merozoites
Plasmodium species such as P. vivax, P. ovale,
differentiate into macrogametocytes and
P. malariae and P. falciparum (Table 7.3).
microgametocytes. When these are ingested by
Plasmodium lives in the RBC of human in its
a mosquito, they develop into male and female
mature condition it is called as trophozoite. It
gametes respectively.
is transmited from one person to another by the
bite of the infected female Anopheles mosquito. In the mosquito's gut, the infected
erythrocytes lyse and male and female
Life cycle of Plasmodium gametes fertilize to form a diploid zygote
Plasmodium vivax is a called ookinete. The ookinete migrates to the
digenic parasite, involving two mosquito's gut wall and develop into an oocyte.
hosts, man as the secondary The oocyte undergoes meiosis by a process
host and female Anopheles called sporogony to form sporozoites. These
mosquito as the primary host. sporozoites migrate to the salivary glands of
The life cycle of Plasmodium the mosquito. The cycle is now completed and
involves three phases namely schizogony, when the mosquito bites another human host,
gamogony and sporogony (Fig. 7.3). the sporozoites are injected and the cycle begins
The parasite first enters the human blood a new.
stream through the bite of an infected female The pathological changes caused by
Anopheles mosquito. As it feeds, the mosquito malaria, affects not only the erythrocytes
injects the saliva containing the sporozoites. The but also the spleen and other visceral organs.
sporozoite within the blood stream immediately Incubation period of malaria is about 12 days.
enters the hepatic cells of the liver. Further in The early symptoms of malaria are headache,

www.tntextbooks.in
,QPRVTXLWRJXW ,QKXPDQ
6SRUR]RLWHV 6SRUR]RLWHV
6DOLYDU\
JODQGV
/LYHU
2RF\VW 0HUR]RLWHV
6FKL]RQW
IRUPV
'1$UHSOLFDWLRQIROORZHG 0HUR]RLWHV
E\VSRURJRQ\ UXSWXUHIURP
5%&
2RNLQHWH 5%&V
0LGWURSKR]RLWH
'1$UHSOLFDWLRQDQG0HLRVLV 6SKDVHEHJLQV 1XFOHXV
=\JRWH +HPR]RLQ
(DUO\WURSKR]RLWH 6LJQHWULQJ
IRUPV IRUPV
0DFURJDPHWH
0DFURJDPHWRF\WH
0LFURJDPHWH
0LFURJDPHWRF\WH
([IODJHOODWLRQ *DPHWRF\WHV3ODVPRGLXP
Fig. 7.3 Life cycle of Plasmodium
nausea and muscular pain. The classic Prevention

symptoms first develop with the synchronized It is possible to break the transmission
release of merozoites, haemozoin toxin and cycle by killing the insect vector. Mosquitoes
erythrocyte debris into the blood stream lay their eggs in water. Larvae hatch and
resulting in malarial paroxysms – shivering develop in water but breathe air by moving to
chills, high fever followed by sweating. Fever the surface. Oil can be sprayed over the water
and chills are caused partly by malarial toxins surface, to make it impossible for mosquito
that induce macrophages to release tumour larvae and pupae to breathe.
necrosis factor (TNF-α) and interleukin.
Ponds, drainage ditches and other
permanent bodies of water can be stocked
Table 7.3 Types of malaria

Sl. No Types of Malaria Causative agent Duration of Erythrocytic
cycle
1 Tertian, benign tertian or vivax malaria P. vivax 48 hours
2 Quartan malaria P. malariae 72 hours
3 Mild tertian malaria P. ovale 48 hours
4 Malignant tertian or quotidian malaria P. falciparum 36 – 48 hours

www.tntextbooks.in
with fishes such as Gambusia which feed on the toes. Ringworms of the feet is known
mosquito larvae. Preparations containing as Athlete’s foot caused by Tinea pedis
Bacillus thuringiensis can be sprayed to kill (Fig. 7.5). Ringworms are generally acquired
the mosquito larvae since it is not toxic to from soil or by using clothes, towels and comb
other forms of life. The best protection against used by infected persons.
malaria is to avoid being bitten by mosquito.
People are advised to use mosquito nets, wire
gauging of windows and doors to prevent
mosquito bites.
In the 1950’s the World Health
Organisation (WHO) introduced the Malaria
eradication programme. This programme
was not successful due to the resistance of
Plasmodium to the drugs used to treat it and
resistance of mosquitoes to DDT and other
insecticides. Fig. 7.4 Symptoms of ringworm
Malaria vaccine is used

to prevent malaria.
The only approved
vaccine as of 2015 is
RTS,S(Mosquirix). It
requires four injections and has
relatively low efficacy (26–50%). Due
to this low efficacy, WHO does not
Fig. 7.5 Symptoms of Athlete’s foot
recommend the use of RTS,S vaccine
in babies between 6 and 12 weeks 7.1.4 Helminthic diseases
of age. Helminthes are mostly endoparasitic in
the gut and blood of human beings and cause
diseases called helminthiasis. The two most
7.1.3 Fungal diseases
prevalent helminthic diseases are Ascariasis and
Fungi was recognized as a causative
Filariasis.
agent of human diseases much earlier than
bacteria. Dermatomycosis is a cutaneous Ascaris is a monogenic parasite and
infection caused by fungi belonging to the exhibits sexual dimorphism. Ascariasis is a
genera Trichophyton, Microsporum and disease caused by the intestinal endoparasite
Epidermophyton. Ascaris lumbricoides commonly called the
round worms (Fig. 7.6). It is transmitted
Ringworm is one of the most common
through ingestion of embryonated eggs through
fungal disease in humans (Fig. 7.4).
contaminated food and water. Children playing
Appearance of dry, scaly lesions on the skin,
in contaminated soils are also prone to have a
nails and scalp are the main symptoms of the
chance of transfer of eggs from hand to mouth.
disease. Heat and moisture help these fungi
The symptoms of the disease are abdominal
to grow and makes them to thrive in skin
pain, vomiting, headache, anaemia, irritability
folds such as those in the groin or between

www.tntextbooks.in
Triradiate mouth
with lips
and diarrhoea. A heavy 7.2 Maintenance of personal and
Excretory
pore
infection can cause public hygiene
Lateral line
nutritional deficiency Hygiene is a set of practices performed
and severe abdominal to conserve good health. According to the World
pain and causes stunted Health Organization (WHO), hygiene refers to
growth in children. “conditions and practices that help to maintain
Cloacal aperture
Penial setae
It may also cause health and prevent the spread of diseases."
enteritis, hepatitis and Personal hygiene refers to maintaining
bronchitis. one’s body clean by bathing, washing hands,
Filariasis is trimming fingernails, wearing clean clothes
Ventrally
curved tail
Fig. 7.6 caused by Wuchereria and also includes attention to keeping surfaces
Ascaris
male and bancrofti, commonly
Anus in the home and workplace, including toilets,
female worm called filarial worm. It bathroom facilities, clean and pathogen-free.
is found in the lymph Our public places teem with infection,
vessels and lymph nodes of man (Fig. 7.7). contamination and germs. It seems that every
Wuchereria bancrofti is sexually dimorphic, surface we touch and the air we breathe are with
viviparous and digenic. The life cycle is pollutants and microbes. It’s not just the public
completed in two hosts, man and the female places that are unclean, but we might be amazed
Culex mosquito The female filarial worm gives at the number of people who do not wash their
rise to juveniles called microfilariae larvae. hands before taking food, after visiting the
In the lymph glands, the juveniles develop into restroom, or who sneeze without covering their
adults. The accumulation of the worms block the faces. Many infectious diseases such as typhoid,
lymphatic system resulting in inflammation of amoebiasis and ascariasis are transmitted
the lymph nodes. In some cases, the obstruction through contaminated food and water.
of lymph vessels causes elephantiasis or filariasis Advancement in science and technology
of the limbs, scrotum and mammary glands provide effective controlling measures for
(Fig. 7.8). many infectious and non-infectious diseases.
The use of vaccines and adopted immunization
programmes have helped to eradicate small pox
in India. Moreover a large number of infectious
diseases like polio, diphtheria, pneumonia
and tetanus have been controlled by the use of
vaccines and by creating awareness among the
people.
7.3 Adolescence – drug and

alcohol abuse
Adolescence begins with a period of
rapid physical and sexual development called
puberty to maturity at 12 to 19 years of age.
Adolescence is also a highly dynamic period of
psychological and social changes in individuals.
Adolescents are vulnerable to group (peer)
Fig. 7.7 Wuchereria Fig. 7.8 Chronic
pressure and many youngsters are pushed into
bancrofti inflammation of the
lower limbs experimenting with drugs and alcohol. Proper

www.tntextbooks.in
education and guidance would enable youth pain killer and is used during surgery. It is the
to say no to drugs and alcohol and to follow a most widely abused narcotic drug which acts as
healthy life style. a depressant and slows down body functions.
Alcohol is a psychoactive drug, which Cannobinoids are a group of chemicals
acts on the brain, affecting a person’s mind and obtained from Cannabis sativa, the Indian hemp
behaviour. It is a depressant, which slows down plant (Fig. 7.10). Natural cannabinoids are
the activity of the nervous system. The intake the main source of marijuana, ganja, hashish
of certain drugs for a purpose other than their and charas. It interferes in the transport of the
normal clinical use in an amount and frequency neurotransmitter, dopamine and has a potent
that impair one’s physical, physiological and stimulating action on the CNS, producing
psychological functions is called drug abuse. increased energy and a sense of euphoria.
The drugs which are commonly abused
include opioids, cannabinoids, coca-alkaloids,
barbiturates, amphetamines and LSD.
Opioids are drugs which bind to specific
opioid receptors present in the central nervous
system and intestinal tract. Heroin (smack) is
chemically diacetyl morphine, which is white,
odourless and bitter crystalline compound. It
is obtained by acetylation of morphine, which
is extracted from flowers of the poppy plant
(Fig. 7.9). Morphine is one of the strongest Fig. 7.10 Cannabis sativa (Hemp plant)
Cocaine is a white powder that is obtained

from the leaves of the coca plant, Erythroxylum
coca. It is commonly called coke or crack. Cocaine
causes serious physical and psychological
problems including hallucinations and
paranoia. The other plants with hallucinogenic
Fig. 7.9 Opium plant (poppy plant) properties are Atropa belladonna and Datura
Table 7.4 Classification of drugs (Fig. 7.11 and Fig. 7.12).
Group Drugs Effects

Amphetamines, cocaine,
Stimulants Accelerates the activity of the brain
nicotine and tobacco
Alcohol, Barbiturates,
Depressants Slows down the activity of the brain
Tranquilizers
Narcotic/ Act as depressants on the Central
Opium, Morphine
Analgesics Nervous System
Lysergic acid diethylamide Distorts the way one sees, hears and
Hallucinogens
(LSD), Phencyclidine feels
Stimulants,
Stimulating action on the CNS and affects
Depressants, Bhang (Marijuana), Ganja, Charas
the cardiovascular system
Hallucinogens

www.tntextbooks.in
respond only to highest doses of drugs and

alcohol leading to greater intake and addiction.
Excessive use of drug and alcohol leads to
physical and psychological dependence.
When psychological dependence develops,
the drug user gets mentally ‘hooked on’ to
the drug. The drug user constantly thinks
only about the drug and has continuous
Fig. 7.11 Atropa Fig. 7.12 Datura uncontrollable craving for it. This state called
belladonna “euphoria” is characterized by mental and
Drugs like methamphetamine, emotional preoccupation with the drug.
amphetamines, barbiturates, tranquilizers, Physical dependence is a state in which
Lysergic acid diethylamide (LSD) are the user’s body requires a continuous presence
normally used as medicine to treat patients of the drug. If the intake of the drug or alcohol
with mental illness like depression and is abruptly stopped, he or she would develop
insomnia and are often abused. withdrawal symptoms. In a sense, the body
Tobacco is smoked, chewed and becomes confused and protests against the
used as snuff. It increases the carbon absence of the drug. The withdrawal symptoms
monoxide content of blood and reduces may range from mild tremors to convulsions,
the concentration of haem bound oxygen, severe agitation and fits, depressed mood, anxiety,
thus causing oxygen deficiency in the body. nervousness, restlessness, irritability, insomnia,
Tobacco contains nicotine, carbon monoxide dryness of throat, etc, depending on the type of
and tars, which cause problems in the heart, drug abuse.
lung and nervous system. Adrenal glands are
stimulated by nicotine to release adrenaline
7.3.2 Effects of drugs and alcohol
Short-term effect appears only for a few
and nor adrenaline which increases blood
minutes after the intake of drugs and alcohol.
pressure and heart beat.
The abuser feels a false sense of well being
7.3.1 Addiction and dependence and a pleasant drowsiness. Some short term
effects are euphoria, pain, dullness of senses,
Addiction is a physical or psychological
alteration in behaviour, blood pressure, narcosis
need to do or take or use certain substance
(deep sleep), nausea and vomiting.
such as alcohol, to the point where it could
be harmful to the individual. This addictive Drugs and alcohol have long-term effect
behaviour can be personally destructive to that lead to serious damages, because of the
a person. Overtime addicts start to lose not
only their jobs, homes and money, but also Alcoholism is the inability to control
friendship, family relationships and contact drinking due to physical and emotional
with the normal world. Addiction to drugs dependence on alcohol. Treatment involves
and alcohol can lead to a psychological counselling by a healthcare professional.
attachment to certain effects such as euphoria Detoxification programme in a hospital or
and temporary feeling of well being. medical facility is an option for those who
need additional assistance. Medications
Repeated use of drugs and alcohol may
are available to reduce the desire to drink
affect the tolerance level of the receptors
and smoke.
present in the body. These receptors then

www.tntextbooks.in
constant and excessive use. The physical and sought from close and trusted friends. Getting
mental disturbance makes the life of the user proper advice to sort out their problems would
unbearable and torturous. For example heavy help the young to vent their feelings of anxiety
drinking permanently damages the liver and guilt.
and brain.
3. Education and counselling
The use of alcohol during adolescence may
Education and counselling create
have long-term effects. Alcohol interferes with
positive attitude to deal with many problems
the ability of the liver to break down fat. Over
and to accept disappointments in life.
time fat accumulation and high levels of alcohol
destroy the liver cells and a scar tissue grows in 4. Looking for danger signs
the place of dead cells. This scarring of the liver Teachers and parents need to look
is called “Liver cirrhosis”. Alcohol irritates the for sign that indicate tendency to go in for
stomach lining due to the production of excess addiction.
acid leading to ulcers. Excessive alcohol use
weakens the heart muscle, causing scar tissue 5. Seeking professional and
to build up in the cardiac muscle fibers. As a medical assistance
result, heavy drinkers have an increased risk Assistance is available in the form of
of high blood pressure, stroke, coronary artery highly qualified psychologists, psychiatrists and
disease and heart attack. Korsakoff syndrome, de-addiction and rehabilitation programmes to
a chronic memory disorder is most commonly help individuals to overcome their problems.
caused by alcohol misuse.
7.4 Mental health – Depression
7.3.3 Prevention and control Mental health is a state of well being of
It is practically possible to prevent some the mind, with self esteem. Self esteem means
one from using drugs and alcohol. Here are liking yourself and being able to stand up for what
some ways that help to prevent drug and you believe is right. Positive mental health is an
alcohol abuse. important part of wellness. A mentally healthy
person reflects a good personality. Activities of
1. Effectively dealing with peer pressure
mentally healthy people are always appreciated
The biggest reason for teens to start
and rewarded by the society as these persons
on drugs is due to their friends / peer groups
are creative as well as cooperative with others.
imposing pressure on them. Hence, it is
Mental health improves the quality of life.
important to have a better group of friends to
avoid such harmful drugs and alcohol. Depression is a common mental disorder
that causes people to experience depressed
2. Seeking help from parents and peers mood, loss of interest or pleasure, feelings of
Help from parents and peer group guilt or low self-worth, disturbed sleep poor
should be sought immediately so that they can appetite, low energy and poor concentration.
be guided appropriately. Help may even be
Alcoholic Anonymous
Alcoholic anonymous was started in 1935 by a businessman and a doctor who had been a
“hopeless drunk” for many years. After the men helped each other to stop drinking and to stay
sober, they then founded the alcoholic anonymous to help other alcoholics. Since that time
alcoholic anonymous has spread throughout the world.

www.tntextbooks.in
Signs and symptoms of mental of thirty to sixty due to life style related
depression disorders.
Loss of self confidence and self esteem
yy The following facts will help in better
Anxiety
yy understanding of life style disorders.
Not being able to enjoy things that are
yy • Life style disorder causes cardiovascular
usually pleasurable or interesting diseases resulting in 31 percent of global
deaths.
Lifestyle changes like exercise,
meditation, yoga and healthy food habits can • The sedentary life style also causes deficiency
help to be relieved from depression. Exercise of vitamins such as vitamin D resulting in
stimulates the body to produce serotonin and fatigue, tiredness, back pain, depression,
endorphins, which are neurotransmitters that bone loss, muscle pain, etc,
suppress depression. Practicing exercise in daily • Life style disorder also includes social
life creates a positive attitude . isolation resulting in age related problems.
Participating in an exercise programme can:
• Eating junk foods that have high caloric
yy Increase self-esteem
values, rich in carbohydrates and fat can
yy Boost self-confidence
lead to obesity and early health issues.
yy Create a sense of empowerment
• Consumption of processed and packaged
Enhance
yy social connections and
food, which lacks in fiber may result in
relationships
constipation.
Brain is one of the most metabolically active
• Several people today complain of irritable
part of the body and needs a steady stream
bowel syndrome with stomach discomfort
of nutrients to function. A poor diet may not
or pain and trouble with bowel movements,
provide the nutrients for a healthy body and may
causing diarrhoea. The main cause of
provoke symptoms of anxiety and depression.
irritable bowel syndrome is stress and other
7.5 Lifestyle disorders in illnesses.
human beings
The old saying that “health is wealth” Life style modifications
is truly applicable to human beings. With the • Avoid eating junk food and foods that have
changes in life style, there are many emerging preservatives and colouring agents.
medical conditions and diseases that are • Physical exercises such as brisk walking and
reducing human longevity. Life style disorder yoga can be done regularly.
result due to activities involving smoking,
• Following medical advice, if any health
alcohol and drug abuse, consuming high fat
problems in addition to life style disorders.
diet, lack of exercise or living a latent life.
The World Health Organization (WHO) • To avoid smoking drugs and drinking
in its report cautions a slow moving public alcohol.
health disaster due to life style disorders in • To follow a healthy balanced diet rich in
the form of non-communicable diseases like vitamins and proteins.
diabetes, cardiovascular and lung diseases. • 7 – 8 hours of sleep every day is required.
WHO believes that not thousands but millions
of people die every year within the age group

www.tntextbooks.in
Summary Activities
Health is a state of complete physical
and psychological well being. Many other Activity 1: Students examine the impact
extended factors like microbes may cause of microorganisms in our daily life and
illness to human body. Protozoans like consider their applied potential. They
Entamoeba, Plasmodium and Leishmania can also conduct independent research
cause diseases such as amoebic dysentery, and communicate their findings.
malaria and kala-azar repectively. Personal Activity 2: Students prepare wet mounts
cleanliness and hygiene, proper disposal of
to observe the microbes found in curd.
waste, safe drinking water and immunization
Activity 3: The leader will blow bubbles
are very useful in preventing diseases. Drug
at the group of students to demonstrate
and alcohol abuse of young and adolescent
is another cause of concern. Addiction
how some diseases can be air borne?
to drugs and alcohol is happening due to Activity 4: Which parasite acts as a
peer pressure, examination–related and transporter host for other parasites? Discuss
competition–related stresses. The addicted Activity 5: Your friends call you a “sissy
person should receive proper counselling, boy” because you do not smoke or chew
education and professional medical help to tobacco. What answer will you give? How
liberate themselves from all forms of addiction. will you prove your strength?
INTERESTING FACTS
1. Freezing does not kill bacteria; it Integrated Methods of Vector
only arrests their growth. Control.
2. Antibiotics not only kill harmful 7. Sterile insect technique (SIT)
bacteria, but also kill beneficial
bacteria of our body.
3. UTI- Urinary Tract Infection is
one of the most common bacterial
infections affecting 150 million
people each year worldwide.
4. World malaria day is on 25th April .
5. Iceland and the Faroe islands are The screw-worm fly was the
the only countries in the world, first pest successfully eliminated
where there are “No mosquitoes” from an area through the sterile
(Mosquito free countries). insect technique, by the use of an
6. VCRC- Vector Control Research integrated area-wide approach.
Center is situated in Puduchery. 8. Zika virus could become a surgical
WHO is collaborating with the weapon against brain cancer.
Centre for Research and Training
in Lymphatic Filariasis and
125 125
Human Health and Diseases

www.tntextbooks.in
Evaluation 8. Marijuana is extracted from

1. Malaria caused a) Dried leaves and flowers of
by Plasmodium hemp plant
is transmitted b) Ergot fungus
through-------- c) Roots of hemp plant
a) Air d) Cocoa plant
b) Contact
9. Choose the correctly match pair.
c) Fleas on food
a) Amphetamines - Stimulant
d) Mosquito bites
b) LSD - Narcotic
2. A 30 year old woman has bleedy
c) Heroin - Psychotropic
diarrhoea for the past 14 hours, which
one of the following organisms is likely d) Benzodiazepine - Pain killer
to cause this illness? 10. The Athlete’s foot disease in human is
a) Streptococcus pyogens caused by-------
b) Clostridium difficile a) Bacteria b) Fungi
c) Shigella dysenteriae c) Virus d) Protozoan
d) Salmonella enteritidis
11. Cirrhosis of liver is caused by chronic
3. Which of the following disease is spread intake of ------
through droplet nuclei? a) Opium b) Alcohol
a) Tularemia b) Listeriosis c) Tobacco d) Cocaine
c) Chicken pox d) Mumps
12. The sporozoite of the malarial parasite is
4. Exo-erythrocytic schizogony of present in ----
Plasmodium takes place in ------- a) saliva of infected female Anopheles
a) RBC b) Leucocytes mosquito.
c) Stomach d) Liver b) RBC of human suffering from
5. The sporozoites of Plasmodium vivax are malaria.
formed from ------------ c) Spleen of infected humans.
a) Gametocytes b) Sporoblasts d) Gut of female Anopheles mosquito.
c) Oocysts d) Spores 13. Haemozoin is
6. Poliomyelitis which causes infantile a) A precursor of haemoglobin.
paralysis enters the body through………. b)A toxin from Streptococcus.
a) Skin b) Mouth and nose c) A toxin from Plasmodium species.
c) Ears d) Eyes d) A toxin from Haemophilus species.
7. Amphetamines are stimulants of the 14. The drug synthesised from Datura is
CNS, whereas barbiturates are ----
a) Hallucinogen b) Depressant
a) CNS stimulant b) both a and b
c) Stimulant d) Pain killer
c) hallucinogenic d) CNS depressants

www.tntextbooks.in
15. Match the pathogens with respective diseases caused by them and select the correct match
using the codes given below.
A. Leishmania donavani - i. Amoebiasis
B. Wuchereria bancrofti - ii. Kala – azar
C. Trypanosoma gambiense - iii. Sleeping sickness
D. Entamoeba histolytica - iv. Filariasis
a) A-ii, B-iv, C-iii, D-i

b) A-ii, B-iv, C-i, D-iii
c) A-iii, B-i, C-ii, D-iv
d) A-i, B-iv, C-iii, D-ii
16. Complete the following table:
Diseases Causative agent Site of infection

Mumps
Chicken pox
Dengue fever
17. List the causative agent, mode of transmission and symptoms for Diphtheria and Typhoid.
18. Compare and contrast bacillary dysentery and amoebic dysentery.
19. A patient was hospitalized with fever and chills. Merozoites were observed in her blood.
What is your diagnosis?
20. (i) W
rite the scientific name of the filarial worm that causes filariasis.
(ii) Write the symptoms of filariasis.
(iii)How is this disease transmitted?
21. List the common withdrawal symptoms of drugs and alcohol abuse.
22. What is Kala-azar?
23. Why do you think it is not possible to produce vaccine against 'common cold'?
24. Tabulate the causative agent, mode of transmission and symptoms of the viral diseases in man.
25. Write a note on the Protozoan diseases.
26. Explain the life-cycle of Plasmodium in man.
27. Suggest some ways to prevent drug and alcohol abuse.

6DOPRQHOOD 9LEULR &RUQ\EDFWHULXP 6WUHSWRFRFFXV &ORVWULGLXP
6KLJHOOD 5DWIOHD
W\SKL FKROHUDH GLSKWKHULDH SQHXPRQLD WHWDQL
<HUVLQLDSHVWLV
%DFLOODU\ &KROHUD
7\SKRLG 'LSKWKHULD 3QHXPRQLD 7HWDQXV
G\VHQWHU\

3ODJXH
&RQWDPLQDWHGIRRGDQG 9HFWRUERUQH &RQWDPLQDWHG

$LUERUQHGLVHDVHV
GLVHDVHV VRLOERUQHGLVHDVHV
Human Health and Diseases

ZDWHUERUQHGLVHDVHV
%DFWHULDO 9HFWRUERUQH :XFKHUHULD

)LODULDVLV
128
GLVHDVHV GLVHDVHV EDQFURIWL
&DQGLGLDVLV
Concept Map
)XQJDO +HOPLQWK &XOH[PRVTXLWR
GLVHDVHV GLVHDVHV
&RQWDPLQDWHG
$WKOHWH¶VIRRW $VFDULV
IRRGDQGZDWHU $VFDULDVLV
+XPDQ OXPEULFRLGHV
ERUQHGLVHDVHV
KHDOWKDQG
GLVHDVHV
6WLPXODQWV
(QWDPRHED &RQWDPLQDWHG
$PRHELDVLV IRRGDQGZDWHU
KLVWRO\WLFD (IIHFWVRI
ERUQHGLVHDVHV 3URWR]RDQ 'HSUHVVDQWV
GUXJVDQG
)HPDOH GLVHDVHV DOFRKRO
3ODVPRGLXP
$QRSKHOHV 0DODULD
YLYD[ 9HFWRUERUQH
PRVTXLWR 1DUFRWLF
GLVHDVHV
www.tntextbooks.in
/HLVKPDQLD
6DQGIO\ .DODD]DU +DOOXFLQRJHQV
GRQRYDQL
7U\SDQRVRPD 6OHHSLQJ 9LUDO

7VHWVHIO\ GLVHDVHV
JDPELHQVH VLFNQHVV
&RQWDPLQDWHGIRRG
$LUERUQH 9HFWRUERUQH %ORRGDQGRWKHU
DQGZDWHUERUQH
GLVHDVHV GLVHDVHV ERG\IOXLGV
GLVHDVHV
3ROLRP\HOLWLV &RPPRQFROG 0XPSV 0HDVOHV &KLFNHQSR[ 'HQJXHIHYHU &KLNXQJXQ\D 9LUDOKHSDWLWLV
9DULFHOOD]RVWHU )ODYLYLUXVRU +HSDWLWLV%

3ROLRYLUXV 5KLQRYLUXV 0XPSVYLUXV 5XEHOODYLUXV 7RJDYLUXV
YLUXV GHQJXHYLUXV YLUXV
$HGHV
PRVTXLWR
18/12/2021 14:53:42
www.tntextbooks.in
8
UNIT - III
IMMUNOLOGY
CHAPTER
Natural forces within us are the

true healers of disease
Chapter outline - Hippocrates
8.1 Basic concepts of immunology

8.2 Innate immunity I n the previous chapter, we have studied in
detail the various infections which cause
diseases in human beings. In this chapter, we
8.3 Acquired immunity
shall discuss how our body protects us from
8.4 Immune responses
these infections by the effective mechanism of
8.5 Lymphoid organs
the immune system.
8.6 Antigens
8.7 Antibodies 8.1 Basic concepts of immunology
8.8 Antigen- antibody interactions Immunology is the study of immune
8.9 Vaccines system. This system protects an indvidual
8.10 Vaccination and immunization from various infective agents. It refers to
8.11 Hypersensitivity all the mechanisms used by the body for
protection from environmental agents that
8.12 Immunodeficiency diseases
are foreign to the body.
8.13 Autoimmune diseases
8.14 Tumour immunology When the immune system does not
function efficiently in an individual, it leads to
infection causing disease. The overall ability
Learning objectives
of body to fight against the disease causing
pathogen is called immunity. It is also called
➢➢ Understands the basic
concepts of immunology. disease resistance and the lack of immunity
is known as susceptibility. Immunity is highly
➢➢ Differentiates between
innate immunity and specific.
acquired immunity, Normally many of the responses of the
primary immune response immune system initiate the destruction and
and secondary immune
elimination of invading organisms and any
response, active and passive immunity.
toxic molecules produced by them. These
➢➢ Realizes the importance of immunization.
immune reactions are destructive in nature
➢➢ Learns to comprehend the concept of and are made in response only to molecules
hypersensitivity.
129

www.tntextbooks.in
that are foreign to the host and not to those of

Immunity
host itself. This ability to distinguish foreign
molecules from self is another fundamental
Innate Adaptive
feature of the immune system. However, Immunity Immunity
occasionally, it fails to make its distinction
and reacts destructively against the host's
Natural Artificial
own molecules; such autoimmune diseases
can be fatal to the organism.
Active Passive Active Passive
Almost all the macromolecules e.g. (infection) (maternal) (immunization) (antibody
transfer)
proteins, polysaccharides, nucleic acids, etc., as
long as they are foreign to recipient organism Fig. 8.1 Immune system
can induce immune response. Any substance
capable of eliciting immune response is called
an ANTIGEN (ANTIbody GENerator). There 8.2 Innate immunity
are two broad classes of immunity responses Innate immunity is the natural
namely, innate immunity and acquired phenomenon of resistance to infection which
immunity (Fig. 8.1). an individual possesses right from the birth.
Table 8.1 Innate immunity- types and mechanisms
Type of innate immunity Mechanism

1. Anatomical barriers
Prevents the entry of microbes.
Skin
Its acidic environment (pH 3-5) retards the growth of microbes.
Mucus entraps foreign microorganisms and competes with microbes

Mucus membrane
for attachment.
2. Physiological barriers
Normal body temperature inhibits the growth of pathogens.

Temperature
Fever also inhibits the growth of pathogens.
Low pH Acidity of gastric secretions (HCl) kills most ingested microbes.
Lysozyme acts as antibacterial agent and cleaves the bacterial cell wall.
Interferons induce antiviral state in the uninfected cells.
Chemical mediators
Complementary substances produced from leucocytes lyse the
pathogenic microbes or facilitate phagocytosis.
Specialized cells (Monocytes, neutrophils, tissue macrophages)

3. Phagocytic barriers
phagocytose, and digest whole microorganisms.
Tissue damage and infection induce leakage of vascular fluid,

containing chemotactic signals like serotonin, histamine and
4. Inflammatory barriers
prostaglandins. They influx the phagocytic cells into the affected area.
This phenomenon is called diapedesis.
Immunology 130

www.tntextbooks.in
The innate defense mechanisms are non-specific as cell mediated immune response or cell
in the sense that they are effective against a mediated immunity. This is brought about by
wide range of potentially infectious agents. It is T cells, macrophages and natural killer cells.
otherwise known as non-specific immunity or 2. Antibody mediated immunity or humoral
natural immunity. immunity
A number of innate defense mechanisms are When pathogens are destroyed by the
operative non-specifically against a large number production of antibodies, then it is known
of microorganisms as shown in the Table 8.1 and as antibody mediated or humoral immunity.
Fig. 8.2. This is brought about by B cells with the help
of antigen presenting cells and T helper cells.
Antibody production is the characteristic
Lysozyme in tears feature of vertebrates only.
Removal of airbrone
particles
Bronchi
Types of acquired immunity
mucus,cilia Acquired immunity may be active
Gut immunity or passive immunity (Table 8.2).
acid
The immunological resistance developed
Skin
Physical barrier by the organisms through the production
of antibodies in their body is called active
Rapid pH change
immunity. Active immunity is acquired through
Flushing of
the use of a person’s immune responses, which
urinary tract lead to the development of memory cells.
Active immunity results from an infection or an
Low pH
of vagina immunization.
Fig. 8.2 Various anatomical and physiological Passive immunity does not require the
barriers to microbial attack body to produce antibodies to antigens. The
antibodies are introduced from outside into the
8.3 Acquired immunity organism. Thus, passive immunity is acquired
The immunity that an individual acquires without the activation of a person’s immune
after birth is known as acquired immunity. response, and therefore there is no memory.
It is the body's resistance to a specific pathogen.
The process of production
The unique features of acquired immunity
of blood cells in the
are antigenic specificity, diversity, recognition of
bone marrow is called
self and non-self and immunological memory.
haematopoiesis.
Components of acquired immunity
Acquired immunity has two components – 8.4 Immune responses
cell mediated immunity (CMI) and antibody The immune responses may be primary
mediated immunity or humoral immunity. or secondary (Table 8.3).
1. Cell mediated immunity Primary immune response

When pathogens are destroyed by cells The primary immune response occurs
without producing antibodies, then it is known when a pathogen comes in contact with the
131 Immunology

www.tntextbooks.in
Table 8.2 Differences between active and passive immunity
Sl.No Active Immunity Passive Immunity

Active immunity is produced actively by Passive immunity is received passively and
1
host’s immune system. there is no active host participation.
It is produced due to contact with pathogen It is produced due to antibodies obtained
2
or by its antigen. from outside.
3 It is durable and effective in protection. It is transient and less effective.
4 Immunological memory is present. No memory.
Booster effect on subsequent dose is
5 Subsequent dose is less effective.
possible.
Immunity is effective only after a short
6 Immunity develops immediately.
period.
immune system for the first time. During Within hours after recognition of the antigen, a
this, the immune system has to learn to new army of plasma cells are generated. Within
recognize the antigen, produce antibody 2 to 3 days, the antibody concentration in the
against it and eventually produce memory blood rises steeply to reach much higher level
lymphocytes. The primary immune response than primary response. This is also called as
is slow and short-lived. “booster response”.
Secondary immune response 8.5 Lymphoid organs

The secondary immune response occurs Immune system of an organism consists of
when a person is exposed to the same antigen several structurally and functionally different
again. During this time, immunological memory organs and tissues that are widely dispersed
has been established and the immune system in the body. The organs involved in the origin,
can start producing antibodies immediately. maturation and proliferation of lymphocytes
are called lymphoid organs (Fig. 8.3).
Table 8.3 Differences between primary and secondary immune responses
Sl.No Primary Immune Response Secondary Immune Response

It occurs as a result of second and
It occurs as a result of primary contact
1 subsequent contacts with the same
with an antigen.
antigen.
Antibody level reaches peak in 7 to 10 Antibody level reaches peak in 3 to 5
2
days. days.
Prolonged period is required to establish
3 It establishes immunity in a short time.
immunity.
Antibody level remains high for longer
4 There is rapid decline in antibody level.
period.
It appears mainly in the lymph nodes It appears mainly in the bone marrow,
5
and spleen. followed by the spleen and lymph nodes.
Immunology 132

www.tntextbooks.in
Primary lymphoid organs

Bursa of Fabricius of birds, bone marrow
and thymus gland of mammals constitute
the primary lymphoid organs involved
in the production and early selection of
lymphocytes. These lymphocytes become
dedicated to a particular antigenic specificity.
Only when the lymphocytes mature in the
primary lymphoidal organs, they become
immunocompetent cells. In mammals, B cell
maturation occurs in the bone marrow and
T cells maturation occurs in the thymus.
Thymus
The thymus is a flat and bilobed organ
located behind the sternun, above the heart.
Each lobe of the thymus contains numerous
lobules, separated from each other by
connective tissue called septa. Each lobule
is differentiated into two compartments,
Fig. 8.3 Lymphoid organs in human body
the outer compartment or outer cortex, is
Based on their functions, they are classified densely packed with immature T cells called
into primary or central lymphoid organs and thymocytes, whereas the inner compartment
secondary or peripheral lymphoid organs. The or medulla is sparsely populated with mature
primary lymphoid organs provide appropriate thymocytes. One of its main secretions is the
environment for lymphocytic maturation. The hormone thymosin. It stimulates the T cell to
secondary lymphoid organs trap antigens and become mature and immunocompetent. By
make it available for mature lymphocytes, which the early teens, the thymus begins to atrophy
can effectively fight against these antigens. and is replaced by adipose tissue (Fig. 8.4).
Thus thymus is most active during the
neonatal and pre-adolescent periods.
7K\URLG
JODQG
7UDFKHD
5LJKWOREH
/HIWOREH
7K\PXV
6HSWDH
/REXOH
$ %
/XQJV
Bursa of Fabricius is a primary lymphoid organ +HDUW
of birds. It is attached to the dorsal side of the Fig. 8.4 Primary lymphoid organ - Thymus
cloaca. B lymphocytes mature in the bursa and A) Location B) Structure
bring about humoral immunity.
133 Immunology

www.tntextbooks.in
Bone marrow
The adenoids are glands
Bone marrow is a lymphoid tissue found
located in the roof of
within the spongy portion of the bone.
the mouth, behind the
Bone marrow contains stem cells known as
soft palate where the
haematopoietic cells. These cells have the
nose connects to the
potential to multiply through cell division
throat. The adenoids produce antibodies
and either remain as stem cells or differentiate
that help to fight infections. Typically,
and mature into different kinds of blood cells.
the adenoids shrink during adolescence
Secondary or peripheral lymphoid and may disappear by adulthood.
organs
In secondary or peripheral lymphoid Lymph node
organs, antigen is localized so that it can be
effectively exposed to mature lymphocytes. Lymph node is a small bean-shaped
The best examples are lymph nodes, structure and is part of the body’s immune
appendix, Peyer’s patches of gastrointestinal system. It is the first one to encounter
tract, tonsils, adenoids, spleen, MALT the antigen that enters the tissue spaces.
(Mucosal-Associated Lymphoid Tissue), Lymph nodes filter and trap substances that
GALT (Gut-Associated Lymphoid Tissue), travel through the lymphatic fluid. They
BALT (Bronchial/Tracheal-Associated are packed tightly with white blood cells,
Lymphoid Tissue). namely lymphocytes and macrophages.
There are hundreds of lymph nodes found
Peyer’s patches are oval-shaped throughout the body. They are connected
areas of thickened tissue that are to one another by lymph vessels. Lymph is
embedded in the mucus-secreting lining a clear, transparent, colourless, mobile and
of the small intestine of humans and extracellular fluid connective tissue. As the
other vertebrate animals. Peyer’s patches lymph percolates through the lymph node,
contain a variety of immune cells, the particulate antigen brought in by the
including macrophages, dendritic cells, lymph will be trapped by the phagocytic cells,
T cells, and B cells. follicular and interdigitating dendritic cells.
The tonsils (palatine tonsils) are

Afferent lymphatic vessel
a pair of soft tissue masses located at
the back of the throat (pharynx). The
tonsils are part of the lymphatic system,
which help to fight infections. They stop
invading germs including bacteria and Sinuses
Mantle zone
viruses. Follicle
Spleen is a secondary lymphoid Cortex
organ located in the upper part of the Paracortex

abdominal cavity close to the diaphragm. Medullary
cords
Efferent lymphatic vessel
Spleen contains B and T cells. It brings
humoral and cell mediated immunity. Fig. 8.5 Secondary lymphoid organ –
Structure of lymph node
Immunology 134

www.tntextbooks.in
Lymph node has three zones (Fig. 8.5). node. Sometimes visible swelling of lymph
They are the cortex, paracortex and medulla. nodes occurs due to active immune response
The outer most layer of the lymph node is and increased concentration of lymphocytes.
called cortex, which consists of B-lymphocytes, Thus swollen lymph nodes may signal an
macrophages, and follicular dendritic cells. infection. There are several groups of lymph
The paracortex zone is beneath the cortex, nodes. The most frequently enlarged lymph
which is richly populated by T lymphocytes nodes are found in the neck, under the chin, in
and interdigitating dendritic cells. The inner the armpits and in the groin.
most zone is called the medulla which is
sparsely populated by lymphocytes, but many Cells of the immune system
of them are plasma cells, which actively The immune system is composed of many
secrete antibody molecules. As the lymph interdependent cells that protect the body from
enters, it slowly percolates through the cortex, microbial infections and the growth of tumour
paracortex and medulla, giving sufficient cells. The cellular composition of adult human
chance for the phagocytic cells and dendritic blood is given in Table 8.4.
cells to trap the antigen brought by the lymph.
Table 8.4 The cellular composition of adult
The lymph leaving a node carries enriched
human blood
antibodies secreted by the medullary plasma
cells against the antigens that enter the lymph Number of Approximate
Cell type
cells per µl percentage
The mucosa-associated lymphoid 4200,000 -

Red blood cells -
tissue (MALT) is a diffuse system of small 6500,000
concentrations of lymphoid tissue in the
alimentary, respiratory and urino-genital White blood cells
tracts. MALT is populated by lymphocytes
Agranulocytes
such as T and B cells, as well as plasma
cells and macrophages, each of which Lymphocytes 1500 - 4000 20-30
is well situated to encounter antigens
Monocytes 200 - 950 2-7
passing through the mucosal epithelium.
It also possesses IgA antibodies. Granulocytes
Gut-associated lymphoid tissue Neutrophils 2000-7000 50-70
(GALT) is a component of the mucosa-
associated lymphoid tissue (MALT) Basophils 50-100 <1
which works in the immune system to
Eosinophils 40-500 2-5
protect the body from invasion in the gut.
Bronchus Associated Lymphoid 150,000-
Platelets -
500,000
Tissues (BALT) also a component of
MALT is made of lymphoid tissue
(tonsils, lymph nodes, lymph follicles) is All these cells are derived from pluripotent
found in the respiratory mucosae from haematopoetic stem cells. Each stem cell has the
the nasal cavities to the lungs. capacity to produce RBC, WBC and platelets.
135 Immunology

www.tntextbooks.in
The only cells capable of specifically recognising B cells do not produce antibodies but become
and producing an immune response are the memory cells. These cells are responsible for
lymphocytes. The other types of white blood cells secondary immune response. T lymphocytes do
play an important role in non specific immune not produce antibodies. They recognize antigen-
response, antigen presentation and cytokine presenting cells and destroy them. The two
production. important types of T cells are Helper T cells and
Killer T cells. Helper T cells release a chemical
Lymphocytes
called cytokine which activates B cells. Killer
About 20-30% of the white blood cells are
cells move around the body and destroy cells
lymphocytes. They have a large nucleus filling
which are damaged or infected (Fig. 8.6).
most of the cell, surrounded by a little cytoplasm.
The two main types of lymphocytes are B and Apart from these cells neutrophils and
T lymphocytes. Both these are produced in the monocytes destroy foreign cells by phagocytosis.
bone marrow. B lymphocytes (B cells) stay in the Monocytes when they mature into large cells,
bone marrow until they are mature. Then they they are called macrophages which perform
circulate around the body. Some remain in the phagocytosis on any foreign organism.
blood, while others accumulate in the lymph
nodes and spleen. T lymphocytes leave the bone Dendritic cells are called so because
marrow and mature in the thymus gland. Once its covered with long, thin membrane
mature, T cells also accumulate in the same areas extensions that resemble dendrites of nerve
of the body as B cells. Lymphocytes have receptor cells. These cells present the antigen to
proteins on their surface. When receptors on a T-helper cells. Four types of dendritic cells
B cell bind with an antigen, the B cell becomes are known. They are langerhans, interstitial
activated and divides rapidly to produce plasma cells, myeloid and lymphoid cells
cells. The plasma cells produce antibodies. Some
Fig. 8.6 Cells of the immune system
Immunology 136

www.tntextbooks.in
8.6 Antigens 8.7 Antibodies

The term antigen (Ag) is used in two Antibodies are immunoglobulin (Ig)
senses, the first to describe a molecule which protein molecules synthesized on exposure
generates an immune response and the second, to antigen that can combine specifically
a molecule which reacts with antibodies. In with the antigen. Whenever pathogens
general antigens are large, complex molecular enter our body, the B-lymphocytes produce
substances that can induce a detectable immune an army of proteins called antibodies to
response. Thus an antigen is a substance that is fight with them. Thus, they are secreted in
specific to an antibody or a T-cell receptor and response to an antigen (Ag) by the effect of
is often used as a synonym for immunogen. B cells called plasma cells. The antibodies
are classified into five major categories,
The histocompatibility based on their physiological and biochemical
antigens are cell surface properties. They are IgG (gamma), IgM (mu),
antigens that induce an IgA (alpha), IgD (delta) and IgE (epsilon).
immune response leading
In the 1950s, experiments by Porter and
to rejection of allografts.
Edelman revealed the basic structure of the
immunoglobulin. An antibody molecule
An immunogen is a substance capable of
is Y shaped structure that comprises of
initiating an immune response. Haptens are
four polypeptide chains, two identical light
substance that are non-immunogenic but can react
chains (L) of molecular weight 25,000 Da
with the products of a specific immune response.
(approximately 214 amino acids) and two
Substances that can enhance the immune
identical heavy chains (H) of molecular
response to an antigen are called adjuvants.
weight 50,000 Da (approximately 450 amino
Epitope is an antigenic determinant and is the
acids). The polypeptide chains are linked
active part of an antigen. A paratope is the antigen
together by di-sulphide (S-S) bonds. One
– binding site and is a part of an antibody which
light chain is attached to each heavy chain
recognizes and binds to an antigen.
and two heavy chains are attached to each
Antigenicity is the property other to form a Y shaped (Fig. 8.7) structure.
of a substance (antigen) Hence, an antibody is represented by H2 L2.
that allows it to react with The heavy chains have a flexible hinge region
the products of the specific at their approximate middles.
immune response.
Antigen binding
Types of antigens site
On the basis of origin, antigens are

classified into exogenous antigens and Variable
region
endogenous antigens. Light chain
The antigens which enter the host from the Disulphide

bond
outside in the form of microorganisms, pollens,
Heavy chain
drugs, or pollutants are called exogenous
Constant
antigens. The antigens which are formed within region
the individual are endogenous antigens. The
best examples are blood group antigens. Fig. 8.7 Structure of immunoglobulin
137 Immunology

www.tntextbooks.in
Each chain (L and H) has two terminals. They are When antigen and antibody are closely
C - terminal (Carboxyl) and amino or N-terminal. fitted, the strength of binding is great. When
Each chain (L and H) has two regions. They have they are apart binding strength is low. The
variable (V) region at one end and a much larger bonds that hold the antigen to the antibody
constant (C) region at the other end. Antibodies combining site are all non-covalent in nature.
responding to different antigens have very different These include hydrogen bonds, electrostatic
(V) regions but their (C) regions are the same bonds, Van der Waals forces and hydrophobic
in all antibodies. In each arm of the monomer bonds. Antibody affinity is the strength of the
antibody, the (V) regions of the heavy and light reaction between a single antigenic determinant
chains combines to form an antigen – binding site and a single combining site on the antibody.
shaped to ‘fit’ a specific antigenic determinant.
The chief application of antigen - antibody
Consequently each antibody monomer has two
reactions are to determine blood groups for
such antigen – binding regions. The (C) regions
transfusion, to study serological ascertainment
that forms the stem of the antibody monomer
of exposure to infectious agents, to develop
determine the antibody class and serve common
immunoassays for the quantification of various
functions in all antibodies.
substances, to detect the presence or absence
The functions of immunoglobulin are of protein in serum and to determine the
agglutination, precipitation, opsonisation, characteristics of certain immunodeficiency
neutralization etc., diseases.
8.8 A
ntigen -antibody Different types of antigen and antibody
interaction reactions
The reaction between The reaction between soluble antigen
an antigen and antibody and antibody leads to visible precipitate
is the basis for humoral formation, which is called precipitin reaction.
immunity or antibody Antibodies that bring about precipitate
mediated immunity. The formation on reacting with antigens are called
reaction between antigen as precipitins.
and antibody occurs in Whenever a particulate antigen interacts
three stages. During the first stage, the reaction with its antibody, it would result in clumping or
involves the formation of antigen - antibody agglutination of the particulate antigen, which
complex. The next stage leads to visible events is called agglutination reaction. The antibody
like precipitation, agglutination, etc., The final involved in bringing about agglutination
stage includes destruction of antigen or its reaction is called agglutinin.
neutralization (Fig. 8.8). Opsonisation or enhanced attachment
is the process by which a pathogen is marked
Binding force of antigen - antibody of ingestion and destruction by a phagocyte.
reaction Opsonisation involves the binding of an
The binding force between antigen and opsonin i.e., antibody, to a receptor on the
antibody is due to three factors. They are pathogen’s cell membrane. After opsonin
closeness between antigen and antibody, non- binds to the membrane, phagocytes are
covalent bonds or intermolecular forces and attracted to the pathogen. So, opsonisation is
affinity of antibody. a process in which pathogens are coated with
Immunology 138

www.tntextbooks.in
Antigen and Antibody interactions
Neutralization Agglutination Precipitation

Complement system
(Exotoxin, toxoid) (Particulate antigen) (Soluble antigen)
Bacteria Complement
Virus molecule
Antigen
Bacterium molecules
Foreign cell Hole
Leads to
Enhances
Phagocytosis Inflammation Cell lysis

Inflammation
Injury
Macrophage
Fig. 8.8 Antigen and antibody reaction
a substance called an opsonin, marking the are known as antitoxins. This specific
pathogen out for destruction by the immune antibody is produced by a host cell in response
system. This results in a much more efficient to a bacterial exotoxin or corresponding
phagocytosis. toxoid (inactivated toxin).
The neutralization reactions are the
reactions of antigen-antibody that involve the 8. 9 Vaccines
elimination of harmful effects of bacterial A vaccine is a biological preparation
exotoxins or a virus by specific antibodies. that provides active acquired immunity
These neutralizing substances i.e., antibodies to a particular disease and resembles a
Attenuated
(weakening)
Live Attenuated
pathogen non-pathogenic
form (vaccine)
Natural live vaccine Live attenuated vaccine
Chemical
Inactivation
Modification
Live
pathogen Killed pathogens Toxin Toxoid
(vaccine) (vaccine)
Fig. 8.9 Types of vaccines
139 Immunology

www.tntextbooks.in
disease-causing microorganism and is

often made from weakened or attenuated Vaccino therapy is the
or killed forms of the microbes, their method of use of vaccine
toxins, or one of its surface proteins. for treatment of disease.
Vaccines “teach” our body how to defend Dr. Edward Jenner
itself when viruses or bacteria, invade it. prepared first vaccine
Vaccines deliver only very little amounts of for small pox in 1796. Polio vaccine was
inactivated or weakened viruses or bacteria, developed by Dr. Jonas Salk (vaccine
or parts of them. This allows the immune consists of inactivated microorganism)
system to recognize the organism without and Dr. Albert Sabin (live attenuated
actually experiencing the disease. Some oral polio vaccine). Louis Pasteur (1885)
vaccines need to be given more than once discovered vaccine against rabies, anthrax
(i.e., a ‘booster’ vaccination) to make sure and cholera. BCG vaccine was developed
the immune system can overcome a real by Calmette and Guerin against
infection in the future. tuberculosis in France in the year 1908.
Vaccine initiates the immunization

process. The vaccines are classified as first, 8. 10 Vaccination and
second and third generation vaccines. immunization
First generation vaccine is further “Vaccination is the process of
subdivided into live attenuated vaccine, administrating a vaccine into the body or the act
of introducing a vaccine into the body to produce
killed vaccine and toxoids (Fig. 8.9). Live
immunity to a specific disease.” Immunization
attenuated vaccines use the weakened
is the process of the body building up immunity
(attenuated), aged, less virulent form
to a particular disease. Immunization describes
of the virus. E.g. Measles, Mumps and
the actual changes in the body after receiving a
Rubella (MMR) vaccine and the Varicella vaccine. Vaccines work by fighting the pathogen
(chickenpox) vaccine, Killed (inactivated) and then recording it in their memory system
vaccines are killed or inactivated by heat to ensure that the next time this pathogen enters
and other methods. E.g. Salk’s polio vaccine. the body, it is eliminated far quickly. Once, the
Toxoid vaccines contain a toxin or chemical body is able to fight against the disease, it is
secreted by the bacteria or virus. They make believed to have built the immunity for it, also
us immune to the harmful effects of the known as the body being immunized against
infection, instead of to the infection itself. the disease.
E.g. DPT vaccine (Diphtheria, Pertussis
and Tetanus). 8.11 Hypersensitivity
Some of the individuals are very sensitive
Second generation vaccine contains to some particles present in the environment.
the pure surface antigen of the pathogen. The exaggerated response of the immune system
E.g.Hepatitis-B vaccine. Third generation to certain antigens present in the environment
vaccine contains the purest and the highest is called allergy (allo-altered, erg-reaction).
potency vaccines which are synthetic in The substances to which such an immune
generation. The latest revolution in vaccine is response is produced are called allergens. An
DNA vaccine or recombinant vaccine (Refer allergen is an antigen that causes an allergic
Chapter- 10 for details).
Immunology 140

www.tntextbooks.in
reaction. Allergic reactions begin within few Structure of HIV

seconds after the contact with the allergen The human immunodeficiency
and last about half an hour. The common virus belongs to the genus Lentivirus.
examples of allergens are mites in dust, pollens When observed under the electron
and some proteins in insect venom. Hay fever microscope, HIV is seen as a spherical virus,
and asthma are some common examples of 100-120 nm in diameter, containing a dense
allergy. Symptoms of allergic reactions include core surrounded by a lipoprotein envelope. The
sneezing, watery eyes, running nose and envelope has glycoprotein (gp) spikes termed
difficulty in breathing. Allergy is a form of over gp 41 and gp 120. At the core, there are two
active immune response mediated by IgE and large single stranded RNA. Attached to the
mast cells. It can also be due to the release of RNA are molecules of reverse transcriptase.
chemicals like histamine and serotonin from It also contains enzymes like protease and
the mast cells. ribonuclease. The core is covered by a capsid
Anaphylaxis is the classical immediate made of proteins. This is followed by another
hypersensitivity reaction. It is a sudden, systematic, layer of matrix proteins as shown in the
severe and immediate hypersensitivity reaction Fig 8.10.
occurring as a result of rapid generalized mast-cell
degranulation. gp41
gp120
8.12 Immunodeficiency diseases

Lipid bilayer
Matrix protein
Immunodeficiency results from the
failure of one or more components of the Capsid protein
immune system. Primary immune deficiencies Reverse
transcriptase
are caused by genetic developmental defects.
Secondary immune deficiencies arise due to Two single-stranded
various reasons like radiation, use of cytolytic RNAs
and immunosuppressive drugs and infections.

AIDS is an acronym for Acquired Immuno
Deficiency Syndrome. It is the deficiency Fig. 8. 10 Structure of HIV
of immune system, acquired during the life
time of an individual indicating that it is
HIV Transmission
not a congenital disease. AIDS is caused by
The HIV is often located within the
Human Immuno Deficiency Virus (HIV). It
cells especially in macrophages. HIV can
selectively infects helper T cells. The infected
survive for 1.5 days inside a cell but only
helper T cells will not stimulate antibody
about 6 hours outside a cell. Routes of HIV
production by B-cells resulting in loss of
transmission include unsafe sexual contact,
natural defence against viral infection. On the
blood-contaminated needles, organ
basis of genetic characteristics and differences
transplants, blood transfusion and vertical
in the viral antigens, HIV is classified into the
transmission from HIV infected mother to
types 1 and 2 (HIV-1, HIV-2).
child. HIV is not transmitted by insects or
by casual contact.
141 Immunology

www.tntextbooks.in
After getting into the body of the person, non-self and attacks its own body. Our body
the virus enters into macrophages where RNA produces antibodies (auto antibodies) and
genome of the virus replicates to form viral cytotoxic T cells that destroy our own tissues.
DNA with the help of the enzyme reverse If a disease-state results, it is referred to as
transcriptase. This viral DNA gets incorporated auto-immune disease. Thus, autoimmunity is a
into the DNA of host cells and directs the infected misdirected immune response. Autoimmunity
cells to produce viral particles. The macrophages is evidenced by the presence of auto antibodies
continue to produce virus and in this way acts like and T cells that are reactive with host antigens.
a HIV factory. Simultaneously, HIV enters into When the cells act as antigens in the same body,
helper T-lymphocytes, replicates and produces they are called autoantigens.
progeny viruses. The progeny viruses released
Autoimmune diseases in human can be
in the blood attack other helper T-lymphocytes.
divided into two broad categories, namely organ-
This is repeated, leading to a progressive decrease
specific and non-organ-specific (systemic)
in the number of helper T lymphocytes in the
autoimmune diseases. In organ-specific disease,
body of the infected person. During this period,
the autoimmune process is directed mostly
the person suffers from bouts of fever, diarrhoea
against one organ. The autoantibodies may
and weight loss. Due to decrease in the number of
block the functions performed by the organs.
helper T lymphocytes, the person starts suffering
Examples include Hashimoto’s thyroiditis,
from infections and becomes immune deficient
Graves’ disease (thyroid gland) and Addison’s
and unable to protect against any infection.
disease (adrenal glands).
A simple blood test is available that can
In non-organ specific (systemic) disorders,
determine whether the person has been infected
autoimmune activity is widely spread throughout
with HIV. The ELISA test (Enzyme Linked
the body. Rheumatoid arthritis and multiple
ImmunoSorbent Assay) detects the presence of
sclerosis are example for systemic disorder.
HIV antibodies. It is a preliminary test. Western
blot test is more reliable and a confirmatory
test. It detects the viral core proteins. If both 8.14 Tumour immunology
tests detect the presence of the antibodies, the A tumour or neoplasm is a group of cells
person is considered to be HIV positive. whose growth has gone unchecked. When a
tumour continues to grow and invades healthy
AIDS has no cure. Prevention of AIDS
tissue, it is called cancer. They spread to other
is the best option. Advocating safe sex and
parts of the body from the tumour and give rise to
promoting regular check-up, safe blood for
transfusion, use of disposable needles, use of secondary tumour. This is known as metastasis.
condoms during sexual contact, prevention of Tumour may be benign or malignant depending
drug abuse, AIDS awareness programme by on its characteristics. Benign or non-cancerous
NACO (National AIDS Control Organisation), tissues are capable of indefinite growth and do
NGOs (Non-Governmental Organisations) and not invade other body parts. In the malignant
WHO are to prevent the spreading of AIDS. tumour, the cells grow indefinitely, detach and
migrate into healthy surrounding tissues.
8.13 Autoimmune diseases In normal cells, cell growth and differentiation
Autoimmunity is due to an abnormal
is highly controlled and regulated. But in cancer
immune response in which the immune system
cells, there is breakdown of this regulatory
fails to properly distinguish between self and
Immunology 142

www.tntextbooks.in
mechanism. Normal cells show a property called Immunotherapy of cancer

contact inhibition, which inhibits uncontrolled
Immunotherapy also called biological
growth. Cancer cells do not have this property. As
therapy uses substances made by the body
a result, cancerous cells divide continuously giving
or in a laboratory (monoclonal antibodies)
rise to mass of tissues called tumours (Table 8.5).
to improve or to resist the immune system
When a cell undergoes malignant function. Different approaches have been
transformation, it acquires new surface antigen attempted in the immunotherapy of cancer.
and may also lose some normal antigens. Immunotherapy appears to be important in
These antigens are present on the membranes getting rid of the residual malignant cells after
of malignant cells and they induce an immune the gross tumour has been removed. The best
response. Both humoral and cellular responses results in the treatment of cancer is to follow
can be observed in malignancy. Cancer cells can an integrated approach to therapy, combining
avoid immune detection as they are not foreign surgery, radiotherapy, chemotherapy and
bodies but are abnormally functioning body immunotherapy.
cells. This makes them difficult to treat.
Scope of Immunology
The concept of immunological surveillance
The younger graduates in this field can
postulates that the primary function of the
find number of employment opportunities in
immune system is to “seek and destroy” Government as well as private hospitals. The
malignant cells that arise by somatic mutation. scope of the immunology is immunotherapy,
The efficiency of the surveillance mechanism microbial immunology, clinical immunology,
reduces either as a result of ageing or due to cellularimmunology,allergyandimmunology,
congenital or acquired immunodeficiencies, translational immunology, transplantation
leads to increased incidence of cancer. Thus, if immunology, neuro-inflammatory disorders,
immunological surveillance is effective, cancer tumour immunology, vaccine immunology,
should not occur. The development of tumour inflammatory disorders, ocular immunology
represents a lapse in surveillance. and inflammation.
Table 8.5. Differences between normal cell and cancer cell
143 Immunology

www.tntextbooks.in
Summary Evaluation
Immunology deals with a study of the immune 1. Colostrum provides
system. The immune system recognises and a) Naturally acquired active
eliminates the invaders, and the ability of immunity
the body to overcome the pathogen is called b) Naturally acquired
immunity. Immunity is classified into innate passive immunity
immunity and acquired immunity. Acquired c) Artificially acquired active
immunity is further classified into cell mediated immunity
immunity and antibody mediated immunity as d) Artificially acquired passive immunity
its components. Acquired immunity may be
active or passive immunity. Immune response 2. Paratope is an
is the body’s response to pathogens and it may (a) Antibody binding site on variable regions
be primary or secondary. The organs involved (b) Antibody binding site on heavy regions
in the origin, maturation and proliferation (c) Antigen binding site on variable regions
of lymphocytes are called lymphoid organs. (d) Antigen binding site on heavy regions
Thymus, bone marrow are primary lymphoid 3. Allergy involves
organs. The secondary lymphoid organs are
a) IgE b) IgG
lymph node, MALT, GALT and BALT.
c) lgA d) IgM
An antigen is a substance that is specific to an
4. Anaphylactic shock is due to
antibody. An immunogen is a substance capable
of initiating an immune response. Haptens are (a) Allergic reaction
substance that are non-immunogenic but can (b) Secretion of toxins
react with the product of a specific immune (c) Secretion of histamines
response. Substances that can enhance the (d) All the above
immune response to an antigen are called 5. Spread of cancerous cells to distant sites
adjuvants. An epitope is also known as antigenic is termed as
determinant and is the active part of the antigen. (a) Metastasis
A paratope is the part of antibody. Precipitation, (b) Oncogenes
agglutination, neutralization, opsonisation etc., (c) Proto-oncogenes
are the different types of antigen and antibody (d) Malignant neoplasm
reaction. A vaccine is biological preparation 6. AIDS virus has
that provides active acquired immunity. The (a) Single stranded RNA
malfunctioning of immune system leads (b) Double stranded RNA
to hypersensitivity, immunodeficiency or (c) Single stranded DNA
autoimmune diseases. A tumour or neoplasm (d) Double stranded DNA
is a group of cells whose growth has gone 7. All are peripheral lymphoid organs except
unchecked. The best results in the treatment of
(a) Lymph nodes
cancer is achieved by an integrated approach to
(b) Spleen
therapy, surgery, radiotherapy, chemotherapy
(c) Mucosa associated lymphoid tissue
and immunotherapy.
(d) Thymus
8. Which is a macrophage?
(a) Monocyte (b) Erythrocyte
(c) Thrombocyte (d) Lymphocyte
Immunology 144

www.tntextbooks.in
9. True about interferon is that lymphoid organ. Explain its role.

(a) It is synthetic antiviral agent Liver, thymus, stomach, thyroid, tonsils
(b) It inhibits viral replication in cells 16. How does saliva act in body defence?
(c) It is specific for a particular virus 17. How does immune system work?
(d) It causes infection 18. Name and explain the type of barriers
which involve macrophages.
10. Cell mediated immunity is carried out
19. What are interferons? Mention their role.
by………….. while humoral immunity is
mainly carried out by 20. List out chemical alarm signals produced
(a) B cells/T cells during inflammation.
(b) Epitopes/antigens 21. Differentiate between
(c) T cells/B cells (a) Innate immunity and acquired

immunity
(d) antibodies/antigens
(b) P
rimary and secondary immune
11. B Cells are activated by responses
(a) Complement (c) Active and passive immunity
(b) Antibody (d) Humoral and CMI immunity
(c) Interferon (e) Autoimmune disease and
(d) Antigen Immunodeficiency disease
12. In agglutination and precipitation 22. Where are B-cells and T-cells produced in
reactions, the antigen is a ______________ the human body? How do they differ from
and ____________ respectively each other? Mention any two differences.
(a) Whole cell/soluble molecule 23. Explain the process of replication of
(b) Soluble molecule/whole cell retrovirus after it gains entry into the
human body.
(c) Bacterium/virus
24. Why is an antibody molecule represented
(d) Protein/Antibody
as H2 L2?
13. B cells that produce and release large 25. Explain the structure of immunoglobulin
amounts of antibody are called with suitable diagram.
(a) Memory cells (b) Basophils 26. What are the cells involved innate immune
(c) Plasma cells (d) killer cells system?
14. Raja is injured and got swelling. The 27. Why is opsonisation efficient in
swelling is due to the infection of tissue is phagocytosis?
an example of 28. What is vaccine? What are its types?
(a) Mechanical barrier 29. A person is infected by HIV. How will you
(b) Physiological barrier diagnose for AIDS?
(c) Phagocytosis 30. Autoimmunity is a misdirected immune
(d) Inflammation response. Justify.
15. Given below are some human organs.

Identify one primary and one secondary
145 Immunology

Concept Map
Immunology
Memory
Antibodies

B-cells Cell-Mediated Immunity Antibody Mediated
Immunity or Humoral
Immunity
Types of Acquired
146
Activates Immunity
B-cells Components Primary
Memory of Acquired immune
T-cells Immunity response
Innate
Activates immunity Acquired
T-cells Antigens immunity
Killer Secondary
T-cells Immune immune
Tumour
Responses response
Immunology
Thymus
Immunodeficiency Basic Lymphoid Primary

disease organs lymphoid Bone
concepts of
organs Marrow
www.tntextbooks.in
immunology
Hypersensitivity Antibodies
Secondary
Lymph
(peripheral)
Vaccination and Vaccines Autoimmune Node
lymphoid organs
Immunization disease
Antigen - Antibody
interactions Cells of the immune
system
Binding force of antigen

- antibody reaction
Different types of Antigen
and Antibody reactions
18/12/2021 14:58:26
www.tntextbooks.in
ICT CORNER
IMMUNOLOGY
Let us do examine to know the

chronic disease - systemic lupus
erythematosus (SLE)
Procedure :
Step -1 : Type the URL or scan the QR code to open the activity page. Click “To enter the lab” to
start the test.
Step -2 : Follow the interactive steps guided by the virtual lab starting from centrifugation and to
ELISA.
Step -3 : On the right, Find the different headers such as “Diagnosis, Background, Notebook,
Glossary and Help” and click to know the virtual procedure happening aside on the left.
Step – 4 : Find “Launch Gene Body” on the right bottom of the window, and Click it to analyse
and understand about the cloning.
Step -5: Complete this ELISA to know a patient acquired the disease or not.
Step 4
IMMUNOLOGY URL:
http://media.hhmi.org/biointeractive/vlabs/immunology/index.html?_
ga=2.219254809.1253796128.1545143882-264360672.1545143882

*Allow flash player
147 Immunology

www.tntextbooks.in
9
UNIT - III
Microbes in
Human Welfare
CHAPTER
Saccharomyces cerevisiae, a species of yeast
used in baking and brewing industry.
Chapter outline
9.1 Microbes in household products Microbes such as bacteria, fungi,
9.2 Microbes in industrial products protozoa, certain algae, viruses, viroids and
9.3 Microbes in sewage treatment and prions are some of the major components
energy generation of the biological system on Earth. Several
microorganisms are beneficial and contribute
9.4 Microbes in the production of biogas
to human welfare. Microbes are present
9.5 Bioremediation
everywhere – in soil, water, air and within
bodies of animals and plants. Microbes like
bacteria and fungi can be grown on nutritive
media to form colonies which can be visibly
seen. Some of the microbes useful to human
welfare are discussed here.
Learning objectives
9.1 Microbes in household
➢➢ Differentiates probiotics from products
pathogens. In every day life, microbes and their
➢➢ Understands the use of microbes in products are used in the preparation of idli,
household products. dosa, cheese, curd, yogurt, dough, bread,
➢➢ Learns about antibiotic production and vinegar, etc., Bacteria like Lactobacillus
fermented beverages. acidophilus, L. lactis and Streptococcus lactis
➢➢ Realizes the commonly called lactic acid bacteria (LAB)
importance of are probiotics which check the growth of
microbes in sewage pathogenic microbes in the stomach and
treatment and energy other parts of the digestive tract.
generation. The LAB bacteria grows in milk and
➢➢ Realizes the applications of microbes in convert it into curd, thereby digesting the milk
bio-remediation. protein casein. A small amount of curd added
to fresh milk as a starter or inoculum contains
millions of Lactobacilli, which under suitable
148

www.tntextbooks.in
o
temperature (≤40 C) multiply and convert di-oxide, which is responsible for leavening of
milk into curd. Curd is more nutritious than dough. When leavened dough is baked, both
milk as it contains a number of organic acids carbon-di-oxide and ethyl alcohol evaporate
and vitamins. making the bread porous and soft.
Prebiotics are compounds Single Cell Protein (SCP)

in food (fibers) that induce Single cell protein refers to edible
the growth or activity of unicellular microorganisms like Spirulina.
beneficial microorganisms. Protein extracts from pure or mixed cultures
Probiotics are live of algae, yeasts, fungi or bacteria may be used
microorganisms intended to provide health as ingredient or as a substitute for protein rich
benefits when consumed, generally by foods and is suitable for human consumption
improving or restoring the gut flora. or as animal feed.
Yogurt is produced by bacterial 9.2 Microbes in industrial

fermentation of milk, and lactic acid is products
produced as a byproduct. Microorganisms Microbes are used to synthesize a number
such as Streptococcus thermophilus and of products valuable to human beings. Products
Lactobacillus bulgaricus coagulate the milk like beverages, antibiotics, organic acids, amino
protein and convert the lactose in the milk acids, vitamins, biofuels, single cell protein,
to lactic acid. The flavour in yogurt is due to enzymes, steroids, vaccines, pharmaceutical
acetaldehyde. drugs, etc., are produced in industries.
Cheese is a dairy product produced in a Production on a large scale requires growing
wide range of flavours, textures and is formed microbes in very large vessels called fermentors.
by coagulation of the milk protein, casein. A fermentor (bioreactor) is a closed vessel with
During cheese production, milk is usually adequate arrangement for aeration, agitation,
acidified and the enzyme rennet is added to temperature, pH control and drain or overflow
cause coagulation. The solids are separated and vent to remove the waste biomass of cultured
pressed to form cheese. Most cheese are made microorganisms along-with their products.
with a starter bacteria, Lactococcus, Lactobacillus
or Streptococcus. 9.2.1 Antibiotic production
Paneer (cottage cheese) is fresh cheese Antibiotics are chemical substances
common in South Asia, especially in India. produced by microorganisms which can kill
It is made by curdling milk with lemon juice, or retard the growth of other disease causing
vinegar and other edible acids. Large holes in microbes even in low concentration. Antibiotic
Swiss cheese is due to the production of large means “against life”. Antibiotics are used to treat
amount of carbon-di-oxide by the bacterium diseases such as plague, meningitis, diphtheria,
Propionibacterium shermanii. syphilis, leprosy, tuberculosis etc., Selman
The dough used in the preparation of idlis and Waksman discovered Streptomycin and was the
dosas are fermented by the bacteria Leuconostoc first to use the term “antibiotic” in 1943.
mesenteroides whereas the dough used in While working on Staphylococci bacteria,
bread making is fermented by Saccharomyces Alexander Fleming observed a green mould
cerevisiae (Baker’s Yeast). Fermentation of growing in one of his unwashed culture plates
glucose mainly forms ethyl alcohol and carbon- around which Staphylococci could not grow. He
149 Microbes in Human Welfare

www.tntextbooks.in
found that it was due to a chemical produced

by the mould and he named it as penicillin, Hypersensitivity reaction
which was the first antibiotic discovered by is a major problem with
Alexander Fleming in 1926 (Fig. 9.1). Penicillin the use of penicillin,
is produced by the fungi Penicillium notatum resulting in nausea,
and Penicillium chrysogenum. It is bactericidal vomiting, wheezing and
(antibiotics that kill bacteria) in action and ultimately cardiovascular collapse. To check
inhibits the synthesis of the bacterial cell wall. the sensitivity reaction, doctors use a needle
to prick the forearm of the patients to give a
Penicillin is also referred as the “queen
weak dose of penicillin. An itchy red region in
of drugs” and its full potential as an effective
the forearm is an indication that the patient
antibiotic was established much later by
is allergic to penicillin. This test is important
Earnest Chain and Howard Florey when they
before administration of penicillin to a patient.
treated the wounded soldiers in World War II
with penicillin. Fleming, Chain and Florey
Tetracycline is a broad spectrum
were awarded the Nobel prize in 1945 for the
bacteriostatic antibiotic (antibiotics that limit the
discovery of penicillin.
growth of bacteria) that inhibits microbial protein
synthesis. Chlortetracycline is the first antibiotic
Antibiosis is the property of antibiotics to
of this group, isolated from the cultures of
kill microorganisms.
Streptomyces aureofaciens. Streptomycin is
Broad-spectrum antibiotics act against a
a broad spectrum antibiotic isolated from
wide range of disease-causing bacteria.
the actinomycetes, Streptomyces griseus. It is
Narrow-spectrum antibiotics are active
bactericidal against both gram positive and
against a selected group of bacterial types.
gram negative bacteria, especially against
Mycobacterium tuberculosis. Antibiotics, such
ng
as erythromycin, chloromycetin, griseofulvin,

Alexander Flemin
neomycin, kenamycin, bacitracin, etc., are also

isolated as microbial products.
Antibiotic resistance
Antibiotic resistance occurs when bacteria
develop the ability to defeat the drug designed
to kill or inhibit their growth. It is one of the
most acute threat to public health. Antibiotic
resistance is accelerated by the misuse and
over use of antibiotics, as well as poor infection
prevention control. Antibiotics should be used
H only when prescribed by a certified health
 N S
 professional. When the bacteria become
O
O
N resistant, antibiotics cannot fight against them
OH and the bacteria multiply. Narrow spectrum
O
antibiotics are preferred over broad spectrum
antibiotics. They effectively and accurately target
 specific pathogenic organisms and are less likely
Fig. 9.1 Discovery of penicillin to cause resistance. "Superbug" is a term used to
Microbes in Human Welfare 150

www.tntextbooks.in
describe strains of bacteria that are resistant to

Alcohol content in various beverages
the majority of antibiotics commonly used today.
• Beer contains 3 to 5 percent of alcohol.
9.2.2 Fermented beverages • Wine contains 9 to 14 percent alcohol.
Microbes especially yeast is being used Wine coolers are made of wine mixed
from time immemorial for the production with carbonated water and flavourings.
of beverages like wine, beer, whisky, brandy Wine coolers have about 4 to 6 percent
and rum. Wine is among the oldest alcoholic alcohol.
beverages known and is produced by • Distilled spirits such as whiskey, gin,
fermentation of fruit juice by yeast. Zymology scotch and vodka usually contain 35
is an applied science which deals with the to 50 percent alcohol.
biochemical process of fermentation and its
practical uses. In some parts of South India, a traditional
Saccharomyces cerevisiae commonly drink called pathaneer is obtained from
called brewer’s yeast is used for fermenting fermenting sap of palms and coconut trees. A
malted cereals and fruit juices to produce common source is tapping of unopened spadices
various alcoholic beverages. Wine and beer of coconut. It is a refreshing drink, which on
are produced without distillation, whereas boiling produces jaggery or palm sugar. When
whisky, brandy and rum are obtained by pathaneer is left undisturbed for few hours it
fermentation and distillation. gets fermented to form toddy with the help of
naturally occurring yeast, to form a beverage
The Pasteur effect is the that contains 4 percent alcohol. After 24 hours
inhibiting effect of oxygen toddy becomes unpalatable and is used for the
on the fermentation production of vinegar.
process. Saccharomyces cerevisiae is the major
producer of ethanol (C2H5OH). It is used for
Oenology is the science and study of industrial, laboratory and fuel purposes. So
wine and wine making. Wine is made from ethanol is referred to as industrial alcohol.
the fermentation of grape juice. Grape juice is Bacteria such as Zymomonas mobilis and Sarcina
fermented by various strains of Saccharomyces ventriculi are also involved in ethanol production.
cerevisiae into alcohol. Grape wine is of two types, The principal substrates for the commercial
red wine and white wine. For red wine, black production of industrial alcohol include molasses
grapes are used including skins and sometimes or corn, potatoes and wood wastes. The process
the stems also are used. In contrast white wine is of ethanol production starts by milling a feed
produced only from the juice of either white or stock followed by the addition of dilute or fungal
red grapes without their skin and stems. amylase (enzyme) from Aspergillus to break
down the starch into fermentable sugars. Yeast
Beer is produced from germinated barley
is then added to convert the sugars to ethanol
malt grain by Saccharomyces carlsbergensis which is then distilled off to obtain ethanol which
or Saccharomyces cerevisiae. Rum is made is upto 96 percent in concentration. The two
from fermented sugarcane or molasses or most common type of biofuels in use today are
directly from sugarcane juice by Saccharomyces ethanol and biodiesel, both of them represent the
cerevisiae. Whisky is a type of distilled alcoholic first generation of biofuel technology. Ethanol is
beverage made from fermented grain mash by often used as a fuel, mainly as a biofuel additive
Saccharomyces cerevisiae. for gasoline.

www.tntextbooks.in
Biodiesel is a fuel made from vegetable oils, fats or greases. Biodiesel fuel can be used in diesel
engines without altering the engine. Pure biodiesel is non-toxic, biodegradable and produces
lower level of air pollutants than petroleum-based diesel fuel. The Government of India
approved the National Policy on Biofuels in December 2009 and identified Jatropha curcas as
the most suitable oilseed for biodiesel production. Pongamia species is also a suitable choice
for production of biodiesel.
removing clots from the blood vessels of

C6H12O6 Yeast 2C2H5OH + 2CO2↑ patients who have undergone myocardial
(Glucose) Fermentation (Ethanol)
infarction.
Cyclosporin A, an immunosuppressant
World biofuel day is used in organ transplantation is produced
observed every year on from the fungus Trichoderma polysporum. It
10th August to create is also used for its anti-inflammatory, anti-
awareness about the fungal and anti-parasitic properties. Statins
importance of renewable produced by the yeast Monascus purpureus
bio-fuels as an alternative to conventional have been used to lower blood cholesterol
non-renewable fossil fuels. This day also levels. It acts by competitively inhibiting
highlights the various efforts taken by the the enzyme responsible for the synthesis of
Government in the biofuel sector. cholesterol. Recombinant human insulin
has been produced predominantly using E.
9.2.3 Chemicals, enzymes and other coli and Saccharomyces cerevisiae for
bioactive molecules therapeutic use in human.
Microbes are not only used for commercial 9.3 M
icrobes in sewage
and industrial production of alcohol, but also treatment and energy
used for production of chemicals like organic generation
acids and enzymes. Examples of organic acid Sewage is the waste generated every day
producers are Aspergillus niger for citric acid, in cities and towns containing human excreta.
Acetobacter aceti for acetic acid, Rhizopus It contains large amounts of organic matter and
oryzae for fumaric acid, Clostridium microbes, which are pathogenic to humans and
butyricum for butyric acid and Lactobacillus are bio-degradable pollutants. Domestic waste
for lactic acid. consists of approximately 99 percent water,
suspended solids and other soluble organic and
Yeast (Saccharomyces cerevisiae) and
inorganic substances. Sewage should not be
bacteria are used for commercial production
discharged directly into natural water bodies
of enzymes. Lipases are used in detergent
like rivers and streams. Before disposal, sewage
formulations and are used for removing oily should be treated in sewage treatment plants to
stains from the laundry. Bottled juices are make it less polluting.
clarified by the use of pectinase, protease and
Microbes(mass of bacteria floc) are allowed
cellulase. Rennet can also be used to separate
to grow in aerated water (secondary treatment).
milk into solid curds for cheese making.
They consume major part of organic matter in
Streptokinase produced by the bacterium the effluent and reduce the BOD in the waste
Streptococcus and genetically engineered water( The details on waste water treatment are
Streptococci are used as “clot buster” for discussed in chapter 13).

www.tntextbooks.in
9.3.1 Microbial Fuel Cell (MFC) Biogas is devoid of smell and burns with a blue
A Microbial Fuel Cell is a bio-electrochemical flame without smoke. The Methanogens are also
system that drives an electric current by using present in anaerobic sludge and rumen of cattle.
bacteria and mimicking bacterial interaction In rumen, these bacteria help in the breakdown
found in nature (Fig. 9.2). Microbial Fuel Cells of cellulose. The excreta of cattle called dung is
work by allowing bacteria to oxidize and reduce commonly called “Gobar”. Gobar gas is generated
organic molecules. Bacterial respiration is basically by the anaerobic decomposition of cattle dung. It
one big redox reaction in which electrons are consists of methane, CO2 with some hydrogen,
being moved around. A MFC consists of an anode nitrogen and other gases in trace amounts.
and a cathode separated by a proton exchange
membrane. Microbes at the anode oxidize the
organic fuel generating protons which pass
through the membrane to the cathode and the
electrons pass through the anode to the external
circuit to generate current.
e-
e-
Fig. 9.3 Biogas Unit
Substrate C
a O2 + 4H+
A In a biogas plant, anaerobic digestion is
n t
o h carried out in an air tight cylindrical tank known
d o as digester (Fig. 9.3). It is made up of concrete
Re e d 2H2O
e bricks and cement or steel. Bio-wastes are collected
OX
CO2 H+ H+ and slurry of dung is fed into this digester. It
has a side opening into which organic materials
for digestion are incorporated for microbial
Proton exchange membrane
activity. Anaerobic digestion is accomplished
Fig. 9.2 Microbial Fuel Cell in three stages: solubilisation, acidogenesis and
9.4 Microbes in the production of methanogenisis. The outlet is connected to a pipe
to supply biogas. The slurry is drained through
biogas
another outlet and is used as fertilizer. Biogas is
Biogas is a mixture of different gases
used for cooking and lighting. The technology of
produced by the breakdown of organic matter in
biogas production was developed in India mainly
the absence of oxygen. Biogas can be produced
due to the efforts of Indian Agricultural Research
from raw materials such as agricultural wastes,
Institute (IARI) and Khadi and Village Industries
manure, municipal wastes, plant material,
Commission (KVIC).
sewage, food waste, etc., Biogas is produced
under anaerobic condition, when the organic 9.5 Bioremediation
materials are converted through microbiological
The use of
reactions into gas and organic fertilizer. Biogas
naturally occurring or
primarily consists of methane (63 percent), along
genetically engineered
with CO2 and hydrogen. Methane producing
microorganisms to reduce
bacteria are called methanogens and one such
or degrade pollutants is
common bacterium is Methanobacterium.

www.tntextbooks.in
called bioremediation. Bioremediation is chrysosporium an anaerobic fungus exhibits

less expensive and more sustainable than strong potential for bioremediation of
other remediations available. It is grouped pesticides, polyaromatic hydrocarbons,
into in situ bioremediation (treatment of dyes, trinitrotoluene, cyanides, carbon
contaminated soil or water in the site) tetrachloride, etc., Dehalococcoides species
and ex situ bioremediation (treatment of are responsible for anaerobic bioremediation
contaminated soil or water that is removed of toxic trichloroethene to non-toxic ethane.
from the site and treated). Pestalotiopsis microspora is a species of
endophytic fungus capable of breaking down
9.5.1 Microorganisms involved
and digesting polyurethane. This makes the
in bioremediation
fungus a potential candidate for bioremediation
Aerobic microbes degrade the pollutants
projects involving large quantities of plastics.
in the presence of oxygen. They mainly degrade
pesticides and hydrocarbons. Pseudomonas Breaks down Ideonella sakaiensis
PET into
putida is a genetically engineered microorganism terephthalic acid
adhere to
PET film
& ethylene glycol
(GEM). Ananda Mohan Chakrabarty obtained
patent for this recombinant bacterial strain.
It is multi- plasmid hydrocarbon-degrading
bacterium which can digest the hydrocarbons
in the oil spills (Fig. 9.4).
Eats the
terephthalic
acid & ethylene PET Bottle
Microorganism glycol
O
O
Fig. 9.6 Actions of Ideonella sakaiensis

+ H2
2
+H
CO 2
oil
2
CO
oil CO 2
O
+ H2
Microorganisms
eat oil or other
Microorganisms digest
oil and convert it to
Microorganisms
give off
Summary
organic contaminants carbon dioxide (CO2)
and water (H2O)
CO2 and H2O
All microbes are not pathogenic, many of them are
beneficial to human beings. We use microbes and
Fig. 9.4 The process of bioremediation their derived products almost every day. Lactic acid
bacteria convert milk into curd. Saccharomyces
Nitrosomonas europaea is also capable of cerevisiae (yeast) is used in bread making. Idly
degrading benzene and a variety of halogenated and dosa are made from dough fermented by
organic compounds including trichloroethylene microbes. Bacteria and fungi are used in cheese
and vinyl chloride. Ideonella sakaiensis is making. Industrial products like lactic acid, acetic
currently tried for recycling of PET plastics acid and alcohol are produced by microbes.
(Fig. 9.6). These bacteria use PETase and Antibiotics are produced from useful microbes
MHETase enzymes to breakdown PET plastic to kill the disease causing harmful microbes. For
into terephthalic acid and ethylene glycol. more than a hundred years, microbes are being
used to treat sewage by the process of activated
Anaerobic microbes degrade the sludge formation. Bio-gas produced by microbes
pollutants in the absence of oxygen. is used as a source of energy in rural areas. In
Dechloromonas aromatica has the ability bio-remediation naturally occurring or genetically
to degrade benzene anaerobically and to engineered microorganisms are used to reduce or
oxidize toluene and xylene. Phanerochaete degrade pollutants.

www.tntextbooks.in
Evaluation 6. The purpose of biological treatment of waste

1.
Which of the following water is to _______
microorganism is used a) Reduce BOD b) Increase BOD
for production of citric c) Reduce sedimentation
acid in industries? d) Increase sedimentation
a) Lactobacillus bulgaris 7.
The gases produced in anaerobic sludge
b) Penicillium citrinum digesters are
c) Aspergillus niger d) Rhizopus nigricans a) Methane, oxygen and hydrogen sulphide.
b) Hydrogen sulphide, methane and sulphur
2. W
hich of the following pair is correctly dioxide.
matched for the product produced by them? c) Hydrogen sulphide, nitrogen and methane.
a) Acetobacter aceti - Antibiotics d) Methane, hydrogen sulphide and CO2.
b) Methanobacterium - Lactic acid
c) Penicilium notatum - Acetic acid 8. How is milk converted into curd? Explain
d) Saccharomyces cerevisiae - Ethanol the process of curd formation.
3.
The most common substrate used in 9. Give any two bioactive molecules produced
distilleries for the production of ethanol by microbes and state their uses.
is_________
10. Define the following terms:
a) Soyameal b) Groundgram
c) Molasses d) Corn meal a) Antibiotics b) Zymology
c) Superbug
4. Cyclosporin – A is an immunosuppressive
drug produced from _______ 11. Write short notes on the following:
a) Aspergillus niger a) Brewer's yeast b) Ideonella sakaiensis
b) Manascus purpureus c) Microbial Fuel Cell
c) Penicillium notatum 12. List the advantages of biogas plants in rural
d) Trichoderma polysporum areas.
5. CO2 is not released during 13. When does antibiotic resistance develop?
a) Alcoholic fermentation
14. What is referred to as industrial alcohol?
b) Lactate fermentation
Briefly describe its preparation.
c) Aerobic respiration in animals
d) Aerobic respiration in plants 15. What is bioremediation?

www.tntextbooks.in
Concept Map
0LFUREHVLQ
KXPDQZHOIDUH
6HZDJH +RXVHKROG (QHUJ\

,QGXVWULHV %LRJDV
WUHDWPHQW SURGXFWV SURGXFWLRQ
3URGXFWLRQRI
IHUPHQWHGEHYHUDJHV 3ULPDU\ 0HWKDQRJHQV &XUG 0LFURELDOIXHO
WUHDWPHQW JURZ FHOOV
DQDHURELFDOO\RQ
FHOOXORVLFPDWHULDO <RJXUW
3URGXFWLRQRIDQWLELRWLFV
DQGSURGXFH
FDUERQGLR[LGH
DQGK\GURJHQ
DORQJZLWK &KHHVH
&KHPLFDOVOLNHFLWULFDFLG 6HFRQGDU\
DFHWLFDFLGODFWLFDFLG WUHDWPHQW PHWKDQH
EXW\ULFDFLGHWF
%UHDG
3URGXFWLRQRI
%LRDFWLYHPROHFXOHV
7HUWLDU\
WUHDWPHQW
ICT CORNER
MICROBES IN HUMAN WELFARE
How the fermentation takes place? Let us

experiment it virtually
Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “START” to begin
the fermentation experiment.
Step -2: Click “next” for all the flasks combination.
Step -3: W
hen the “Matching Game” starts to know the result, “Drag and place” the combination
perfectly to their respective flasks.
Step – 4 :Go on through the other tests, explanations and the principle involved in the fermentation
process.
MICROBES IN HUMAN WELFARE URL:

http://www.bch.cuhk.edu.hk/vlab2/animation/fermentation/
*Allow flash player

www.tntextbooks.in
10
UNIT - IV
Applications of
Biotechnology
CHAPTER
"Our world is built on biology"
Chapter outline
10.1 Applications in Medicine
B efore we start this chapter, it will be helpful
if you revise the structure of DNA, Protein
synthesis and genetic engineering. Genetic
10.2 Gene therapy engineering involves the manipulation of DNA
10.3 Stem Cell Therapy and naturally occurring processes such as protein
10.4 Molecular Diagnostics synthesis for a wide range of applications including
10.5 Transgenic Animals the production of therapeutically important
10.6 Biological products and proteins. This also involves extracting a gene from
their uses one organism and transferring it to the DNA of
10.7 Animal cloning another organism, of the same or another species.
The DNA produced in this way is referred to as
10.8 Ethical issues
recombinant DNA (rDNA) and this technique as
10.9 Regulation in biotechnology
recombinant DNA technology. All these are part of
10.10 Possible threats of Genetically the broad field biotechnology which can be defined
Modified Organisms as the applications of scientific and engineering
10.11 Biosafety guidelines principles to the processing of material by biological
agents to provide goods and services.
Biotechnology is an umbrella term that covers
Learning objectives various techniques for using the properties of
living things to make products or provide services.
➢➢ Understand the applications of rDNA The term biotechnology was first used before
technology in the field of medicine. 20th century for such traditional activities as
➢➢ Analyse the role of making idli, dosa, dairy products, bread or
diagnostic tools in wine, but none of these would be considered
Molecular diagnosis. biotechnology in the modern sense.
➢➢ Learn animal cloning In this chapter we will study the applications
and its applications. of bio-technology in various fields including
➢➢ Create awareness on the the field of Medicine. Recombinant DNA
ethical issues involved in biotechnology. technology has led to the large scale
➢➢ Realise the need for biosafety guidelines production of various hormones and proteins
and regulations in Biotechnology. of therapeutic use.
157

www.tntextbooks.in
10.1 Applications in Medicine the animal insulin as compared to human

insulin, it resulted in the occurrence of
10.1.1 Recombinant Human Insulin allergic reactions in some diabetic patients.
The Human insulin is synthesized by the Production of insulin by recombinant DNA
β cells of Islets of Langerhans in the pancreas. It technology started in the late 1970s. This
is formed of 51 aminoacids which are arranged technique involved the insertion of human
in two polypeptide chains, A and B. The insulin gene on the plasmids of E.coli. The
polypeptide chain A has 21 amino acids while polypeptide chains are synthesized as a
the polypeptide chain B has 30 amino acids. precursor called pre-pro insulin, which
Both A and B chains are attached together by contains A and B segments linked by a third
disulphide bonds. Insulin controls the levels chain (C) and preceded by a leader sequence.
of glucose in blood. It facilitates the cellular The leader sequence is removed after
uptake and utilization of glucose for the translation and the C chain is excised, leaving
release of energy. Deficiency of insulin leads the A and B polypeptide chains (Fig. 10.1).
to diabetes mellitus which is characterized by Insulin was the first ever pharmaceutical
increased blood glucose concentration and product of recombinant DNA technology
a complex of symptoms which may lead to administered to humans. The approval to use
death, if untreated. A continuous program of recombinant insulin for diabetes mellitus was
insulin dependence is required to treat this given in 1982. In 1986 human insulin was
deficiency. marketed under the trade name Humulin.
In the early years, insulin isolated and
purified from the pancreas of pigs and cows Best and Banting in 1921, isolated insulin from
was used to treat diabetic patients. Due the pancreatic islets of a dog and demonstrated
to minor differences in the structure of its effectiveness against diabetes.
Extraction &
DNA Introduction of purification of
recombinant human insulin
DNA into a C chain
bacterial cell Recombinant A chain
Bacterium COOH
Human H2N
pancreas cell Signal B chain
Human Recombinant
peptide
Pre pro insulin
insulin-producing bacteria
gene multiplying C chain
Recombinant and producing A chain
human insulin in COOH Human insulin

DNA S S
fermentation tank S S
H 2N
Bacterial Plasmid DNA B chain
DNA cut with restriction Pro insulin

Fermentation
enzymes
Tank A chain
S S
H 2N COOH
Plasmid S
S
S
S
DNA H 2N COOH
B chain
Bacterium
Human insulin Insulin
Fig. 10.1 Human Insulin Production
Applications of Biotechnology 158

www.tntextbooks.in
10.1.2 Human alpha lactalbumin could be isolated from blood, but the amount
Alpha lactalbumin is a protein composed of blood required for isolation of interferons is
of 123 amino acids and 4 disulphide bridges, enormous and not practical. To overcome this
with a molecular weight of 14178 Da. In issue interferons could be produced by rDNA
human milk, α lactalbumin is the most technology. The yeast Saccharomyces cerevisiae
abundant protein comprising 25% of total is more suitable for production of recombinant
protein found in human milk. It is synthesized interferons than E.coli, since E.coli does not
by the mammary glands. α lactalbumin possess the machinery for glycosylation of
binds calcium and zinc ions and possesses proteins. Interferons are used for the treatment
bactericidal and anti tumour activities. of various diseases like cancer, AIDS, multiple
Improvement of the nutritional value sclerosis, hepatitis C and herpes zoster. In spite
of cow’s milk with transgenic expression of of the therapeutic applications interferons are
recombinant human alpha lactalbumin has not within the reach of the common man due to
been attempted. Healthy transgenic cows were high cost for its production.
produced by somatic nuclear transfer, in which
10.1.4 Recombinant Vaccines
expression of upto 1.55g/L of recombinant
Recombinant DNA technology has been
human alpha lactalbumin was achieved.
used to produce new generation vaccines. The
Similarly transgenic goats were also produced,
limitations of traditional vaccine production could
in which the expression of Human alpha
be overcome by this approach.
lactalbumin was about 0.1 to 0.9mg/mL.
The recombinant vaccines are generally of
Somatic cell nuclear transfer is a
uniform quality and produce less side effects as
technique for creating a viable embryo from
compared to the vaccines produced by conventional
a body cell and an egg cell. This technique is
methods. Different types of recombinant vaccines
discussed later in animal cloning.
include subunit recombinant vaccines, attenuated
In 1997, Rosie, the first recombinant vaccines and DNA vaccines.
transgenic cow produced Subunit recombinant vaccines
human protein enriched Vaccines that use components of a pathogenic
milk, which contained the organism rather than the whole organism are called
human alpha lactalbumin. The protein subunit vaccines; recombinant DNA technology
rich milk (2.4 gm/litre) was a nutritionally is very suited for developing new subunit vaccines.
balanced food for new born babies than It includes components like proteins, peptides and
the normal milk produced by the cows. DNAs of pathogenic organisms. The advantages of
these vaccines include their purity in preparation,
10.1.3 Interferons stability and safe use.
Interferons are proteinaceous, antiviral,
Attenuated recombinant vaccines
species specific substances produced by
This includes genetically modified
mammalian cells when infected with viruses.
pathogenic organisms (bacteria or viruses)
Interferons were discovered by Alick Isaacs and
that are made nonpathogenic and are used
Jean Lindemann in 1957. Based on the structure
as vaccines. It is now possible to genetically
of interferons they are classified as α, β and γ
engineer the organisms (bacteria or viruses) and
interferons. They stimulate the cellular DNA to
use them as live vaccines and such vaccines are
produce antiviral enzymes which inhibit viral
referred to as attenuated recombinant vaccines.
replication and protect the cells. Interferons
159 Applications of Biotechnology

www.tntextbooks.in
antigenic molecules which are displayed on its

Edible vaccines are prepared by molecular surfaces. This would evoke an antibody response
pharming using the science of genetic
engineering. Selected genes are introduced to the free floating antigen secreted by the cells.
into plants and the transgenic plants are The DNA vaccine cannot cause the disease as it
induced to manufacture the encoded protein. contains only copies of a few of its genes. DNA
Edible vaccines are mucosal targeted vaccines vaccines are relatively easy and inexpensive to
which cause stimulation of both systemic and
mucosal immune response. At present edible design and produce.
vaccines are produced for human and animal Vaccines produced by these new techniques
diseases like measles, cholera, foot and mouth have definite advantages like producing target
disease and hepatitis.
proteins, long lasting immunity and trigger
immune response only against specific pathogens
DNA Vaccines
with less toxic effects.
Genetic immunisation by using DNA vaccines
is a novel approach that came into being in 1990. Recombinant hepatitis B vaccine is a
The immune response of the body is stimulated subunit vaccine. It is produced by combining
by a DNA molecule. A DNA vaccine consists of a Hb (Hepatitis B Virus) antigen producing gene
gene encoding an antigenic protein, inserted onto in a plasmid DNA obtained from a bacteria. The
a plasmid, and then incorporated into the cells in resultant recombinant DNA is cloned in the yeast,
a target animal. DNA instructs the cells to make Saccharomyces cerevisiae (Fig. 10.2).
The recombinant vaccine for hepatitis B (HbsAg) was the first synthetic vaccine launched in 1997
which was marketed by trade names Recombivax and Engerix-B. India is the fourth country in the
world after USA, France and Belgium to develop an indigenous hepatitis B vaccine.
DNA
HB
Recombinant vaccine
Bacterium
Extraction &
Hepatitis B purification of
Virus HB antigen HB vaccine
producing
gene Recombinant yeast
Recombinant cell multiplying and
DNA producing HB antigen
in fermentation tank
Bacterial Plasmid DNA
DNA cut with restriction
enzymes Fermentation
Tank
Plasmid
DNA
Bacterium HB antigen
Fig. 10.2 Production of recombinant HB Vaccine


www.tntextbooks.in
10.2 Gene Therapy have no effective treatment and so gene therapy

If a person is born with a hereditary could offer hope for many people. There are
disease, can a corrective therapy be given two strategies involved in gene therapy namely;
for such disease? Yes, this can be done by a Gene augmentation therapy which involves
process known as gene therapy. This process insertion of DNA into the genome to replace
involves the transfer of a normal gene into a the missing gene product and Gene inhibition
person’s cells that carries one or more mutant therapy which involves insertion of the anti
alleles. Expression of normal gene in the sense gene which inhibits the expression of the
person results in a functional gene product dominant gene (Fig. 10.3).
whose action produces a normal phenotype. The two approaches to achieve gene therapy
Delivery of the normal gene is accomplished are somatic cell and germ line gene therapy.
by using a vector. The main thrust of gene Somatic cell therapy involves the insertion of
therapy has been directed at correcting a fully functional and expressible gene into a
single gene mutations as in cystic fibrosis and target somatic cell to correct a genetic disease
haemophilia. At present most genetic diseases permanently whereas Germline gene therapy
Table 10.1 Diffentiation between somatic cell gene therapy and germ line gene therapy
SOMATIC CELL GENE THERAPY GERM LINE GENE THERAPY
Therapeutic genes transferred into the somatic Therapeutic genes transferred into the germ
cells. cells.
Introduction of genes into bone marrow cells,
Genes introduced into eggs and sperms.
blood cells, skin cells etc.,
Will not be inherited in later generations. Heritable and passed on to later generations.
The first clinical gene therapy was given in 1990 by French Anderson to a four
year old girl with adenosine deaminase (ADA) deficiency. ADA deficiency or SCID
(Severe combined immunodeficiency) is an autosomal recessive metabolic disorder. It is
caused by the deletion or dysfunction of the gene coding for ADA enzyme. In these patients
the nonfunctioning T-Lymphocytes cannot elicit immune responses against invading
pathogens. The right approach for SCID treatment would be to give the patient a functioning
ADA which breaks down toxic biological products.
In some children ADA deficiency could be cured by bone marrow transplantation,
where defective immune cells could be replaced with healthy immune cells from a donor. In
some patients it can be treated by enzyme replacement therapy, in which functional ADA is
injected into the patient.
During gene therapy the lymphocytes from the blood of the patient are removed and
grown in a nutrient culture medium. A healthy and functional human gene, ADA cDNA
encoding this enzyme is introduced into the lymphocytes using a retrovirus. The genetically
engineered lymphocytes are subsequently returned to the patient. Since these cells are not
immortal, the patient requires periodic infusion of such genetically engineered lymphocytes.
The disease could be cured permanently if the gene for ADA isolated from bone marrow cells
are introduced into the cells of the early embryonic stages.

www.tntextbooks.in
Bacterium carrying
plasmid with cloned normal Genetically disabled
human ADA gene retrovirus
Cloned ADA gene is

T cells
incorporated into virus
with disabled ADA gene
isolated from SCID patient Genetically altered
cells are reimplanted to
produce ADA
Retrovirus infects
T cells, transfer
ADA gene to cells
Cells are grown
in culture to
ensure ADA gene
is active
Fig. 10.3 Process of gene therapy

involves the introduction of DNA into germ cells differentiate into all types of cells that are
which is passed on to the successive generations. derived from any of the three germ layers
Gene therapy involves isolation of a specific ectoderm, endoderm and mesoderm.
gene and making its copies and inserting them In mammals there are two main types
into target cells to make the desired proteins. of stem cells – Embryonic Stem Cells (ES
It is absolutely essential for gene therapists to Cells) and adult stem cells. ES Cells are both
ensure that the gene is harmless to the patient pluripotent (can produce the three primary
and it is appropriately expressed and that the germ layers ectoderm, mesoderm and
body’s immune system does not react to the endoderm) and multipotent (can differentiate
foreign proteins produced by the new genes. into a number of types of cells) (Fig. 10.4).
10.3 Stem Cell Therapy ES cells are isolated from the epiblast tissue
Stem cells are undifferentiated cells of the inner cell mass of a blastocyst. When
found in most of the multi cellular animals. stimulated, ES Cells can develop into more
These cells maintain their undifferentiated than 200 cells types of the adult body.
state even after undergoing numerous mitotic ES Cells are immortal i.e., they can proliferate
divisions. in a sterile culture medium and maintain their
undifferentiated state.
Stem cell research has the potential to
revolutionize the future of medicine with the Adult stem cells are found in various tissues
ability to regenerate damaged and diseased of children as well as adults. An adult stem cell or
organs. Stem cells are capable of self renewal somatic stem cell can divide and create another
and exhibit ‘cellular potency’. Stem cells can cell similar to it. Most of the adult stem cells are

www.tntextbooks.in
multipotent and can act as a repair system of the they may be used for treatment in the future,
body, replenishing adult tissues. The red bone when required. Amniotic cell bank is a facility
marrow is a rich source of adult stem cells. that stores stem cells derived from amniotic
The most important and potential fluid for future use. Stem cells are stored in
application of human stem cells is the generation banks specifically for use by the individual
of cells and tissues that could be used for cell from whom such cells have been collected
based therapies. Human stem cells could be used and the banking costs are paid. Cord Blood
to test new drugs. Banking is the extraction of stem cells from
the umbilical cord during childbirth. While
Totipotency (Toti-total) is the ability
of a single cell to divide and produce all of the umbilical cord and cord blood are the most
the differentiated cells in an organism. popular sources of stem cells, the placenta,
Pluripotency (Pluri-several) refers to a amniotic sac and amniotic fluid are also rich
stem cell that has the potential to differentiate sources in terms of both quantity and quality.
into any of the three germ layers-ectoderm,
endoderm and mesoderm. 10.4 Molecular Diagnostics
Multipotency (multi-Many) refers Early diagnosis of infectious diseases
to the stem cells that can differentiate into or inherent genetic defects is essential for
various types of cells that are related. For
appropriate treatment. Early detection of the
example blood stem cells can differentiate
into lymphocytes, monocytes , neutrophils disease is not possible using conventional
etc., diagnostic methods like microscopic
Oligopotency (Oligo-Few) refers to examinations, serum analysis and urine
stem cells that can differentiate into few cell analysis.These laboratory techniques are
types. For example lymphoid or myeloid indirect and not always specific. Scientists
stem cells can differentiate into B and T cells are continuously searching for specific,
but not RBC. sensitive and simple diagnostic techniques
Unipotency ( Uni- Single) refers to the for diagnosis of diseases. Recombinant DNA
ability of the stem cells to differentiate into
technology, Polymerase Chain Reactions
only one cell type.
(PCR) and Enzyme Linked Immunosorbent
Assay (ELISA) are some of the techniques
More that are reliable and help in early diagnosis.
Stem cell
Stem cell Presence of pathogens like virus, bacteria,
etc., is detected only when the pathogen
produces symptoms in the patient. By the
time the symptoms appear concentration
of pathogen becomes very high in the body.
Muscle cell Neuron However very low concentration of a bacteria
or a virus, even when the symptoms of the
disease does not appear, can be detected by
Red blood corpuscles amplification of their nucleic acid.
Fig. 10.4 Embryonic stem cells ELISA (Enzyme Linked Immunosorbent Assay)
ELISA is a biochemical procedure
Stem Cell Banks
discovered by Eva Engvall and Peter
Stem cell banking is the extraction, Perlmann (1971) to detect the presence of
processing and storage of stem cells, so that specific antibodies or antigens in a sample

www.tntextbooks.in
of serum, urine, etc., It is a very important and the substrate of the enzyme (hydrogen
diagnostic tool to determine if a person is peroxidase) is added with certain reagents
HIV positive or negative. ELISA is a tool for such as 4-chloronaphthol. The activity of the
determining serum antibody concentrations enzyme yields a coloured product indicating
(such as the antibodies produced in a person the presence of the antigen. The intensity
infected by pathogens such as HIV) and also of the colour is directly proportional to
for detecting the presence of specific antigens the amount of the antigen. ELISA is highly
and hormones such as human chorionic sensitive and can detect antigens in the range
gonadotropins. of a nanogram.
There are four kinds of ELISA namely,
Coating
Antigen is adsorbed onto the wells in
Direct ELISA, Indirect ELISA, sandwich
ELISA plate in coating buffer ELISA and competitive ELISA. It is a
highly sensitive and specific method used
Remove buffer and wash plate for diagnosis. ELISA possesses the added
Blocking advantages of not requiring radioisotopes or
A buffer containing unrelated protein is a radiation counting apparatus.
used to block free sites in the wells
PCR (Polymerase Chain Reaction)
Remove buffer and wash plate The polymerase chain reaction (PCR)
Detection is an invitro amplification technique
Enzyme conjugated detection antibody used for synthesising multiple identical
binds antigen
copies (billions) of DNA of interest. The
technique was developed by Kary Mullis
Remove buffer and wash plate
(Nobel laureate, 1993) in the year 1983.
Readout Denaturation, renaturation or
Substrate is catalyzed by the enzyme to
generate colored readout primer annealing and synthesis or primer
extension, are the three steps involved in
PCR (Fig. 10.6). The double stranded DNA
of interest is denatured to separate into two
individual strands by high temperature . This
is called denaturation. Each strand is allowed
to hybridize with a primer (renaturation or
primer annealing). The primer template is
used to synthesize DNA by using Taq – DNA
Fig. 10.5 Enzyme Linked Immuno polymerase (isolated from the bacterium
Sorbent Assay Thermus aquaticus).
During denaturation the reaction
During diagnosis the sample suspected
mixture is heated to 950 C for a short time to
to contain the antigen is immobilized on the
denature the target DNA into single strands
surface of an ELISA plate (Fig. 10.5). The
that will act as a template for DNA synthesis.
antibody specific to this antigen is added
Annealing is done by rapid cooling of the
and allowed to react with the immobilized
mixture, allowing the primers to bind to the
antigen. The anti-antibody is linked to an
sequences on each of the two strands flanking
appropriate enzyme like peroxidase. The
the target DNA. During primer extension or
unreacted anti-antibody is washed away

www.tntextbooks.in
synthesis the temperature of the mixture is identify them. The concept behind PCR based
increased to 750C for a sufficient period of diagnosis of infectious diseases is simple – if
time to allow Taq DNA polymerase to extend the pathogen is present in a clinical specimen
each primer by copying the single stranded its DNA will be present. Its DNA has unique
template. At the end of incubation both single sequences that can be detected by PCR, often
template strands will be made partially double using the clinical specimen (for example,
stranded. The new strand of each double blood, stool, spinal fluid, or sputum) in the
stranded DNA extends to a variable distance PCR mixture. PCR is also employed in the
downstream. These steps are repeated again prenatal diagnosis of inherited diseases by
and again to generate multiple forms of the using chorionic villi samples or cells from
desired DNA. This process is also called DNA amniocentesis. Diseases like sickle cell
amplification. anemia, β-thalassemia and phenylketonuria
The PCR technique can also be used can be detected by PCR in these samples. cDNA
for amplifications of RNA in which case from PCR is a valuable tool for diagnosis and
it is referred to as reverse transcription monitoring retroviral infections e.g., Corona
PCR (RT-PCR). In this process the RNA Virus (SARS - CoV-2).
molecules (mRNA) must be converted to Several virally induced cancers, like
complementary DNA by the enzyme reverse cervical cancer caused by Papilloma virus
transcriptase. The cDNA then serves as the can be detected by PCR. Sex of human beings
template for PCR. and live stocks, embryos fertilized invitro can
PCR In Clinical Diagnosis be determined by PCR by using primers and
The specificity and sensitivity of PCR is DNA probes specific for sex chromosomes.
useful for the diagnosis of inherited disorders PCR technique is also used to detect sex-
(genetic diseases), viral diseases, bacterial linked disorders in fertilized embryos.
diseases, etc., The diagnosis and treatment of
a particular disease often requires identifying Applications of PCR
a particular pathogen. Traditional methods The differences in the genomes of
of identification involve culturing these two different organisms can be studied by
organisms from clinical specimens and PCR. PCR is very important in the study of
performing metabolic and other tests to evolutions, more specifically phylogenetics.
5’ 3’
3’ 5’
5’ 3’
Nucleotide
5’ 3’
5’ 3’ Denaturation Annealing Extension

3’ 5’
3’ 5’
DNA primer 3’ 5’
Original
DNA
5’ 3’
3’ 5’
Fig. 10.6 Steps involved in PCR

www.tntextbooks.in
As a technique which can amplify even expression of foreign gene in transgenic

minute quantities of DNA from any source, tissue or animals. Transgenic animals such
like hair, mummified tissues, bones or any as mice, rat, rabbit, pig, cow, goat, sheep
fossilized materials. and fish have been produced (Fig. 10.7).
PCR technique can also be used in the
field of forensic medicine . A single molecule
of DNA from blood stains, hair, semen of
an individual is adequate for amplification
by PCR. The amplified DNA is used to Human
E
Egg
develop DNA fingerprint which is used as an gene
donor
important tool in forensic science.Thus, PCR
Egg
is very useful for identification of criminals.
PCR is also used in amplification of specific Micro injection of
DNA segment to be used in gene therapy. human gene
10.5 Transgenic Animals

In early days selective breeding
methods were carried out to improve the
genetic characteristics of live stock and
other domestic animals. With the advent of Development
modern biotechnology it is possible to carry within a host goat
out manipulations at the genetic level to get

the desired traits in animals. Transgenesis
is the process of introduction of extra Transgenic
goat
(foreign/exogenous) DNA into the genome
Milk from
of the animals to create and maintain stable transgenic goat
heritable characters. The foreign DNA Fig. 10. 7 Production of transgenic
that is introduced is called the transgene animals
and the animals that are produced by DNA
Uses Of Transgenesis
manipulations are called transgenic animals
or the genetically engineered or genetically • Transgenesis is a powerful tool to study
modified organisms. gene expression and developmental
processes in higher organisms.
The various steps involved in the
production of transgenic organisms are • Transgenesis helps in the improvement of
genetic characters in animals. Transgenic
• Identification and separation of desired
animals serve as good models for
gene.
understanding human diseases which
• S election of a vector (generally a virus) or help in the investigation of new treatments
direct transmission. for diseases. Transgenic models exist for
• Combining the desired gene with the vector. many human diseases such as cancer,
• Introduction of transferred vector Alzheimer’s, cystic fibrosis, rheumatoid
into cells, tissues, embryo or mature arthritis and sickle cell anemia.
individual.
•
Demonstration of integration and

www.tntextbooks.in
• Transgenic animals are used to produce and these can be produced using transgenic
proteins which are important for medical animals as bioreactors. Monoclonal antibodies,
and pharmaceutical applications. which are used to treat cancer, heart disease
• Transgenic mice are used for testing the and transplant rejection are produced by this
safety of vaccines. technology. Natural protein adhesives are
non toxic, biodegradable and rarely trigger
• Transgenic animals are used for testing
an immune response, hence could be used
toxicity in animals that carry genes which
to reattach tendons and tissues, fill cavities in
make them sensitive to toxic substances
teeth, and repair broken bones.
than non-transgenic animals exposed
to toxic substances and their effects are 10.7 Animal Cloning
studied. Cloning is the process of producing
• Transgenesis is important for improving genetically identical individuals of an organism
the quality and quantity of milk, meat, either naturally or artificially. In nature many
eggs and wool production in addition to organisms produce clones through asexual
testing drug resistance. reproduction.
10.6 Biological products and their Cloning in biotechnology refers to the
uses process of creating copies of organisms or copies
A biological product is a substance of cells or DNA fragments (molecular cloning).
derived from a living organism and used for Dolly was the first mammal (Sheep)
the prevention or treatment of disease. These clone developed by Ian Wilmut and Campbell
products include antitoxins, bacterial and in 1997. Dolly, the transgenic clone was
viral vaccines, blood products and hormone developed by the nuclear transfer technique
extracts. These products may be produced and the phenomenon of totipotency.
through biotechnology in a living system, such Totipotency refers to the potential of a cell
as a microorganism, plant cell or animal cell, to develop different cells, tissues, organs and
and are often more difficult to characterize than finally an organism.
small molecule drugs. Through recombinant
DNA technology it is possible to produce these The mammary gland udder cells
biological products on demand. There are (somatic cells) from a donor sheep (ewe) were
many types of biological products approved isolated and subjected to starvation for 5 days.
for use -they are, therapeutic proteins, The udder cells could not undergo normal
monoclonal antibodies and vaccines. Health growth cycle, entered a dormant stage and
care and pharmaceutical industries have been became totipotent. An ovum (egg cell) was
revolutionised by biotechnological proteins. taken from another sheep (ewe) and its nucleus
Hormones and antibodies are produced was removed to form an enucleated ovum. The
commercially, primarily for the medical dormant mammary gland cell/udder cell and
industry. Recombinant hormones like Insulin, the enucleated ovum were fused. The outer
Human growth hormone, Recombinant membrane of the mammary cell was ruptured
vaccines and recombinant proteins like human allowing the ovum to envelope the nucleus.
alpha lactalbumin are available today. The fused cell was implanted into another
ewe which served as a surrogate mother. Five
Animals are used as bioreactors to produce months later dolly was born. Dolly was the
desirable proteins. Antibodies are substances first animal to be cloned from a differentiated
that react against the disease causing antigens

www.tntextbooks.in
somatic cell taken from an adult animal • It can cause animals to suffer.
without the process of fertilization (Fig. 10.8). •
Reports show that animal surrogates were
manifesting adverse outcomes and cloned
animals were affected with disease and have
high mortality rate.
Udder cell Egg from B • It might compromise human health through
from A
consumption of cloned animal meat.
Nucleus •
Cloned animals age faster than normal
Nucleus
Remove animals and are less healthy than the parent
nucleus from
Fuse cells egg organism as discovered in Dolly.
• Cloning can lead to occurrence of genetic
disorders in animals.
• More than 90% of cloning attempts fail to
produce a viable offspring.
Culture in
oviduct tissue Ian Wilmut and Campbell
removed 277 cells from
Implant 6 day old the udder of an adult
embryo in surrogate
sheep and fused those
cells with 277 unfertilised
Blastocyst egg cells from which the nuclear material
was removed. After culturing the resulting
embryos for 6 days , they implanted 29
embryos into the surrogate mother's womb
and only one Dolly was produced.
Dolly
A gene ‘knock out’ is a genetically
Fig. 10. 8 Cloning of dolly engineered organism that carries one or
Advantages and Disadvantages Of Cloning more genes in its chromosomes that have
Animals been made inoperative.
• Offers benefits for clinical trials and medical

research. It can help in the production of 10.8 Ethical Issues
proteins and drugs in the field of medicine. Biotechnology has given to the society cheap
• Aids stem cell research. drugs, better friuts and vegetables, pest resistant
• Animal cloning could help to save endangered crops, indigenious cure to diseases and lot of
species. controversy. This is mainly because the major
part of the modern biotechnology deals with
• Animal and human activists see it as a threat
genetic manipulations. People fear that these
to biodiversity saying that this alters evolution
genetic manipulations may lead to unknown
which will have an impact on populations and
consequences. The major apprehension
the ecosystem.
of recombinant DNA technology is that
• The process is tedious and very expensive.
unique microorganisms either inadvertently

www.tntextbooks.in
or deliberately for the purpose of war may responsible for the local implementation of
be developed that could cause epidemics or guidelines; Review Committee on Genetic
environmental catastrophies. Although many Manipulation (RCGM) is responsible
are concerned about the possible risk of genetic for issuing permits and the GEAC is
engineering, the risks are in fact slight and the responsible for monitoring the large scale
potential benefits are substantial. and commercial use of transgenic materials.
10.9 Regulations in Biotechnology The biotechnology industry is governed

by different enactments depending on their
Regulations apply to the production, sale relevance / applicability on a case to case
and use of biotech products and genetically basis. “Recombinant DNA safety guidelines,
modified organisms. GMOs are carefully 1990” were released by the Department of
tested and documented before the products are Biotechnology (DBT) which cover areas of
available. GMOs should be labelled and used research involving genetically engineered
according to instructions. These regulations are organisms and these guidelines were
designed to protect the people, living organisms further revised in 1994.
and the environment. The Biotechnology
Regulatory Authority of India (BRAI) is a RCGM under the DBT comprises
proposed regulatory body in India for uses of representatives of DBT, Indian Council
biotechnology products including GMOs. The for Medical Research, Indian Council for
Genetic Engineering Approval Committee Agricultural research and Council for Scientific
(GEAC), a body under the Ministry of and Industrial Research.
Environment, forests and climate change
Industrial licensing under the Industrial
(India) is responsible for approval of
(Development and Regulation) Act, 1951 is
genetically engineered products in India. If
compulsory for bulk drugs produced by the
the bill is passed the responsibility will be
use of recombinant DNA technology.
taken over by the Environmental Appraisal
Panel, a subdivision of the BRAI. The bill Being a signatory to the Trade Related
also proposes setting up an inter ministerial Intellectual Property Rights (TRIPS)
governing body to oversee the performance Agreement of WTO, India has amended its
of BRAI and a National Biotechnology legislations pertaining to intellectual property
Advisory Council of stakeholders to through various legislations including Patents
provide feedback on the use of, import and (Amendment) Act, 1999.
manufacture of biotechnology products and
organisms in the society. The regulatory 1. The Recombinant DNA Advisory Advisory
body is an autonomous and statutory Committee (RDAC)
agency to regulate the research, transport, 2. Institutional Biosafety Committee

import and manufacture of biotechnology (IBSC)
products and organisms. 3. Review Committee on Genetic Approval

Manipulation (RCGM)
GEAC is assisted by the State 4. Genetic Engineering Approval
Biotechnology Co-ordination Committee Committee (GEAC)
(SBCC) and District Level committee (DLC). 5. State Biotechnology Coordination
The most important committees are The Committee (SBCC) Monitoring
Institutional Biosafety Committee (IBSC), 6. District Level Committee (DLC)

www.tntextbooks.in
The possible risks of GMOs

Biopiracy can be defined as “the
use of bioresources by multinational Creating new or more vigorous pests and
companies and other organisations pathogens. Worsening the effects of existing
without proper authorization from the pests through hybridization with related
countries and the people concerned transgenic organisms (Table 10.2).
without compensatory payment”. • Harming non-target species such as soil
Bioethics is the study of the ethical organisms, non-pest insects, birds and
issues emerging from the advances in other animals.
Biology and medicine. It is also a moral • Disrupting biotic communities including
discernment as it relates to the medical agro ecosystems.
policy and practice. • Irreparable loss or changes in species
diversity or genetic diversity within species.
10.10 Possible threats of Genetically • Creating risks for human health.
Modified Organisms The release of GMOs into the environment
Genetically Modified Organisms (GMOs) could also have far reaching consequences. This
also called Genetically Engineered organisms is because the living GMOs proliferate, persist,
(GEOs) are created to play a role in agriculture, disperse and sometimes may transfer their DNA
forestry, aquaculture, bioremediation and into other organisms. GEOs could also displace
environmental management in developed and the existing organism and create new species
developing countries. However, deliberate which may cause severe environmental damage.
or inadvertent release of GMOs into the Due to these risks the regulatory authorities
environment could have negative ecological are very careful in permitting the field trials of
effects under certain circumstances. GMOs into the environment.
Table 10.2. Risks of GMOs
Environmental Health Agricultural
Proteins transcribed and
Toxins in pest-resistant translated from transferred
GMOs could negatively genes could cause allergic GMOs with pest toxins could increase
impact non-target reactions in humans or evolution of resistance in certain pest
organisms and harm other animals – currently populations.
ecosystems. GM foods are not properly
labelled.
Cross-species pollination Antibiotic resistance genes

could spread herbicide used as markers during Big biotech companies hold monopolistic
resistance genes and gene transfer could spread legal rights (patents) over GM seeds.
create 'super-weeds'. to pathogenic bacteria.
Biodiversity could be
negatively affected by Transferred genes GMOs do present two major
destruction of pests, could mutate and cause agricultural problems in the forms of
weeds, and even unexpected risks. pesticide- and herbicide-resistance.
competing plants.

www.tntextbooks.in
10.11 Biosafety Guidelines in return for disclosing the knowledge to the

others who may use the knowledge to develop
Due to the growing concerns arising from
further inventions and innovations.
Genetically Modified Organisms (GMOs)
throughout the globe the WHO has built an The laws are formulated from time to
informal working group on biosafety in 1991. time at national and international levels.
This group prepared the ‘voluntary code for Development of new crop varieties is also an
the release of organisms into the environment’. intellectual property right. It is protected by
ICGEB (International Centre for Genetic ‘plant breeders rights’ (PBRs). PBRs recognize
Engineering and Biotechnology) has played a the fact that farmers and rural communities
significant role in issues related to biosafety have contributed to the creation, conservation,
and the environmentally sustainable use of exchange and knowledge of genetic and
biotechnology. The main ‘topic of concern’ species utilization of genetic diversity. IPR
related to the release of GMO’s are risks for and IPP are granted by the Government to
human health, environment, and agriculture plant breeders for producing a specific plant
which is found on the website of ICGEB. variety that is new and never existed before.
In India, DBT has evolved ‘rDNA safety IPR is protected by different ways like
guidelines’ to exercise powers conferred patents, copyrights and trade marks.
through the Environmental Protection Act
1986 for the manufacture, use, import, export
Patents
and storage of hazardous micro organisms The science of biotechnology involves
and genetically engineered organisms, cells the production of enormous number of
etc., These guidelines are implemented and commercial products of economic importance.
monitored by the Institutional Biosafety The inventions include biotechnology
Committees (IBSCs), the Review Committee on products and processes. The products include
Genetic Manipulation (RCGM) and the Genetic living entities like micro organisms, animals,
Engineering Approval Committee (GEAC) of plants, cell lines, cell organelles, plasmids and
the Ministry of Environment and Forest. genes and naturally occurring products like
primary and secondary metabolites produced
Intellectual Property Rights (IPR) and by living systems e.g. alcohol, antibiotics.
Protection (IPP)
The physical objects like household Thomas Alva Edison was the only scientist in
goods or land or properties of a person and the world with more than 1000 patents to his
the ownership and rights on these properties credit.
is protected by certain laws operating in the
country. This type of physical property is The biotechnological processes
tangible; but the transformed microorganisms, involve isolation, purification, cultivation,
plants, animals and technologies for the bioconversion of novel, innovative, simple
production of commercial products are and cost effective processes, and creation of
exclusively the property of the intellectuals. The biotechnological products.
discoverer or inventor has complete rights on his
A patent is a Government issued document
property or invention. The rights of intellectuals
that allows the person for an exclusive right
are protected by laws framed by a country. The
to manufacture, use or sell an invention for a
intellectual property is an intangible asset. Legal
defined period (usually 20 years). It is a legal
rights or patents provide an inventor only a
document safeguarding the rights and privileges
temporary monopoly on the use of an invention,
of an inventor / invention. The purpose of

www.tntextbooks.in
patenting in biotechnology ensures fair financial Copyright

returns for those who have invested finances, The protection of authorships of published
ideas, time and hard work for an invention. work comes under copyrights of IPRs. Copyright
The following criteria must be satisfied for protection is given for form of expressions
patenting : of ideas. For example the authors, editors,
• The invention must be novel and useful; publishers or both the publisher/ editor of a book
have copyrights. The content of the book cannot
•
The product must be inventive and
be reproduced or reprinted without written
reproducible;
permission from copyright holders. Patents and
• The patent application should provide the
trade secrets provide protection for the basic
full description of the invention and the knowhow but copyright protects the expressed
invention must be patentable. materials in printed, video recorded or taped
The first living organism forms. In the field of biotechnology the data
that was patented was a base of DNA sequences or any published forms,
genetically engineered photomicrographs, etc., are subject to copyright.
species of bacteria - Trade marks
Pseudomonas putida in Any specific symbol or words to identify
1980 which was genetically engineered by a particular product or process of a company
Ananda Mohan Chakrabarty in 1971. constitute trademark. This enables the public
to distinguish between a trader’s goods from
General Agreement of Tariffs and similar goods of other traders
Trade (GATT) and trade related IPRs
Biotechnology as an independent
(TRIPs)
discipline has drawn world wide attention from
GATT was framed in 1948 by developed
the Governments and the corporate world
countries to settle dispute, among the countries
because of its limitless applications. It is looked
regarding share of world trade. The benefits of
upon as a panacea for treating diseases and
GATT was enjoyed only by developed countries.
genetic disorders. The global demand of the
In 1988 US congress enacted a law ‘the omnibus
biotechnological products is on the increase.
trade and competitiveness act’ (OTCA) which
It is the science for the future with solutions
gave powers to US to investigate the laws related
to many of the problems related to health,
to trade.
agriculture, environment and industries.
Geographical indication (GI)
A geographical indication is a name or Summary
sign used on products which correspond to Biotechnology is defined as “any
a specific geographical origin and possess technological application that uses biological
qualities or a reputation that are due to that systems, living organisms or derivatives
origin. Geographical indications are typically thereof, to make or modify products or
used for agricultural products, food products, processes for specific use”. In 1919, Hungarian
handicrafts and industrial products. Darjeeling agricultural engineer Karl Ereky coined the
tea was the first GI tagged product in India in term Biotechnology. Biotechnology includes
2004-05. In Tamilnadu, Kancheepuram silk, two major technologies, Genetic engineering
and Chemical engineering.
Coimbatore wetgrinder, Thanjavur paintings,
Madurai Malli, Thirunelveli Halwa and Temple Biotechnology has application in four
jewellery of Nagercoil are GI tagged. major industrial areas, including health
care (medical) agriculture, industrial and

www.tntextbooks.in
environment.Biotechnology techniques are Evaluation

used in the field of medicine for diagnosis, 1. T
he first clinical gene therapy was done for
prevention and treatment of different diseases.
the treatment of
Production of recombinant hormones,
a) AIDS
recombinant clotting factor VIII and
b) Cancer
recombinant interferons have helped in the
treatment of diseases. Recombinant vaccines c) Cystic fibrosis
have been used to prevent various diseases. d) SCID
The recombinant vaccines are of three types- 2. Dolly, the sheep was
subunit recombinant vaccines, attenuated obtained by a technique known as
recombinant vaccines and gene recombinant a) Cloning by gene transfer
vaccines. b) Cloning without the help of gametes
Genetic defects could be corrected by a c) Cloning by tissue culture of somatic cells
process called Gene therapy. It is of two types d) Cloning by nuclear transfer
somatic cell gene therapy and germline gene 3. The genetic defect adenosine deaminase
therapy. deficiency may be cured permanently by
Stem cells are undifferentiated cells found a) Enzyme replacement therapy
in multicellular organisms. These cells are of b) Periodic infusion of genetically engineered
two types -Embryonic stem cells and adult stem lymphocytes having ADA cDNA
cells. Stem cells have the ability to regenerate c) Administering adenosine deaminase
damaged and diseased organs. Recombinant activators
DNA technology, Polymerase chain reaction d) Introducing bone marrow cells
and Enzyme Linked Immunosorbent Assay are producing ADA into embryo at an
techniques that are reliable and help in early
early stage of development
diagnosis.
4. H
ow many amino acids are arranged in the
Transgenesis is the process of introduction
two chains of Insulin?
of a foreign gene into the genome of animals to
a) Chain A has 12 and Chain B has 13
create and maintain stable heritable characters.
b) Chain A has 21 and Chain B has 30 amino
A biological product is a substance
acids
derived from a living organism and used for
c) Chain A has 20 and chain B has 30 amino
the prevention or treatment of diseases.
acids
Cloning is the process of producing
d) Chain A has 12 and chain B has 20 amino
genetically identical individuals of an organism
acids.
either naturally or artificially.
5. P CR proceeds in three distinct steps governed
Advances in Biotechnology and their
by temperature, they are in order of
applications are most frequently associated
with controversies, ethical issues and concerns. a) Denaturation, Annealing, Synthesis
Statutory bodies are constituted to monitor b) Synthesis, Annealing, Denaturation
and approve the biotechnological processes c) Annealing, Synthesis, Denaturation
and products. d) Denaturation, Synthesis, Annealing
Genetically modified organisms can play 6. Which one of the following statements is true
a positive role in sustainable agriculture, regarding DNA polymerase used in PCR?
forestry, aquaculture, bioremediation and a) It is used to ligate introduced DNA in
environmental management in developed and recipient cells
developing countries. Biosafety guidelines b) It serves as a selectable marker
have been formulated by many countries for c) It is isolated from a Virus
DNA recombinant manipulations. d) It remains active at a high temperature

www.tntextbooks.in
7. ELISA is mainly used for into the individual. By this the function
a) Detection of mutations can be restored. An alternate method
b) Detection of pathogens would be to provide gene product known
c) Selecting animals having desired traits as enzyme replacement therapy, which
d) Selecting plants having desired traits would also restore the function. Which
8. Transgenic animals are those which have in your opinion is a better option? Give
a) Foreign DNA in some of their cells reasons for your answer.
b) Foreign DNA in all their cells 18. W
hat are transgenic animals? Give
c) Foreign RNA in some of their cells examples.
d) Foreign RNA in all their cells 19. If a person thinks he is infected with HIV,
9. Vaccines that use components of a due to unprotected sex, and goes for a blood
pathogenic organism rather than the whole test. Do you think a test such as ELISA will
organism are called help? If so why? If not, why?
a) Subunit recombinant vaccines 20. Explain how ADA deficiency can be
b) attenuated recombinant vaccines corrected?
c) DNA vaccines 21. What are DNA vaccines?
d) conventional vaccines
22. Differentiate between Somatic cell gene
10. GEAC stands for therapy and germline gene therapy.
a) Genome Engineering Action Committee
23. What are stem cells? Explain its role in the
b) Ground Environment Action Committee
field of medicine.
c) Genetic Engineering Approval Committee
d) Genetic and Environment Approval 24. One of the applications of biotechnology is
Committee ‘gene therapy” to treat a person born with a
hereditary disease.
11. Mention the number of primers required in
each cycle of PCR. Write the role of primers i) What does “gene therapy” mean?
and DNA polymerase in PCR. Name the ii) Name
the hereditary disease for which
source organism of the DNA polymerase the first clinical gene therapy was used.
used in PCR.
iii)
Mention the steps involved in gene
12. How is the amplification of a gene sample of
therapy to treat this disease.
interest carried out using PCR?
13. W hat is genetically engineered Insulin? 25. PCR is a useful tool for early diagnosis of an
Infectious disease. Elaborate.
14. Explain how “Rosie” is different from a
normal cow. 26. What are recombinant vaccines?. Explain
15. How was Insulin obtained before the the types.
advent of rDNA technology? What were the 27. Explain why cloning of Dolly, the sheep
problems encountered? was such a major scientific breakthrough?
16. ELISA is a technique based on the 28. Mention the advantages and disadvantages
principles of antigen-antibody reactions. of cloning.
Can this technique be used in the molecular
diagnosis of a genetic disorder such as 29. Explain how recombinant Insulin can be
Phenylketonuria? produced.
17. Gene therapy is an attempt to correct a 30. What are the possible risks of GMOs?
Genetic defect by providing a normal gene

www.tntextbooks.in
ICT CORNER
APPLICATIONS OF BIOTECHNOLOGY
A Transgenic fly. Come let us create

and use
Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “Click to enter
the lab” to begin.
Step -2: Click wherever the cursor symbol becomes as “Hand” symbol as that would lead for
the next step.
Step -3 Follow the instructions for all the six steps “Prepare DNA to Examine Light Output”.
Step – 4 : Explore the “Use Transgenic flies” a dialog box option found below the lab area to
know uses.
Step 4
Applications of Biotechnology URL:

http://media.hhmi.org/biointeractive/vlabs/transgenic_fly/index.html?_
ga=2.234689054.1812412497.1546851037-264360672.1545143882

*Allow flash player

www.tntextbooks.in
11
2
UNIT
UNIT--VI
Organisms
Reproductive
and
Populations
System
CHAPTER
Save nature – save our future

Chapter
Chapter Outline
Outline
11.1. Organism and its Environment
11.2. Habitat
T
11.3. Major Abiotic Components or Factors he word ‘ecology’ is derived from the
11.4. Concept of Biome and their Greek term ‘oikos’, meaning ‘house’ and
Distribution
logos, meaning ‘study’. Thus, the study of the
11.5. Responses to abiotic factors
environmental ‘house’ includes all the organisms
11.6. Adaptations
in it and all the functional processes that make
11.7. Populations
11.8. Population attributes the house habitable.
11.9. Population age distribution The study of ecology encompasses
11.10. Growth models / Curves different levels-organism, population,
11.11. Population regulation
community, ecosystem, etc., In ecology, the
11.12. Population interaction
term population, originally coined to denote
a group of people is broadened to include
Learning Objectives
groups of individuals of any one kind of
To gain knowledge / insight about: organism. Community in the ecological sense
➢➢ The local and geographical distribution (designated as ‘biotic community’) includes
- abundance of organisms.
all the populations occupying a given area.
➢➢ Temporal changes in the occurrence,
abundance and activities. The community (Biotic) and the non-living
➢➢ Interrelationship between environment (Abiotic) function together as
organism in population an ecological system (or) ecosystem. Biome
and communities. is a term in wide use for a large regional or
➢➢ Structural adaptation and sub continental system characterized by a
functional adjustment
major vegetation type. The largest and most
of organisms to their physical
environment. nearly self-sufficient biological system is often
➢➢ The evolutionary development of all designated as the Ecosphere, which includes all
these interrelations. the living organisms of the Earth, interacting
➢➢ Population growth, models, regulation. with the physical environment to regulate
➢➢ Animal associations – intraspecific, their distribution, abundance, production and
interspecific. evolution.
176

www.tntextbooks.in
11.1 Organism and its range of adaptations like fins (locomotion),

environment streamlined body (aerodynamic), lateral line
system (sensory), gills (respiration), air sacs
Every living organism has its own
(floatation) and kidneys (excretion).
specific surrounding, medium or environment
with which it continuously interacts and Niche (or) Ecological Niche
develops suitable adaptations for survival As every organism has its unique habitat,
there. Environment is a collective term which so also it has an ecological niche which includes
includes the different conditions in which an the physical space occupied by an organism
organism lives or is present. The common and and its functional role in the community.
influencing factors in any environment are light, The ecological niche of an organism not only
temperature, pressure, water, salinity. These are depends on where it lives but also includes the
collectively referred to as abiotic components. sum total of its environmental requirements.
Environments are variable and dynamic, in Charles Elton (1927) was the first to use
which temperature changes and light changes the term ‘niche’ as the functional status of an
are diurnal and seasonal. These influence the organism in its community. Groups of species
organisms inhabiting them. An organism’s with comparable role and niche dimensions
growth, distribution, number, behavior and within a community are termed ‘guilds’.
reproduction is determined by the different Species that occupy the same niche in different
factors present in the environment. geographical regions, are termed ‘ecological
equivalents’.
11.2 Habitat Many animals share the same general
Habitat refers to the place where an habitat. But their niches are well defined. The life
organism or a community of organisms live, style of an individual population in the habitat
including all biotic and abiotic factors or is known as its niche. For example, crickets
conditions of the surrounding environment. and grasshoppers are closely related insects
The collection of all the habitat areas of a species that live in the same habitat, yet they occupy
constitutes its geographical range. Organisms different ecological niches. The grasshopper is
in a habitat interact with each other and can be very active during daylight. It can usually be
part of trophic levels to form food chains and found on a plant, feeding on the plant parts.
food webs. Although the cricket lives in the same field, it
Examples: In a xerophytic habitat, the is quite different. During the day, the cricket
camel is able to use water efficiently and hides under leaves or plant debris and is usually
effectively for evaporative cooling through their inactive. It is active at night time (nocturnal).
skin and respiratory system. They excrete highly The cricket and the grasshopper do not interfere
concentrated urine and can also withstand with each other’s activities in the same habitat.
dehydration upto 25% of the body weight. The Thus, niche of an organism can be defined as
hoofs and hump are also suitable adaptations the total position and function of an individual
for survival in this dry sandy environment. in its environment.
In an aquatic media, maintaining In a pond ecosystem, where Catla, Rohu
homeostasis and osmotic balance is a and Mrigal are present, the ecological niche of
challenge. So, marine animals have appropriate the Catla is a surface feeder, Rohu is a column
adaptations to prevent cell shrinkage. While feeder and Mrigal is a bottom feeder. Their
freshwater organisms have suitable adaptations mouths are designed to suit their niche and
to withstand bursting of their cells. Apart hence have different positions and functions in
from this, organisms such as fish have a wide their habitat. (Fig.11.1)
177 Organisms and Populations

www.tntextbooks.in
6RODU The metabolism of organisms is regulated

UDGLDWLRQ
by enzymes which are temperature sensitive. In
many organisms, determination of sex and sex
3KRWRV\QWKHVLV
ratio, maturation of gonads, gametogenesis and
6XUIDFH
IHHGHU reproduction is influenced by temperature. In
&DWOD
LV
certain environments, the size and colouration
VLV
RUDXWRO\V
QGRUDXWRO\
3K\WRSODQNWRQ 0DFURSK\WHV
of animals are influenced by temperature. Birds
1XWULHQWV ([FUHWLRQDQG
([FUHWLRQD
and mammals attain greater body size in colder
&ROXPQ
IHHGHU5RKX
=RRSODQNWRQ
regions than warmer regions (Bergmann’s

rule). Warm blooded animals, living in colder
1XWULHQWV
%HQWKRV
%RWWRP
IHHGHU0ULJDO
climates, tend to have shorter limbs, ears and
0LFURELDOGHFRPSRVLWLRQ
other appendages when compared to the
Fig.11.1 Types of feeders (niche) in pond ecosystem members of the same species in warmer climates
(Allen’s rule). In some aquatic environments, an
inverse relationship between water temperature
11.3 Major Abiotic Components and fish meristic characters is observed -
or Factors lower the temperature, more the vertebrae
The abiotic factors include the chemical (Jordon’s rule).
and physical factors which influence or affect
Bergman's rule
organisms and their functioning in their Bergman's rule is an eco geographic principle
environment. The common abiotic factors are: that states that within broadly distributed
taxoncmic clade, populations and
Temperature species of larger size are found in
colder and of smaller
size are in warmer
Temperature or degree of hotness and regions.
coldness is an essential and variable factor in
any environment. It influences all forms of life
by affecting many vital activities of organisms
like metabolism, behaviour, reproduction,
development and even death in the Biosphere.
7KH$OOHQ5XOH
The minimum and maximum temperature of an )URPWKHQRUWKHUQDUFWLFKDUH/DUFWLFXVWKURXJKWKHPRUH
environment regulates the survival of a cell. VRXWKHUO\GHVHUWMDFNUDEELW/DOOHQLKDUHVVKRZSURJUHVVLYHO\
ORQJHUH[WUHPLWLHVOHJV HDUVDQGOHDQHUERGLHV
van’t Hoff ’s rule

van’t Hoff proposed that, with the
increase of every 10ºC, the rate of metabolic
D/HSXV E/DPHULFDQXV F/FDOLIRPLFXV G/DOOHQL
activity doubles or the reaction rate is DUFWLFXV
halved with the decrease of 10ºC. This rule

Temperature influences the distribution
is referred as the van’t Hoff ’s rule. The effect
of organisms. The tropics have higher diversity
of temperature on the rate of reaction is
expressed in terms of temperature coefficient and density of populations, when compared to
or Q10 value. The Q10 values are estimated temperate and polar regions.
taking the ratio between the rate of reaction Adaptations to temperature
at XºC and rate of reaction at (X-10ºC). In Adaptation to temperature is essential
the living system the Q10 value is about 2.0. for the survival of the species/organisms.
If the Q10 value is 2.0, it means 10ºC increase
Organisms which can survive a wide range of
and the rate of metabolism doubles.
temperature are referred to as Eurytherms
Organisms and Populations 178

www.tntextbooks.in
(cat, dog, tiger, human). Eurythermy can be calories) and duration (length of day) of light
an evolutionary advantage: adaptations to cold are considered significant for organisms.
temperatures (cold-eurythemy) are seen as Light influences growth, pigmentation,
essential for the survival of species during ice migration and reproduction. The
ages. In addition, the ability to survive in a intensity and frequency of light influences
wide range of temperatures increases a species' metabolic activity, induce gene mutations
ability to inhabit other areas, an advantage (UV, X- rays). Light is essential for vision. This
for natural selection. Eurythermy is an aspect of is proved by the poorly developed or absence
thermoregulation in organisms. of eyes in cave dwelling organisms. Diapause is
Those organisms which can tolerate only a also influenced by light in animals. Gonads of
narrow range of temperature are Stenotherms birds become more active with increasing light
(Fish, Frogs, Lizards and Snakes). in summer. Light influences the locomotion
Over the course of time, by evolution, and movement of lower animals.
animals of different ecological habitats have Phototaxis: The movement of organism
developed different variations and adaptations
in response to light, either towards the source
to temperature changes. It enabled them to
of light as in Moths (positive phototaxis) or
survive in different habitats and develop niches.
away from light (Euglena, Volvox, earthworm
In case of extreme temperatures, organisms have
adapted by forming heat resistant spores, cysts (negative phototaxis).
(Entamoeba), antifreeze proteins (Arctic fishes). Phototropism: The growth or orientation
Hibernation (winter sleep) and Aestivation of an organism in response to light, either
(summer sleep) are useful adaptations to towards the source of light (positive
overcome extreme winters and summers. In phototropism) as seen in Sunflower, or a way
certain conditions, migration is an appropriate from light (negative phototropism) as in case
adaptation to overcome extreme temperatures of the root of plants.
and resultant water and food scarcity. (Fig 11.2).
Photokinesis: A change in the speed
Light of locomotion (or frequency of turning) in
It is an important and essential abiotic a motile organism or cell which is made in
factor. Ecologically, the quality (wavelength or response to a change in light intensity is called
colour), the intensity (actual energy in gram Photokinesis. It involves undirected random
movement in response to light.
6WHQRWKHUPDO 6WHQRWKHUPDO
ROLJRWKHUPDO (XU\WKHUPDO SRO\WKHUPDO
2SWLPXP
$FWLYLW\
2SWLPXP 2SWLPXP
0LQLPXP 0D[LPXP 0LQLPXP 0D[LPXP
7HPSHUDWXUH
Fig. 11.2 Types of Organisms based on temperature tolerance

www.tntextbooks.in
Water • Water has high surface tension. This allows

Life on earth began in the seas and water pollen, dust, and even water striders to
is essential for the survival of all forms of life. remain at the surface of a water body even
About three-fourth of the earth’s surface is though they are denser than the water.
covered with water (hydrosphere). Water is Û&
Û&
found in three states: gaseous, liquid, and solid. ,&(
Û&
There are two types of water on Earth. Û& :DWHU
They are the Fresh water (rivers, lakes, ponds) Û&
and the Salt water (seas and oceans). Based on Û&

Û&
the dissolved salts, water can be hard water
(sulphates/nitrates of Calcium/Magnesium)
or soft water. If hardness can be removed by Fig. 11.3 Thermal zones in cold water bodies
boiling, it is temporary hard water, and if boiling
Soil
does not help, it is permanent hard water.
It is a mixture of organic matter, minerals,
Essential properties of water gases, liquids and organisms that together
•• Water is one of the main agents in support life. The soil zone is known as
Pedogenesis (soil formation). Pedosphere. Soil is formed from rocks which
•• It is the medium for several different are the parent materials of soil, by weathering
ecosystems. and is called embryonic soil (Pedogenesis).
•• It is present as moisture in the atmosphere It has four major functions-
and the outer layers of the lithosphere and is •• medium for plant growth
uneven in distribution on the earth. •• means for water storage and purification
•• Water is heavier than air and imparts greater •• modifier of earth’s atmosphere
buoyancy to the aquatic medium. This •• habitat for many organisms, which in turn
enables organism to float at variable levels. modify the soil
•• Water has high heat capacity and latent heat, Soil is formed of many horizontal layers called
due to which it can withhold large amounts as Soil Profile.
of heat. Thus, oceans and lakes tend to Properties of Soil
maintain a relatively constant temperature,
1. Texture of soil – The texture of soil is
and the biosphere is relatively thermostable.
determined by the size of the soil particles.
•• Water is physically unique because it is less The types of soil include sand, silt and clay
dense as a solid (ice) than as a liquid. on the basis of their size differences.
•• When water freezes (0⁰C), it contracts. The 2. Porosity – The space present between soil
maximum density of liquid water occurs at particles in a given volume of soil are called
4ºC. Below that, it expands markedly. This pore spaces. The percentage of soil volume
enables ice to float on the top of water bodies. occupied by pore space or by the interstitial
Hence, only the surface of water bodies will spaces is called porosity of the soil.
freeze, while below the surface, water will be 3. Permeability of soil-The characteristic
in liquid form, sustaining life (Fig. 11.3). of soil that determines the movement of
• Water is considered as the Universal solvent. water through pore spaces is known as soil
It is the main medium by which chemical permeability. Soil permeability is directly
dependent on the pore size. Water holding
constituents are transported from abiotic
capacity of the soil is inversely dependent
components to the living components of an
on soil porosity.
ecosystem.

www.tntextbooks.in
4. Soil Temperature-Soil gets its heat energy temperature and density of oxygen decreases.
from solar radiation, decomposing organic Higher altitudes usually receive snow instead of
matter, and heat from the interior of earth. rain because of low temperature.
Soil temperature effects the germination Animals are known to modify their
of seeds, growth of roots and biological response to environmental changes (stress) in
activity of soil-inhabiting micro-and macro- reasonably short time spans. This is known as
organisms. Acclimatization. This is observed when people
5. Soil water- In soil, water is not only important who have moved from the plains to higher
as a solvent and transporting agent, but also altitudes show enhanced RBC count within a
maintains soil texture, arrangement and few days of settling in their new habitat. This
compactness of soil particles, making soil helps them cope with lower atmospheric oxygen
habitable for plants and animals. and higher oxygen demand.
Wind 11.4 Concept of biome and their
Wind is the natural movement of air of any distribution
velocity from a particular direction. The two Biomes are large regions of earth that
main causes are differential heating between have similar or common vegetation and
the equator and the poles and the rotation climatic conditions. They play a crucial role
of the planet (Coriolis effect). Wind helps to in sustaining life on Earth. They are defined
transport pollen grains, seeds, and even flight by their soil, climate, flora and fauna. Biomes
of birds. While it is the source of wind energy, have distinct biological communities that
it also causes erosion. Wind speed is measured have been formed in response to a shared
with an Anemometer. physio-chemical climate. Biomes are seen to
even spread across continents. Thus, it can be
Humidity observed that a biome is a broader term than
Moisture in the form of invisible vapor habitat. Any biome can comprise a variety of
in the atmosphere is called humidity. which habitats. Factors such as temperature, light,
is generally expressed in terms of absolute water availability determine what type of
humidity, relative humidity or specific humidity. organisms and adaptations are observed in a
Absolute humidity is the total mass of water biome (Fig. 11.4).
vapour present in a given volume or mass of air. Characters of a Biome
It does not take temperature into consideration. •• Location, Geographical position (Latitude,
Relative humidity is the amount of water Longitude)
vapour present in air and is expressed as a •• Climate and physiochemical environment
percentage of the amount needed for saturation •• Predominant plant and animal life
at the same temperature Relative humidity is
•• Boundaries between biomes are not always
expressed as a percentage; a high percentage sharply defined. Transition or transient
means that the air-water mixture is more zones are seen as in case of grassland and
humid at a given temperature. Humidity is forest biomes. (Fig. 11.5)
measured with a Hygrometer.
Aquatic Biomes
Altitude
They occupy about 71% of the biosphere.
This factor is mainly the elevation or gradient The aquatic biome is home to millions of aquatic
and it affects temperature and precipitation in organisms like fishes. The climate of coastal
an ecosystem or biome. As altitude increases, zones are influenced by aquatic bodies.

www.tntextbooks.in
Tropical Rain Forest

Temperate Forest
Desert
Tundra
Taiga (Boreal forest)
Grassland
Savana / Tropical Grassland
Freshwater
Marine
Ice
Fig. 11.4 Biomes and their geographical distribution
rainforest, and deciduous and coniferous

$UFWLF forests. Terrestrial biomes are distinguished
OG
&R
primarily by their predominant vegetation,

7XQGUD
and are mainly determined by climate, which
H
in turn, determines the organisms inhabiting

WXU
6XEDUFWLF
HUD
them. These include the keystone species and

PS
7DLJD
WH
indicator species which are unique to their

LQJ
DV
7HPSHUDWH
respective biomes. The terrestrial biomes are a
FUH
7HPSHUDWH 7HPSHUDWH
'H
IRUHVW JUDVVODQG 'HVHUW source of food, O2 and act as CO2 sink, apart
7URSLFDO
from the climate regulatory role.
W
+R
5DLQIRUHVW 6DYDQQD 'HVHUW Major Biomes of the Earth

:HW 'U\
'HFUHDVLQJPRLVWXUH Tundra biome, Taiga biome, Grassland
Fig. 11.5 Biomes can be broadly classified biome, Alpine biome, Forest biome and Desert
as Aquatic biomes and Terrestrial biomes biome.
Aquatic biomes of earth Tundra Biome

1. Freshwater (Lakes, ponds, rivers) •• This is the almost treeless plain in the
2. Brackish water (Estuaries / Wetlands) northern parts of Asia, Europe and North
America.
3. Marine (Coral reefs, pelagic zones and
abyssal zones) •• Winters are long with little daylight,
Summers are short, with long daylight
Terrestrial Biomes
These are large communities of plants and hours.
animals that occupy a distinct region. They •• Precipitation is less than 250 mm per year.
include grassland, tundra, desert, tropical It is a zone of permafrost.

www.tntextbooks.in
•• Dwarf willows, birches, mosses, grasses, •• They have hot summers, cold winters, and
sedges are the flora here. irregular rainfall.
•• Reindeer, arctic hare, musk ox, lemmings •• Often they are characterized by high winds.
are important Tundra herbivores. Some •• The low irregular rainfall is the factor which
important carnivores are the arctic fox, makes the difference between a temperate
arctic wolf, bobcat and snowy owl. Polar deciduous forest and a temperate grassland.
bears live along coastal areas.
•• Herbivores like antelope, bison, wild horse,
•• Because of the severe winters, many of the jack rabbit, ground squirrel and prairie dogs
animals are migratory. For example, the are abundant.
many shore birds and waterfowl such as •• Predators include coyotes, foxes, hawks and
ducks and geese, nest in the Tundra during snakes.
the summer and migrate south for the winter.
•• In India, fauna of grasslands includes
Taiga Biome Elephant, Gaur, Rhino, Antelope.
•• The Taiga is 1300-1450 km wide zone south
•• Flora of grasslands include purple needle
of the Tundra.
grass, wild oats, foxtail, ryegrass and buffalo
•• This area has long and cold winters.
grass (Fig. 11.7).
•• Summer temperature ranges from 10⁰ C to 21⁰ C.
•• Precipitation ranges about 380-1000 mm
annually.
•• The Taiga is a forest of coniferous trees such
as spruce, fir and pine. This is a major source
for the logging industry.
•• Important migratory herbivores include
moose, elk, deer and reindeer. Moose and
reindeer migrate to the Taiga for winter and to
the Tundra for summers. The common smaller Fig. 11.7 Grassland biome
mammals are herbivorous squirrels, snowshoe
hare and predatory pine martens. Important Alpine Biome
predators include the timber wolf, grizzly bear, •• The alpine zone (zone between timber line
black bear, bobcat and wolverines. (Fig. 11.6) and snow zone) includes in the descending
order, a sub-snow zone immediately below
the snow zone, a meadow zone in the centre
and a shrub zone which gradually merges
into the timber zone.
•• The snow zone of Himalayas lies over
5100m above mean sea level and alpine
zone exists at a height of 3600m. From an
ecological view point, the zone above the
Fig. 11.6 Taiga biome limits of tree growth (timber line) exhibits
Grassland Biome extreme environmental conditions which
•• Grasslands occur in temperate and in the greatly influence the biota of this region.
tropical regions.

www.tntextbooks.in
The length of daylight is about 12 hours and

Historically biomes are varies little.
known to move as climate •• The average annual temperature ranges
changes. A classic example between 20° C and 25° C.
is the Sahara Desert, which
•• Precipitation is evenly distributed
years ago was supposed to throughout the year with annual rainfall
be a lush landscape with river flowing exceeding 2000 mm.
through it. Accordingly, appropriate
•• Soil is nutrient-poor and acidic.
fauna like Hippos, Giraffes, Crocodiles Decomposition is rapid and soils are subject
lived amid abundant trees. Over course to heavy leaching.
of time the climate dried out. It has now
•• Tree canopy is multilayered and continuous,
become the planets largest desert. The allowing little light penetration.
animals have migrated out to adjacent
•• Flora is highly diverse: one square kilometer
regions with more favourable conditions. may contain as many as 100 different tree
(Source: National Geography) species. Trees are 25-35 m tall, with buttressed
trunks and shallow roots, mostly evergreen,
•• Alpine zone of Himalayas is characterized with large dark green leaves. Common
by sparseness of animal groups. Many vegetation are orchids, bromeliads, vines
invertebrates of alpine zone are predatory (lianas), ferns, mosses, and palms.
and occur in lakes, streams and ponds. •• They are characterized by the greatest
Among vertebrates, fishes and amphibians diversity of fauna which includes birds, bats,
are totally lacking and reptilian fauna is small mammals, and insects.
greatly impoverished.
•• Flora of alpines includes alpine phacelia, More than half of earth’s tropical forests
bear grass, bristlecone pine, moss campion, have already been destroyed.
polylepis forest, pygmy bitterroot, and
wild potato.
Forest Biome
Forest is a broad term used to describe
areas where there are a large number of
trees (Fig. 11.8). The forest biomes include a
complex assemblage of different kinds of biotic
communities. The major forest biomes are the Fig. 11.8 Forest biome
Tropical forests and the Temperate forests.
Temperate forest
Tropical forest •• These forests occur in eastern North
•• They occur near the equator (between America, northeastern Asia and western
latitudes 23.5⁰ at north and 23.5⁰ at south). and central Europe.
•• The major characteristic of tropical forests is •• Have well-defined seasons with a distinct
their distinct seasons. Only two seasons are winter. Moderate climate and a growing
present (rainy and dry). Winter is absent. season of 140-200 days during 4-6 frost-
free months distinguish temperate forests.

www.tntextbooks.in
•• Annual temperature varies from -30° C to •• Hot deserts such as the Sahara of North
30° C. Africa and the deserts of the southwestern
•• Precipitation (750-1500 mm) is distributed U.S., Mexico, Australia and India
evenly throughout the year. (Thar desert) occur at low latitudes.
•• Hot deserts have a considerable amount
•• Soil is fertile, enriched with decaying litter.
of specialized vegetation (xerophytes),
•• Canopy is moderately dense and aloe, agave, Opuntia species, Euphorbia
allows light to penetrate, resulting in royleana as well as specialized vertebrate
well-developed and richly diversified and invertebrate animals.
understorey vegetation and stratification •• The dominant animals of warm deserts are
of animals. reptiles and small mammals. The Indian
•• Flora is characterized by 3-4 tree species Spiny-tailed lizard, the blackbuck, the
per km2. Trees have broad leaves that are white-footed fox are the common fauna
lost annually such as oak, hickory, beech, of the Thar deserts. There are also insects,
hemlock, maple, basswood, cottonwood, arachnids and birds.
elm, willow, and spring-flowering herbs. •• Cold deserts occur in Antarctic, Greenland
•• Fauna consists of squirrels, rabbits, skunks, and the Nearctic realm, parts of USA and in
birds, deer, mountain lion, bobcat, timber parts of western Asia and the Ladakh region
wolf, fox, and black bear. in India.
•• Widely distributed animals are jack rabbits,
Only scattered remnants of original kangaroo rats, kangaroo mice, pocket
temperate forests remain today. mice, grasshopper mice, antelope and
ground squirrels.
Desert Biome
•• Deserts cover about one fifth of the earth's Rainfall is lowest in
surface and occur where rainfall is >500
the Atacama Desert of
mm/year.
Chile, where it averages
•• Rainfall is usually very low and/or less than 15 mm. Some
concentrated in short bursts between
years are even rainless.
long rainless periods. Evaporation rates
Inland Sahara also receives less than
regularly exceed rainfall rates.
15 mm rainfall a year. Rainfall in
•• Soils are course-textured, shallow, rocky
American deserts is higher — almost
or gravely with good drainage and have no
280 mm a year.
subsurface water. The finer dust and sand
particles are blown elsewhere, leaving
11.5 Responses To Abiotic Factors
heavier pieces behind. Sand dunes are
Every living organism responds to
common.
its environment. There are various ways
•• Mean annual temperatures range from by which organisms respond to abiotic
20-25° C. The extreme maximum ranges conditions. Some organisms can maintain
from 43.5 - 49° C. Minimum temperatures constant physiological and morphological
sometimes drop to -18° C. Based on the conditions or undertake steps to overcome
temperature range, deserts can be Hot the environmental condition, which in itself
deserts and Cold deserts. is a response (Fig. 11.9).

www.tntextbooks.in
problems like heat and desiccation. Some

&RQIRUPHUV
lower animals suspend a certain phase of their
5HJXODWRUV
3DUWLDOUHJXODWRUV life cycle, which is referred to as diapause.
,QWHUQDOOHYHO
11.6 Adaptations
In biology, adaptation is a
dynamic evolutionary process
that fits organisms to their
environment and enhancing
their evolutionary fitness.
([WHUQDOOHYHO
Adaptations can be a phenotypic or adaptive
Fig. 11.9 Organisms’ response to trait with a functional role in each individual
environmental stressors organism that is maintained and has
The types of responses observed are been evolved by natural selection. The adaptive
•• Regulate: Some organisms are able to traits may be structural adaptation, behavioural
maintain homeostasis by physiological adaptation and physiological adaptation.
means which ensures constant body a) Structural adaptations
temperature, ionic / osmotic balance.
The external and internal structures of
Birds, mammals and a few lower vertebrate
animals can help them to adapt better to their
and invertebrate species are capable of such
environment. Some of the most common
regulation.
examples are mammals growing thicker fur
•• Conform: Most animals cannot maintain to survive freezing climates. Some of the
a constant internal environment. Their most attractive adaptations in nature occur
body temperature changes with the for reasons of crypsis (e.g. camouflage) and
ambient temperature. In aquatic animals mimicry. Cryptic animals are those which
like fishes, the osmotic concentration of camouflage perfectly with their environment
the body fluids changes with that of the and are almost impossible to detect. Certain
ambient water osmotic concentration. Such reptiles and insects such as chameleons and
animals are called Conformers. In case of stick insects show this type of adaptation,
extreme condition, the inhabitants relocate which helps in prey capture or to evade from
themselves as in migration. predators. Likewise, horse legs are suitable
•• Migrate: Organisms tend to move away for fast running and adapted for grasslands
temporarily from a stressful habitat to a and similar terrestrial environments.
new, hospitable area and return when the
b) Behavioural adaptations
stressful period is over. Birds migrate from
Action and behaviour of animals are
Siberia to Vedanthangal in Tamilnadu to
instinctive or learned. Animals develop certain
escape from the severe winter periods.
behavioural traits or adaptations for survival.
•• Suspend: In certain conditions, if the Fleeing from a predator, hiding during sleep,
organisms is unable to migrate, it may avoid seeking refuge from climate change or moving
the stress by becoming inactive. This is seen to find different food sources are all behavioral
commonly in bears going into hibernation adaptations. The two most characteristic forms
during winter. Some snails and fish go of behavioral adaptations are migration and
into aestivation to avoid summer related courtship. Migration allows the animals to find

www.tntextbooks.in
better resources or evade threat. Courtship is 7. Integuments rich in mucous glands are
a set of behavioral patterns to find a mate to protected by scales.
reproduce. Most nocturnal animals remain 8. Maintain water and ionic balance in its
underground or inactive during daytime. This body with excretory structures.
is a modification of their feeding and activity
pattern or habit or behaviour. Adaptations of terrestrial animals
1. Earthworms and land Planarians
Ethology is the scientific study of animal
secrete a mucus coating to maintain a
behaviour, under natural conditions. moist situation for burrowing, coiling,
c) Physiological adaptations respiration, etc.,
These are adaptations of organisms 2. Arthropods have an external covering

over the respiratory surfaces and well-
that help them to live and survive in their
developed tracheal systems.
environment with unique niches. Example:
Lions have sharp canines to hunt and tear 3. In vertebrate skin, there are many
cellular layers besides the well protected
meat and a digestive system suitable for
respiratory surfaces that help in
digesting raw meat. The two most well-known
preventing loss of water.
physiological adaptations are hibernation and
4. Some animals obtain their water
aestivation. These are two different types of
requirement from food as partial
inactivity where the metabolic rate slows down
replacement of water lost through
so much that the animal can survive without excretion.
eating or drinking. Aquatic medium and
5. Birds make nests and breed before the
terrestrial habitats have their own respective
rainy season as there is availability of
environmental conditions. Hence organisms abundant food. But during drought
have to evolve appropriate adaptations to select birds rarely reproduce.
suitable habitats and niches.
6. Camels are able to regulate water
Adaptations of aquatic animals effectively for evaporative cooling
1. The pectoral fins and dorsal fins act as through the skin and respiratory system
stabilizers or balancers and the caudal and excrete highly concentrated urine,
fin helps in changing the direction as a and can also withstand dehydration up
rudder. to 25% of their body weight.
2. Arrangement of body muscles in the 11.7 Populations
form of bundles (myotomes) help in
Population is defined
locomotion.
as any group of organisms
3. Stream lined structure helps in the swift
of the same species which
movement of the animals in water.
can interbreed among
4. Respiration by gills making use of gases
themselves, and occupy a particular space
dissolved in water.
and function as part of a biotic community.
5. Presence of air-bladders filled with air
A population has various properties like
for buoyancy.
population density, natality (birth rate),
6. Presence of lateral-line system. They
function as rheoreceptors which is mortality (death rate), age distribution, biotic
helpful in echolocating objects in water. potential, dispersion and ‘r’, ‘K’ selected

www.tntextbooks.in
growth forms. A population possesses genetic Mortality

characteristics that are directly related to Mortality is the population decline factor and
their adaptiveness, reproductive success, and is oppposite to natality. Mortality can be expressed
persistence in their habitats over time. Life as a loss of individuals in unit time or death
history of an organism is an important part rate. Generally, mortality is expressed as specific
mortality, that is, the number of members of an
of this attribute. The population has a definite
original population dying after the lapse of a given
structure and function that can be described
time. The crude death rate of a population can be
with reference to time. calculated by the equation.
11.8 Population Attributes Death rate (d)= number of deaths per unit time
average population
Population density
The rate of mortality (death) is determined
The density of a population refers to
by density. Mortality is high at high density
its size in relation to unit of space and time.
because of the hazards of overcrowding,
Population density is the total number of that increased predation and spread of disease.
species within a natural habitat. The size of
Mortality rates vary among species and
the population can be measured in several are correlated and influenced by a number
ways, including abundance (absolute number of factors such as destruction of nests, eggs
in population), numerical density (number or young by storms, wind, floods, predators,
of individuals per unit area (or) volume) and accidents and desertion by parents.
biomass density (biomass per unit area (or)
Population Dispersion
volume). The population density of a species
Populations have a tendency to disperse
can also be expressed with reference to the
or spread out in all directions, until some
actual area of habitat available to the species
barriers are reached. This is observed by the
When the size of individuals in the population
migration of individuals into (Immigration)
is relatively uniform then density is expressed or out (Emigration) of the population area.
in terms of number of individuals (numerical
Migration
density).
Migration is a peculiar and unique kind of
Natality mass population movement from one place to
Populations increase because of another and back. To avoid the severe winter
natality. Natality is equivalent to birth rate cold, Siberian cranes migrate from Siberia
to Vedanthangal in Tamil Nadu and return
and is an expression of the production of new
back in spring. Some fishes are known to
individuals in the population by birth, hatching,
migrate from sea to fresh water (anadromous
germination (or) fission. The two main aspects of migration, Salmon) and some from fresh
reproduction, namely fertility and fecundity play water to sea (catadromous migration, Eel).
a significant role in a population. Natality rate
Emigration
may be expressed in crude birth rate number of
Under natural conditions, emigration
organisms born per female per unit time.
usually occurs when there is overcrowding. This
is regarded as an adaptive behavior that regulates
Birth rate (b) = number of birth per unit time the population in a particular site and prevents
average population

www.tntextbooks.in
$JH'LVWULEXWLRQ
$JHVWUXFWXUH
3RVWUHSURGXFWLYHDJH
5HSURGXFWLYHDJH
3UHUHSURGXFWLYHDJH
,QFUHDVLQJSRSXODWLRQ 6WDEOHSRSXODWLRQ 'HFUHDVLQJSRSXODWLRQ
Fig. 11.10 Age distribution pyramids
over exploitation of the habitat. Further, it leads J-Shaped growth form

to occupation of new areas elsewhere. When a population increases rapidly
Immigration in an exponential fashion and then stops
It leads to a rise in population levels. If abruptly due to environmental resistance or
the population increases beyond the carrying due to sudden appearance of a limiting factor,
capacity, it can result in increased mortality they are said to exhibit J-shaped growth form.
among the immigrants or decreased Many insects show explosive increase in
reproductive capacity of the individuals. number during the rainy season followed by
their disappearance at the end of the season
Both emigration and immigration are
(Fig. 11.11).
initiated or triggered by weather and other
abiotic and biotic factors. Biotic Environmental Carrying
potential resistance capacity
11.9 Population Age Distribution
The proportion of the age groups
(pre- reproductive, reproductive and post
Population
reproductive) in a population is its age distribution

attribute. This determines the reproductive status J curve S curve
of the population at the given time and is an
indicator of the future population size.
Usually a rapidly growing population will
have larger proportion of young individuals. A 0
stable population will have an even distribution Time
of various age classes. A declining population Fig. 11.11 J-Shaped and S-Shaped
tends to have a larger proportion of older growth curves
individuals (Fig. 11.10).
S-Shaped growth form (Sigmoid form)
11.10 Growth Models / Curves Some populations, as in a population of
Populations show characteristic growth
small mammals, increase slowly at first then
patterns or forms. These patterns can be plotted
more rapidly and gradually slow down as
and termed as J-shaped growth form and
environmental resistance increases whereby
S-shaped growth form (Sigmoid form).

www.tntextbooks.in
equilibrium is reached and maintained. Their 11.11 Population Regulation

growth is represented by S shaped growth The inherent tendency of all animal
curve. populations is to increase in number. But it does
not increase indefinitely. Once the carrying
Biotic potential or Reproductive capacity (r)
capacity of the environment is reached,
It is the maximum reproductive
capacity of an organism under optimum population numbers remain static or fluctuate
environmental conditions. depending on environmental conditions. This is
Carrying capacity (K) regulated by many factors which are
The maximum number of organism that 1. Density independent – Extrinsic factors
a region can support without environmental
2. Density dependent - Intrinsic factors
degradation is called carrying capacity.
Environmental resistance Extrinsic factors include availability of space,
Is the sum total of the environmental shelter, weather, food, etc. Intrinsic factors
limiting factors, both biotic and abiotic, include competition, predation, emigration,
which together act to prevent the biotic immigration and diseases.
potential of an organism from being realized.
11.12 Population Interaction
Table 11.2 Differences between r- selected Organisms belonging to different
and K selected species populations interact for food, shelter, mating
or for other necessities. Interaction may be
r selected species K selected species
intra specific (interaction within the members
(r - Reproductive (K - Carrying
of same species) or inter specific (among
capacity) capacity)
organisms of different species).
Smaller sized Larger sized Intra specific association is observed for all
organisms organisms livelihood processes like feeding, territoriality,
Produce many Produce few breeding and protection.
offspring offspring Interspecific associations or interactions
can be:
Late maturity with
Mature early extended parental Neutral: where different species live together
care but do not affect each other.
Positive: it is a symbiotic relationship in which
Short life
Long life expectancy no organism in association is harmed and either
expectancy
one or both may be benefitted. It is of two types
Each individual – Mutualism and Commensalism.
Can reproduce
reproduces only Negative: One or both of the interacting
more than once in
once or few times in organisms will be affected as in case of
lifetime
their life time
competition, predation, parasitism.
Most individuals The common types of interspecific
Only few reach
reach maximum life inter actions are:
adulthood
span
AMENSALISM (--, 0): This is the ecological
Unstable interaction in which an individiual species
Stable environment,
environment, harm another without obtaining benefit,
density dependent
density independent large powerful animals harm weak animals.
e.g., animals destroyed at the feet of elephants

www.tntextbooks.in
Table 11.3 Analysis of two species population interactions

S. TYPES OF SPECIES SPECIES GENERAL NATURE OF
EXAMPLES
NO. INTERACTION 1 2 INTERACTION
1 Amensalism -- 0 The most powerful animal Animals
or large organisms inhibits destroyed at
the growth of other lower the feet of
organisms elephants
2 Mutualism + + Interaction favorable to both Between
and obligatory crocodile and
bird
3 Commensalism + 0 Population 1, the commensal Sucker fish on
benefits, while 2 the host is not shark
affected
4 Competition -- -- Direct inhibition of each Birds compete
species by the other with squirrels
for nuts and
seeds
5 Parasitism + -- Population 1, the parasite, Ascaris and
generally smaller than 2, the tapeworm
host in human
digestive tract
6 Predation + -- Population 1, the predator, Lion predatory
generally larger than 2, the on deer
prey
MUTUALISM (+, +): It is the type of interaction

where both species benefit from the interaction.
Mutualism may be facultative when the species
involved are capable of existence independent of
one another, or obligate, when the relationship
is imperative of the existence of one or both
species. Examples: Fig. 11.12 Sea anemone on hermit crab;
•• Certain bacteria in the caeca and intestine Crocodile and bird
COMMENSALISM (+, 0): This defines the
of herbivores aid in the digestion of
interaction in which two or more species are
cellulose. In return the host provides
mutually associated in activities centering
suitable environment for the growth of the
on food and one species at least, derives
bacteria.
benefit from the association while the
•• The cross pollination of flowers by insects
other associates are neither benefited nor
and birds seeking nectar and pollen which
harmed. The concept of commensalism has
is of great importance in agriculture.
been broadened in recent years, to apply
•• Small birds cleaning the teeth of crocodiles.
to coactions other than those centering on
Here the birds gets food and the teeth of
food such as cover, support, production, and
crocodile is cleaned.
locomotion. Examples:
•• The hermit crab carries along on its shell
a Sea anemone (a sedentary coelenterate). •• Barnacles attached to Whales travel
The crab is protected from its enemies by thousands of miles collecting and filtering
the stinging cells of the anemone while the food from the moving water. The whales
anemone gets its food (Fig. 11.12). are not affected by the barnacles.

www.tntextbooks.in
•• Egrets usually are present near cattle. They

catch insects which are disturbed by the
cattle. The bird benefits, while the cattles
are not affected (Fig. 11.13).
Fig. 11.14 Owls competing for food

Fig. 11.13 Egrets near cattle; barnacles on whale
and protection from the host. Parasites
COMPETITION (--, --): It refers to the type of
exhibit adaptations to exploit their hosts.
interaction in which individuals of a species
The parasites may be viral parasites
or members of different species vie for limited
(plant / animal viruses), microbial parasites
availability of food, water, nesting space, cover,
(e.g., bacteria / protozoa / fungi), phytoparasites
mates or other resources. When resources are in
(plant parasites) and zooparasites
more than adequate to meet the demands of the
(animal parasites such as Platyhelminthes,
organisms seeking them, competition does not
nematodes, arthropods). Parasites may inhabit
occur, but when inadequate to satisfy the need of
or attach to the surface of the host (Ectoparasites
the organisms seeking them, the weakest, least
- Head lice, Leech) or live within the body of
adapted, or least aggressive individuals are often
the host (endoparasites – ascaris, tapeworm).
forced to face challenges. This phenomenon is
The endoparasites usually live in the alimentary
known as the competitive exclusion principle
tract, body cavities, various organs or blood or
of Hardin.
other tissues of the host.
DEGREE OF COMPETITION - Competition Parasites may be permanent or temporary.
is usually keen between individuals of the same Temporary parasites spend only a part of their
species (intraspecific competition) because life cycle as parasites. For example, Glochidium
they have identical requirements for food, larva of Anadonia (fresh water mussel) attaches
mates, and so on. Interspecific competition itself to the body of fish. Permanent parasites
occurs where different species require at least spend their life completely dependent on
some resource materials or conditions in their host organism. The common examples
common. The severity of competition depends of permanent parasites are Plasmodium,
on the extent of similarity or overlap in the Entamoeba, Round worms, Pin worms,
requirements of different individuals and the Tape worms, etc.,
shortage of the supply in the habitat as birds
compete with squirrels for nuts, and seeds; PREDATION (+, --): It is a form of interaction,
insects and ungulates compete for food in where one animal kills another animal for
grasslands (Fig. 11.14). food. Like parasitism, predation is important
in community dynamics, but both differ in the
PARASITISM (+, --): It is a kind of harmful
point that a predator tends to be larger than
interaction between two species, wherein one
its prey, and it catches its prey from without,
species is the ‘parasite’ and the other its ‘host’.
while a parasite is smaller than its host and
The parasite benefits at the expense of the host.
consumes it from within.
A parasite derives shelter, food

www.tntextbooks.in
area. Populations have attributes that individual

organisms do not, such as natality and mortality,
sex ratio and age distribution. The proportion
of different age groups of males and females
in a population is often presented graphically
as age pyramid, its shape indicated whether a
population is stationary, growing or declining.
Ecological effects of any factors on a

population are generally reflected in population
density. Population grow through births and
immigration and decline through deaths and
Fig. 11.15 Lion predating on deer emigration. When resources are unlimited,
the growth is usually exponential but when
By their hunting activities predators can
resources become progressively limiting the
be regarded as specialized or generalized.
growth pattern turns logistic. In either case,
Specialized predators are those adapted to
growth is ultimately limited by the carrying
hunt only a few specific species. Lion and
capacity of the environment. The intrinsic rate
deer exhibit predator – prey relationship,
of natural increase is a measure of the inherent
where the Lion is the predator and the deer is
potential of a population to grow.
the prey. This type of interaction helps in the
transfer of energy up the trophic levels and is Population of the same or different species
an essential strategy in population regulation in a habitat do not live in isolation but interact
(Fig. 11.15). in many ways. These interactions may be intra
specific or interspecific. They may be positive,
Summary negative or neutral in nature.
Ecology is the study of the relationships
of living organisms with the abiotic and Evaluation:
biotic components of their environment.
Temperature, Light, Water, Soil, Humidity, 1. All populations in a given
Wind and Topographic factors are the important physical area are defined
physical components of the environment to as
which the organisms are adapted in various a) Biome
ways. Maintenance of a constant internal b) Ecosystem
environment by the organisms contributes to
c) Territory
optimal performance, but only some organisms
d) Biotic factors
(regulators) are capable of homeostasis in the
fact of changing external environment. Others 2. Organisms which can survive a wide range
simply conform. Many species have evolved of temperature are called
adaptations to avoid unfavourable conditions in a) Ectotherms b) Eurytherms
space or in time. c) Endotherms d) Stenotherms
Population ecology is an important area of 3. The interaction in nature, where one gets
ecology. A population is a group of individuals benefit on the expense of other is...
of a given special sharing or competing for a) Predation b) Mutualism
similar resources in a defined geographical c) Amensalism d) Commensalism

www.tntextbooks.in
4. Predation and parasitism are which type of S. A B C

interactions? No.
a) (+,+) b) (+, O) a. Conformer Regulator Partial
c) (--, --) d) (+, --) Regulator
b. Regulator Partial Conformer
5. Competition between species leads to
Regulator
a) Extinction b) Mutation c. Partial Regulator Conformer
c) Amensalism d) Symbiosis Regulator
d. Regulator Conformer Partial
6. Which of the following is an r-species
Regulator
a) Human b) Insects
9. The relationship between sucker fish and
c) Rhinoceros d) Whale
shark is...........
7. Match the following and choose the correct a) Competition b) Commensalism
combination from the options given below.
c) Predation d) Parasitism
Column I Column II
A. Mutualism 1. Lion and deer 10. Which of the following is correct for
r-selected species
B. Commensalism 2. Round worm and man
a) L arge number of progeny with small size
C. Parasitism 3. Birds compete with
squirrels for nuts b) large number of progeny with large size
D. Competition 4. Sea anemone on hermit c) small number of progeny with small size
crab d) small number of progeny with large size
E. Predation 5. Barnacles attached to 11. Animals that can move from fresh water
Whales to sea called as.....
a) A- 4, B-5, C-2, D –3, E-1 a) Stenothermal b) Eurythermal
b) A- 3, B-1, C-4, D – 2, E-5 c) Catadromous d) Anadromous
c) A- 2, B-3, C-1, D – 5, E-4 12. Some organisms are able to maintain
d) A- 5, B-4, C-2, D – 3, E-1 homeostasis by physical means ...
8. The figure given below is a diagrammatic a) Conform b) Regulate
representation of response of organisms c) Migrate d) Suspend
to abiotic factors. What do A, B and C 13. What is a Habitat?
represent respectively.
14. Define ecological niche.
15. What is Acclimatisation?
$ 16. What is Pedogenesis?
,QWHUQDOOHYHO
% 17. What is soil permeability?

18. Differentiate between Eurytherms and
& Stenotherms.
19. Explain hibernation and aestivation with
examples.
([WHUQDOOHYHO 20. Give the characters of a Biome?
21. Classify the aquatic biomes of Earth.

www.tntextbooks.in
22. What are the ways by which organisms 29. List the adaptations seen in terrestrial
respond to abiotic factors? animals.
23. Classify the adaptive traits found in 30. Describe Population Age Distribution.
organisms. 31. Describe Growth Models/Curves.
24. Differentiate Natality and Mortality. 32. Tabulate and analysis of two species
25. Differentiate J and S shaped curve. population interaction.
26. Give an account of population regulation. 33. Explain Parasitism with an example.
27. Give an account of the properties of soil. 34. Differentiate between Amensalism and
28. Differentiate between Tundra and Taiga Commensalism.
Biomes.

Concept Map
2UJDQLVPDQG

3RSXODWLRQ
Organisms and Populations

2UJDQLVP 3RSXODWLRQ
196
+DELWDWDQG 5HVSRQVHWR 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ
$ELRWLFIDFWRUV %LRPH $GDSWDWLRQ
QLFKH DELRWLFIDFWRUV DWWULEXWHV JURZWKFXUYHV UHJXODWLRQ LQWHJUDWLRQ
- 'HQVLW\
7HPSHUDWXUH 7XQGUD &RQIRUP 0RUSKRORJLFDO 'HQVLW\ 0XWXDOLVP
JURZWKFXUYHV GHSHQGHQW
6 'HQVLW\
/LJKW 7DLJD 5HJXODWH 3K\VLRORJLFDO 1DWDOLW\ JURZWKFXUYHV &RPPHQVDOLVP
LQGHSHQGHQW
www.tntextbooks.in
6RLO *UDVVODQG 0LJUDWH %HKDYLRXU 0RUWDOLW\ &RPSHWLWLRQ
:DWHU )RUHVW 6XVSHQG (PLJUDWLRQ 3DUDVLWLVP
$WPRVSKHULF
'HVHUW ,PPLJUDWLRQ 3UHGDWLRQ
KXPLGLW\
7RSRJUDSKLF
0LJUDWLRQ
IDFWRU
18/12/2021 15:07:13
www.tntextbooks.in
12
UNIT - V
Biodiversity and
its Conservation
CHAPTER
Nilgiri tahr is an endangered species in the
IUCN Red List of Threatened Species
due to hunting and poaching
Chapter outline
12.1 Biodiversity
12.2 Importance of biodiversity – Global
and India
A wide variety of living organisms including
plants, animals and micro-organisms with
whom we share this planet earth makes the world
12.3 Biogeographical regions of India a beautiful place to live in. Living organisms exist
12.4 Threats to biodiversity almost everywhere from mountain peaks to the
12.5. Causes of Biodiversity Loss ocean depths; from deserts to the rainforests.
12.6 IUCN They vary in their habit and behaviour, shape,
size and colour. The remarkable diversity of
12.7 Biodiversity and its conservation
living organisms forms an inseparable and
12.8 Restoration of degraded habitats
significant part of our planet, however, the ever
12.9 Biodiversity Act (BDA)
increasing human population is posing serious
threats to bio-diversity. In this chapter, we shall
discuss biodiversity – concepts, levels, magnitude
Learning objectives
and patterns, importance of biodiversity,
biogeographical regions of India, threats to
➢➢ Acquire knowledge about concept, biodiversity, causes of biodiversity loss, extinction,
level and patterns of biodiversity. and biodiversity conservation.
➢➢ Appreciate the magnitude
of India’s biodiversity. 12.1 Biodiversity
➢➢ Understand The 1992 UN Earth Summit defined
biogeographical regions
Biodiversity as the variability among living
and resources of India.
organisms from all sources, including
➢➢ Gain insight into the
terrestrial, marine and other aquatic ecosystems
threats to biodiversity.
➢➢ Understand the reasons/ and the ecological complexes of which they are
causes and effects of extinction. a part. This includes diversity within species,
➢➢ Create awareness to restore degraded between species and ecosystems of a region.
habitats and environment. It reflects the number of different organisms
➢➢ To be aware of the Biodiversity Act and their relative frequencies in an ecological
and its provisions. system and constitutes the most important
functional component of a natural ecosystem.
197

www.tntextbooks.in
It helps to maintain ecological processes, Genetic diversity
create soil, recycle nutrients, influence climate,

degrade waste and control diseases. It provides
an index of health of an ecosystem.The survival
of human race depends on the existence and
wellbeing of all life forms (plants and animals) Genetic diversity in a whole population
in the biosphere.
Species diversity
12.1.1 Concept of biodiversity

The term biodiversity was introduced
by Walter Rosen (1986). Biodiversity is the
assemblage of different life forms. Each species
is adapted to live in its specific environments. Species diversity in a
coastal redwood ecosystem
The changes in climatic conditions are
reflected in the distribution and pattern of Ecosystem diversity
biodiversity on our planet. The number of
species per unit area declines as we move
from tropics towards the poles. The Tundra
and Taiga of northern Canada, Alaska,
northern Europe and Russia possess less than
12 species of trees. The temperate forests of Community and
the United states have 20-35 species of trees, ecosystem diversity
across the landscape
of an entire region
while the tropical forests of Panama have over
110 species of trees in a relatively small area. Fig. 12.1 Three levels of biodiversity
formation of different races, varieties and
12.1.2 Levels of biodiversity
subspecies. Rouwolfia vomitaria, a medicinal
Edward Wilson popularized the term
plant growing in different ranges of the
‘Biodiversity’ to describe diversity at all levels
Himalayas shows differences in the potency
of biological organization from populations to
and concentration of the active ingredient
biomes. There are three levels of biodiversity
reserpine due to genetic diversity. Genetic
– Genetic diversity, Species diversity and diversity helps in developing adaptations to
Community/Ecosystem diversity (Fig. 12.1). changing environmental conditions.
Genetic diversity refers to the differences Species diversity refers to the variety
in genetic make-up (number and types of genes) in number and richness of the species in any
between distinct species and to the genetic habitat. The number of species per unit area at
variation within a single species; also covers a specific time is called species richness, which
genetic variation between distinct populations denotes the measure of species diversity. The
of the same species. Genetic diversity can Western Ghats have greater amphibian species
be measured using a variety of molecular diversity than the Eastern Ghats. The more
techniques. India has more than 50,000 genetic the number of species in an area the more is
variants of Paddy and 1000 variants of Mango. the species richness (Fig. 12.1a). The three
Variation of genes of a species increases with indices of diversity are - Alpha, Beta and
diversity in size and habitat. It results in the Gamma diversity.
Biodiversity and its Conservation 198

www.tntextbooks.in
i. Alpha diversity: It is measured by counting described. Each year about 10-15 thousand
the number of taxa (usually species) within new species are identified and published
a particular area, community or ecosystem. worldwide, of which 75% are invertebrates. The
ii.
B eta diversity: It is species diversity number of undescribed species is undoubtedly
between two adjacent ecosystems and is much higher.
obtaining by comparing the number of India is very rich in terms of biological
species unique to each of the ecosystem. diversity due to its unique bio-geographical
iii. Gamma diversity refers to the diversity location, diversified climatic conditions and
of the habitats over the total landscape or enormous eco-diversity and geo-diversity.
geographical area. According to world biogeographic classification,
iii. Gamma diversity: It refers to the diversity India represents two of the major realms
of the habitats over the total landscape or (The Palearctic and Indo-Malayan) and three
geographical area. biomes (Tropical humid forests, Tropical Dry/
Deciduous forests and Warm Deserts/Semi
deserts). With only about 2.4% of the world’s
total land surface, India is known to have over
8 % of the species of animals that the world
holds and this percentage accounts for about
92,000 known species.
India is the seventh largest country in the
world in terms of area. India has a variety of
ecosystems, biomes with its varied habitats
like, hills, valleys, plateaus, sea shores,
Fig. 12.1a Species biodiversity mangroves, estuaries, glaciers, grasslands
Community/Ecosystem diversity is the and river basins. It also reflects different
variety of habitats, biotic communities, and kinds of climates, precipitation, temperature
ecological processes in the biosphere. It is the distribution, river flow and soil. India is one
diversity at ecosystem level due to diversity of of the 17 mega biodiversity countries of the
niches, trophic levels and ecological processes world and has ten biogeographic zones with
like nutrient cycles, food webs, energy flow characteristic habitat and biota.
and several biotic interactions. India with its
alpine meadows, rain forests, mangroves,
"The world is currently undergoing a very
coral reefs, grass lands and deserts has one of
rapid loss of biodiversity comparable
the greatest ecosystem diversity on earth.
with the great mass extinction events
12.1.3 Magnitude of biodiversity that have previously occurred only
five or six times in the earth's history."
Biodiversity is often quantified as the
- World Wildlife Fund
number of species in a region at a given time.
The current estimate of different species on
earth is around 8-9 million. However, we really 12.1.4 Patterns of biodiversity
don’t know the exact magnitude of our natural distribution
wealth. This is called the ‘The Taxonomic The distribution of plants and animals
impediment’. So far about 1.5 million species of is not uniform around the world. Organisms
microorganisms, animals and plants have been require different sets of conditions for their
199 Biodiversity and its Conservation

www.tntextbooks.in
optimum metabolism and growth. Within

this optimal range (habitat) a large number
and type of organisms are likely to occur,
grow and multiply. The habitat conditions are
determined by their latitudes and altitudes.
MSL.171.91m
Latitudinal and altitudinal gradients:

Temperature, precipitation, distance from the
equator (latitudinal gradient), altitude from sea
level (altitudinal gradient) are some of the factors
that determine biodiversity distribution patterns.
The most important pattern of biodiversity is Mean Sea Level (MSL) is an average
latitudinal gradient in diversity. This means level of the surface of one or more of
that there is an increasing diversity from the Earth’s oceans (or seas) from which
poles to equator. Diversity increases as one heights such as elevations may be
moves towards the temperate zones and reaches measured.
the maximum at the tropics. Thus, tropics
As we travel by train we notice names
harbour more biodiversity than temperate or
of stations on big yellow signboards
polar regions, especially between the latitudes
on which is usually written how much
of 23.5⁰N and 23.5⁰S (Tropic of Cancer to the
elevated that place is compared to MSL.
Tropic of Capricorn). Harsh conditions exist in
temperate areas during the cold seasons while For example, Erode junction is about
very harsh conditions prevail for most of the year 171 meters above MSL.
in polar regions.
Columbia located near the equator (0⁰) has
but also for supporting both variety and
nearly 1400 species of birds while New York at
number of organisms.
41⁰N has 105 species and Greenland at 71⁰N
has 56 species. India, with much of its land area • The temperatures vary between 25⁰C to
in the tropical latitudes, is home for more than 35⁰C, a range in which most metabolic
1200 species of birds. Thus it is evident that the activities of living organisms occur with
latitude increases the species diversity. ease and efficiency.
Decrease in species diversity occurs as • The average rainfall is often more than
one ascends a high mountain due to drop in 200 mm per year.
temperature (temperature decreases @ 6.5⁰C
• Climate, seasons, temperature, humidity,
per Km above mean sea level)
photoperiods are more or less stable and
The reasons for the richness of encourage both variety and numbers.
biodiversity in the Tropics are:
• Rich resource and nutrient availability.
• Warm tropical regions between the tropic
of Cancer and Capricorn on either side
Species - Area relationships
of equator possess congenial habitats for
German Naturalist and Geographer
living organisms.
Alexander von Humboldt explored the
• Environmental conditions of the tropics wilderness of south American jungles and
are favourable not only for speciation found that within a region the species richness
increased with increasing area but upto a

www.tntextbooks.in
certain limit. The relationship between species of flora and fauna including microorganisms.
richness and area for a wide variety of taxa These organisms can inhabit different
(angiosperm plants, birds, bats, freshwater ecosystems with varying conditions like the
fishes) turned out to be the rectangular Rainforests, Coral reefs, Grasslands, Deserts,
hyperbola. On a logarithmic scale, the Tundra and the Polar ice caps. This variety
relationship is a straight line described by the (Biodiversity) is essential for the wellbeing of
equation. our planet and sustenance of life as a whole.
log S = log C + Z log A Ecologist Paul Ehrlich proposed the 'Rivet
where Popper Hypothesis' for better understanding
S = Species richness the loss of each species in the ecosystem. He
A = Area compared each species of an ecosystem with
Z = Slope of the line rivets in the body of an aeroplane. Thousands
(regression coefficient) of rivets (species) join all the parts of an
C = Y-intercept aeroplane (ecosystem). If every passenger
travelling in the aeroplane starts taking rivets
home(loss of species), initially it may not
affect flight safety (proper functioning of the
ecosystem). However, the plane becomes
S=CAz
dangerously weak over a period of time,
(S) Species richness
when more and more rivets are removed.

ale Moreover, which rivet is removed is also
sc
g
-lo log S = log C + Z log A important. When the key rivets (removal
log
of key stone species) on the wings of the
aeroplane are removed, undoubtedly it poses
a serious threat to the flight safety. Thus we
(A) Area (S) understand the role of every species for the
Fig. 12.2 Species - Area relationship on harmonial function of an ecosystem.
log scale The importance of biodiversity can be
viewed and measured as
Regression coefficient Z generally has a
a) Ecosystem services
value of 0.1-0.2 regardless of taxonomic group
or region. However, in case of the species – b) Biological resources
area relationship in very large areas like entire c) Social benefits of biodiversity
continents, the slope of the line appears to The organization and functioning
be much steeper (Z-value in the range of of ecosystems world over is effected and
0.6-1.2). For example, in case of the fruit eating dependent on biodiversity and its richness.
(frugivorous) birds and mammals in the tropical The major functional attributes are:
forests of different continents, the slope is found • continuity of nutrient cycles or
to be a steeper line of 1.15 (Fig. 12.2). biogeochemical cycles (N2, C, H2O, P,
S cycles)
12.2 Importance of biodiversity –
• soil formation, conditioning or
Global and India
maintenance of soil health (fertility) by
Biodiversity is the variety of life on earth.
soil microbial diversity along with the
That is, it is the number of different species
different trophic members

www.tntextbooks.in
• increases ecosystem productivity and stability and survival of species. Biodiverse

provide food resources regions are reservoirs of biological
resources like food resources, gene pool,
• act as water traps, filters, water flow
genetic resource, medicinal resources,
regulators and water purifiers (forest
bio-prospecting
cover and vegetation)
• to provide unique aesthetic value and hot
• climate stability (forests are essential for
spots for Ecotourism. Along with forest
rainfall, temperature regulation, CO2
resources and wildlife it has commercial
absorption, which in turn regulate the
significance
density and type of vegetation)
• an indicator of the health of the ecosystem.
• forest resource management and
Endemism is a crucial indicator of
sustainable development
richness.
• maintaining balance between biotic
components
12.3 Biogeographical regions of
India
• cleaning up of pollutants – microbes As per the international ‘biome’ type
are the biggest degraders of molecules of classification based upon climate, fauna
including many anthropogenic ones and flora and the soil conditions, India can
which are present in effluents, sewage, be divided into ten different biogeographic
garbage and agro-chemicals zones, (Fig. 12.3 and table 12.1) namely:
• ecological stability – the varieties and
richness of species contribute to ecological
Table 12.1. Biogeographical Zones Of India

S. Biogeographical Biotic Provinces Area % Biota
No. Zones
1. Trans Himalaya Comprises mountain 5.7% Alpine steppe vegetation, richest
areas of Ladakh (J&K), wild sheep and goat community in
North Sikkim and Lahaul the world (renowned for its quality
and Spiti of H.P wool), Chiru, black rocked crane,
etc.,
2. Himalayas The entire mountain chain 7.2% Alpine forest, orchids,
running from western to rhodotendrons, wild sheep, mountain
north eastern India goats, shrew, snow leopard, panda
etc.,
3. Indian Desert The extremely arid area 6.9% Thorn forests, deciduous forest,
west of the Aravalli hill wild ass (endemic), Indian bustard,
range comprising of the camel, foxes,snakes tc.,
sand desert of Rajasthan
(Thar) and the salt desert
of Gujarat (Kutch)

www.tntextbooks.in
4. Semi-arid zones The zones in between the 15.6% Thorn and deciduous forest,
desert and the Deccan mangroves, Nilghai, black buck,
plateau including the four horned antelopes, sambar,
Aravalli hill range chital, spotted deer, Asiatic lion,
tiger, leopard, jackal etc.,
5. Western Ghats Mountain ranges from Sat 4% Evergreen to dry deciduous forests,
Pena in South Gujarat to Nilgiri langur, Indian elephant.
the southern most tip of Nilgiri tahr (state animal of
Kerala Tamilnadu), the grizzled squirrel
and lion tailed macaque (endemic)
6. Deccan Peninsula A large area comprising 43% Deciduous forest, thorn forests and
of raised land bound by pockets of semi ever green forests,
the Sathpura range on chital, sambar, sloth bear, barking
the north, Western Ghats deer, Nilghai, elephant , black buck
on the west and Eastern etc.,
Ghats on the east
7. Gangetic plains One of most fertile region 11% Mangrove forest, dry deciduous
of India which extends forest, rhinoceros, elephant, buffalo,
from eastern Rajasthan tiger, crocodile, swamp deer, hog
through Uttar Pradesh, deer etc.,
Bihar and West Bengal
8. North – East India The plains and non 5.2% Biogeographical Gateway for much
Himalayan hill ranges of of India’s fauna and flora and also
north eastern India. biodiversity hot spot.
This region represents the Semi ever green forest, monsoon
transition zone between forests, swamps and grassland,
the Indian, Indo – Malayan Indian rhinoceros, golden langur,
and Indo – Chinese leopard etc.,
bio geographical regions.
It is the meeting point of
the Himalayan mountains
and peninsular India
9. Coastal Region The coastline from Gujarat 2.5% Mangroves, sponges, corals, crabs,
to Sunderbans with sandy turtles, tunas, ornamental fishes etc.,
beaches, mud flats, coral
reefs, and mangroves
10. Andaman and Andaman and Nicobar 0.3% Evergreen forest, a wide diversity of
Nicobar Islands Islands in the Bay of corals, Narcondam hornbills, giant
Bengal robber crab, turtle, wild boar, water
monitor, south Andaman krait etc.,

www.tntextbooks.in
Trans-Himalaya
Himalaya
Semi arid Zones
Gangetic Plains
Indian Desert
North East India
Deccan Peninsula
Coastal Region
Western Ghats
Andaman & Nicobar Islands
Fig. 12.3 Biogeographical regions of India
12.4 Threats to biodiversity loss and fragmentation leads to formation of

isolated, small and scattered populations and as
Even though India is one of the 17 identified
endangered species.
mega diverse countries of the world, it faces lots
of threats to its biodiversity. Some of the other threats include
specialised diet, specialized habitat
Apart from natural causes, human
requirement, large size, small population
activities, both directly and indirectly are today’s
size, limited geographic distribution and
main reason for habitat loss and biodiversity
high economic or commercial value. Large
loss. Fragmentation and degradation
mammals by virtue of their size require
due to agricultural practices, extraction
larger areas to obtain the necessities of
(mining, fishing, logging, harvesting) and
life - food, cover, mates than do smaller
development (settlements, industrial and
mammals. Individual home range of Lion
associated infrastructures) leads to habitat

www.tntextbooks.in
can be about 100 square Km. Mammals have • Industrialization, Urbanization,

specialized dietary needs such as carnivores, infrastructure development, Transport –
frugivores and the need to forage over much Road and Shipping activity, communication
larger areas than general dietary herbivores towers, dam construction, unregulated
and omnivores. Mammals also have low tourism and monoculture are common area
reproductive output other than small rodents. of specific threats
• Co-extinction
The interrelationship
and interdependence of Habitat Loss
all living components Development of human society is
in a system can be seen inevitable. Natural habitats are destroyed
from the example of the for the purpose of settlement, agriculture,
fruit bats of Guam (South East Asia). The mining, industries and construction of
fruit bats are a delicacy here, and hence highways. As a result species are forced to
their population has dwindled which is adapt to the changes in the environment or
not surprising. What is surprising is that move to other places. If not, they become
local fruit production has got affected victim to predation, starvation, disease and
as it was identified that the bats served
eventually die or results in human animal
as pollinators. Hence there is a need for
conflict.
conservation of diversity as that could
avert such situations. Over population, urbanization,
industrialization and agricultural
advancements require additional land,
12.5 Causes of biodiversity loss
water and raw materials every year. This is
The major causes for biodiversity decline are: made possible only through fragmentation
• Habitat loss, fragmentation and or destruction of natural habitats by filling
destruction (affects about 73% of all wetlands, ploughing grasslands, cutting down
species) trees, forest, desilting rivers, constructing
transport ways, caving mountains, extracting,
• Pollution and pollutants (smog, pesticides,
herbicides, oil slicks, GHGs) ores, changing the course of rivers and filling
of seashore.
• Climate change
The most dramatic example of habitat
• Introduction of alien/exotic species loss comes from the tropical rainforests 14% of
• Over exploitation of resources (poaching, the earth’s land surface once covered by these
indiscriminate cutting of trees, over tropical forests, is not more than 6% now. The
fishing, hunting, mining) Amazon rainforest, a vast area, harbouring
millions of species, also called “Lungs of the
• Intensive agriculture and aquacultural
planet”is destroyed and being replaced for
practices
agriculture and human settlements. 90% of
• Hybridization between native and non- New Zealand’s wetlands have been destroyed
native species and loss of native species and cleared for cultivating soya beans and
• Natural disasters (Tsunami, forest fire, raising grass for beef cattle. Kodaikanal
earth quake, volcanoes) and Nilgiri hills of Tamil Nadu have been

www.tntextbooks.in
destroyed rapidly for human occupancy. Loss the need becomes greed, it leads to over
of habitat results in annihilation of plants, exploitation of natural resources. Excessive
microorganisms and forcing out animals exploitation of a species, reduces the size of
from their habitats. its population to such a level that it becomes
vulnerable to extinction. Dodo, passenger
pigeon and Steller’s sea cow have become
Where are the Sparrows?
extinct in the last 200-300 years due to over
Common Sparrows are going extinct exploitation by humans. Overfishing due to
because of mindless urbanization. They population pressure leads to many marine fish
are losing not just their natural habitats (populations) declining around the world.
but also the essential human touch they
need and thrive upon. The population of Exotic species invasion:
sparrows is dwindling due to the use of Exotic species (non-native; alien) are
packed food, insecticides in farming and organisms often introduced unintentionally
changing lifestyles, and match box-styled or deliberately for commercial purpose, as
architecture resulting in an inadequate biological control agents and other uses. They
availability of food and shelter for the birds. often become invasive and drive away the local
Unlike pigeons that can make nests on species and is considered as the second major
ledges, sparrows need cavities to build their cause for extinction of species. Exotic species
nests. have proved harmful to both aquatic and
terrestrial ecosystems.
Habitat fragmentation Tilapia fish (Jilabi kendai)
Habitat fragmentation is the process (Oreochromis mosambicus) introduced from
where a large, continuous area of habitat is east coast of South Africa in 1952 for its high
both, reduced in area and divided into two or productivity into Kerala’s inland waters, became
more fragments. Fragmentation of habitats invasive, due to which the native species such
like forest land into crop lands, orchard lands, as Puntius dubius and Labeo kontius face local
plantations, urban areas, industrial estates, extinction.
transport and transit systems has resulted in the The introduction of the Nile Perch, a
destruction of complex interactions amongst predatory fish into Lake Victoria in East Africa
species, (food chain and webs) destruction of led to the extinction of an ecologically unique
species in the cleared regions, annihilation of assemblage of more than 200 nature species
species restricted to these habitats (endemic) of cichlid fish in the lake.
and decreased biodiversity in the habitat
fragments. Animals requiring large territories Papaya Mealy Bug (Paracoccus marginatus)
such as mammals and birds are severely is native of Mexico and Central America, is
affected. The elephant corridors and migratory believed to have destroyed huge crops of papaya
routes are highly vulnerable. The dwindling in Assam, West Bengal and TamilNadu.
of many well-known birds (sparrows) and
Global Climate changes
animals can be attributed to this.
Industrialization is a major contributor
Over exploitation: to climate change and a major threat to
biodiversity. Energy drives our industries,
We depend on nature for our basic needs
which is provided by burning of fossil fuels.
such as food and shelter. However, when

www.tntextbooks.in
This increases the emission of CO2, a GHG, Coextinctions

leading to climate change. Due to large scale Coextinction of a species is the loss of
deforestation, the emitted CO2 cannot be a species as a consequence of the extinction
absorbed fully, and its concentration in the of another. (Eg., orchid bees and forest trees
air increases. Climate change increases land
by cross pollination). Extinction of one will
and ocean temperature, changes precipitation
automatically cause extinction of the other.
patterns and raises the sea level. This
Another example for co-extinction is the
inturn results in melting of glaciers, water
connection between Calvaria tree and the
inundation, less predictability of weather
patterns, extreme weather conditions, extinct bird of Mauritius Island, the Dodo. The
outbreak of squalor diseases, migration of Calvaria tree is dependent on the Dodo bird
animals and loss of trees in forest. Thus, for completion of its life cycle. The mutualistic
climate change is an imminent danger to the association is that the tough horny endocarp of
existing biodiversity (Fig. 12.4). the seeds of Calvaria tree are made permeable
by the actions of the large stones in bird's
Human
gizzard and digestive juices thereby facilitating
Anthropogenic Ecosystem
GHG and Aerosol Services easier germination. The extinction of the Dodo
Emissions
Climate
Land-use
Change
bird led to the imminent danger of the Calvaria
Impacts
tree coextinction.
Climate
Climate
Climate
Impacts
Biodiversity Intensive agriculture
Regulation Spread of agriculture is sometimes at
Ecosystem
the cost of wetlands, grasslands and forests.
Biogenic
GHG and Aerosol
Function Intensive agriculture is based on a few high
Emissions
yielding varieties. As a result, there is reduction
Biogeochemical
Cycles in the genetic diversity. It also increases
vulnerability of the crop plants to sudden attack
Fig. 12.4 Links between biodiversity,
Links between Biodiversity, Climate Change and Human Well-being
climate change and human well - being by pathogens and pests. There are only few
varieties of traditional paddy strains today due
Shifting or Jhum cultivation to use to hybrid varieties in Tamil Nadu.
(Slash-and-burn agriculture)
In shifting cultivation, plots of natural 12.5.1 Loss of Biodiversity
tree vegetation are burnt away and the cleared Species have been evolving and dying out
patches are farmed for 2-3 seasons, after (extinction) ever since the origin of life. However,
which their fertility reduces to a point where species are now becoming extinct at a faster rate.
crop production is no longer profitable. The This is destabilizing the ecological stability and
farmer then abandons this patch and cuts the distribution of biological diversity on earth.
down a new patch of forest trees elsewhere Human activities greatly contribute to the loss of
for crop production. This system is practiced biodiversity. Natural resources such as land, water
in north-eastern regions of India. When vast and organisms are indiscriminately exploited by
areas are cleared and burnt, it results in loss of human beings.
forest cover, pollution and discharge of CO2
According to the Convention of
which in turn attributes to loss of habitat and
Biological Diversity, direct and indirect
climate change which has an impact on the
human activities have a detrimental effect
faunal diversity of that regions.

www.tntextbooks.in
on biodiversity. Direct human activities like a. Himalaya (the entire Indian Himalayan
change in local land use, species introduction region)
or removal, harvesting, pollution and climate b. Western Ghats
change contribute a greater pressure on loss of c. Indo-Burma: includes entire North-eastern
biodiversity. Indirect human drivers include India, except Assam and Andaman group of
demographic, economic, technological, cultural Islands (and Myanmar, Thailand, Vietnam,
and religious factors. Laos, Cambodia and Southern China)
Even though new species are being d. Sundalands: includes Nicobar group
discovered, there is little hope for adding new of Islands (and Indonesia, Malaysia,
species through speciation into the biodiversity Singapore, Brunei, Philippines)
treasure. Monsoon failure, global warming, 12.5.3 Endangered organisms
depletion in ozone layer, landslides in hilly states, A species that has been categorized as
pollution are a few indirect effects of human very likely to become extinct is an Endangered
activities which results in the loss biodiversity. species. Endangered (EN), as categorized by the
IUCN Red List (2004) documents the extinction International Union for Conservation of Nature
of 784 species in the 500 years. (IUCN) Red List, is the second most severe
It is estimated that the current rate of conservation status for wild populations in the
biodiversity loss is 100 to 1000 times higher IUCN's scheme after Critically Endangered
than the naturally occurring extinction rate and (CR).
is still expected to grow in the future. This loss In 1998 there were1102 animal and 1197
of biodiversity has a immense impact on plant plant species in the IUCN Red List. In 2012,
animal and human life. The negative effects the list features 3079 animal and 2655 plant
include dramatic influence on the food web. species as endangered (EN) worldwide.
Even reduction in one species can adversely
affect the entire food chain which further leads One more species goes extinct...
to an overall reduction in biodiversity. Reduced
biodiversity leads to immediate danger for food
security by reducing ecosystem services.
12.5.2 Hotspots
Hotspots are areas characterized with high
concentration of endemic species (the organisms
which are exclusively restricted to a given area) George the tree snail (Achatinella
experiencing unusual rapid rate of habitat apexfulva) died on January 1, 2019, at
modification loss. Norman Myers defined hot spots the age of 14. He was the last snail of his
as “regions that harbour a great diversity of endemic species, and is emblematic of the loss of
species and at the same time, have been significantly native Hawaiian molluscs.
impacted and altered by human activities.”
A hotspot is a region that supports at least 12.5.4 Extinction
1500 endemic vascular plant species (0.5% of the Species is considered extinct when none
global total) has lost more than 70% of its original of its members are alive anywhere in the
vegetation. There are 35 biodiversity hotspots world. If individuals of a species remain alive
in the world. India is home to four biodiversity only in captivity or other human controlled
hotspots (as per ENVIS). They are conditions, the species is said to be extinct in

www.tntextbooks.in
the wild. In both of these situations, the species changes, predators and diseases. A small
would be considered globally extinct. A species population can get extinct sooner than the
in considered to be locally extinct when it is no large population due to inbreeding depression
longer found in an area it once inhabited but is (less adaptivity and variation).
still found elsewhere in the wild. ii. Mass extinction: The earth has experienced
In the 450 million years of life on Earth, quite a few mass extinctions due to
there had been 5 mass extinctions, which had environmental catastrophes. A mass
eliminated at least 50% of the species of flora extinction occurred about 225 million years
and fauna on the globe. ago during the Permian, where 90% of shallow
The extinction of species is mainly water marine invertebrates disappeared.
due to drastic environmental changes and iii. Anthropogenic extinction: These are
population characteristics. abetted by human activities like hunting,
There are three types of Extinctions habitat destruction, over exploitation,
i. Natural extinction: It is a slow process urbanization and industrialization. Some
of replacement of existing species with examples of extinctions are Dodo of
better adapted species due to changes in Mauritius and Steller’s sea cow of Russia.
environmental conditions, evolutionary Amphibians seem to be at higher risk of
extinction because of habitat destruction.
Project Tiger: The Government of India The most serious aspect of the loss of
launched the ‘Project Tiger’ in 1973 to biodiversity is the extinction of species. The
protect our national animal. From 9 tiger unique information contained in its genetic
reserves since its inception, the Project material (DNA) and the niche it possesses are
Tiger coverage has increased to 50 at lost forever.
present. Project Tiger is an ongoing
Centrally Sponsored Scheme of the 12.6 IUCN
Ministry of Environment and Forests,
The International Union for Conservation
providing central assistance to the states
of Nature (IUCN) is an organization working in
for tiger conservation in designated tiger
the field of nature conservation and sustainable
reserves. Project Tiger was launched in the
use of natural resources. It was established in
Jim Corbett National Park, Uttarakhand
1948 and located at Gland VD, Switzerland. It is
in1973. The project ensures a viable
involved in data gathering and analysis research,
population of Bengal tigers in their natural
field projects and education on conservation,
habitats, protecting them from extinction
sustainable development and biodiversity.
and preserving areas of biological
IUCN’s mission is to influence, encourage
importance as a natural heritage.
and assist societies throughout the world to
The National Tiger Conservation
conserve nature and to ensure that any use of
Authority (NTCA) is a statutory body of
natural resources is equitable and ecologically
the Ministry, created under the Wildlife
sustainable. It influences governments and
(Protection) Act, 1972. India holds over
industries through partnerships by providing
half the world’s tiger population. According
information and advice. The organization
to the latest tiger census report released on
collects, compiles and publishes the IUCN red
20th January 2015 by NTCA, the current
list of threatened species and their conservation
tiger population is estimated at 2,212.
status in the world. It plays a vital role in the

www.tntextbooks.in
implementation of several international The large-scale loss of biodiversity and

conventions on nature conservation and its global impact makes conservation the
biodiversity. need of the hour.
Red Data Book Conservation of biodiversity is protection
Red Data book or Red list is a catalogue and scientific management of biodiversity
of taxa facing risk of extinction. IUCN – so as to maintain it at its optimum level and
International Union of Conservation of Nature derive sustainable benefits for the present as
and Natural Resources, which is renamed well as future generations. It aims to protect
as WCU – World Conservation Union species from extinction and their habitats and
(Morges Switzerland) maintains the Red Data ecosystems from degradation.
book. The concept of Red list was mooted in
General strategies in conservation
1963. The purpose of preparation of Red List
are: • identify and protect all threatened species
• To create awareness on the degree of threat • identify and conserve in protected areas
to biodiversity the wild relatives of all the economically
• Identification and documentation of species important organisms
at high risk of extinction • identify and protect critical habitats for
• Provide global index on declining feeding, breeding, nursing, resting of each
biodiversity species
• Preparing conservation priorities and help • air, water and soil should be conserved on
in conservation of action priority basis
• Information on international agreements on • wildlife Protection Act should be
conservation of biological diversity implemented
Red list has eight categories of species
There are two aspects of conservation strategies
i) Extinct ii) Extinct in wild iii) Critically
(Table 12.4).
Endangered iv) Endangered v) Vulnerable
vi) Lower risk vii) Data deficiency viii) Not i) In-situ conservation
evaluated. ii) Ex-situ conservation
12.7 Biodiversity and its 12.7.1 In-situ Conservation

(Conservation in the natural
conservation habitat)
The natural resources
This is the conservation of genetic
of the Earth, including air,
resources through their protection within a
water, land, flora and fauna
natural or manmade ecosystem in which they
of natural ecosystems must
occur. It is conservation and protection of the
be safeguarded for the
whole ecosystem and its biodiversity at all levels
benefit of the present and future generations
in order to protect the threatened species.
through careful planning and management,
as appropriate – Principle of the Stockholm Maximum protection of biodiversity
Declaration, 1972. hotspots regions with very high levels of species
richness. Although all the biodiversity hotspots
together cover less than 2 percent of the earth
land area, the number of species they harbour is

www.tntextbooks.in
extremely high and protection of these hotspots poaching, hunting, grazing and cultivation are
could reduce the ongoing mass biodiversity loss. not permitted. They are large areas of scenic
and national beauty maintained for scientific
Protected Areas
educational and recreational use. They are not
These are biogeographical areas where
used for commercial extraction of resources.
biological diversity along with natural and
Kaziranga National park is a protected area for
cultural resources is protected, maintained and the one Horned Rhinoceros in Assam.
managed through legal measures. protected
areas include national parks, wild life sanctuaries, Wild Life Sanctuaries (WLS)
community reserves and biosphere reserves. Any area other than the area comprised with
World Conservation monitoring centre has any reserve forest or the territorial waters can be
recognized 37,000 protected areas world-wide. notified by the State Government to constitute as
a sanctuary if such area is of adequate ecological,
India has about 771 protected areas covering
faunal, floral, geomorphological, natural or
162099 km2 comprising of National Parks (104),
zoological significance. This is for the purpose
Wild Life Sanctuaries (544), biosphere reserves
of protecting, endangered factual species. Some
(18) and several sacred groves. restricted human activities are allowed inside
National Parks (NP) the Sanctuary area details of which are given in
It is a natural habitat that is notified by CHAPTER IV, of the Wildlife Protection Act
the state government to be constituted as a (WPA) 1972. Ecotourism is permitted, as long as
National Park due to its ecological, faunal, floral, animal life is undisturbed.
geomorphological, or zoological association of There are 544 existing wildlife sanctuaries in
importance. No human activity is permitted India covering an area of 118,918 km2, which is
inside the national park except the activities 3.62 % of the geographical area of the country
(National Wildlife Database, 2017).
permitted by the Chief Wildlife Warden of the
state under the conditions given in CHAPTER Sanctuaries are tracts of land where wild
IV, of the Wildlife Protection Act (WPA) 1972 animals and fauna can take refuge without being
(Table 12.2). hunted or poached. Other activities like collection
of forest products, regulated harvesting of timber,
Table 12.2 National Parks in Tamil Nadu
private ownership of land are permitted. Periyar
National Parks Year of wild life sanctuary in Kerala is famous for the
District(s)
in Tamil Nadu establishment Indian Tiger and Asiatic Elephant (Table 12.3).
Guindy NP 1977 Chennai
Gulf of Mannar Ramanathpuram Table 12.3 Wild Life Sanctuaries in Tamil Nadu
1986
Marine NP and Tuticorin Prominent WLS Year of
Indira Gandhi Districts
in Tamil Nadu establishment
1976 Coimbatore
(Annamalai) NP
Vedanthangal
Mudumalai NP 1940 Nilgiris 1936 Chengalpet
Lake Birds WLS
Mukurthi NP 2001 Nilgiris
Mudumalai WLS 1942 Nilgiris
There are 104 existing national parks in Point Calimere
1967 Nagapattinam
India covering an area of 40,501 km2, which is WLS
1.23% of the geographical area of the country Indira Gandhi
(National Wildlife Database, Aug. 2018). (Annamalai) 1976 Coimbatore
WLS
National Park is an area which is strictly reserved
for the betterment of wildlife and biodiversity Mundanthurai
1988 Tirunelveli
and where activities like development, forestry, WLS

www.tntextbooks.in
THE MADRAS CROCODILE BANK TRUST Biosphere Reserve (BR)

Biosphere Reserve (BR) is an international
The Madras Crocodile Bank Trust and Centre
designation by UNESCO for representative
for Herpetology was the brain child of the
parts of natural and cultural landscapes
legendary Romulus Whitaker and a handful
extending over large area of terrestrial or
of like-minded conservation visionaries, who
coastal/ marine ecosystems or a combination
began work on the facility in 1976. It aimed to
thereof. BRs are designated to deal with the
save India’s dwindling crocodilian population.
conservation of biodiversity, economic and
The mission is to promote the conservation
social development and maintenance of
of reptiles and amphibians and their habitats
associated cultural values. Biosphere Reserves
through education, scientific research and
are thus special environments for both people
capture breeding. The crocodile bank remains a
and nature and are living examples of how
world leader in the field of frontline conservation
human beings and nature can co-exist while
and the preservation of natural landscapes. The
respecting each other’s needs. The Biosphere
Crocodile Bank currently consists of a large
Reserve Programme is guided by UNESCO’s
reptile park near Chennai and several field
Man and Biosphere (MAB) programme, as
projects located throughout the subcontinent
India is a signatory to the landscape approach
reaching as far as the Nicobar Islands. About
supported by MAB programme. The scheme
half a million people visit the bank every year,
called Biosphere Reserve was implemented
making it one of the most popular tourist
by the Government of India in 1986. There
attractions along the East Coast Road.
are 18 Biosphere Reserves in the country.
Arignar Anna Zoological Park, Vandalur of installing CCTV Cameras for both visitors
Arignar Anna Zoological Park is spread and animal management under the name
over an area of 602 hectares. of Reserve of Zoo e-Eye. 24 x 7 Animal Live Streaming
Forest at Vandalur, Chennai. It is one of the was introduced for the benefit of the visitors
largest zoo in South East Asia in terms of for the first time in the world. Vandalur Zoo
area. The Zoological Park exhibits different Mobile Application was introduced to provide
classes of animals – it has around 2500 wild services to the visitors like facility to book
animals of nearly 180 species which includes tickets, Zoo navigation, Animal information
Mammals, Birds and Reptiles. 34 years since in text and audio format. Digital payments at
its establishment, the Zoological Park has ticket counters are also available.
emerged as a successful ex-situ conservation The Zoo school has been involved
centre and a captive breeding centre for many in education and outreach programmes.
endangered species like Royal Bengal Tiger, One such successful programme is
Lion Tailed Macaque, Nilgiri Langur, Gray ‘Zoo Ambassador’ which is been conducted
Wolf, etc., for school children. In the year 2018, more
The Zoo has many attractive features like than 400 students were trained and titled as
Butterfly Park, Childrens Park, Walk Through Zoo Ambassadors. The Zoo also has a Rescue
Aviary, Lion & Deer Safari, Forest Museum, Centre which accommodates rescued wild
Interpretation centre, etc., which attracts animals and treats them to come out of stress.
more than 21 lakh visitors every year. The Source: Director, Arignar Anna Zoological
Zoo has strengthened its protection by means Park, Vandalur, Chennai

www.tntextbooks.in
Agasthyamalai (Karnataka - Tamil Nadu - Table 12.4 Difference between Insitu and
Kerala), Nilgiri (Tamil Nadu - Kerala), Gulf of Exsitu Conservation
Mannar (Tamil Nadu) are the BRs notified in Insitu Conservation Exsitu Conservation
Tamil Nadu It is the on-site This is a conservation
conservation or the strategy which
Sacred Groves conservation of genetic involves placing of
A sacred grove or sacred woods are any resources in natural threatened animals
grove of trees that are of special religious populations of plant or and plants in special
importance to a particular culture. Sacred animal species. care locations for
groves feature in various cultures throughout their protection.
the world. It is the process It helps in recovering
of protecting an populations or
12.7.2 Ex-Situ Conservation endangered plant or preventing their
It is conservation of selected rare plants/ animal species in its extinction under
animals in places outside their natural homes. It natural habitat, either by simulated conditions
includes offsite collections and gene banks. protecting or restoring that closely resemble
the habitat itself, or by their natural habitats.
Offsite Collections defending the species
They are live collections of wild and from predators.
domesticated species in Botanical gardens, National Parks, Zoological parks and
Zoological parks, Wildlife safari parks, Arborata Biosphere Reserve, Botanical gardens
(gardens with trees and shrubs). The organisms Wild Life Sanctuaries are common exsitu
are well maintained for captive breeding form insitu conservation
programmes. As a result, many animals which conservation strategies. programs.
have become extinct in the world continue to be
maintained in Zoological Parks. As the number 12.7.3 Role of WWF and CITES
increases in captive breeding, the individuals World Wild Fund for Nature (WWF) is
are selectively released in the wild. In this way an international non-governmental charitable
the Indian crocodile and gangetic dolphin have trust founded in 1961, with headquarters at
been saved from extinction. Gland, Vaud, Switzerland. It aims at wildness
preservation and the reduction of human impact
Gene Banks
on the environment. It was formerly named the
Gene banks are a type of biorepository
World Wildlife Fund. The living planet report is
which preserve genetic materials. Seeds of
being published every two years by WWF since
different genetic strains of commercially
1998.
important plants can be stored in long periods
The vision of WWF is to conserve nature and
in seed banks, gametes of threatened species
reduce the most pressing threats to the diversity
can be preserved in viable and fertile condition
of life on Earth by conserving the world’s most
for long periods using cryopreservation
ecologically important regions, protect and
techniques.
restore species and their habitats, strengthen
However, it is not economically feasible
local communities’ ability to conserve the natural
to conserve all biological wealth and all the
resources they depend upon and to ensure that
ecosystems. The number of species required
the value of nature is reflected in decision made
to be saved from extinction far exceeds the
by individuals, communities, governments and
conservation efforts.
businesses.

www.tntextbooks.in
CITES in the preservation of biodiversity. The strategy

The Convention on International Trade involves developing alternate resources and sources
in Endangered Species (CITES) of wild fauna of income for those who depend on the protected
and flora, also known as the Washington natural habitat (forest) for their livelihood.
Convention, is a multilateral treaty to protect FREEP is conducting pilot
endangered plants and animals. It was drafted from ecodevelopment programmes in the Kalakad-
a resolution adopted from a meeting of members Mundanthurai Tiger Reserve (KMTR) in Tamil
of the IUCN in 1963 and opened for signature in Nadu. The reserve contains a unique and varied
1973. It came into force during July 1975. array of flora ranging from thorn and dry
teak to tropical evergreen, and supports a rich
ZOOLOGICAL SURVEY OF INDIA variety of birds and mammals, including tigers,
The Zoological Survey of India (ZSI) leopards and elephants. The last tiger refuge in
was established in 1916 to promote survey, Tamil Nadu, the KMTR is one of 50 sites covered
exploration and research leading to the under the Indian Government’s Project Tiger, a
advancement in our knowledge of various programme receiving international assistance
aspects of biodiversity of our country. to enhance tiger habitat.
The objectives of ZSI are:
CONVENTION ON BIOLOGICAL
•
Exploration, Survey, Inventorying and
DIVERSITY (CBD)
Monitoring of faunal diversity in various
The United Nations convention on
states, ecosystems and protected areas of
Biological Diversity, known as CBD in
India.
short, was signed by India and 172 other
•
Periodic review of the status of
nations on December 29, 1993. The CBD
threatened and endemic species.
was an attempt to establish an international
•
Preparation of Red Data Book and
program for conserving and using the
Fauna of India.
world’s biological resources. This historical
•
Biological studies on selected
treaty recognizes the “sovereign right of
important species.
nation over their genetic resources” and
•
Maintenance and Development of
considers “appropriate access to genetic
National Zoological Collections.
resources.” The treaty also takes into account
It aims to ensure that international trade in the “fair and equitable sharing” of benefits
specimens of wild animals and plants should not arising from the use of genetic resources.
be a threat to the survival of the species in the
wild. It accords varying degrees of protection to Over 100 villages are now participating
more than 35,0000 species of animals and plants. in the KMTR project. Communities and
individual farmers have planted fuelwood and
12.8 Restoration of Degraded fodder plantations. Some villagers have installed
Habitats cow dung-based gas plants for home fuel needs
Biodiversity conservation through eco and are using fuel-saving pressure cookers and
development – an Indian case study more efficient wood-burning stoves (smokeless
The Forestry Research Education and chulas). Loans for a wide array of alternative
Extension Project FREEP (A World Bank income-generating activities such as dairy and
Initiative) in India is employing a strategy called poultry farming, tailoring, coconut leaf weaving,
‘ecodevelopment’ which enlists local communities and setting up tea and dry goods shops are made

www.tntextbooks.in
available. Thus, the eco-development programme Summary

at the KMTR is rapidly coming to be seen as a Biodiversity is the variety of all life on Earth,
model for conserving biodiversity through local encompassing genetic, species and ecosystem
participation. diversity. Today’s biodiversity is the fruit of
12.9 Bio Diversity Act (BDA) billions of years of evolution, shaped by natural
The Convention on Biological Diversity processes and, increasingly, by the influence of
(CBD) is a United Nations initiative to protect humans. To date, about two million species have
Biodiversity and encourage the sustainable been identified on Earth.
use of natural resources. The convention was Biodiversity supplies a large number of goods
held in 1992 at the ‘Earth Summit’ in Brazil. and services that sustain human life, including
India is a signatory of the CBD. The Biological the provision of food, fuel and building materials;
Diversity Act, 2002 is an Act of the Parliament purification of air and water; stabilization and
of India for preservation of biological moderation of the earth’s climate; moderation of
diversity in India, and provides mechanism floods, droughts, temperature extremes and wind
for equitable sharing of benefits arising out forces; generation and renewal of soil health;
of the use of traditional biological resources maintenance of genetic resources as inputs to
and knowledge. The Act was enacted to meet crop varieties and livestock breeds, medicines,
the obligations under Convention on Biological and other products; and cultural, recreational
Diversity (CBD), to which India is a party. and aesthetic benefits.
The National Biodiversity Authority (NBA)
Over the past few hundred years,
was established by the Central Government in
biodiversity has faced major challenges,
2003 to implement India’s Biological Diversity
including a growing demand for biological
Act (2002). The NBA is a Statutory Body and
resources caused by population growth
it performs facilitative, regulatory and advisory
and increased consumption. This increased
functions for the Government of India on issues
exploitation of biological resources has resulted
of conservation, sustainable use of biological
resources and fair and equitable sharing of in the loss of species at levels currently estimated
benefits arising out of the use of biological to be 100 times faster than the natural rate of
resources. The Headquarters of the NBA is loss prior to significant human intervention.
situated in Chennai. Though many species were lost and new ones
formed, it is likely we will lose all this natural
Fresh water, wildlife, food and wealth in less than two centuries, if the present
climate are things which are not just ‘Nice rate of biodiversity losses persist.
to have’ …. they are ‘Need to have’. These
The biodiversity and its conservation is
are things indispensable for the survival of
the important global issue of international
mankind….. together, we can protect LIFE
concern. Recognition of this problem has
on our planet – including our own.
made scientists and policy makers to work and
develop mechanisms to document, conserve
and sustainably use biodiversity.
The younger generation should be made
to realize the critical state of biodiversity today
and volunteer to protect and conserve it, so as
to enable the future generations get to enjoy the
benefits of Nature.

www.tntextbooks.in
Evaluation a) Both Assertion and Reason are true

1. Which of the following and Reason explains Assertion correctly.
regio n has maximum b) Both Assertion and Reason are true but
biodiversity Reason is not the correct explanation of
a) Taiga Assertion.
c) Assertion is true , but Reason is false.
b) Tropical forest
d) Both Assertion and Reason are false.
c) Temperate rain forest
d) Mangroves 10. Define endemism.
11. How many hotspots are there in India?
2. Conservation of biodiversity within their
Name them.
natural habitat is
12. What are the three levels of biodiversity?
a) Insitu conservation
13. Name the active chemical found in the
b) Exsitu conservation
medicinal plant Rauwolfia vomitoria. What
c) In vivo conservation
type of diversity it belongs to?
d) In vitro conservation
14. “Amazon forest is considered to be the lungs
3. Which one of the following is not coming of the planet”-Justify this statement.
under insitu conservation 15. ‘Red data book’-What do you know about it?
a) Sanctuaries b) Natural parks 16. Compare and Contrast the insitu and exsitu
c) Zoological park d) Biosphere reserve conservation.
4. Which of the following is considered a 17. What are called endangered species? Explain
hotspots of biodiversity in India with examples.
a) Western ghats b) Indo-gangetic plain 18. Why do we find a decrease in biodiversity
c) Eastern Himalayas d) A and C distribution, if we move from the tropics
5. The organization which published the red towards the poles?
list of species is 19. What are the factors that drive habitat loss?
20. Alien species invasion is a threat to endemic
a) WWF b) IUCN c) ZSI d) UNEP
species – substantiate this statement.
6. Who introduced the term biodiversity? 21. Mention the major threats to biodiversity
a) Edward Wilson b) Walter Rosen caused by human activities. Explain.
c) Norman Myers d) Alice Norman 22. What is mass extinction? Will you encounter
one such extinction in the near future.
7. Which of the following forests is known as
Enumerate the steps to be taken to prevent it.
the lungs of the planet earth?
23. In north eastern states, the jhum cultivation
a) Tundra forest
is a major threat to biodiversity – substantiate
a) Rain forest of north east India
the statement.
b) Taiga forest
24. List out the various causes for biodiversity
c) Amazon rain forest
losses.
8. Which one of the following are at high risk 25. How can we contribute to promote
extinction due to habitat destruction biodiversity conservation?
a) Mammals b) Birds 26. Write a note on i) Protected areas,
c) Amphibians d) Echinoderms ii) Wild life sanctuaries, iii) WWF
9. Assertion: The Environmental conditions
of the tropics are favourable for
speciation and diversity of organisms.
Reason: The climate seasons, temperature,
humidity and photoperiod are more or less
stable and congenial.

www.tntextbooks.in
Concept Map
,PSRUWDQFH
RIELRGLYHUVLW\
7KUHDWVWR 3DWWHUQVRI
ELRGLYHUVLW\ ELRGLYHUVLW\
0DJQLWXGH
&DXVHVRI RI
ELRGLYHUVLW\ ELRGLYHUVLW\
ORVV
%LRGLYHUVLW\ +RWVSRWV
/RVVRI
ELRGLYHUVLW\
/HYHORI
ELRGLYHUVLW\
(QGDQJHUHG
RUJDQLVPV
&RQFHSWVRI
ELRGLYHUVLW\
([WLQFWLRQ
Red data
book Offsite Gene
Protected conservation banks
National
areas
parks
IUCN CITES
INSITU EXSITU
conservation Govt WWF conservation
Wild life Biosphere
Sanctuaries reserves Organisations
in conservation
Biodiversity conservation

www.tntextbooks.in
ICT CORNER
BIO DIVERSITY AND ITS CONSERVATION
Let us go out for an virtual exhibition,

to know about 30 endangered animals.
Procedure :
ype the URL or scan the QR code to open the activity page. Click “Explore the
Step -1: T
exhibition” to start the exhibition.
Step -2: Find the species name below the figure (Ex: Helmeted Hornbill). Find a grey dot right
next to the name. Click the same to know about its extinction.
Step -3: Click “<” on the left top of this page to play a video about the same species. Click “x” to
run to the homepage.
Step – 4 : On the left “ top first” option to load all the species. Middle square in a circle is for slide
show of all the species.
Step -5: On the right of the page, find ^ and down button to move on from one to the next.
Step 4
BIO DIVERSITY AND ITS CONSERVATION URL:

http://www.species-in-pieces.com/

*Allow flash player

www.tntextbooks.in
13
UNIT - V
Environmental
Issues
CHAPTER
Chapter Outline
13.1 Pollution
13.2 Air Pollution Environment is my prime teacher
13.3 Water Pollution - Masanabu Fukuoka
13.4 Noise Pollution
A
13.5 Agrochemicals
clean environment is very necessary
13.6 Biomagnification
to live a peaceful and healthy life. But
13.7 Eutrophication our environment is getting dirty day by day
13.8 Organic Farming and its because of our negligence. Earth is currently
Implementation facing a lot of environmental concerns like air
13.9 Solid Waste Management pollution, water pollution, and noise pollution,
13.10 Ecosan Toilets global warming, acid rain, biomagnification,
eutrophication, deforestation, waste disposal,
ozone layer depletion and climate change.
Over the last few decades, the exploitation of
Learning Objectives our planet and degradation of our environment
have gone up at an alarming rate. As our
•• Gain knowledge about our environment and its actions have not been in favour of protecting
importance.
•• Get to know about the effects and after effects of this planet, we have seen natural disasters
human activities on climate and ecosystem. striking us more often in the form of flash
•• Know about eco-friendly practices for pollution floods, tsunami and cyclones.
mitigation.
•• Acquire insights into solutions to “Every individual should be environmentally
environmental problems. aware, regardless of whether they work with
•• Understand the need for peoples’ environmental issues or not.”
participation in environmental
protection. 13.1 Pollution
•• Understand the importance of
clean environment.
Pollution is any undesirable change in the
physical, chemical and biological characteristics
of the environment due to natural causes and
human activities. The agents which cause
pollution are called pollutants. Pollution is
219

www.tntextbooks.in
classified according to the types of environment continue to accumulate (biomagnification).

that is affected. They are mainly air, water and Toxic elements like lead, mercury, cadmium,
soil pollution. chromium and nickel are such common
pollutants.
13.1.1 Classification of Pollutants
In terms of eco-system, pollutants can 13.2 Air Pollution
be classified into two basic groups – Non- Earth is surrounded by a gaseous envelope
degradable and degradable. Based on the time which is called atmosphere. The gaseous
taken to breakdown into their ingredients, blanket of the atmosphere acts as a thermal
degradable pollutants are classified as rapidly insulator and regulates the temperature of
degradable (non-persistent) and slowly the earth by selectively absorbing The UV
degradable (persistent). rays of solar radiation. The adverse effects
a) Rapidly degradable or non-persistent of pollution include depletion of Ozone
pollutants: These can be broken down by by Chlorofluorocarbons or CFCs, used as
natural processes. Domestic sewage and refrigerants and global warming by elevated
vegetable waste are examples of such pollutants. CO2 (industries, deforestation, and partial
b) Slowly degradable or persistent combustion).
pollutants: These are pollutants that remain The alterations or changes in the composition
in the environment for many years in an of the earth’s atmosphere by natural or human
unchanged condition and take decades or activities (anthropogenic factors) are referred as
longer to degrade, as in the case of DDT. Air Pollution. Pollutants include the abundant
c) Non-degradable pollutants: These presence of solid, liquid or gaseous substances
cannot be degraded by natural processes. produced by human or natural activity. The
Once they are released into the environment, nature and concentration of a pollutant
they are difficult to be eliminated and determines the severity of detrimental effects
Pollutant emissions
Lightning Fertilizer
Wildfires Volcanoes Oil & Gas Cities Industry, power plants, Airplanes, Cars, Trucks,
Sewage treatment Buses and Three & Two wheelers
Natural Area Stationary Transport
Fig. 13.1 Sources of air pollution.

Environmental Issues 220

www.tntextbooks.in
on organisms and human health. Along with •• Area sources – agricultural - wood /
atmospheric factors (humidity, precipitation, stubble burning, fireplaces
wind, air currents, altitude) prevailing at a place •• Natural sources – wind-blown dust,
and time, its effects can be far reaching and wildfires, volcanoes.
catastrophic.
13.2.2 Effects of Air Pollution
Air pollutants can be •• Affects all organisms as they depend on the
• discharge of dusts or particulate matter atmosphere for respiration.
(PM: 2.5-10 µm)
• discharge of gases (SO2, NO2, CO, CO2) •• Causes irritation in the throat, nose, lungs
and eyes. It causes breathing problems and
Carbon monoxide (CO) is produced mainly aggravates existing health conditions such
due to incomplete combustion of fossil fuels. as emphysema and asthma.
Automobiles are major causes of CO pollution
•• Contaminated air reduces the body’s
in large cities and towns Automobile exhausts,
defense mechanism and decreases the
fumes from factories, emission from power
body’s capacity to fight other infections
plants, forest fires and burning of fire-wood
in the respiratory system.
contribute to CO pollution.
•• Frequent exposure to polluted air increases
With rapid urbanization, major amount of
the risk of cardiovascular diseases.
carbon dioxide and sulphur dioxide (SO2) is
Breathing air that is filled with fine
released in the atmosphere. From automobiles,
particulate matter can induce hardening of
aeroplanes, power plants and other human
the arteries, triggering cardiac arrhythmia
activities that involving the burning of fossil
or even a heart attack.
fuels (coal, oil etc.,) CO2 is the main pollutant
that is leading to global warming. •• People who exercise outdoors can
sometimes be susceptible to adverse effects
Nitrogen oxides are also major air
of air pollution because it involves deeper
pollutants. Fossil fuel combustion and
and faster breathing. Hence it is advisable to
automobiles exhausts are the source of
walk or jog in the mornings in places with
nitrogen oxides. Sulphur dioxide and nitrogen
ample tree cover.
oxides are the major causes of acid rain.
•• Gas leaks can be lethal or affect the quality
Particulate matters are tiny particles of
of air in the affected area.
solid matter suspended in a gas or liquid.
Combustion of fossil fuels, fly ash produced •• CO in the atmosphere interferes with O2
in thermal power plants, forest fires, asbestos transport since haemoglobin has greater
mining units, cement factories are the main affinity for carbon monoxide. At low
sources of particulate matter pollution. concentration it causes headache and
blurred vision. In higher concentration, it
13.2.1 Sources can lead to coma and death.
The main sources of air pollution (Fig 13.1) are:
•• Transport sources – cars, buses, airplanes, ameer, an App provides
S
trucks, trains
hourly updates on the
•• Stationary sources – power plants, National Air Quality Index
incinerators, oil refineries, industrial (AQI) published by CPCB.
facilities, and factories
221 Environmental Issues

www.tntextbooks.in
13.2.3 Other notable effects of Air 13.2.4 Control of Air Pollution

Pollution Certain measures help to remove pollutants,
Smog is a type of air pollution caused by tiny reduce their presence or prevent their entry into
particles in the air. The word comes from a the atmosphere.
mixture of the words smoke and fog . •• Trees are the best remedy for urban
Today, smog generally refers to photochemical particulate and gaseous pollution
smog, which is created when sunlight reacts •• Forests act as carbon sinks and lungs of
with nitrogen oxides and volatile organic the planet
compounds found in fossil fuel emissions •• Catalytic converters in vehicles help to
from automobiles, factories, and power plants. reduce polluting gases drastically
These reactions create ground-level ozone and
•• Diesel exhaust filters in automobiles cuts
particulate matter, reducing visibility. Smog can
particulates
make breathing more difficult, especially for
people with asthma. •• Electrostatic precipitators reduce release
of industrial pollutants.
Smog also affects plants and animals. It
damages crops as well as causes health problems •• Cost effective air pollution treatment
in pets, farm animals and human beings. Smog systems like indoor plants and high
has also been known to cause corrosive damage performance biofilters can improve
to buildings and vehicles. indoor air quality.
Peroxyacetyl nitrate (PAN) is a secondary
pollutant present in photochemical smog. It The Taj Mahal, a UNESCO world
is thermally unstable and decomposes into heritage site, is facing deterioration and
peroxyethanol radicals and nitrogen dioxide damage by industrial gases due to several
gas causing eye irritation. industrial units around Agra. The white
marble has decolorized to yellow.
Global warming: Increase in the
concentrations of greenhouse gases such as
13.2.5 Legal Protection
CO2, methane, nitrous oxide, CFCs, and ozone
•• The Air (Prevention and Control of
causes greenhouse effect, warming of the earth,
Pollution) Act was enacted in 1981 and
resulting in sea level rise, submerging of islands
amended in 1987 for the prevention,
and sea shores of various parts of the world.
control and abatement of Air pollution in
Ozone depletion: Thinning of the
India.
stratospheric ozone layer is known as ozone
•• Traffic Emissions Standards: The
depletion. Such depletion causes the ‘ozone hole’,
Government has decided to enforce Bharat
resulting in poor screening of the harmful UV
Stage VI norms from 2020.
rays and increase in incidences of skin cancer.
Some of the common agents that deplete ozone •• The Green Bench and the National Green
are CFCs. Tribunal (NGT) give judicial safeguard to
environmental protection.
Acid rain: Acid rain is a form of precipitation
that contains acidic components, such as Steps taken by the Central and the State
sulphuric acid or nitric acid. It damages trees, governments in India:
crops and harms marine animals (coral reefs) •• Road traffic rationing, encourage public
and induces corrosion. transport, carpooling

www.tntextbooks.in
•• Increase green cover alongside roads 13.3 Water Pollution

(planting avenue trees)
13.3.1 Quality of Water
•• Promoting Swachh Bharat Abhiyan
Water is essential for life and for the health of
•• Enactment and Enforcement of stricter
the environment. As a valuable natural resource,
environmental laws
it comprises marine, estuarine, freshwater
•• Maintenance of air standards by proper (river and lakes) and groundwater environments
enforcement and monitoring that stretch across coastal and inland areas.
Water has two dimensions that are closely linked:
Average human quantity and quality. Water quality is commonly
consumption of Oxygen defined by its physical, chemical, biological and
per day = 550 L aesthetic (appearance and smell) characteristics.
Cost of 2.75 L Oxygen A healthy environment is one in which the water
cylinder = ₹ 6500 quality supports a rich and varied community of
Cost of 550 L of oxygen from tree organisms and protects public health.
= ₹ 13,00,000
13.3.2 Water Pollution
-----------------------------------------
Water pollution occurs when there is a
Oxygen production by one healthy
change in the chemical, physical or biological
tree per year =1,00,375 L
quality of water that has harmful effect(s) on
Cost of 2.75 L oxygen cylinder living organisms that consume it or live in it.
= ₹ 6500 Water pollution adversely affects water
Cost of 1,00,375 L of oxygen from one bodies due to the large amounts of natural
tree /year = ₹ 23,72,50,000 or man-made materials let into it. When it
becomes unfit for its intended use, water is
•• Reducing carbon emissions considered polluted.
•• Encourage use of renewable energy
13.3.3 Sources of Water Pollution
•• Limiting the sale of firecrackers and
developing eco-friendly crackers Even though water bodies or sources can be
polluted by natural causes, water pollution is
•• Make Environmental Impact Assessment
usually caused by human activities. There are
mandatory
three main types of sources: point sources,
Air Quality Index (AQI) is a number used non-point sources, leaks and spills.
by government agencies to communicate to the
Point sources: Discharge of pollutants at
public how polluted the air is at a given time.
specific locations through pipelines or sewers
Air Quality Index into the water body. Factory effluents, sewage,
AQI Air Pollution Level Colour underground mines, oil wells, oil tankers
and agriculture are common point sources
0-50 Good
(Fig. 13.2 a).
51-100 Moderate
Non-point sources: Sources that cannot be
101-150 Unhealthy for Sensitive Groups
traced to a single site of discharge like acid
151-200 Unhealthy
rain, dumping of the plastics in water bodies,
201-300 Very Unhealthy agriculture chemical run off are common
301+ Hazardous examples (Fig. 13.2 b).

www.tntextbooks.in
(a) containing waste water, sometimes in toxic

concentrations. These discharges can affect
temperatures of the water bodies as well as
dissolved oxygen level.
3. Agricultural wastes include fertiliser and
pesticide runoff from agricultural fields,
food processing waste, tree and saw dust
from logging operations and bacteria from
(b) sewage or livestock operations.
Water pollutants reach water bodies like
rivers, streams and the marine system by
precipitation, run-off and the groundwater by
seepage or percolation.
13.3.4 Effect of Water pollution on
Ecosystems
(c) 1. Destruction of ecosystems: Ecosystems,
especially aquatic systems, can be severely
affected or destroyed by water pollution.
Water pollutants affect existing niches and
habitats and the survival of organisms. Soil
fertility is affected and the system becomes
uninhabitable.
2. Disruption of food-chains: Water
Fig 13.2 Sources of water pollution pollution disrupts the natural food chains
as well as food webs. Pollutants such as
Leaks and Spills: This occurs mostly due to lead and cadmium are taken up by primary
ship collision, off shore oil rigs, oil leakages consumers where they can be lethal or
and discharges into sea (Fig. 13.2 c). get stored. Later, when these animals are
Sources of water pollution can also be classified consumed by secondary consumers, the
in three ways. They are municipal wastes, food chain can get disrupted at any trophic
industrial wastes, and agricultural wastes. level or result in enhanced concentration
of these pollutants (biomagnification). Hot
water from industries when released into
Sources of water pollution
the water bodies affects aquatic density and
diversity.
Municipal Industrial Agricultural 13.3.5. Effect of Water pollution on

wastes wastes wastes
Organisms
1. Water pollution can be lethal to aquatic
organisms and others that depend on these
1. Municipal waste water is from homes and water bodies.
commercial establishments.
Accidental oil spills from tanker ships can cause
2. Industrial discharge (effluents) may substantial environmental damage. Oil spreads
contain varieties of compounds such on the water surface, prevents the entry of light
as heavy metals (cadmium, chromium, and oxygen into the water. This increases BOD
lead), and organic / inorganic chemicals and COD, resulting in mass death of organisms

www.tntextbooks.in
and degradation of water quality. It also clogs prohibit the pollution of a stream or well
fish gills and the feathers of aquatic birds. by disposal of polluting matter.
3. The Central/State Pollution Control
On January 28, 2017, two cargo ships Boards have the power to advise the
collided off the Ennore coast in Chennai central/state government on various
causing oil to spill into the sea. Due to wave matters concerned with the prevention
action and the southern current, the spill and control of pollution of water.
spread over to 34 km down south affecting
4. The Ministry of Environment, Forest and
the coast. Beach sand also got spoiled by
Climate Change (MoEFCC) is the nodal
the oil sludge. It took more than a thousand
agency of the Central Government for
volunteers to clean the oil sludge.
the planning, promotion, co-ordination
2. Humans and other organisms can get and for overseeing the implementation
affected by diseases such as hepatitis and of India’s environmental and forestry
typhoid by consuming contaminated policies and programmes.
water and food. Excess of fluoride in 5. National river conservation plan (NRCP)
drinking water causes fluorosis. In many was enacted in 1995 to improve the water
poor nations, outbreak of water borne quality of the rivers, which are the major
diseases and epidemics are a result of fresh water resources in our country. This
contaminated water and poor or absence important assignment taken up under the
of water treatment processes. NRCP includes,
3. Water pollution can cause eutrophication To capture the raw sewage flowing into the
due to nutrient enrichment. This causes river through open drains and divert them
algal blooms which affect the quality for treatment.
of water bodies (Fig. 13.3). Red tides, if Setting up sewage treatment plants for
occur, can be lethal to aquatic organisms. treating the diverted sewage.
Construction of low cost sanitation toilets
to prevent open defecation on river banks.
Prevention
•• Regulate or control of pollutant(s)
discharge at the point of generation.
•• Wastewater can be pretreated by scientific
methods before discharge to municipal
treatment sources.
Fig. 13.3 Algal bloom •• Setting up of Sewage Treatment Plants
13.3.6 Control Measures (STP) and Effluent Treatment Plants (ETP).
1. Right to clean water is a fundamental •• Regulate or restrict the use of synthetic
right under the Indian Constitution fertilisers and pesticides.
(Article 21). •• Public awareness and peoples’ involvement
2. Water (Prevention and Control of is essential.
Pollution) Act, 1974, sections 17 to 40

www.tntextbooks.in
13.4.2 Effect of Noise Pollution

Assessment by CPCB
•• According to the USEPA (United States
The number of polluted stretches in
Environmental Protection Agency) there
India’s rivers has increased to 351 from
are direct links between noise and health.
302 (in 2006), and the number of critically
Heart disease, high blood pressure, stress
polluted stretches – where water quality
related illness, sleep disruption, hearing
indicators are the poorest – has gone
loss (deafness), and productivity loss are
up to 45 from 35 (Source: The Hindu,
the problems related to noise pollution.
17 September, 2018).
•• Increased stress and tension, nervousness,
irritability, anxiety, depression and panic
Case study attacks.
Namami Gange (National Mission •• Peptic ulcer, severe head ache,
for Clean Ganga) Programme is an memory loss.
Integrated Conservation Mission approved •• Marine animals are affected by noise
as the ‘Flagship Programme’ of the Union pollution from offshore activities and port
Government in June 2014 with a budget activities.
outlay of 20,000 crores to accomplish the •• Fire crackers frighten animals. Birds are
twin objectives of effective abatement of often affected by increased air traffic.
pollution, conservation and rejuvenation of
River Ganga. 13.4.3 Control
•• Planting trees in and around noise sources
13.4 Noise Pollution is an effective solution for noise pollution
Sound that is unwanted and undesirable or as plants are known to absorb noise and
can disrupts one’s quality of life is called as Noise. bring down sound levels.
When there is lot of ‘noise’ in the environment, •• Regular servicing and tuning of
it is termed as Noise Pollution. The intensity of automobile engines can effectively reduce
noise is meaured in decibels (dB). noise pollution by vehicles and machinery.
•• Workers should be provided with ear plugs
13.4.1 Sources of Noise Pollution
and earmuffs at work sites that generate
Vehicle engines, air horns, audio video high noise levels.
systems, trains, low flying aircrafts, factory
•• Lubrication of machinery and regular
machines, sirens, motors, drillers and servicing minimizes noise levels.
crushers, compressor machines, crackers,
•• Regulations should be imposed to restrict
explosives, modern supersonic transports are
the usage of loudspeakers in crowded
the common sources of noise pollution. areas and public places.
The threshold of pain is about 120 db.
World Health Organization has proposed that 13.4.4 Legal Protection
noise must be recognized as a major threat to Article 48-A and Article 51-A of the
human well-being. This is applicable for all Constitution of India, Noise Pollution
living organisms. (Regulation and Control) Rules 2000, and
Tamil Nadu State Environment Policy
2017 are some of the legal relief from noise
pollution.

www.tntextbooks.in
According to Noise Pollution (Regulation •• Consumption can lead to poisoning, side

and Control) Rules, 2000, the permissible effects and after effects.
limit of noise in areas categorized as •• Chemicals can cause skin rashes and
commercial is 65 decibels (dB) during day irritation of eyes.
and 55 dB during night. •• Many of these chemicals are reported to be
13.5 Agrochemicals carcinogenic.
Chemicals which are used in agriculture for •• They can trigger hormonal disorders and
growth of plants and pest control are called neurotoxicity.
agrochemicals or agrichemicals. •• Beneficial insects and animals can be
Overuse of agrochemicals have been observed affected.
to generate residues that cause nutrient
13.6 Biomagnification
imbalance, and
Food chains are components of all
•• May kill beneficial bacteria and soil
ecosystems. Producers and consumers form
organisms.
trophic levels in a chain through which energy
•• Can cause eutrophication in water bodies.
flow is carried out by the process of eating and
•• Affect aquatic animals and their productivity. being eaten. Usage, storage and transformation
•• Pesticide containing water, even in trace of food and biomolecules by metabolism are a
quantities is unfit for human consumption. normal process. Degradation or breakdown is
•• Particles (aerosols) and residues of these an essential part of any food chain and hence all
chemicals cause air pollution. naturally occurring substances are degradable.
•• Inhalation of contaminated air can cause
Magnification of
respiratory problems. DDT concentration
1. M
osquito Repellents Fish-eating
birds 10,000,000
DEET (n-n-diethylnetatoluamide)
and allethrin used in mosquito coils Large
fish 1,000,000
may cause itching, burning, tingling
sensation or numbness.
Small
2. C
olony collapse syndrome in Honey fish
100,000
bees due to pesticides/herbicides can

lead to destruction of hives and lower Zooplankton 10,000
agricultural productivity. !!Remember
bees are Nature’s best pollinators!!
Producer
1000
(Phytoplankton)
1
Water
1
Fig. 13.4 Biomagnification

www.tntextbooks.in
Biomagnification of DDT can radically accelerate the aging process.

When non-degradable substances enter the food This phenomenon is known as Cultural or
chain, they do not get metabolized or broken Accelerated Eutrophication.
down or expelled and instead get transferred up Nutrients stimulate the growth of algae, water
the tropic levels of the food chain. During this hyacinth and can cause clogging of canals, rivers
process, they show an increase in concentration and lakes as well as, displacing native plants. It
which is referred to as biomagnification. This causes unsightly foam and unpleasant odours,
results in increased toxicity and may even be and deprives the water of dissolved oxygen.
lethal. This phenomenon is well established for
mercury and DDT. Figure 13.4 schematically 13.7.1 Integrated Wastewater
shows biomagnification of DDT in an aquatic Management
food chain where the concentration of DDT is Wastewater Treatment
enhanced at successive trophic levels.
Wastewater or sewage originates from
13.7 Eutrophication domestic waste waters, industrial wastes and
animal wastes. Realizing the importance of
When run-off from land clean potable water, the Government passed the
containing nutrients reaches Water (Prevention and Control of Pollution)
water bodies like lakes, it Act in 1974, which made it mandatory to treat
results in dense growth of wastewater in treatment plants. The main
plant life. This phenomenon objective of a wastewater treatment process is
is called Eutrophication. Natural aging of to reduce organic and inorganic components in
lakes also leads to nutrient enrichment of its wastewater to a level that it no longer supports
water. In a lake, the water is cold and clear microbial growth and to eliminate other
(oligotrophic stage), supporting little life. With potentially toxic materials. Microorganisms
time, streams draining into the lake introduce mainly bacteria and some protozoa play an
nutrients such as nitrates and phosphates, which essential part in the treatment of sewage to
encourage the growth of aquatic organisms. make it harmless. Sewage contains pathogenic
Aquatic plants and animal life grow rapidly, and bacteria. These bacteria must be destroyed in
organic remains begin to be deposited on the order to prevent the spread of diseases. Sewage
lake bottom (mesotrophic stage) (Fig. 13.5). treatment is usually performed in the following
three stages (Fig. 13.6).
Pollutants from anthropogenic activities
like effluents from the industries and homes
Fig. 13.5 Stages of Eutrophication

www.tntextbooks.in
Preliminary Primary Secondary or biological Tertiary

treatment treatment treatment treatment
Primary Secondary Treated

Aeration zone Disinfection
Pretreatment settling tank settling tank sewage
(air + liquid water) zone
Waste for
water from dispose/reuse
cities and towns Remove
coarse solids Air 80-90% Organic
sand and grit solids
Recirculated to aeration tank
Primary Secondary
sludge Anaerobic sludge
sludge digester
Production of biogas
Fig. 13.6 Sewage treatment process
Primary treatment till the BOD is reduced. The greater the BOD of
Primary treatment involves the physical the waste water more is its polluting potential.
removal of solid and particulate organic and Once the BOD of sewage water is reduced
inorganic materials from the sewage through significantly, the effluent is then passed into
filtration and sedimentation. Floating debris a settling tank where the bacterial “flocs” are
is removed by sequential filtration. Then the allowed to sediment. This sediment is called
grit (soil and small pebbles) are removed by activated sludge. A small part of activated
sedimentation. All solids that settle form the sludge is pumped back into the aeration tank
primary sludge and the supernatant forms the to serve as the inoculum. The remaining major
effluent. The effluent from the primary settling part of the sludge is pumped into large tanks
tank is taken for secondary treatment. called anaerobic sludge digesters. Here, the
Secondary treatment or biological bacteria which grow anaerobically, digest the
treatment bacteria and the fungi in the sludge. During this
digestion, bacteria produce a mixture of gases
The primary effluent is passed into large
such as methane, hydrogen sulphide and CO2.
aeration tanks where it is constantly agitated
These gases form biogas and can be used as a
mechanically and air is pumped into it. This
source of energy.
allows vigorous growth of useful aerobic
microbes into floc (masses of bacteria Tertiary treatment
associated with fungal filaments to form mesh Tertiary treatment is the final process
like structures). While growing, these microbes that improves the quality of the waste water
consume the major part of the organic matter in before it is reused, recycled or released into
the effluent. This significantly reduces the BOD natural water bodies. This treatment removes
(Biochemical oxygen demand or Biological the remaining inorganic compounds and
substances, such as nitrogen and phosphorus.
oxygen demand). BOD refers to the amount
UV is an ideal disinfectant for wastewater since
of the oxygen that would be consumed, if all
it does not alter the water quality – except for
the organic matter in one litre of water were
inactivating microorganisms. UV is a chemical-
oxidized by bacteria. The sewage water is treated free process that can completely replace
the existing chlorination system and also

www.tntextbooks.in
Fig .13.7 (a) DEWATS System at Auroville (b) RZWT system at Aravind Eye Hospital
inactivates chlorine-resistant microorganisms

like Cryptosporidium and Giardia.
Case Study: Auroville, located in South India
near Puducherry has been experimenting
with natural wastewater recycling systems
(Decentralized Waste Water Treatment System
(DEWATS)) (Fig.13.7a). Such treatment
plants have now also been implemented in G. Nammalvar was a supporter and expert
Aravind Eye Hospital, Puducherry (Root of organic farming. He was an agricultural
Zone Wastewater Treatment (RZWT)) scientist, environmental activist celebrated for
(Fig.13.7 b) and the Chennai Mathematical his work on spreading Ecological farming &
Institute, Siruseri IT Park, Chennai. Organic farming. He was against the use of
chemical fertilisers and pesticides. He trained
13.8 Organic Farming and Its hundreds of farmers in natural farming.
Implementation Nammalvar was the author of several Tamil and
It is a method of farming system which English books on natural farming, pesticides
primarily aims at cultivating the land and raising & fertilisers and was featured in magazines &
crops in such a way, so as to keep the soil alive television programs. He founded the Nammalvar
and in good health by use of organic wastes Ecological Foundation for Farm Research and
(crop, animal and farm wastes, aquatic wastes) Global Food Security Trust or simply Vaanagam
and other biological materials along with at Karur, Tamilnadu. He developed social forest
beneficial microbes (biofertilizers) to release at Ammankurai and the Kolunji Ecological Farm
nutrients to crops for increased sustainable in Pudukottai. He and his friends made a 10-
production in an eco-friendly pollution free acre barren land into fertile cultivable land in the
environment. dry Pudukottai district. He planted 52 varieties
of trees in the same waste land extending in 20
13.9 Solid Waste Management acres. His organization ‘Kudumbam’ preserves
Every day, tonnes of solid wastes are disposed and regenerates hundreds of native flora and
off at landfill sites. This waste comes from fauna, in order to ensure a sustainable livelihood.
homes, offices, industries and various other
agricultural related activities. These landfill solvents, radioactive materials, e-waste
sites produce foul smell if waste is not stored and plastics are mixed up with paper and
and treated properly. When hazardous other scraps and burnt, they produce gases
wastes like pesticides, batteries containing such as dioxins. These gases are toxic and
lead, cadmium, mercury or zinc, cleaning carcinogenic. These pollute the surrounding

www.tntextbooks.in
Table 13.1 Major sources of solid waste

Waste category Source
Food wastes, plastics, paper, glass, leather, cardboard, metals, yard wastes,
Residential
ashes, tires, batteries, old mattresses
Industrial Packaging wastes, ashes, chemicals, cans, plastics, metal parts
Thin and thick plastics, food wastes, metals, paper, glass, wood,
Commercial
cardboard materials
Institutional Wood, paper, metals, cardboard materials, electronics
Construction
Steel materials, concrete, wood, plastics, rubber, copper wires, dirt and glass
and Demolition
Agriculture Agricultural wastes, spoiled food, pesticide containers
Syringes, bandages, used gloves, catheter, urine bags, drugs, paper,
Biomedical
plastics, food wastes, sanitary napkins and diapers, chemicals
Electronic items like used TVs, transistors, tape recorders, computer cabinets,
E-Waste
mother boards, CDs, cassettes, mouse, wires, cords, switches., chargers
air, ground water and can seriously affect

the health of humans, wildlife and our
environment (Table 13.1).
Solid Waste management includes the
activities and actions required to manage waste
from its inception to its final disposal. This
includes the collection, transport, treatment and
disposal of waste, together with monitoring and
Dr. Sultan Ahmed Ismail is an Indian soil regulation of the waste management process. It
biologist and ecologist from Tamil Nadu. is all about how solid waste can be changed and
His work has centered on techniques used as a valuable resource.
for recycling biodegradable waste into Case Study: The Corporation of Chennai
fertiliser using varieties of earthworms, looks after clearance and management of solid
and on soil bioremediation. waste in Chennai. Every day around 5400
Dr. Ismail received a D.Sc. in Zoology Metric Tonnes (MT) of garbage is collected
from the University of Madras for his from the city. Door to door collection of garbage
research on the role of earthworms in is done in most zones apart from sweeping,
soil ecology and waste management. collecting, and storing the waste in the specified
He works on vermicomposting as a
bins. At present garbage generated in Chennai
sustainable ecological practice. He has
is dumped at two sites. Proposals are there for
been instrumental in introducing as well
remediation of the existing landfill or scientific
as spreading awareness on environmental
issues, solid waste management, closure and to have integrated waste processing
vermicomposting, organic farming, facilities with waste to energy plants as one of
vermitech and waste management to the components at the existing Kodungaiyur
several educational institutions, industries and Perungudi sites.
and organic farmers in India and abroad.

www.tntextbooks.in
13.9.1 Waste management practices much of the radioactivity in nuclear reactors

a) Source segregation and accelerators is very short lived.
b) Composting 4. Concentrate and confine process -
1. Aerobic 2. Anaerobic Concentrating and containing is the
c) Vermicomposting objective of treatment activities for longer-
d) Biogas generation lived radioactivity. The waste is contained
in corrosion resistant containers and
e) Incineration
transported to disposal sites. Leaching of
13.9.2 Radioactive waste heavy metals and radionuclides from these
Radioactive wastes are generated during sites is a problem of growing concern.
various operations of the nuclear power plant. Control and Management
Radioactive waste can be in gas, liquid or solid Three ways are employed to manage nuclear
form, and its level of radioactivity can vary. The wastes
waste can remain radioactive for a few hours or
•• Spent Fuel Pools - The spent fuel discharged
several months or even hundreds of thousands
from the reactors is temporarily stored in
of years. Depending on the level and nature of
the reactor pool. The Spent fuel rods are
radioactivity, radioactive wastes can be classified used in stored cooling ponds. They protect
as exempt waste, Low and Intermediate level the surroundings from radiation and absorb
waste and High Level Waste. the heat generated during radioactive decay.
Radioactive waste management •• Vitrification method – This prevents
Radioactive waste management involves reaction or degradation of nuclear waste for
the treatment, storage, and disposal of liquid, extended periods of time and encased in dry
airborne, and solid effluents from the nuclear cement caskets.
industry. •• Geological Repositories - A deep geological
repository is a nuclear waste repository
The Three Mile Island excavated deep within a stable geologic
(Pennsylvania, United environment. It is suited to provide a high
States), Chernobyl level of long-term isolation and containment
(Pripyat, Ukraine) and without future maintenance. In India at
Fukushima Daiichi Tarapur and Kalpakkam, a wet storage
(Ōkuma, Japan) are nuclear disasters facility of Spent Fuel is the main mode of
the world has seen in the recent period. storage.
13.9.3 Medical waste

Methods of disposal of radioactive Any kind of waste that contains infectious
wastes are material generated by hospitals, laboratories,
1. Limit generation - Limiting the generation medical research centers, Pharmaceutical
of waste is the first and most important companies and Veterinary clinics are called
consideration in managing radioactive wastes. medical wastes.
2. Dilute and disperse - For wastes having Medical wastes contain body fluids like blood,
low radioactivity, dilution and dispersion urine, body parts and other contaminants,
are adopted. culture dishes, glasswares, bandages, gloves,
3. Delay and decay - Delay and decay is discarded needles, scalpels, swabs and tissues.
frequently an important strategy because

www.tntextbooks.in
Management: The safe and sustainable are also considered e-waste. Unauthorised
management of biomedical waste is the social processing of e-waste in developing countries
and legal responsibilities of people working in can lead to adverse human health effects and
healthcare centers. environmental pollution.
Waste disposal: Involved by incineration, Recycling and disposal of e-waste may
chemical disinfection, autoclaving, encapsulation, involve significant risk to the health of workers
microwave irradiation are methods of waste and communities in developed countries
disposals. Final disposal includes landfill and and great care must be taken to avoid unsafe
burying as per norms inside premises. exposure in recycling operations and leaking
13.9.4 E-Waste of materials such as heavy metals from landfills
Electronic waste or e-waste describes and incinerator ashes.
discarded electrical electronic devices as well 13.9.5 Plastic Waste – Solutions and
as any refuse created by discarded electronic Remedies
devices and components and substances Plastics are low molecular weight organic
involved in their manufacture or use. Their
polymers that are non-degradable in the natural
disposal is a growing problem because electronic
environment. They are used in several items,
equipment frequently contains hazardous
including cars, bulletproof vests, toys, hospital
substances. In a personal computer, for example,
equipment, carry bags and food containers.
there may be lead (Pb) in the cathode ray tube
Packaging materials used in supermarkets, retail
(CRT) and soldering compound, mercury
outlets, manufacturing industries, households,
(Hg) in switches and housing, and cobalt (Co)
hotels, hospitals, restaurants and transport
in steel components, among other equally
toxic substances. E-wastes are basically PCB companies are major contributors to plastic
(Polychlorinated biphenyl) based, which are waste generation. Plastic waste constitutes a
non-degradable (Fig.13.7). major part of municipal solid waste.
• Remedies: ‘4R’- Refuse, Reduce, Reuse

and Recycle mantra is the best available
remedy for plastic waste pollution.
• Tamil Nadu State government successfully
implemented the ban on single use
plastics from 1st January 2019.
13.10 Ecosan Toilets

About 150 liters of wastewater at an average
is generated by an Indian individual daily, and
a large amount of it is generated from toilets.
Ecological sanitation (EcoSan) is a sustainable
system for handling human excreta by using
dry composting toilets. EcoSan toilets not
only reduce wastewater generation but also
Fig.13.7 Types of E-wastes generate the natural fertilizer from recycled
human excreta, which forms an excellent
Used electronics which are destined for
substitute for chemical fertilizers. This
reuse, resale, salvage, recycling, or disposal
method is based on the principle of recovery

www.tntextbooks.in
and recycling of nutrients from excreta to Evaluation

create a valuable supply for agriculture.
1. Right to Clean Water is a
‘EcoSan’ toilets are being used in several parts
fundamental right, under
of India and Sri Lanka.
the Indian Constitution
Summary a) Article 12
Degrading natural environments, depleting b) Article 21
natural resources, pollution, vulnerability to c) Article 31
large scale environmental changes and hazards d) Article 41
are the core Environmental issues of today.
2. The ‘thickness’ of Stratospheric Ozone layer
Air pollution by fossil fuel burning and other is measured in/on:
anthropological activities like industrialization
a) Sieverts units b) Dobson units
is reaching alarming levels and affecting human
health and testing the survival of sensitive species. c) Melson units d)Beaufort Scale
Domestic and industrial sewage, and 3. As per 2017 statistics, the highest per capita
agricultural run-off are the most common reasons emitter of Carbon dioxide in the world is
for pollution of water bodies, resulting in reduced a) USA b) China
dissolved oxygen and increased Biochemical
c) Qatar d) Saudi Arabia
Oxygen demand of water bodies. Eutrophication
and algal blooms are regular occurrences today. 4. The use of microorganism metabolism to
Industrial wastewaters are often rich in toxic remove pollutants such as oil spills in the
chemicals, heavy metals and organic compounds water bodies is known as
which harm living organisms and may even a) Biomagnification b) Bioremediation
result in death of aquatic life.
c) Biomethanation d) Bioreduction
Noise pollution is a threat to human and
other animals. It can affect health and disturb 5. Which among the following always
peaceful habitats. Agrochemicals and its usages decreases in a Food chain across tropic
cause many ill effects in human beings, other levels?
organisms and soil. Agrochemicals can also a) Number b)Accumulated chemicals
cause biomagnification. The solution is to revert c) Energy d) Force
to non-chemical farming (use of biofertilisers,
biopesticides, protect pollinators) practices. 6. In the E-waste generated by the Mobile
Phones, which among the following metal
Generation of municipal wastes and their safe is most abundant?
disposal are major issues faced by communities
a) Copper b) Silver
today. Solid wastes create environmental
problems and must be disposed-off in safe ways. c) Palladium d) Gold
Disposal of solid wastes, radioactive wastes and 7. ___________ is/are an ideal disinfectant
e-wastes requires further efforts and research. for waste water.
Solid wastes like plastic can be combated by
a) U-V Rays b) Chlorination
practicing the 4R - refuse, reduce, reuse and
recycle. Ecosan toilets are some of the universally c) Boiling d) Ozonisation
accepted eco-friendly practices.

www.tntextbooks.in
8. SMOG is derived from : 14. What effect can fertilizer runoff have on an
a) Smoke b) Fog aquatic ecosystem?
c) Both A and B d) Only A
15. How can we control air pollution?
9. Excess of fluoride in drinking water
16. Discuss the role of an individual to reduce
causes:
environmental pollution.
a) Lung disease b) Intestinal infection
c) Fluorosis d) None of the above 17. How does recycling help reduce pollution?
10. Expand (i) CFC (ii) AQI (iii) PAN 18. Discuss briefly the following :
a. Catalytic converter
11. What is SMOG and how it is harmful for us?
b. Ecosan toilets
12. List all the wastes that you generate, at home,
19. What are some solutions to toxic dumping
school or during your trips to other places.
in our oceans?
Could you very easily reduce the generation
of these wastes? Which would be difficult or 20. Define BOD.
rather impossible to reduce?
21. What is referred to as biomagnification?
13. Write notes on the following:
a. Eutrophication 22. What are the effects of noise pollution?
b. Algal Bloom

www.tntextbooks.in
Glossary Cardiac arrhythmia– Any variation from the

normal rhythm in the heartbeat.
Abiogenesis – The emergence Carrier – An individual heterozygous for a
of life forms from non-living recessive gene that is not expressed.
chemical systems. In contrast
Catastrophic– Something or substance that
with spontaneous generation,
involves or causes a sudden terrible disaster.
abiogenesis is not a process
Chemical Oxygen Demand - A measure of the
that biologists think continues in a particular
oxygen required to oxidize soluble and particulate
environment, such as a planet or moon, once a
organic matter in water.
living system has emerged.
Cirrhosis - Scarring of the liver that impairs its
Acidogenesis – Conversion of simple organic
functioning.
materials into acetate, H2 and CO2 by acidogenic
Co-dominance – In a heterozygote, the dominant
bacteria.
and recessive allele is capable of phenotypic
Algal bloom – Presence of large amounts of
expression.
nutrients in waste water causing excessive growth
Coacervates – Are the microscopic spontaneously
of planktonic algae.
formed spherical aggregates of lipid molecules
Allergy - A hypersensitivity reaction that can
that are held together by electrostatic forces and
involve various deleterious effects.
that may have been precursor of cells. They are
Anthropogenic causes– Problems created
the cluster of molecular aggregates in colloidal
by human
form which are bounded by a membrane
Anthropology – The study of differences and and grows by absorbing molecules from the
similarities, both biological and cultural, in human environment. Oparin believed that life developed
populations. Anthropology is concerned with typical from coacervates.
biological and cultural characteristics of human
Cytolysis - Destruction of cells.
populations in all periods and in all parts of the
Cursorial – A cursorial organism is one
world.
that is adapted specifically to run. Cursorial
Antisense DNA– It is the non coding strand
organisms are typically adapted to long-
complementary to the coding strand in double
distance running at high speeds, rather than
stranded DNA. The antisense strand serves as a
animals with high acceleration over short
template for mRNA synthesis.
distances; thus, a cheetah is considered
Apoptosis– Is a form of programmed cell death cursorial, while a leopard is not.
that occurs in multicellular organisms.
Denaturing – Denaturing means separation or
Attenuated – Reduced in virulence. splitting of the double helix into single stands
Autoradiography – It is the use of X-ray or by breaking hydrogen bonds between the two
photographic film to detect radioactive materials. strands.
Bacteriophages– Viruses which infect bacterial Dendritic cells - Professional antigen presenting
cells. cells that have long membrane processes.
Biogeography - The scientific study of the Diapedesis - The movement of blood cells
geographic distribution of organisms. (leucocytes) out of the circulatory system and
Canopy – The canopy is the above ground towards the site of tissue damage or infection
portion of a plant community or crop, formed accompanying inflammation.
by the collection of individual plant crowns. Dinosaurs - a term coined by Sir Richard Owen
Carcinogens– Substances causing cancer. for giant extinct reptiles. Group of animals that
Glossary 236
XII Std Zoology Glossary EM.indd 236 12/15/2021 10:55:55 AM

www.tntextbooks.in
have bird-like and lizard-like facial appearance Galaxy – A specific arrangement of stars.
(Mesozoic). Gene bank-A facility established for the ex-situ
Distribution – The occurrence of different Conservation of individuals, seeds, tissues or
organisms in a given area and the way they are reproductive cells .
distributed in their space, specific time and Gene pool – The total gene content of a whole
utilization of their resources. species.
DO – Dissolved Oxygen is the amount of Genetic drift – An alteration in the gene
gaseous oxygen (O2) dissolved in the water. frequency.
Ecotourism - Travel undertaken to witness sites Geology – The study of origin and structure of
or regions of unique natural ecological quality Earth.
the provision of services to facilitate such travel. Glaciers– A large mass of ice that moves slowly.
El Nino– Unusual warming of surface waters in Haemophilia – A medical condition in which
the eastern tropical Pacific Ocean. the ability of the blood to clot is severely
Emphysema– A serious medical condition that reduced, causing the patient to bleed severely
occurs when the lungs become larger and do not from even a slight injury.
work properly, causing difficulty in breathing. Haemozoin - Toxic malarial pigment that
Endemism-The phenomenon in which the causes malaria fever.
organisms are exclusively restricted to a given Hallucination - The sensation of seeing, hearing
area. or sensing something that does not exist.
Endometriosis – An abnormal condition in Heterochromatin – Heterochromatin is a tightly
which endometrial tissue that normally lines packed form of DNA or condensed DNA.
the uterus grows outside . Homeostasis– It is the state of steady internal
Eohippus – Ancestor of modern horse. conditions maintained by living things.
Euchromatin – Euchromatin is a tightly packed Immune reaction – The production of
form of chromatin that is enriched in genes, and antibodies in response to antigens.
is often under active transcription. Interferon - An antiviral protein produced
Eutrophication - Excessive richness of nutrients from virally infected fibroblasts and leucocytes
in a lake or other water bodies frequently due to induces antiviral state in uninfected cells.
run of fertilizers from the land causing dense Intersex – An individual showing a combination
growth of plant life. of male and female characters.
Fibroids – Fibroids are abnormal growths Intra-Uterine Insemination (IUI)-Processed
formed on the outside, inside or in the walls of sperm sample is infused into the uterus, by
the uterus. passing the vagina.
Foetus – Developmental stage extending
Intracytoplasmic sperm injection (ICSI)-
from the ninth week of development
injection of a sperm directly into the ovum.
to birth.
Intra uterine transfer (IUT)-Transfer of
Fossorial – Fossorial (from Latin fossor,
embryo with more than 8 celled blastomeres
meaning "digger") is an animal adapted
to digging which lives primarily, but not into the uterus.
solely, underground. Some examples are In vitro fertilization (IVF)- Fertilization
badgers, naked mole-rats, clams, and mole outside the body in the laboratory.
salamanders. In vivo fertilization -Fusion of gametes within
the female.
237 Glossary

www.tntextbooks.in
Inflammation - e.g., Vaginitis- inflammation Nascent RNA – Nascent RNA is an immediately

in the vagina, urethritis- inflammation in the formed RNA. In this RNA no post transcriptional
urethra,endocervicitis- inflammation inside modification had occured.
the cervix, epididymitis - inflammation in the NBOD – Nitrogenous BOD.
epididymis, prostatitis - inflammation in the Nk cells - Natural Killer cells that kill infected
prostate gland. and tumor cells.
Keystone species-A species whose loss from Nondisjunction – Nondisjunction is the
an ecosystem would cause a greater than failure of homologous chromosomes or sister
average change in other species population or chromatids to separate properly during cell
ecosystem process. division.
Locus – The particular point on the chromosome NPK fertilizers– Fertilizers with Nitrogen (N),
at which the gene for a given trait occurs. Phosphorus (P) and Potassium (K).
Macrophage - A large, leucocyte derived from a Nucleosome – A morphologically repeating
monocyte that functions in phagocytosis. unit of DNA containing 190 base pairs of DNA
Malt - Mucosal Associated Lymphoid Tissue folded together with eight histone molecules.
collective terms for secondary lymphoid organs Null cell - A small population of peripheral
located along various mucous membrane blood lymphocytes that lack the membrane
surfaces including Peyer’s patches, tonsils, markers characteristic of B and T cells. Natural
appendix. killer cells are included in this group.
Mast cell - A bone marrow derived cell. Ontogeny – Life history of an individual.
Menarche – Starting of the first menstrual Oocyte – The encysted zygote of Plasmodium
period. Operon – A cluster of genes whose expression
Merozoite - A trophozoite of Plasmodium is controlled by a single operator.
found in RBC or liver cells. Panspermia – Units of life in the forms of
Methanogenesis – Conversion of acetate, H2 spores.
and CO2 into methane by methane producing Permafrost – Any ground that remains
bacteria. completely frozen (32°F (0°C) or colder) for
Molecular biology – The branch of biology at least two years straight. These permanently
which attempts to interpret biological events frozen grounds are most common in regions
in terms of the physico chemical properties of with high mountains and in Earth’s higher
molecules in a cell. latitudes near the North and South Poles.
Molecular Pharming – Production of active Phenotypic plasticity -The ability of
pharmaceutical substances in genetically one genotype to produce more than
moldified organisms. one phenotype when exposed to different
Mould – An impression of a complete organism environments.
or a part of it in the rock that surrounds it. Phylogeny – Record of ancestral history.
Multiple Sclerosis– It is a demyelinating disease Planetesimals - Planetesimals are the
in which the insulating covers of nerve cells in fundamental building blocks of the planets as
the brain and spinal cord are damaged. well as the ancestors of asteroids and comets.
Mutation – Sudden and inheritable changes. Polypeptide chain– It consists of smaller
Narcotic - A powerful drug that produces, subunits or amino acids that are linked together.
relaxed, dreamy state, derived from Opium They are the building blocks of proteins.
plant. Postpartum – Period of life following childbirth.
Glossary 238

www.tntextbooks.in
Precursor– A substance from which another is Single cell protein (SCP) – A protein derived from
formed, especially by metabolic reaction. a culture of single celled organisms used especially
Primer – A short oligonucleotide that hybridizes as a food supplement.
the template strand and gives a 3’ – OH end for the SOD– Sediment Oxygen Demand is the rate at
initiation of nucleic acid synthesis. which dissolved oxygen is removed from the water
Probe – The probe is a single stranded DNA column during the decomposition of organic
molecule that is ‘complementary’ to the gene of matter in streambed or lakebed sediments.
interest in a sample under study. Solubilisation – Dissolving the feed stock in water
Pseudopodia – Blunt temporary protoplasmic to make a slurry for anaerobic digestion.
projections found in Amoeba or in some amoeba- Speciation – Formation of new species from the
like cells. pre-existing ones.
Psychoactive drug - A chemical substance that Structural gene – A gene coding for the structure
acts on brain and affects the mind and behaviour of a protein.
of user. Taq DNA polymerase– A thermostable DNA
Puberty – Period of reproductive maturity. polymerase obtained from thermophilic bacterium
Pyrolysis– Decomposition brought about by high Thermus aquaticus. It helps in the synthesis of
temperatures. DNA.
Recombinant– A cell or organism whose genetic Transgene– The target gene responsible for the
complement results from recombination. development of transgenic organism.
Redia – Larva in the life cycle of most trematodes. Trophozoite stage – In Plasmodium life cycle,
Rheoreceptors – They are receptors in fish cryptomerozoites in the RBC become round and it
and some amphibians that respond to water modifies into a young trophozoite.
currents. Umbilical cord – Structure bearing arteries and
Saltation – Single step large mutation. veins connecting the placenta and the foetus.
Satellite DNA – Short highly repeated Variations – Dissimilarity between the members
eukaryotic DNA sequences, usually clustered in of the same species.
heterochromatin and generally not transcribed. Vitrification– Transformation of a substance into
Saltatorial – Saltatorial is an animal adapted to a glass.
leaping. They have large, muscular hindlimbs and Volatility– A liquid or substance is one that will
sometimes, reduced forelimbs. A few example quickly change into a gas.
for jumpers in the animal kingdom include fleas, Withdrawal symptoms - The reactions
froghoppers, grasshoppers, and frogs. experienced by an addict after he/she stops using
Schizogony - The process of multiple fission, in drugs.
which one organism divides to produce many Woolly mammoth – A hairy relative of modern
daughter cells. elephant that lived in cold climates.
Schizont – The trophozoite of Plasmodium grows Zoogeography – Study of details with the
in size to form the schizont. geographical distribution of animals.
Selection – Choosing the better adapted alleles Zygote intra fallopian transfer-(ZIFT)
from the mixed population. Transfer of zygote or embryo with 8 or
Sewage - Domestic waste water containing various less than 8 celled blastomeres into the
solid and liquid waste materials including human fallopian tube.
excreta.
239 Glossary

www.tntextbooks.in
Reference • Ekambaranatha Ayyar and Anantha Krishnan,

• Ahluwalia KB., (1895), Genetics, wiley eastern (1987), Manual of Zoology, Vol II Chordata,
Ltd., 5th Edition S.Viswanathan Publishers and
• Ananthanaryan, R and JayaramPaniker, C.K. Printers Pvt. Ltd.,
(2009). Text book of Microbiology, University • Farrugia. A and R. Blundell (2007). In vitro
Press (India) Pvt. Ltd. 8th Edition. Fertilisation and Other Artificial Reproductive
• Barucha, E. (2004). Textbook for Environmental Technology Methods-Review Paper.
Studies, New Delhi: University Grants International Journal of Molecular Medicine
Commission. and Advance Sciences 3 (1): 16-23, 2007.
• Benjamin, E., Coico, R and Sunshine, G. (2000). • Fukuoka, M. (2009). The One-Straw Revolution:
Immunology.A short course.Fourth Edition. An Introduction to Natural Farming, New York
Wiley-Liss, Wiley and Sons, Inc., Publication. Review of Books, New York.
• Bose, A.K. (1999). Legal Control of Water • Futuyma Douglas J 2008, Evolution, Second
Pollution in India. Indian Institute of Edition, Prime books publishers, USA.
Management, Kolkata. • Gangane. S.D(2012), Human genetics,
• Brooker/Widmaier, 2014, Evolution, Second 4th edition Elsevier publications India Ltd.,
Edition, Prime books publishers, USA. • Gaya Pandey, 2010, Bio-cultural Evolution,
• Chaudhary Sushil, 2000, Pioneer Refresher Concept publishing company Pvt, New Delhi.
Course in Biology, Dhanpat Rai & Co, Delhi. • Getchell, Pippin and Varnes, Perspectives on
• Clary DP., (2010), Molecular biology, Ap cell Health, New edition, Mcdougal Littell.
press. • Goldsby, R.A., Kindt, T.J., Osborne, B.A.
• Climate change and global warming. (2015). and Kuby, J. (2003). Immunology.Fifth
ENVIS centre for Himalayan Ecology, Edition.W.H.Freeman and Company.
Uttarakhand. New York.
• Dabady, K & Tulk, P. (2015). Agrochemicals • Goodwin TM, Montoro MN, Muderspach
and their Impact on Human Health, McGill L, Paulson R, Roy R.(2010). Management
University, Canada. of Common Problems in Obstetrics
• Daniel L. Hartl., (2011), Essential Genetics. A and Gynecology, 5th Edition, Dec 2010,
genomics perspective fifth edition, Jones and Wiley-Blackwell. ISBN: 978-1-444-39034-6.
Bartlett Publishers. • Gopalakrishnan T.S ,Dr. Itta Sambaswaiah
• Dhami P.S and Mahindru R.C 1698, A text book 1684, Dr Kamalakara Rao A.P (Three Author
of Biology, Pradeep publications, Jalandhar. book) Principles of organic evolution, 7th
Edition Himalaya Publishing House, Chennai.
• Doan, T., Melvold, R., Viselli, S. and
Waltenbaugh, C. (2008). Lippincott’s Illustrated • Guyton. AC. and I.E. Hall. (2000).
Reviews: Immunology. Published by Wolters Endocrinology and Reproduction. In Schmitt,
Kluwer (India) Pvt. Ltd., New Delhi. W., R. Gruliow and A Norwitz. (Eds.). Text
book of Medical Physiology. W.B. Saunders
• Dodson O. Dodson, 1661, Evolution process
Company. pp: 916-941.
and product, Dodson University, Australia.
• Hall J. E. , 202, 13th Edition. In Guyton
• Dubey. R.C and Maheswari., D.K (2010),
and Hall Textbook of Medical Physiology;
A text book of Microbiology, Revised edition,
Reed Elsevier India Pvt. Ltd.,
S. Chand & Company Ltd.,
• Helen Kreuzer and Adrianne Massey
• Edward J. Kormondy Concepts of Ecology –
(2005) Biology and Biotechnology-Science,
Fourth edition Publised by Ashoke K. Ghosh,
Applications and Issues, ASM Press, American
PHI Learning (P) Ltd.,
Society for Microbiology., Washington DC.
References 240
XII Std Zoology References EM.indd 240 12/15/2021 10:57:30 AM

www.tntextbooks.in
• Herren, Ray V (2005), Introduction to • Randhawa SS (2006), a text book of genetics,

Biotechnology: An Agricultural Revolution, 3rd edition, pee vee publications Ltd.,
Thomson-Delmar Learning Inc., NY. • Ridley Mark, 2004, Evolution, Third edition
• Ichhpujani R.L and Rajesh Bhatia (1994), Blackwell publishing, Malden, USA.
Microbiology for Nurses, First edition, Jaypee • Roitt(2001). Immunology. Harcourt Publishers
brothers Medical Publishers (P) Ltd., limited. Sixth edition.
• Jones M, Fosbery M, Gregory J and Taylor D., • S.N.Chary Ecology – Environmental Studies,
(2014), Bridge international. AS and A First Edition 2008, Published by Rajiv Beri for
level biology course book, Fourth edition, Macmillan India Ltd.,
Cambridge University Press. • Sekar, P. & Mathivanan, J. (2008). Environmental
• Jordan E.L and Verma P.S.,(2010), Invertebrate Education, Neminatha Pathippagam, Polur.
Zoology, 14th Edition, S. Chand & Company Ltd., • Sharma P.D. Ecology and Environment
• Joseph, B. (2009). Environmental Studies, McGraw 12th edition – 12th Revised edition, Rastogi
Hill Education (India) Pvt. Ltd., New Delhi. publication.
• Kardong Kenneth V 2005, Biological Evolution, • Silverthorn, D.U(2016). Human Physiology.
Washington State University, USA. An integrated approach. Pearson Education
• Klug W.S and Cummings M.R., Concept of Limited. Seventh Edition.
Genetics, Seventh Edition. Chapter 5. • Stiling, P. (2012). Ecology: Global Insights &
• Kotpal R.L., (2016), Modern Text Book Of Investigations, McGraw-Hill Companies Inc.,
Zoology- Invertebrates, 11th Edition, Rastogi New York.
Publications. • Tamarin RH (2007), Principles of genetics, 7th
• Kotpal R.L., (2012), Modern Text Book Of edition, tata Mcgraw hill publication Ltd.,
Zoology- Vertebrates(Diversity - II), 3rd • Tamil Nadu State Environment Policy – 2017,
Edition, Rastogi Publications. Department of Environment, Government of
• Leonard B. Radinsky, 2000, Evolution of Tamil Nadu, Chennai - 600 015.
Vertebrates Second Edition, John Wiley and • Tortora.J and Funk.R., (2008), Microbiology an
Sons, New York. Introduction, 9th edition, Pearson Education
• MacKenzie, S.H. (1996). The Ecosystem, Island in South Asia.
Press, CA (USA). • U. Satyanarayana Biotechnology, Books and
• Marieb E. N. and Hoehn K, 2011, 8th Allied (P) Ltd., Kolkata.
Edition. In. Anatomy and Physiology; • Ugene P.Odum, Gray W. Barrett Fundamental
Pearson Education Inc., of Ecology – Fifth edition, 2005. Cengage
• Mudaliar A.L and Krishna Menon M.K, Learning India (p) Ltd.,
202, 12th Edition. In. Clinical Obstetrics; • VamanRao C. (2017). Immunology.Narosa
Universities Press (India) Pvt. Ltd., Publishing House Pvt. Ltd., Third Edition.
• Muthayya NM, 2010, 4th Edition. In. Human • Verma P.S., Agarwal V.K. Environmental
Physiology; Jaypee Brothers Medical Publishers Biology – S.Chand & Company Ltd.,
(P) Ltd., • Verma PS and Agarwal VK., (2008), Genetics,
• National Population Education project, Ninth Revised multicolor edition, S.Chand
Adolescence Education in Schools, NCERT, & Company Ltd.,
New Delhi. • William J. Thieman and Michael A Palladino
• R. C. Dubey (2003) A Textbook of (2004), Introduction to Biotechnology,
Biotechnology, S. Chand and Company LTD., Pearson Education Inc., and Dorling Kingsley
New Delhi. Publishing Inc., New Delhi, India.
241 References
XII Std Zoology References EM.indd 241 12/15/2021 10:57:31 AM

www.tntextbooks.in
MCQs for Higher Studies

Chapter 1 - Reproduction in Organisms Chapter 2 - Human Reproduction
1. “Nothing lives forever, but life continues”. What 1. Select the incorrect statement. [NEET 2016, phase I]
does it mean? [AIPMT 1995] a) LH and FSH trigger ovulation in ovary
a) Older dies but new ones are produced by b) LH and FSH decrease gradually during the
reproduction follicular phase
b) Nothing can produce without death c) LH triggers secretion of androgens from the Leydig cells.
c) Death has nothing to do with the continuation of d) FSH stimulates the sertoli cells which help in
life spermiogenesis
d) Parthenogenesis is must for sexual reproduction 2. Identify the correct statement on ‘inhibitin’
2. A few statements describing certain features of [NEET 2016, phase I]
reproduction are given below. Select the options that a) is produced by granulose cells in ovary and
are true for both sexual and asexual reproduction inhibits the secretion of FSH
from the options given: b) is produced by granulose cells in ovary and inhibits
i. Gametic fusion takes place the secretion of LH
ii. Transfer of genetic material takes place c) is produced by nurse cells in testes and inhibits the
iii. Reduction division takes place secretion of LH
iv. Progeny have some resemblance with parents d) inhibits the secretion of LH, FSH and prolactin.
a) i and ii b) ii and iii 3. Several hormones like hCG, hPL, oestrogen and
c) ii and iv d) i and ii progesterone are produced by [NEET 2016, phase I ]
3. A few statements with regard to sexual reproduction a) ovary b) placenta
are given below: c) fallopian tube d) pituitary
i. Sexual reproduction does not always require two 4. Match column I with column II and select the correct
individuals option using the codes given below
ii. Sexual reproduction generally involves gametic [NEET 2016, phase I]
fusion Column I Column II
iii. Meiosis never occurs during sexual reproduction A. Mons pubis 1.Embryo formation
iv. External fertilization is a rule during sexual
B. Antrum 2. Sperm
reproduction
Choose the correct statements from the options C. Trophectoderm 3. Female external genitalia
below: D. Nebenkem 4. Graafian follicle
a) i and iv b) i and ii
A B C D
c) ii and iii d) i and iv
a) 3 4 2 1
4. Given below are a few statements related to external
b) 3 4 1 2
fertilization. Choose the correct statements:
c) 3 1 4 2
i. The male and female gametes are formed and
d) 1 4 3 2
released simultaneously
5. Which one of the following is not the function of
ii. Only a few gametes are released into the medium
placenta? (NEET, 2013)
iii. Water is the medium in a majority of organisms
a) To facilitate supply of oxygen and nutrients to embryo
exhibiting external fertilization
b) To secrete oestrogen
iv. Offspring formed as a result of external
c) To facilitate the removal of carbondioxide and
fertilization have better chance of survival than
material from embryo
those formed inside the organism
d) To secrete oxytocin during parturition
a) iii and iv b) i and iii
6. The testes in human are situated outside the
c) ii and iv d) i and iv
abdominal cavity inside a pouch called scrotum. The
5. Which of the following statements, support the view purpose served is for [AIPMT 2011]
that elaborate sexual reproductive process develops a) escaping any possible compression by the visceral organs.
much later in the organic evolution? b) providing more space for the growth of epididymis.
i) Lower groups of organisms have simpler body design c) providing a secondary sexual feature for exhibiting
ii)Asexual reproduction is common in lower groups the male sex
iii) Asexual reproduction is common in higher d) maintaining the scrotal temperature lower than
groups of organisms internal body temperature
iv)The high incidence of sexual reproduction is in 7. Hormones secreted by placenta to maintain
angiosperms and vertebrates. pregnancy are [NEET,2018]
a) i, ii and iii b) i, iii and iv a) hCG, hPL, progesterone, estrogen
c) i, ii, and iv d) ii, iii and iv b) hCG, hPL, estrogen, relaxin, oxytocin
MCQs for Higher Studies 242
XII Std Zoology Competitive Questions EM.indd 242 12/15/2021 12:09:16 PM

www.tntextbooks.in
c) hCG, hPL, progesterone, prolactin b) Out of one pair factors one is dominant and the
d) hCG,
progesterone, estrogen, glucocorticoids other recessive
8. Match and select the correct option [NEET, 2018] c) Alleles do not show any blending and both the
Column I Column II characters recover as such in F2 generation
d) Factors occur in pairs
a. Proliferative phase 1. Breakdown of
3. ABO blood groups in humans are controlled by the
endometrium lining
gene I. It has three alleles – IA, IB and i. Since there
b. Secretory phase 2. Follicular phase are three different alleles, six different genotypes are
possible. How many phenotypes can occur?
c. Menstruation 3. Luteal phase
[AIPMT PRE 2010]
a b c
a) Three b) One c) Four d) Two
A) 3 2 1
4. Which one of the following symbols and its
B) 2 3 1
representation, used in human pedigree analysis is
C) 1 3 2
correct? [AIPMT PRE 2010]
D) 3 1 2
a) □ =○=Mating between relatives
b) ○ =Unaffected male
Chapter 3 - Reproductive Health c) □ =Unaffected female
1. Which of the following is a hormone releasing d) ◊=Male affected
Intrauterine Device (IUD)? [AIPMT 2014] 5. Which one of the following conditions correctly
a) Multiload 375 b) LNG-20 describes the manner of determining the sex in the
c) Cervical cap d) Vault given example? [AIPMT PRE 2011]
2. Assisted reproductive technology, IVF involves the a) XO type of sex chromosomes determine male
transfer of [AIPMT 2014] sex in grasshopper
a) Ovum into the fallopian tube b) XO condition in humans as found in Turner
b) Zygote into the fallopian tube syndrome, determines female sex
c) Zygote into the uterus c) Homozygous sex chromosomes(XX) produce
d) Embryo with 16 blastomeres into the fallopian tube male in Drosophila
3. In context of amniocentesis, which of the following d) Homozygous sex chromosomes(ZZ) determine
statements is incorrect? [NEET-I, 2016] female sex in birds
a) It is usually done when a woman is between 14-16 6. A normal-visioned man whose father was blind,
weeks pregnant marries a woman whose father was also colour
b) It is used for prenatal sex determination blind. They have their first child as a daughter. What
c) It can be used for detection of Down syndrome are the chances that this child would be colour blind?
d) It can be used for detection of Cleft palate [AIPMT PRE 2012]
4. Which of the following approach does not give the a) 100% b) 0% c) 25% d) 50%
defined action of contraceptive? [NEET-I, 2016] 7. Which of the following statements is not true of two
a) Barrier methods Prevent fertilization genes that show 50 per cent recombination frequency
[AIPMT 2013]
b) Intra uterine Increases phagocytosis of sperms,
a) The genes may be on different chromosomes
devices suppresses sperm motility and
b) The genes are tightly linked
fertilizing capacity of sperms
c) The genes show independent assortment
c) Hormonal Prevent retard entry of sperms, d) If the genes are present on the same chromosome
contraceptives prevent ovulation and fertilization 8. A pleiotropic gene: [RE-AIPMT 2015]
d) Vasectomy Prevents spermatogenesis a) Is a gene evolved during Pliocene
b) Controls a trait only in combination with another gene
Chapter 4 - Principle of Inheritance and Variation c) Controls multiple traits in an individual
1. The fruit fly Drosophila melanogaster was found d) Is expressed only in primitive plants
to be very suitable for experimental verification of 9. A gene showing codominance has: [RE-AIPMT 2015]
chromosomal theory of inheritance by Morgan and a) Alleles tightly linked on the same chromosome
his colleagues because [AIPMT MAINS 2010] b) Alleles that are recessive to each other
a) It reproduces parthenogenetically c) Both alleles independently expressed in the
b) A single mating produces two young flies heterozygote
c) S maller female is easily recognizable from large male d) One allele dominant on the other
d) It completes the life cycle in about two weeks 10. Pick out the correct statements: [NEET-I, 2016]
2. Which one of the following cannot be explained on a) Haemophilia is a sex-linked recessive disease
the basis of Mendel’s Law of Dominance? b) Down’s syndrome is due to aneuploidy
[AIPMT PRE 2010] c) Phenylketonuria is an autosomal recessive gene disorder
a) The discrete unit controlling a particular character d) Sickle cell anaemia is an X-linked recessive gene
is called a factor disorder
243 MCQs for Higher Studies

www.tntextbooks.in
a) A and D are correct b) B and D are correct c) Prove semiconservative nature of DNA replication
c) A,C and D are correct d) A ,B and C are correct d) Polymerises in the 5’ to 3’direction and explain 3’
to 5’ DNA replication
Chapter 5 - Molecular Genetics 8. During translation initiation in prokaryotes, a GTP
1. The association of histone H1 with a nucleosome molecules is needed in [AIPMT 2003]
indicates (NEET 2017) a) association of 30s, mRNA with formyl met tRNA
a) Transcription is occurring b) association of 50s subunit of ribosome with
b) DNA replication is occurring initiation complex
c) The DNA is condensed into chromatin fibre c) formation of formyl met tRNA
d) The DNA double helix is exposed d) binding of 30s subunit of ribosome with mRNA.
2. Which of the following is not required for any of 9. Reverse transcriptase is
the techniques of DNA fingerprinting available at a) RNA dependent RNA polymerase
present? [NEET 2016] b) DNA dependent RNA polymerase
a) Zinc finger analysis c) DNA dependent DNA polymerase
b) R estriction enzymes d) RNA dependent DNA polymerase
c) D NA-DNA hybridization 10. Escherichia coli fully labeled with N14 medium. The
d) polymerase chain reaction two strands of DNA molecules of the first generation
3. Satellite DNA is important because it [AIPMT 2015] bacteria have
a) codes for proteins needs in cell cycle a) Different density and do not resemble parent DNA
b) shows high degree of polymorphism in population b) Different density but resemble parent DNA
and also the same degree of polymorphism in c) Same density and resemble parent DNA
an individual, which is heritable from parents to d) Same density but do not resemble parents DNA
children Chapter 6 - Evolution
c) Does not code for protein and is same in all
1. The wings of a bird and of an insect are
members of the population.
a) homologous structure and represent convergent
d) Codes for enzymes needed for DNA replication.
evolution
4. The diagram shows an important concept in the
b) homologous structure and represent divergent evolution
genetic implication of DNA. Fill in the blanks A to C.
c) analogous structure and represent convergent
(NEET 2013)
evolution
A B C
d) analogous structure and represent divergent evolution
DNA ----→mRNA ---------→protein -proposed by---
2. Which one of the following statement is correct?
a) A- trancscription, B- replication C-James Watson
a) stem cells are specialized cells
b) A- trancscription, B- trancscription, C-Erwin
a) there is no evidence of the existence of gills during
c) A- trancscription, B- tranlation, C-Francis Crick
embryogenesis of mammals
d) A- trancscription, B- extension, C-Rosalind
b) all plant and animal cells are totipotent
Frankin
c) Ontogeny repeats phylogeny
5. Select the two statements out of the four (I –IV) given
3. In Hardy-Weinberg equation, the frequency of
below about lac operon. [AIPMT 2010]
heterozygous individual is represented by
i. Glucose or galactose may bind with the repressor
a) p2 b) 2pq c) pq d) q2
and inactive it.
4. The correct order in Era is
ii. In the absence of lactose, the repressor binds
a) Palaeozoic---- Archaeozoic --- Coenozoic
with the operator region
b) Archaeozoic ---Palaeozoic------ Proterozoic
iii. The z-gene codes for permease.
c) Palaeozoic--- Mesozoic ----- Coenozoic
iv. This was elucidated by Francois Jacob and
d) Mesozoic ---- Archaeozoic---- Proterozoic
Jacques monod.
5. The most apparent change during the evolutionary
The correct statements are
history of Homo sapiens is raced in (AIPMT 2010)
a) i and ii b) i and iii c) ii and iv d) i and ii
a) loss of body hair
6. Which one of the following pairs of codons is
b) walking upright
correctly matched with their function or the single
c) shortening of jaws
for the particular amino acid? [AIPMT 2008]
d) remarkable increase in the brain size
a) GUU, GCU – Alanine
6. The process by which organisms with different
b) UAG, UGA – Stop codon
evolutionary history evolve similar phenotypic
c) AUG, ACG - start/methionine
adaptations in response to a common environmental
d) UUA, UCA – Leucine
challenge is called (AIPMT 2013)
7. The Okazaki fragments in DNA chain growth
a) Natural selection
(AIPMT 2007)
b) Convergent evolution
a) Result in transcription
c) Non-random evolution
b) Polymerise in the 3’ to 5’ direction and forms
d) Adaptive radiation Human health and diseases
replication fork

www.tntextbooks.in
Chapter 7 & 8 - Human Health and Diseases and Immunology a) Ancylostoma duodenale
1. Select the correct statement from the given below. b) Enterobius vermicularis
[AIPMT 2010] c) Trichimella spiralis
a) Barbiturates when given to criminals make them d) Ascaris lumbricoides
tell the truth 8. The active form of Entamoeba histolytica feeds upon:
b) Morphine is often given to persons who have [AIPMT 2015]
under gone surgery as a pain killer a) Erythrocytes, mucosa and submucosa of colon
c) Chewing tobacco lowers blood pressure and heart rate b) Mucosa and submucosa colon only
d) Cocaine is given to patients after surgery as it c) Food in intestine
stimulates recovery d) Blood only
2. Match the following [AIPMT 2008] 9. Which one of the following statements is correct with
Column I Column II respect to AIDS? [AIPMT PRE 2010]
a) The HIV can be transmitted through eating food
A) Amoebiasis i) Treptonema pallidum
together with an infected person
B) Diphtheria ii) Use only sterilized food
b) Drug addicts are least susceptible to HIV infection
and water
c) AIDS patients are being fully cured 100 percent
C) Cholera iii) DPT vaccine
with proper care and nutrition
D) Syphilis iv) Use oral rehydration d) The causative HIV retrovirus enters helper
therapy
T-lymphocytes thus reducing their numbers
A B C D
10. Select the correct statement with respect to diseases
a) i ii iii iv
and immunization [AIPMT MAINS 2011]
b) ii iv i iii
a) If due to some reason B and T lymphocytes are
c) ii I iii iv
damaged, the body will not produce antibodies
d) ii iii iv i
against a pathogen
3. If a person shows production of interferons in his
b) Injection of dead/inactivated pathogens caused
body, the chances are that he has got an infection of
passive immunity
a) Typhoid b) Measles
c) Certain protozoans have been used in mass
c) Tetanus d) Malaria
production of hepatitis B vaccine
4. A person suffering from a disease caused by
d) Injection of snake antivenom against snake bite is
Plasmodium, experiences recurring chill and fever at
an example of active immunization
the time when? [AIPMT MAINS 2010]
11. Which one of the following statements is correct with
a) The sporozoites released from RBC’s are being
respect to immunity? [AIPMT MAINS 2012]
rapidly killed and broken down inside spleen
a) The antibodies against small pox pathogen are
b) The trophozoites reach maximum growth and give
produced by T – lymphocytes
out certain toxins.
b) Antibodies are protein molecules each of which
c) The parasite after its rapid multiplication inside
has four light chains
RBC’s reptures them, releasing the stage to enter
c) Rejection of a kidney graft is the function of
fresh RBC’s
B – lymphocytes
d) The microgametocytes and megagametocytes are
d) Preformed antibodies need to be injected to
being destroyed by the WBC’s
treat the bite by a viper snake.
5. Where will you look for the sporozoites of the
12. Which one of the following is not a property of
material parasite? [AIPMT PRE 2011]
cancerous cells whereas the remaining three are?
a) Red blood corpuscles of humans suffering from malaria
[AIPMT PRE 2012]
b) Spleen of infected humans
a) They compete with normal cells for vital nutrients
c) Salivary glands of freshy moulted female anopheles
b) They do not remain confined in the area of formation
mosquito
c) They divide in an uncontrolled manner
d) Saliva of infected female anopheles mosquito
d) They show contact inhibition
6. Which one of the following organisms is scientifically
13. At which stager HIV infection does one usually show
and correctly named, correctly printed according
symptoms of AIDS? [AIPMT 2014]
to the International Rules of Nomenclature and
a) Within 15 days of sexual contact with an infected
correctly described? [AIPMT MAINS 2012]
person
a) Plasmodium falciparum – a protozoan causing
b) When the infected retro virus enters host cells
the most serious type of malaria.
c) When HIV damages large number of helper
b) Felis tigris – The Indian tiger is well protected in
T- Lymphocytes
Gir forests
d) When the viral DNA is produced by reverse
c) E. Coli – The full name is Entamoeba coli, a
transcriptase
commonly occurring bacterium in human intestine
14. Match each disease with its correct type of vaccine
7. Which of the following endoparasites of humans
[AIPMT 2015]
does show viviparity? [AIPMT 2015]

www.tntextbooks.in
a)Tuberculosis i) harmless virus 5. During sewage treatment, biogas are produced which
includes [AIPMT 2015]
b)Whooping cough ii) inactivated toxin a) Methane, hydrogen sulphide, carbon dioxide
c)Diphtheria iii) killed bacteria b) Methane, oxygen, hydrogen sulphide
d)Polio iv) harmless bacteria c) Hydrogen sulphide, methane, sulphur dioxide
a) b) c) d) d) Hydrogen sulphide, nitrogen, methane
a) (ii) (i) (iii) (iv) 6. What gases are produced in anaerobic sludge
b) (iii) (ii) (iv) (i) digesters? [AIPMT 2014]
c) (iv) (iii) (ii) (i) a) Methane and CO2 only
d) (i) (ii) (iv) (iii) b) Methane, hydrogen sulphide and CO2
15. Which of the following is correct regarding AIDS c) Methane, hydrogen sulphide and O2
causative agent HIV? [NEET-II, 2016] d) Hydrogen sulphide and CO2
a) HIV is enveloped virus that contains two 7. Match the following list of microbes and their
identical molecules of single-stranded RNA and importance: [RE-AIPMT 2015]
two molecules of reverse transcriptase a)Saccharomyces (i)Production of
b) HIV is unenveloped retrovirus cerevisiae immunosuppressive agents
c) HIV does not escape but attacks the acquired b)Monasus purpureus (ii)Ripening of Swiss cheese
immune response
c)Trichoderma (iii)Commercial
d HIV is enveloped virus containing one molecule of
polysporum production of ethanol
single – stranded RNA and one molecule of reverse
transcriptase d)Propionibacterium (iv)Production of blood-
shermanii cholesterol lowering agents.
Chapter 9 - Microbes in Human Welfare e) (iv) (iii) (ii) (i)
f) (iv) (ii) (i) (iii)
1. When domestic sewage mixes with river water
g) (iii) (i) (iv) (ii)
[AIPMT MAINS 2010]
h) (iii) (iv) (i) (ii)
a) Small animals like rat will die after drinking river water
8. Which of the following is wrongly matched in the
b) The increased microbial activity releases
given table? [NEET – I, 2016]
micronutrients such as iron.
c) The increased microbial activity uses up Microbe Product Application
dissolved oxygen (a)Trichoderma Cyclosporin A Immunosuppressive
d) The river water is still suitable for drinking as polysporum drug
impurities are only about 0.1 per cent (b)Monascus Statins Lowering of blood
2. Select the correct statement from the following purpureus cholesterol
[AIPMT PRE 2010] (c) Streptococcus Streptokinase Removal of clot
a) Biogas is produced by the activity of aerobic from blood vessel
bacteria on animal waste (d)Clostridium Lipase Removal of oil
b) Methanobacterium is an aerobic bacterium found butylicum stains
in rumen of cattle 9. Match Column – I with Column – II and select the
c) Biogas, commonly called gobar gas, is pure methane correct options using the codes given below:
d) Activated sludge-sediment in settlement tank [NEET – II, 2016]
of sewage treatment plant is a right source of Column I Column II
aerobic bacteria A.Citric acid 1. Trichoderma
3. Read the following four statements (A to D): B.Cyclosporin A 2. Clostridium
[AIPMT MAINS 2012] C.Statins 3. Aspergillus
a) Colostrum is recommended for the new born
D.Butyric acid 4. Monoscus
because it is rich in antigen
a) A:3, B:1, C:4, D:2
b) Chikungunya is caused by a gram negative
bacterium b) A:1, B:4, C:2, D:3
c) Tissue culture has proved useful in obtaining c) A:3, B:4, C:1, D:2
virus-free plants. d) A:3, B:1, C:2, D:4
d) Beer is manufactured by distillation of fermented
grape juice Chapter 10 - Biotechnology and Its Application
How many of the above statements are wrong? 1. Genetic engineering has been successfully used for
a) Three b) Four c) One d) Two producing [AIPMT RE 2010]
4. Which of the following are likely to be present in a) Transgenic mice for testing safety of polio
deep sea water? [AIPMT 2013] vaccine before used in humans
a) Archaebacteria b) Eubacteria b) Transgenic models for studying new treatments
c) Blue – green algae d) Saprophytic fungi for certain cardiac diseases

www.tntextbooks.in
c) Transgenic cow Rosie which produces high fat c) Restrict the action of the enzyme DNA polymerase.
milk for making ghee d) Remove nucleotides from the ends of the DNA
d) Animals like bulls for farm work as they have molecule.
super power 8. Stirred – tank bioreactors have been designed for
2. Read the following four statements (A to D) about [AIPMT PRE 2010]
certain mistakes in two of them. [AIPMT MAINS 2011] a) Addition of preservatives of the product
a) The first transgenic buffalo, Rosie produced milk b) Purification of the product
which was human alpha – lactalbumin enriched. c) Ensuring anaerobic conditions in the culture vessel
b) Restriction enzymes are used in isolation of DNA d) Availability of oxygen throughout the process
from other macromolecules. 9. There is a retriction endonuclease called EcoRI. What
c) Downstream processing is one of the steps of does ‘co’ part in it stand for? [AIPMT PRE 2011]
rDNA technology a) Coelom b) Coenzyme
d) Disarmed pathogen vectors are also used in c) Coli d) Colon
transfer of rDNA into the host. 10. Which one is true state regarding DNA polymerase
Which of the two statements have mistakes? used in PCR? [AIPMT PRE 2012]
a) B and C b) C and D a) It is used to ligate introduced DNA in recipient cells.
c) A and C d) A and B b) It serves as selectable marker
3. The colonies of recombinant bacteria appear white c) It is isolated from a virus.
in contrast to blue colonies of non-recombinant d) It remains active at high temperature.
bacteria because of [AIPMT 2013] 11. For transformation, micro-particles coated with
a) Non-recombinant bacteria containing β-galactosidase. DNA to be bombarded with gene gun are made up of
b) Insertional inactivation of α-galactosidase in non- [AIPMT PRE 2012]
recombinant bacteria. a) Silver or Platinum b) Platinum or Zinc
c) Insertional inactivation of α-galactosidase in c) Silicon or Platinum d) Gold or Tungsten
recombinant bacteria.
d) Inactivation of glycosidase enzyme in recombinant Chapter 11 - Organisms and Population
bacteria
4. Which body of the Government of India regulates 1. Which one of the following is most appropriately
GM research and safety of introducing GM organism defined? [AIPMT MAINS 2010]
for public services? [AIPMT 2015] a) Host is an organism which provides food to
a) Bio-safety committee another organism.
b) Indian council of agricultural research b) Amensalism is a relationship in which one species
c) Genetic engineering approval committee is benefited whereas the other is unaffected.
d) Research committee on Genetic manipulation c) Predator is an organism that catches and kills
5. In genetic engineering, a DNS segment (gene) of other organism for food.
interest is transferred to the host cell through a d) Parasite is an organism which always lives inside
vector. Consider the following four agents (A to D) the body of other organism and may kill it.
in this regard and select correct option about which 2. Study the four statements (1 to 4) given below and select
one or more of these can be used as vector/vectors. the two correct ones out of them. [AIPMT PRE 2010]
[AIPMT MAIN 2010] a) A lion eating a deer and a sparrow feeding on grain
A) A bacterium B) Plasmid are ecologically similar in being consumers.
C) Plasmodium D) Bacteriophage b) Predator star fish Pisaster helps in maintaining
a) (A), (B) and (D) only b) (A) only species diversity of some invertebrates.
c) (A) and (C) only d) (B) and (D) only c) Predators ultimately lead to the extinction of prey
6. Which one of the following palindromic base species.
sequences in DNA can be easily cut at about the d) Production of chemicals such as nicotine,
middle by some particular restriction enzyme? strychnine by the plants is metabolic disorders.
[AIPMT PRE 2010] The two correct statements are
a) 5’ – CGTTCG – 3’ 3’ –ATGGTA -5’ a) (B) and (C) b) (C) and (D)
b) 5’-GATATG -3’ 3’ CTACTA -5’ c) (A) and (D) d) (A) and (B)
c) 5’ –GAATTC – 3’ 3’ – CTTAAG-5’ 3. Which two of the following changes ( 1 to 4) usually
d) 5’ –CACGTA -3’ 3’ –CTCAGT -5’ tend to occur in the plain dwellers when they move to
7. Restriction endonucleases are enzymes which high altitudes(3500 m or more)? [AIPMT PRE 2010]
[AIPMT PRE 2010] A) Increase in red blood cell size
a) Make cuts at specific positions within the DNA B) Increase in red blood cell production
molecule. C) Increased breathing rate
b) Recognize a specific nucleotide sequence for D) Increase in thrombocyte count
binding of DNA ligase. a) (B) and (C) b) (C) and (D)
c) (A) and (D) d) (A) and (B)

www.tntextbooks.in
4. Consider the following four conditions (A-D) and d) The desert areas of Rajasthan and Gujarat have a
select the correct pair of them as adaptation to very high level of desert animal species as well as
environment in desert lizards. [AIPMT PRE 2011] numerous rare animals
The conditions: 2. Sacred groves are specially useful in[AIPMT MAINS 2012]
A) Burrowing in soil to escape high temperature. a) Preventing soil erosion
B) Losing heat rapidly from the body during high b) Year-round flow of water in rivers
temperature c) Conserving rare and threatened species
C) Bask in sun when temperature is low d) Generating environmental awareness
D) Insulating body due to thick fatty dermis. 3. The highest number of species in the world is
a) (A) and (C) b) (B) and (D)
represented by [AIPMT PRE 2012]
c) (A) and (B) d) (C) and (D)
a) Fungi b) Mosses c) Algae d) Lichens
5. People who have migrated from the planes to an area
adjoining Rohtang Pass about six months back 4. Which of the following is not used for ex situ plant
[AIPMT PRE 2012] conservation? [AIPMT PRE 2012]
a)Have more RBC’s and their haemoglobin has a a) Field gene banks b) Seed banks
lower binding affinity to O2 c) Shifting cultivation d) Botanical gardens
b) Are not physically fit to play games like football 5. In which of the following both pairs have correct
c) Suffer from altitude sickness with symptoms like combination? [AIPMT 2015]
nausea, fatigue, etc., a) In situ conservation: National Park
d) Have the usual RBC count but then haemoglobin Ex situ conservation: Botanical Garden
has very high binding affinity to O2 b) In situ conservation: Cryopreservation
6. A biologist studies the population of eats in a barn. Ex situ conservation: Wildlife Sanctuary
He found that the average natality was 250, average
c) In situ conservation: Seed Bank
mortality is 240, immigration is 20 and emigration to be
Ex situ conservation: National park
30. The net increase in population is [AIPMT 2013]
d) In situ conservation: Tissue culture
a) 10 b) 15 c) 05 d) Zero
7. An association of individuals of different species
Ex situ conservation: Sacred groves
living in the same habitat and having functional 6. Cryopreservation of gametes of threatened species
interaction is: [RE-AIMPT 2015] in viable and fertile condition can be referred to
a) Biotic community b) Ecosystem as [AIPMT 2015]
c) Population d) Ecological niche a) In situ conservation of biodiversity
8. Gause’s principle of competitive exclusion states b) Advanced ex situ conservation of biodiversity
that: [NEET – I, 2016] c) In situ conservation by sacred groves
a) More abundant species will exclude the less d) In situ cryo-conservation of biodiversity
abundant species through competition 7. The species confined to a particular region and not
b) Competition for the same resources excludes
found elsewhere is termed as [RE-AIPMT 2015]
species having different food preferences
a) Alien b) Endemic c) Rare d) Keystone
c) No two species can occupy the same niche
indefinitely for the same limiting resources 8. Which of the following National Parks is home to
d) Larger organisms exclude smaller ones through the famous musk deer or hangal? [NEET-II, 2016]
competition a) Bandhavgarh National Park, Madhya Pradesh
9. When does the growth rate of a population following b) Eaglenest Wildlife Sanctuary, Arunachal Pradesh
the logistic model equal zero? The logistic model is c) Dachigam National Park, Jammu & Kashmir
given as dN/dt=rN(1-N/K): [NEET – I, 2016] d) Keibul Lamjao National Park, Manipur
a) When N/K is exactly one
b) When N nears the carrying capacity of the habitat Chapter 13 - Environmental Issues
c) When N/K equals zero 1. DB is a standard abbreviation used for the
d) When dearth rate is greater than birth rate quantitative expression of [AIPMT PRE -2010]
a)The density of bacteria in a medium
Chapter 12 - Biodiversity and conservation
b) A particular pollutant
1. Select the correct statement about biodiversity c) The dominant bacillus in a culture
[AIPMT MAINS 2012] d) A certain pesticide
a) Large scale planting of Bt cotton has no adverse
effect on biodiversity.
b) Western Ghats have a very high degree of species
richness and endemism
c) Conservation of biodiversity is just a fad pursued
by the developed countries

www.tntextbooks.in
2. Which one of the following expanded forms of the 6. Rachel Carson’s famous book ‘Silent Spring’ is related
following acronyms is correct? [AIPMT PRE-2011] to [AIPMT-2015]
a) Pesticide pollution
a)UNEP United Nations Environmental Policy
b) Noise Pollution
b)EPA Environmental Pollution Agency c) Population explosion
c)IUCN International Union for Conservation d) Ecosystem management
of Nature and Natural Resources 7. Increase in the concentration of the toxicant at
d)IPCC International Penal for climate Change successive trophic levels is known as [RE AIPMT-2015]
a) Biodeterioration
3. In an area where DDT had been used extensively b) Biotransformation
the population of birds declined significantly c) Biogeochemical cycling
because d) Biomagnification
[AIPMT PRE-2012]
8. A river with an inflow of domestic sewage rich in
a) Birds stopped laying eggs
organic waste may result in: [NEET-I, 2016]
b) Earthworms in the area got eradicated.
a) Drying of the river very soon due to algal bloom
c) Cobras were feeding exclusively on birds.
b) Increased population of aquatic food web organisms
d) Many of the birds eggs, laid, did not hatch.
c) An increased production of fish due to
4. Measuring Biochemical Oxygen Demand (BOD) is a biodegradable nutrients
method used for [AIPMT PRE-2012] d) Death of fish due to lack of oxygen
a) Estimating the amount of organic matter in
9. A lake which is rich in organic waste may result in
sewage water.
[NEET-II, 2016]
b) Working out the efficiency of oil driven automobile
a) Drying of the lake due to algal bloom
engines.
b) Increased population of fish due to lots of nutrients
c) Measuring the activity of saccharomyces cerevisiae
c) Mortality of fish due to lack of oxygen
in producing curd on a commercial scales
d) Increases population of aquatic organisms due to
d) Working out the efficiency of RBCs about their
minerals
capacity to carry oxygen
10. The highest DDT concentration in aquatic food
5. A scrubber in the exhaust of a chemical industrial
chain shall occur in [NEET-II, 2016]
plant removes
a) Seagull b) Crab
a) Gases like sulphur dioxide.
c) Cell d) Phytoplankton
b) Particulate matter of the size 5 micrometer or
above.
c) Gases like ozone and methane
d) Particulate matter of the size 2.5 micrometer or less

www.tntextbooks.in

ZOOLOGY PRACTICALS
Zoology Practical Manual

General Instruction
In order to get maximum benefit and good training it is necessary for the
students to follow the following instructions.
1. The students must attend all practical classes. Each experiment in

practicals has got important relevance to theory subjects.
2. Bring this practical manual to your practicals class.
3. Bring the following objects to the practicals class – Pencils (HB), Pen,
Eraser, a scale and a small hand towel.
4. Record the title, date and findings of the experiment in the observation
note book.
5. Carefully listen to the instructions given by your Teacher.
6. While observation slides or models draw the structure of the specimen
as you see it neatly in your observation note book. Use pencil for
drawing.
7. W
hile doing experiments neither consult your neighbours nor look
into their readings or observations.
8. If the object under the microscope remains without proper focusing
immediately bring it to the notice of the Teacher.
9. D
o not touch or lift the models or equipments kept for your
identification.
10. Diagrams to be drawn for Prepared slides only in the record note.
Relevant photographs can be collected and pasted for the other
sections.
250
XII Std Zoology Practical EM.indd 250 12/15/2021 10:52:38 AM

www.tntextbooks.in
CONTENT
S.No EXPERIMENTS Page No
1 Fermentation by yeast 252
2 Determination of colour and pH in the given water samples 253
3 Marking of Wildlife Sanctuary and National parks in India map 254
4 Human Mendelian traits 257
5 ABO blood grouping - Demonstration Experiment 258
A & B - PREPARED SLIDES
6 Human Sperm 259
7 Human ovum 259
8 Paramecium – conjugation 260
9 Entamoeba histolytica 260
10 Thymus – T.S 261
11 Lymph node – T.S 261
C -PRESERVED SPECIMENS
12 Mutualism – Sea anemone on hermit crab 262
13 Commensalism – Sucker fish (Echeneis) on shark 262
D -PICTURES
14 tRNA 263
15 Homologous organs 263
16 Analogous organs 264
17 Animal cloning - Dolly (Sheep) 264
18 Human insulin production - Flowchart 265
E -GENETICS - KARYOTYPING
19 Normal Human karyotype 265
20 Autosomal Anomaly – Patau’s Syndrome 266
21 Sex Chromosomal Anomaly – Turner’s Syndrome 266
F -PEDIGREE ANALYSIS
22 X – Linked Disease – Haemophilia 267
23 Autosomal Disease – Sickle cell anemia 268
PROJECT WORK
etermine the universality of variations by studying thumb
D
1 269
impressions in a given population
2 Study the effect of a local industry on the environment 269
3 Study the ecological role of some insects and birds in a given locality 269
4 Visit to a zoological park/wildlife sanctuary in your locality 269
5 Visit to a nearby aquatic habitat 269
251

www.tntextbooks.in
EXPERIMENTS
1. FERMENTATION BY YEAST
AIM
To find the variation in the process of fermentation by yeast in the given samples I, II and III.
MATERIALS REQUIRED
• Glucose solution • Test tubes
• Palm sugar / Jaggery solution • Delivery tube
• Jaggery with salt / starch solution • One holed rubber cork
• Yeast solution • Lime water
PRINCIPLE
Fermentation is an anaerobic metabolic process accompanied with effervescence. During
this process, sugar is converted into ethyl alcohol and CO2. Yeast has an enzyme zymase
which catalyses the fermentation process.
Zymase
C6H12O6 2C2H5OH + 2CO2
Yeast Ethyl alcohol
Glucose
PROCEDURE
• T ake 2ml of the given samples I, II and III in three clean test tubes (labelled as 1,2 and 3)
respectively.
• Add 2ml of yeast solution in all the test tubes and plug the tubes with cotton wool.
• Wait while fermentation takes place and note the time taken.
• Appearance of effervescence in the test tube indicates that fermentation has taken place.
• Remove the cotton wool and pass the gas through a delivery tube into a test tube
containing limewater.
• The lime water turns milky indicating that the gas evolved during fermentation is
carbon dioxide.
OBSERVATION
SL.NO. SAMPLE TIME TAKEN INFERENCE
1
2
3
INFERENCE
e variation in the time taken for fermentation to take place in the different sugar
Th
solutions indicates that the simple sugars like glucose are fermented much quicker than
the complex sugars.
PREPARATION OF YEAST SOLUTION

• 100ml of lukewarm distilled water + 10g of yeast granules.
252

www.tntextbooks.in
2. DETERMINATION OF COLOUR AND pH IN THE GIVEN WATER SAMPLES

AIM
To investigate the colour and pH in the given water samples I, II ,III and thereby determining
the quality of water for consumption.
MATERIALS REQUIRED:
• pH paper and colour chart • Dropper / glass rod
• Water samples • Test tubes
PRINCIPLE
The colour of water sample ranges from colourless to green and yellowish brown
depending upon the planktonic growth and suspended solids.
The pH of a solution is a measure of the concentration of hydrogen ions. The pH value can
vary from 0 to 14. Solutions with a pH between 0 and 7 are acidic, while those with a pH between
7 and 14 are basic. pH 7 is considered neutral.
PROCEDURE
• O bserve and tabulate the colour of the water samples I , II and III taken in test tubes
against a white background.
• Take the three different water solutions in separate test tubes and label them.
• A piece of pH paper is dipped into the sample and compared with that of the colour on the
pH chart.
• The approximate pH value of the samples is thus determined and the results tabulated.
OBSERVATION
SL.NO. SAMPLE COLOUR OF THE SAMPLE pH OF THE SAMPLE
1 I
2 II
3 II
INFERENCE
• Th
e pH of the sample is found to be . Since it is closer to the neutral pH, it
is fit for consumption.
PRECAUTIONS
• Use only the standard colour chart supplied with the pH paper for assessing the pH value.
• Keep the pH strips away from chemicals.
• Either use fresh fine dropper or glass rod for each different sample, or wash the dropper or
rod well with water every time.
253

www.tntextbooks.in
3. MARKING OF WILDLIFE SANCTUARY AND NATIONAL PARKS IN INDIA MAP
W E
Kaziranga
National Park
Gir National Park

&
Wildlife Sanctuary
Mudumalai Wildlife
Sanctuary
& National Park Point Calimere Wildlife
and bird Sanctuary
Periyar Wildlife
Sanctuary
Map not in scale
254

www.tntextbooks.in
3. MARKING OF WILDLIFE SANCTUARY AND NATIONAL PARKS IN INDIA MAP
Mark the given Wildlife Sanctuary and National Park in the given map of India .Write its
location and significance.
1. KAZIRANGA NATIONAL PARK
LOCATION: Golaghat and Nagaon districts of Assam
SIGNIFICANCE: Kaziranga National park's 430 square kilometer area sprinkled with
elephant-grass meadows, swampy lagoons, and dense forests is home to more than 2200 Indian
one-horned rhinoceros, approximately 2/3rd of their total world population. The park is the
breeding ground of elephants, wild water buffalo, and swamp deer. Over the time, the tiger
population has also increased in Kaziranga, and that's the reason why Kaziranga was declared as
Tiger Reserve in 2006.
2. POINT CALIMERE WILDLIFE AND BIRD SANCTUARY

LOCATION: Point Calimere (Kodiakkarai), Nagapattinam (dt)
SIGNIFICANCE: It was created for the conservation of near threatened species, Black buck
antelope, an endemic mammal species of India.
3. GIR NATIONAL PARK AND WILDLIFE SANCTUARY

LOCATION: Talala Gir in Gujarat
SIGNIFICANCE: Gir is the only natural habitat of world popular Asiatic Lions. It covers total
area of 1412 square kilometers of which 258 Km forms the core area of the National Park. The
Sambar is counted largest Indian Deer. The Gir forest is also known for the Chowsingha – the
world’s only four horned antelope. The Jackal, striped Hyena and Indian Fox are some of the
smaller carnivores found in Gir Forest.
4. PERIYAR WILDLIFE SANCTUARY

LOCATION: Kerala
SIGNIFICANCE: Apart from Elephants, the other animals to be seen in the Periyar sanctuary are
Gaur, Wild Pigs, Sambar, Barking Deer, Mouse Deer, Dole or Indian Wild Dog and very rarely, a
Tiger. There are, now, an estimated 40 tigers here.
5. MUDUMALAI WILDLIFE SANCTUARY AND NATIONAL PARK

LOCATION: Nilgiri hills, Nilgiri District, TamilNadu (Shares boundary with the states of
Karnataka and Kerala).
SIGNIFICANCE The protected area is home to several endangered and vulnerable species
including Indian elephant, Bengal tiger, Gaur and Indian leopard. There are at least 266 species
of birds in the sanctuary, including critically endangered Indian white-rumped vulture and long-
billed vulture.
255

www.tntextbooks.in
4. HUMAN MENDELIAN TRAITS
DOMINANT RECESSIVE
Cleft chin Have cleft No cleft
Hair curl Curly Straight
Roller Non roller

Tongue
rolling
Dimples Dimple No dimple
Ear lobes Free Attached

lobe lobe
Left thumb Right thumb

Interlocking
on top on top
fingers
Handedness Right Left
Widow’s Widow’s Straight

peak peak
Shape of Oval Square

face
Finger mid
Hair No hair
digital hair
256

www.tntextbooks.in
4. HUMAN MENDELIAN TRAITS
AIM
To assess the distribution of various genetic traits in a given population.
MATERIALS REQUIRED
• List of traits
• Sheet of paper
PROCEDURE
• Th
e students are divided into groups and the assessment of the various genetic traits are
done , first individually and then among themselves.
• The phenotype and the possible genotypes are recorded in the tabular column.
• B
ased on the occurrence of the traits , the frequency of the dominant and recessive
characters were discussed.
MY MY GENOTYPE
TRAIT POSSIBLE ALLELES NO. % (DOMINANT OR
PHENOTYPE RECESSIVE)
Cleft chin Have cleft (C)

No Cleft (c)
Hair curl Curly (H)
Straight (h)
Tongue Roller ( T)
rolling Non roller (t)
Dimples Dimple (D)
No dimples (d)
Earlobes Free lobe (F)
Attached (f)
Interlocking Left thumb on top (L)
fingers Right thumb on top (l)
Handedness Right (R)
Left (r)
Widow’s Widow’s peak (W)
peak Straight (w)
Shape of the Oval (O)
face Square (o)
Finger mid- Hair (M)
digital hair No hair (m)
INFERENCE
Discuss and answer the following questions :
1) Did you have mostly dominant or recessive traits?
2) For which trait were most students dominant?
3) For which trait were most students recessive?
257

www.tntextbooks.in
5. ABO BLOOD GROUPS - DEMONSTRATION EXPERIMENT
AIM
To find out the blood group of a classs / school students.
MATERIAL REQUIRED
1. Human blood sample 5. Spirit (70% alcohol)
2. Antisera A and B 6. Slides / White tile
3. Antisera D 7. Cotton
4. Lancet 8. Mixing sticks
PRINCIPLE
The determination of ABO blood group is based on the agglutination reaction. The A, B
and Rh antigens present on the surface of the RBC react with the corresponding antibodies
(antisera) to form visible agglutination or clumping.
PROCEDURE
1. Take a clean dry slide / white tile and divide it into three divisions.
2. Wipe the middle finger with cotton moistened with 70% alcohol and allow to dry.
3. Prick disinfected area with sterile lancet.
4. Squeeze the finger and allow a drop of blood to fall on each division of the slide/ white tile.
5. Add one drop of antiserum into the appropriately labelled drop of blood on the slide/
white tile.
6. Mix serum and blood drops with the applicator stick.
7. Observe the mixtures for agglutination and record the blood groups.
8. Record the findings in a tabular form.
OBSERVATION
Group O Group A
Agglutination with….
Anti A Anti B Anti D Blood Group

B A B A
Group B Group AB
(+)-Agglutination (-)-Non Agglutination
B A B A
RESULT
The given blood is found to be group
WARNING: Use only sterilized lancets. Avoid using bell pins or other sharp objects for pricking.
258

www.tntextbooks.in
A & B- PREPARED SLIDES

6. HUMAN SPERM
IDENTIFICATION Acrosome
The given slide is identified as Human Sperm. Head
Nucleus
COMMENTS
1. The human sperm is microscopic, flagellated and a motile male Neck
gamete. Mitochondria
Middle
2. The sperm is composed of a head, neck, middle piece and a tail. piece
3. The head comprises of acrosome and nucleus.

Tail
4.
The middle piece possesses mitochondria which produces
energy in the form of ATP molecules.
5. The tail is the longest part and is slender and tapering.
7. HUMAN OVUM
IDENTIFICATION
The given slide is identified as human ovum.
COMMENTS
1.
Human ovum is microscopic,
non-cleidoic and a alecithal
&RURQDUDGLDWD
female gamete. =RQD3HOOXFLGD
2.
The ovum is surrounded by 9LWHOOLQH
PHPEUDQH
three coverings namely vitelline
1XFOHXV
membrane, zona pellucida and *HUPLQDOYHVLFOH
corona radiata.
2RSODVP
3.
The cytoplasm of the egg is
called ooplasm and contains a
large nucleus called the germinal
vesicle.
4.
The narrow space between the
vitelline membrane and zona
pellucida is known as perivitelline space.
259

www.tntextbooks.in
8. PARAMECIUM – CONJUGATION
IDENTIFICATION
The given slide is identified as Paramecium – Conjugation.
COMMENTS
1. Conjugation is a form of sexual reproduction,
wherein two individuals called conjugants
Contractile
mutually exchange nuclear material and then vacuole
get separated. Conjugation
tube
2.
The pellicle and cytoplasm at the point of Micronucleus
contact is broken and a protoplasmic bridge is Macronucleus
formed.
3. The large pronucleus acts as female pronucleus

and the smaller nucleus acts as male pronucleus.
4.
The male pronucleus moves through the
protoplasmic bridge and fuses with the female
pronucleus to form the diploid nucleus.
9. Entamoeba histolytica
IDENTIFICATION
The given slide is identified as Entamoeba histolytica.
COMMENTS
1.
Entamoeba is an endoparasitic
protozoan which causes
Plasma
amoebiasis or amoebic dysentery. membrane
2.
It lives in the lumen of the Endoplasm
large intestine and feeds on the
Ectoplasm
epithelial cells.
Nucleus
3. The infective stage of this parasite
is the trophozoite.
4. The symptoms of amoebiasis are
ulceration, bleeding, abdominal
pain and stools with excess
mucus.
260

www.tntextbooks.in
10. THYMUS - T.S
IDENTIFICATION
The given slide is identified as thymus gland – T.S.
COMMENTS
1.
Thymus is a primary lymphoid
bilobed organ located behind the Capsule
sternum and above the heart.
2.
It has many lobules separated
from each other by connective
tissue called septa.
Cortex
Thymocyte
3. Each lobule is differentiated into
an outer cortex and inner medulla.
4. Thymus gland is mainly involved Septa
in proliferation and maturation

Medulla
of T – cells (thymus dependent Hassall’s

corpuscles
cell) and secretion of thymosin
hormone.
11. LYMPH NODE – T.S
IDENTIFICATION
The given slide is identified as lymph node – T.S.
COMMENTS
1.
Lymph node is a small bean shaped
structure found along the course of Afferent
vessel
lymphatic duct.
2. Lymph node has three zones: cortex, Cortex
paracortex and medulla.
Medulla
3.
The cortex contains B lymphocytes,
macrophages and follicular dendritic Capsule
Efferent
cells. vessel Paracortex
4.
The medulla consists of sparsely
populated B-lymphocytes, which
secrete antibody molecules.
5. The paracortex zone lies between the
cortex and medulla and consists of richly populated T cells and dendritic cell.
261

www.tntextbooks.in
C - PRESERVED SPECIMENS
12. MUTUALISM - SEA ANEMONE ON HERMIT CRAB
IDENTIFICATION
The specimen is identified as Sea anemone on hermit crab.
COMMENTS
1. Mutualism is an association of animals
where both species are benefited from Sea
anemone
the interaction.
2. The hermit crab takes shelter on an empty
molluscan shell, while the sea anemone
Hermit
(a sedentary coelenterate) grows on the crab
shell.
3. The crab is protected from its enemies by
the stinging cells found in the tentacles
of sea anemone, whereas the anemone is
transported to procure its food.
13. COMMENSALISM - SUCKER FISH (ECHENEIS) ON SHARK
IDENTIFICATION
The specimen is identified as sucker fish (ECHENEIS) on shark.
COMMENTS
1. Commensalism is an association of two
or more species in which one derives
benefit, while other is neither benefited
nor harmed.
2. The dorsal fin of suckerfish is modified
into a sucker – a sticky gripping structure
used to attach to the body of a larger fish
such as shark.
3.
In this association the fish gets free
transport and food while the shark is
neither benefited nor harmed in the
association. Modified Dorsal
Fin (Sucker)
262

www.tntextbooks.in
D - PICTURES
14. tRNA
3’ OH
IDENTIFICATION A
I
C
The given model is identified as t RNA (transfer RNA). C
COMMENTS 5’
1. t RNA was formerly referred to as sRNA (soluble RNA)

T loop
2. It is a type of RNA and has a clover leaf structure. D loop
3. It is a small RNA molecule, typically between 70 to 90

nucleotides in length.
Variable
4. It is an adapter molecule composed of RNA that serves as arm
the physical link between the mRNA and the amino acid
sequence of proteins. Anticodon
loop
5. It transports activated amino acids from the cellular amino
acid pool to the site of protein synthesis. Anticodon
15. HOMOLOGOUS ORGANS
IDENTIFICATION
The given picture is identified as homologous organs.
COMMENTS
1. Structures which are similar in origin but perform different functions are called homologous
structure.E.g. Fore limbs of terrestrial vertebrates bird, bat, whale, horse, and human.
2.
The forelimbs of these 6 5 4 3 2 1 5 4 3 2 1
organisms perform
different functions, and
have similar anatomical 6
Bat
Bird
structures such as humerus,
radius, ulna, carpals, 1
2
metacarpals and phalanges. 3
4
1
1 2
3.
In these animals same 5
3
structures develop along

2
4
3
different directions due 4

5
Whale 5 Cat Horse Human
to adaptations to different 6
6
needs. This is referred to as 1 Humerus 2 Ulna 3 Radius 4 Carpals 5 Metacarpals 6 Phalanges
divergent evolution.
263

www.tntextbooks.in
16. ANALOGOUS ORGANS
IDENTIFICATION
The given picture is identified as analogous organs.
COMMENTS
1. Organism having different structural patterns but similar function is termed as analogous
structure. E.g. Wings of bird and insects (Butterfly, dragon fly).
2.
The structures of
Forewing
these animals are not Ulna
anatomically similar Carpals

Radius
though they perform Humerus
similar functions.
3. The analogous structures
are developed due to Hindwing
convergent evolution
– different structures
evolving for the same
function.
17. ANIMAL CLONING – DOLLY (SHEEP)
IDENTIFICATION
The given picture is identified as cloning of animal – Udder cell Egg from B
from A
Dolly (Sheep)
COMMENTS Nucleus
Nucleus
Remove
nucleus from
1. Cloning is the process to produce genetically identical Fuse cells egg
individuals of an organism either naturally or artificially.

2. Dolly was the first mammal (sheep) clone developed by
Ian Wilmut and Campbell in 1997.
Culture in
3. Dolly was cloned from a differentiated somatic cell taken oviduct tissue
from an adult animal without the process of fertilization. Implant 6 day old
embryo in surrogate
4.
In this process, the udder cells (somatic cells) of
mammary gland from a donor sheep were isolated. An Blastocyst
ovum (egg cell, germ cell) was taken from the ovary of
another sheep and enucleated.
5. The udder cell and enucleated ovum were fused and
implanted into a surrogate mother. Five months later, Dolly
dolly was born.
264

www.tntextbooks.in
18. HUMAN INSULIN PRODUCTION- FLOWCHART
IDENTIFICATION
The given picture is identified as the flow chart of Human Insulin Production.
COMMENTS Extraction &
DNA Introduction of purification of
1. Production of insulin recombinant
DNA into a
human insulin
C chain
bacterial cell Recombinant
by recombinant DNA
A chain
Bacterium COOH
Human
technology started in the late
H2N
pancreas cell Signal B chain
Human Recombinant
peptide
Pre pro insulin
1970s. insulin-producing
gene
bacteria
multiplying C chain
Recombinant and producing A chain
2. This technique involved the DNA human insulin in

fermentation tank
S
S
S
S
COOH Human insulin
insertion of human insulin

H 2N
Bacterial Plasmid DNA B chain
DNA cut with restriction Pro insulin

Fermentation
enzymes
gene on the plasmids of Tank
H2N
A chain
S S
COOH
E.coli.
Plasmid S
S
S
S
DNA H2N COOH
B chain
Bacterium
3.
The inserted gene
Human insulin Insulin
synthesizes the polypeptide

chains A and B segments linked by a third chain(C) as a precursor called Pre-Pro insulin.
4. The linking C chain is excised, leaving, A and B polypeptide chains.
5. Insulin was the first ever pharmaceutical product of rDNA technology, administered to
humans.
E - GENETICS – KARYOTYPING
19. NORMAL HUMAN KARYOTYPE
IDENTIFICATION
The given photograph is identified as normal karyotype of human beings.
COMMENTS
1.
Karyotyping is a technique A B
through which a complete set of
1 2 3 4 5
chromosomes are separated from
a cell and are arranged in pairs. C
2.
A diagrammatic representation 6 7 8 9 10 11 12
of chromosomes is called an
D E
idiogram. 13 14 15 16 17 18
3. There are 22 pairs of autosomes F G
and a pair of allosomes 19 20 21 22 xy
( XX- female, XY – male) arranged
based on their size, shape, banding pattern and position of centromere.
4. It helps in gender identification and to detect genetic diseases.
265

www.tntextbooks.in
20. AUTOSOMAL ANOMALY – PATAU’S SYNDROME
IDENTIFICATION
The given photograph is identified as Patau’s Syndrome.
COMMENTS
1. It is one of the autosomal aneuploids
formed due to trisomic condition of
chromosome 13.
1 2 3 4 5
2. It is caused by meiotic non-disjunction
of chromosomes.
3. The symptoms are multiple and severe
body malformation with profound 6 7 8 9 10 11 12
mental deficiency.
4.
The individuals have small head
with small eyes, cleft palate and 13 14 15 16 17 18
malformation of brain.
19 20 21 22 x y
21. SEX CHROMOSOMAL ANOMALY - TURNER’S SYNDROME
IDENTIFICATION

The given photograph is identified as
Turner’s syndrome.
COMMENTS
1. This genetic disorder is due to the loss of 1 2 3 4 5 6
an X chromosome resulting in a karyotype
of 44A+XO = 45.
2. It is caused due to meiotic non-disjunction
7 8 9 10 11 12
of allosomes.
3. These individuals are sterile female with
short stature and webbed neck.
13 14 15 16 17 18
4. They also have under developed breasts
and gonads with lack of menstrual cycle
during puberty. 19 20 21 22
x y
266

www.tntextbooks.in
F - PEDIGREE ANALYSIS
22. X – LINKED DISEASE - HAEMOPHILIA (BLEEDER'S DISEASE)
IDENTIFICATION
The given pedigree chart is identified as the genetic disease Haemophilia.
COMMENTS
1. Haemophilia or bleeder’s disease (Royal disease) is the most notorious of all sex-linked
diseases. The person suffering from this disease bleeds for a long period (30 minutes to 24
hours) during injury due to the failure of blood coagulation.
2. It is caused by a recessive X – linked gene more common in men than women.
3. The females are carriers of the disease and would transmit the disease to 50% of their sons
even if the male parent is normal.
4. It follows criss – cross or zig – zag pattern of inheritance (i.e., grandfather transmits his X
linked character to his grandson through carrier daughter).
II
III
IV
DISCUSSION QUESTIONS
1. Observe the given pedigree chart and identify the affected individuals and carriers in the II
generation.
2. Why are men affected often in X linked inheritance?
3. What is the pattern of inheritance in the given pedigree chart?
4. Why are women said to be carriers in X linked inheritance?
5. How is haemophilia caused?
267

www.tntextbooks.in
23. AUTOSOMAL DISEASE –SICKLE CELL ANEMIA
IDENTIFICATION
The given pedigree chart is identified as the genetic disease sickle cell anaemia,.
COMMENTS
1. It is an autosome linked recessive trait that can be transmitted from parents to the offspring,
if both the parents are carriers for the gene (heterozygous).
2. The genotype HbS HbS causes sickle cell anemia, while the genotype HbA and HbS individuals
appear apparently unaffected but they are carrier of the disease.
3. Sickle cell anemia is a classical example of point mutation.
4. The defect is caused by the substitution of Glutamic acid by valine at the sixth position of the
beta chain of the haemoglobin molecules.
II
II
III
III
IV
DISCUSSION QUESTIONS
1. Observe the given pedigree chart and give reasons for the occurrence of the disease in the
second generation.
2. Will males and females be equally affected in this type of inheritance? Give reasons.
3. What is the genotype of the diseased and carrier sickle sell individual?
4. How is Sickle cell anemia disease caused?
268

www.tntextbooks.in
PROJECT WORK
1. D
etermine the universality of variations by studying thumb impressions in a given
population
a. Collect around 15 – 25 thumb impressions from within the families of your area or
among classes of your school.
b. Identify and compare the occurrence of the general patterns like circular (whorls),
loops and arches. Record your results in the form of 'Bar diagram' using frequencies
of the pattern collected in a graph sheet.
c. Eventhough many of them shared the same pattern of imprints, no two imprints were
the same.
S.
Pattern No. of imprints
No
1 Whorls
Whorls
2 Loops
3 Arches
Loops Arches
2. Study the effect of a local industry on the environment

a. Select an industry in your area.
b. Take a detailed note of the source of energy used, raw materials (local or imported),
product formed etc.,
c. List the possible types of pollutants released by the industry(air/water/soil)
d. Check the safety measures undertaken by the management to comply with the
regulations set by the Pollution Control Board
3. Study the ecological role of some insects and birds in a given locality
a. Select an area in school or neighbourhood to observe insects and birds.
b.Study their role as pollinator, agent in seed dispersal, vector for transmission of
disease, predator, prey etc.,
4. Visit to a zoological park/wildlife sanctuary in your locality
a. Observe the variety of birds and animals in the zoo.
b. Tabulate based on the status – endemic, endangered, abundance etc.,
5. Visit to a nearby aquatic habitat
a. Select a nearby waterbody (lake or pond).
b. Observe the aquatic fauna and record your findings.
c. Physico – chemical factors like pH, temperature, turbidity, salinity can also be noted.
269

www.tntextbooks.in
STATE COUNCIL OF EDUCATIONAL RESEARCH AND TRAINING, CHENNAI – 6

ZOOLOGY PRACTICAL
MODEL QUESTION PAPER
CLASS: XII TIME: 2½Hrs
MARKS: 15
1. Analyse the given samples I, II and III for fermentation process. Write the aim, principle,
procedure and inference of the experiment.
(Procedure – 1; Experiment- 1; Result – 1 =3)
2. Analyse the given water samples (I,II and III) for colour and pH . Tabulate your results and find
out which water is suitable for consumption. (2)
3. Mark the location of the given Wildlife Sanctuary and National parks in India map Add a note
on its location and significance.
(or)
Mention any 4 Mendelian traits in your body and write their phenotype and genotype. (2)
4 .a. Identify the reproductive cell in slide ‘A’. Give any 2 structural details with diagram
(½ +½+½=1 ½)
b. Identify the given slide ‘B’. Write any 2 diagnostic features with diagram (½ +½+½=1 ½)
5. Identify the type of animal association in the given specimen ‘C’ and comment
on its interaction. (½+ 1=1 ½)
6. Identify the given picture ‘D’. Write any 2 comments. (½+ 1=1 ½)
7. Identify the chromosomal abnormality in ‘E’. Write any 2 characteristic features. (1)
8. Analyse and identify the genetic disease in the pedigree chart given in ‘F’. Answer the given
questions. (1)
NOTE: Any relevant points and comments apart from those provided in the practical manual must
also be considered for evaluation.
270

www.tntextbooks.in
SYLLABUS
I. REPRODUCTION
1. Human Sperm
2. Human ovum
3. Paramecium – conjugation
II. GENETICS
1. ABO blood grouping
2. Analysing Mendelian traits in a given population
3. tRNA - Structure
4. Homologous organs
5. Analogous organs
6. Normal Human karyotype
7. Autosomal Anomaly – Patau’s Syndrome
8. Sex Chromosomal Anomaly – Turner’s Syndrome
9. Autosomal Disease –Sickle cell anemia
10. X – Linked Disease - Haemophilia
III. HEALTH & DISEASES, IMMUNOLOGY AND MICROBES IN HUMAN

WELFARE
1. Fermentation by yeast
2. Entamoeba histolytica
3. Thymus – T.S
4. Lymph node – T.S
IV. BIOTECHNOLOGY
1. Animal cloning - Dolly (Sheep)
2. Insulin production - Flowchart
V. ECOLOGY
1. Marking of Wildlife Sanctuary and National parks in India map
2. Determination of colour and pH in the given water samples
3. Mutualism - Sea anemone on hermit crab
4. Commensalism - Sucker fish (Echeneis) on shark
271

www.tntextbooks.in
Zoology – Class XII

List of Authors and Reviewers
Advisory Committee Members Subject Expert and Coordinator Domain Experts
and Chair person Dr. S. Shameem Dr. P. Sarala
Associate Professor, Department of Zoology,
Dr. Sultan Ahmed Ismail Deputy Director
State Council of Educational Research and Training, Quaid-e-Millath College for Women, Chennai.
Scientist Chennai.
Ecoscience Research Foundation, Chennai. Dr. Sumit Rose
Dr. P.K. Kaleena Coordinators Associate Professor, Department of Zoology,
Presidency College, Chennai.
Associate Professor, Dr. V.T. Shanthi
Department of Zoology, Senior Lecturer, Dr. B. Meena
District Institute of Education and Tranning, Tirur. Associate Professor, Department of Zoology,
Presidency College, Chennai. Presidency College, Chennai.
Mrs. B. Selvi
Assistant Professor, Dr. E. Malathi
Content Writers SCERT, Chennai. Associate Professor, Department of Zoology,
Queen Mary’s College, Chennai.
Mr. M. Mayilsamy Prospects of Zoology
Senior Lecturer, Reviewers
District Institute of Education and Tranning,
Krishnagiri.
Dr. T. Sankara Saravanan Dr. Dinesh Kumar
Deputy Director
Reader, NCERT, New Delhi.
Dr. P. Sekar Tamil Nadu Textbook and Educational
Assistant Professor Services Corporation, Chennai. Dr.Vareishang Tangu
Govt. Institute of Advanced Assistant Professor in Zoology
Study in Education (Autonomous), Translators RIE NCERT, Mysore.
Saidapet, Chennai.
Dr. S. Muthazhagu Dr. Chitralekha Ramachandran
Dr. S. Ganesapandian Associate Professor (Rtd.) Professor (Rtd.),
Head Master A.A Govt. Arts College, Cheyyar. Stella Mary's College, Chennai.
Government Higher Secondary School,
Kadukkai Valasai, Ramanathapuram Dist. Mr. M. Sivaguru Ms. Hemamalini Akundy
Head Master Assistant HOD., Salwan Public School,
Dr. J. Savarimuthu Michael Sri Ramakrishna Vidyasala Higher Secondary School, Gurgaon.
P.G. Assistant in Zoology Chidambaram, Cuddalore.
Carmel Higher Secondary School, Content Readers
Nagercoil, Kanyakumari Dist. Mr. S. Maheswaran
Head Master Dr. Mazher Sulthana
Mr. Alen Godfrey R. Jose Govt. Boys Higher Secondary School, Associate Professor in Zoology (Rtd.),
P.G. Assistant in Zoology Sayal Gudi, Ramanathapuram Dist. Presidency College, Chennai.
M.C.C Mat.Higher Secondary School,
Chetpet, Chennai. Mr. V. Rajendran Dr. R. Saravanan
Assistant Professor in Zoology
P.G. Assistant in Zoology
Mr. L. Sivan Pillai Government Higher Secondary School,
Dr. Ambedkar Govt. Arts College,
P.G. Assistant in Biology Vyasarpadi, Chennai.
Aragalur, Salem Dist.
Bharath Senior Secondary School,
Mr. S. Natarajan Dr. N. Sarojini
Adyar, Chennai. Assistant Professor in Zoology
P.G. Assistant in Zoology,
Mrs. P. Sophia Selvakumari Model School, Kolli Hills, Namakkal Dist. Bharathi Women’s College, Chennai.
P.G. Assistant in Zoology Mr. K. Senthil Vel Mr. S. Munusamy
Bentinck Higher Secondary School for Girls, P.G.Assistant in Zoology Head Master. (Rtd.),
Vepery, Chennai. A.S. Govt. Higher Secondary School, GHSS., Velachery, Chennai.
Mr. K.P. Muthuswamy Sholavandan, Madurai Dist.
P.G. Assistant in Zoology

C.S.M.A. Higher Secondary School,
Mr. S.P. Sabarinathan
P.G.Assistant in Zoology
Art and Design Team
M.M. Kovilur, Dindigul Dist. Govt. Higher Secondary School, Illustrators
Sengurichi, Dindugul Dist. Gopu Rasuvel
Mr. V. Elangovan
P.G. Assistant in Zoology Mr. G. Kirubananthan N. Prabhakar
Sir M. Ct. M. Higher Secondary School, P.G. Assistant in Zoology Murugesan Veeraiyan
Pursawalkam, Chennai. Govt. Higher Secondary School,
Anakaputhur, Kanchipuram District. Santhanakrishnan
Mr. M. William Vijayraj Vimal Shanmugam
P.G. Assistant in Zoology ICT Coordinators
Dr. P. S. S. Mpl. Higher Secondary School, Layout In-House
Kanchipuram. R.Kamesh
V. S. Johnsmith
Mr. N. Senthil Kumar SGT., Govt. Primary School,
Pinjanur, Cuddalore Dist. Petchimuthu
PG Assistant in Zoology
Govt Boys Higher Secondary School, QR Management Team Santhiyagu Stephen
Thalaivasal, Salem District. R. Mathan Raj
Mrs. Reena Alfred J.F. Paul Edwin Roy, B.T, Pakkirisamy Annadurai
PUMS -Rakkipatty, Salem.
Principal
Alpha Higher Secondary School, M. Murugesan, B.T, Wrapper Design
CIT, Saidapet, Chennai. Pums. Pethavelankottagam, Kathir Arumugam
Muttupettai, Thiruvarur.
Mr. R. Perumal In-House QC
Principal V. Padmavathi, B.T, Manohar Radhakrishnan
Velammal Vidhyashram, GHS, Vetriyur, Ariyalur.
Arun Kamaraj P.
Surapet, Chennai.
This book has been printed on 80 G.S.M. Elegant Maplitho paper. Co-ordination
Printed by offset at: Ramesh Munisamy
272

12th Zoology EM - WWW - Tntextbooks.in

Uploaded by

Document Informationclick to expand document information

Copyright:

Available Formats

12th Zoology EM - WWW - Tntextbooks.in

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

12th Zoology EM - WWW - Tntextbooks.in

Uploaded by

Copyright:

Available Formats

www.tntextbooks.

GOVERNMENT OF TAMIL NADU

HIGHER SECONDARY SECOND YEAR

A publication under Free Textbook Programme of Government of Tamil Nadu

Department of School Education

XII Std Zoology Introduction EM.indd 1 12/14/2021 10:56:05 AM

Government of Tamil Nadu

First Edition - 2019

NOT FOR SALE

State Council of Educational Research

Printing & Publishing

Tamil NaduTextbook and Educational

XII Std Zoology Introduction EM.indd 2 12/14/2021 10:56:05 AM

XII Std Zoology Introduction EM.indd 3 12/14/2021 10:56:05 AM

Conceptual picture with caption relating to

Chapter Outline Presents a complete overview of the chapter

Goals to transform the classroom processes into

Amazing facts, Rhetorical questions to lead students

Directions are provided to students to conduct activities

Infographics Visual representation of the lesson to enrich learning .

HOW TO USE Superfluous information about a personality or day to

To motivate the students to further explore the content

ICT To enhance digital Science skills among students

Conceptual diagram that depicts relationships between

Glossary Explanation of scientific terms

Evaluation Assess students to pause, think and check their understanding

References List of related books for further details of the topic

Web links List of digital resources

XII Std Zoology Introduction EM.indd 4 12/14/2021 10:56:06 AM

Scholarship for Biology Students

XII Std Zoology Introduction EM.indd 5 12/14/2021 10:56:06 AM

Pharmacy Colleges: • Vellore Govt. Medical College, Vellore

XII Std Zoology Introduction EM.indd 6 12/14/2021 10:56:06 AM

List of Tamilnadu Agricultural Salim Ali Centre for Ornithology

XII Std Zoology Introduction EM.indd 7 12/14/2021 10:56:06 AM

HIGHER SECONDARY SECOND YEAR

XII Std Zoology Introduction EM.indd 8 12/14/2021 10:56:06 AM

Paramecia is capable of both sexual and

1.1. Modes of reproduction

XII Std Zoology Chapter 1 EM.indd 1 18/12/2021 14:50:06

in multicellular organisms with relatively i) Simple irregular binary fission

Fig. 1.1 Irregular simple binary fission in Amoeba

Micronucleus Oral groove

Macronucleus Micronucleus New

Fig. 1.2 Transverse binary fission in Paramecium

XII Std Zoology Chapter 1 EM.indd 2 18/12/2021 14:50:06

Chromatids Nucleolar Nuclear

Fig. 1.3 Longitudinal binary fission in Euglena

Fig. 1.4 Multiple fission in encysted Amoeba

XII Std Zoology Chapter 1 EM.indd 3 18/12/2021 14:50:07

Nucleus Spore case

Fig. 1.6 Sporulation in Amoeba

XII Std Zoology Chapter 1 EM.indd 4 18/12/2021 14:50:08

Hydra Growth Bud develops Bud detaches

Fig. 1.7 Budding in Leucosolenia (Sponge) Fig. 1.8 Budding in Hydra

Fig. 1.9 Gemmule in sponges Fig. 1.10 Apolysis in Taenia solium

XII Std Zoology Chapter 1 EM.indd 5 18/12/2021 14:50:09

zygote, which develops into

zygote into a multicellular structure 2.1 Human reproductive system

and the breast size is 3ULPDU\ Q 3ULPDU\RRF\WH