Journal of Controlled Release 330 (2021) 329–340

Contents lists available at ScienceDirect

Journal of Controlled Release

journal homepage: www.elsevier.com/locate/jconrel

Formulation and efficacy of ECO/pRHO-ABCA4-SV40 nanoparticles for

nonviral gene therapy of Stargardt disease in a mouse model
Da Sun a, 1, Wenyu Sun a, 1, Song-Qi Gao a, Cheng Wei a, Amirreza Naderi a, Andrew L. Schilb a,
Josef Scheidt a, Sangjoon Lee a, Timothy S. Kern b, c, Krzysztof Palczewski b, Zheng-Rong Lu a, *
a
Department of Biomedical Engineering, Case Western Reserve University, Cleveland, OH 44106, United States of America
b
Department of Ophthalmology, Physiology & Biophysics, and Chemistry, University of California, Irvine, Irvine, CA 92697, United States of America
c
Veterans Administration Medical Center Research Service, Long Beach, CA, 90822, United States of America

A R T I C L E I N F O A B S T R A C T

Keywords: It is still a challenge to develop gene replacement therapy for retinal disorders caused by mutations in large
Non-viral gene delivery genes, such as Stargardt disease (STGD). STGD is caused by mutations in ABCA4 gene. Previously, we have
ECO developed an effective non-viral gene therapy using self-assembled nanoparticles of a multifunctional pH-
Plasmid DNA
sensitive amino lipid ECO and a therapeutic ABCA4 plasmid containing rhodopsin promoter (pRHO-ABCA4).
Gene therapy
In this study, we modified the ABCA4 plasmid with simian virus 40 enhancer (SV40, pRHO-ABCA4-SV40) for
SV40 enhancer
Stargardt disease enhanced gene expression. We also prepared and assessed the formulations of ECO/pDNA nanoparticles using
sucrose or sorbitol as a stablilizer to develop consistent and stable formulations. Results demonstrated that ECO
formed stable nanoparticles with pRHO-ABCA4-SV40 in the presence of sucrose, but not with sorbitol. The
transfection efficiency in vitro increased significantly after introduction of SV40 enhancer for plasmid pCMV-
ABCA4-SV40 with a CMV promoter. Sucrose didn’t affect the transfection efficiency, while sorbitol resulted in a
fluctuation of the in vitro transfection efficiency. Subretinal gene therapy in Abca4− /− mice using ECO/pRHO-
ABCA4 and ECO/pRHO-ABCA4-SV40 nanoparticles induced 36% and 29% reduction in A2E accumulation
respectively. Therefore, the ECO/pABCA4 based nanoparticles are promising for non-viral gene therapy for
Stargardt disease and can be expended for applications in a variety of visual dystrophies with mutated large
genes.

1. Introduction in various phases of clinical trials [7]. Most of the gene therapies under
clinical development are based on AAVs. However, the broad applica­
Stargardt disease (STGD) is characterized as gradual bilateral decline tion of AAV-based gene therapy is limited by its cargo capacity [8,9].
in central vision and visual acuity that is commonly caused by mutations This greatly restricted the application of viral gene therapies to treat
in ABCA4 gene, which encodes a 210-kDa ATP-dependent flippase ocular genetic diseases caused by mutations in large genes, such as
importer [1,2]. Gene replacement therapy, that delivers a healthy copy Stargardt disease (STGD) and Usher Syndrome [10–12]. For viral sys­
of a mutated gene into the targeted cells and expresses the encoded tems, strategies such as dual-AAV, multi-AAV vectors, and lentiviral
functional protein to restore its normal function, has shown the promise vectors have been tested to overcome the limitations [13–16]. Clinical
for effective treatment for STGD and other genetic ocular diseases [3–5]. application of these therapies is hindered by various limitations,
The first FDA approved gene therapy is adeno-associated virus (AAV) including poor expression of whole functional proteins and immuno­
expressing hRPE65 for treating Leber’s congenital amaurosis type 2 genicity. Non-viral gene delivery systems do not have limitations in gene
(LCA2) [6]. The recent success has re-energized the enthusiasm in packaging capacity and have also been developed for treating various
developing gene therapy to treat previously untreatable genetic disor­ retinal genetic diseases covering wide range of gene sizes [17,18].
ders. Numerous gene therapies have been developed and some are now A challenge for gene therapy in retinal genetic diseases is to maintain

* Corresponding author at: M. Frank Rudy and Margaret Domiter Rudy Professor of Biomedical Engineering, Department of Biomedical Engineering, Case Western
Reserve University, Wickenden 427, Mail Stop 7207, 10900 Euclid Avenue, Cleveland, OH 44106, United States of America.
E-mail address: zxl125@case.edu (Z.-R. Lu).
1
These authors contribute equally to this work.

https://doi.org/10.1016/j.jconrel.2020.12.010
Received 13 July 2020; Received in revised form 7 December 2020; Accepted 9 December 2020
Available online 21 December 2020
0168-3659/© 2020 Elsevier B.V. All rights reserved.
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

prolonged stable protein expression to retain normal visual functions. 2. Results

Clinically, one subretinal administration of AAV therapy could last for
years in LCA2 patients, but the clinical findings indicated declining In order to enhance the expression of ABCA4 gene, a simian virus 40
therapeutic effect over time [4,19,20]. Repetitive administrations may enhancer (SV40) was incorporated into the pRHO-ABCA4 vector, which
be needed to sustain the rescuing effect in retinal structure and function. was used in our previous publications [25,26]. As shown in Fig. 1A, the
Unfortunately, immune response development after the initial viral gene SV40 enhancer was inserted in pRHO-ABCA4 between NheI and NotI
therapy renders the following repeated injection of the viral vector restriction sites. The successful preparation of pRHO-ABCA4-SV40
ineffective [21]. Non-viral gene therapy exhibits low immunogenicity plasmid was confirmed by agarose gel electrophoresis showing the
and can be repeatedly administered for prolonged therapeutic efficacy. polyA SV40 enhancer band after digestions at NheI and NotI restriction
However, non-viral gene delivery systems may suffer from low effi­ sites (Fig. 1B). Similarly, pCMV-ABCA4-SV40 was also prepared as a
ciency [22]. The functional segments on the therapeutic gene construct control plasmid using the plasmid in our previous publications [25,26].
can be modified to enhance the therapeutic efficacy. Because of the ECO/pDNA nanoparticles of pRHO-ABCA4-SV40 and pCMV-ABCA4-
unlimited gene loading capacity of the non-viral system, therapeutic SV40 were first prepared by self-assembly of ECO with the plasmids at
plasmids can be modified with tissue specific promoters to achieve amine/phosphate (N/P) ratios of 6, 8 and 10 [25,26]. The plasmids
specific gene expression in different retinal tissues or cells [23,24]. pRHO-ABCA4 and pCMV-ABCA4 were used as controls. Sucrose or sor­
Tissue specific promoters have been incorporated in plasmid DNA to bitol were then added as an excipient with a concentration of 5% or 10%
enhance specific gene expression, while universal promoters used in to stabilize the nanoparticles. The nanoparticles were characterized by
AAV-based gene therapy tend to facilitate non-specific transient protein dynamic light scattering (DLS) for their size distributions (Fig. 2) and
expression in all cell types [25,26]. Tissue specific promoters can also zeta potential distributions (Fig. 3) under different excipient conditions.
minimize off-target transgene expression and improve the safety of gene As shown in Fig. 2, ECO and pABCA4s formulated stable nanoparticles at
therapy. Therapeutic gene constructs can also be modified with all the N/P ratios in the presence of sucrose at both 5% and 10% con­
expression enhancers for enhancing exogenous expression in mamma­ tents. The sizes were between 220 nm and 250 nm and the distributions
lian cells with the non-viral delivery systems [27]. were seen as single peaks with negligible aggregation peaks and were
Development of stable and reproducible formulation of nanoparticle not affected by the excipient. However, sorbitol addition affected some
based non-viral gene therapy is an essential step for clinical translation of the ECO/pABCA4 formulations. For example, ECO/pRHO-ABCA4 at
based on the requirements from the regulatory agencies. The formula­ N/P ratio of 6, ECO/pRHO-ABCA4-SV40 at N/P ratio of 8, ECO/pCMV-
tion or drug product of gene therapy should have consistent physico­ ABCA4 at N/P ratio of 10, and ECO/pCMV-ABCA4-SV40 at N/P ratio of
chemical properties, including acceptable stability and shelf life, 10 showed broadened size distributions after sorbitol addition. Zeta
consistent particle size, size distribution and surface charges [28]. It is potential distributions demonstrated no noticeable change after sucrose
costly to establish Good Manufacturing Practice (GMP) for viral gene additions for the ECO/pABCA4 nanoparticle formulations (Fig. 3). ECO/
therapies due to expensive biological production process, which leads to pABCA4 nanoparticles demonstrated uniformed distributions around
high prices for the therapies [29,30]. The GMP production of non-viral +20 mV across all the N/P ratios under sucrose conditions. However,
gene therapies can be achieved with conventional chemical process, sorbitol addition to ECO/pABCA4 nanoparticle formulations resulted in
which is more cost-effective than viral systems. In order to produce some noticeable changes in zeta potential distributions.
consistent and stable nanoparticle formulations, stabilizers have been Encapsulation of pABCA4s in the ECO/pABCA4 nanoparticle for­
used in the formulations to prevent particle aggregations [31,32]. Most mulations under different excipient conditions (sucrose and sorbitol, 5%
stabilizers are able to form hydrogen bonds on the surface of nano­ or 10%) was verified by agarose gel electrophoresis (Fig. 4). ECO and
particles to stabilize nanoparticle formulations in aqueous solution by pABCA4s formulated stable nanoparticles at all N/P ratios for all the
either exchanging with water molecules or forming an inert and rigid excipients conditions, demonstrated by visible bands remaining on the
glass matrix for an acceptable shelf-life [33]. The stabilizers are gener­ top of the gels. As shown in our previous studies, ECO could efficiently
ally biocompatible substances with minimal effect on the nanoparticle encapsulate pABCA4s or other large plasmids with nanoparticle stability
functions. Sucrose, trehalose, sorbitol and hydroxyethyl starch have observed through the voltage conditions of electrophoresis [25,26,44].
been used as stabilizers in a wide variety of nanoparticle formulations Unlike the effects on the size and zeta potential distributions, sorbitol
[34–36]. did not affect the stability and encapsulations of ECO/pABCA4 nano­
We have developed a multifunctional pH-sensitive amino lipid (1- particles. Taken together, sorbitol has some unpredictable effects on the
aminoethyl)iminobis[N-(oleoylcysteinyl-1-amino-ethyl)propionamide) stability of the ECO/pABCA4 nanoparticles and may not be a suitable
(ECO) based nanoparticle platform for efficient intracellular delivery of excipient for ECO/pDNA nanoparticles despite that it has commonly
therapeutic nucleic acids, including siRNA and plasmid DNA. ECO has used on pharmaceutical formulations. Sucrose demonstrates no effect on
demonstrated excellent efficacy for cytosolic delivery of therapeutic the size, zeta potential and stability of ECO/pABCA4 nanoparticles and
nucleic acids of different sizes in a wide range of applications is a promising excipient for the formulations of ECO/pABCA4
[25,26,33,37–44]. In a previous study, we demonstrated that ECO nanoparticles.
facilitated efficient subretinal delivery of a large rhodopsin promoter To assess the introduction of SV40 enhancer on transfection effi­
(photoreceptor specific) modified therapeutic ABCA4 plasmid (pRHO- ciency, ECO/pCMV-ABCA4 and ECO/pCMV-ABCA4-SV40 nanoparticles
ABCA4, 12 kb), and induced long-term ABCA4 expression in the retina (N/P = 6, 8, 10; pDNA concentration 1 μg/mL and 2 μg/mL) were
of a mouse model of Stargardt disease [25,26]. In this study, we opti­ investigated in ARPE-19 cells. ABCA4 expressions at the mRNA level
mized the therapeutic plasmid with a simian virus 40 enhancer (SV40) were analyzed using qRT-PCR 48 h after transfection (Fig. 5). ECO/
(pRHO-ABCA4-SV40) for prolonged gene expression. We also explored pCMV-ABCA4-SV40 nanoparticles demonstrated significantly more
and developed stable ECO/pRHO-ABCA4-SV40 nanoparticle formula­ ABCA4 mRNA expression than ECO/pCMV-ABCA4 without the SV40
tions using sucrose and sorbitol to improve stability and shelf-life for enhancer for both doses. ABCA4 mRNA expression also increased with
clinical translation. The formulations of ECO/pCMV-ABCA4-SV40 the N/P ratios and pDNA doses. Therefore, introduction of the SV40
nanoparticles were also developed as a non-specific control. The nano­ enhancer is able to significantly enhance the in vitro expression of ECO/
particles were characterized and tested for gene expression in vitro and in pDNA nanoparticle formulations.
vivo. Gene replacement therapy of ECO/pRHO-ABCA4-SV40 nano­ The effect of sucrose and sorbitol on gene expression was also eval­
particle formulations was also performed to evaluate the efficacy in uated using pCMV-ABCA4 (with and without SV40 enhancer) and a re­
Abca4− /− mice, the orthologous rodent model to STGD. porter plasmid pCMV-GFP in ARPE-19 cells. The GFP expression was
evaluated using confocal microscope and flow cytometry 48 h after

330
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 1. Plasmid pRHO-ABCA4-SV40 vector map demonstrating the insertion of SV40 enhancer between NheI and NotI restriction cites (A) and agarose gel elec­
trophoresis confirming the success of SV40 insertion (B).

transfection (Fig. 6). Significant GFP signals were observed under expression in Abca4− /− mice and reduced A2E accumulation [25].
confocal for all the conditions compared with untreated control using Similarly, the Abca4− /− mice (1-month-old) received a single subretinal
ECO/pCMV-GFP nanoparticles (Fig. 6A). The flow cytometry results also injection of ECO/pRHO-ABCA4 or ECO/pRHO-ABCA4-SV40 with PBS as
demonstrated around 70% of cells showing GFP expression for ECO/ a control. All the treated mice were euthanized 8 months after injection
pCMV-GFP nanoparticles in 5%, 10% sucrose and 10% sorbitol (Fig. 6B and the A2E levels were analyzed using high-performance liquid chro­
and C). However, GFP expression was significantly reduced when 5% matography (HPLC). A2E was identified as the peak at 2.5 min in the
sorbitol was added (Fig. 6C). ABCA4 expression were not affected by chromatograms under current HPLC running conditions, which was
sucrose addition as demonstrated in Fig. 6D. ECO/pCMV-ABCA4-SV40 ensured by the analysis of the synthesized A2E standard (Fig. 8A). The
nanoparticles demonstrated significantly higher ABCA4 mRNA expres­ spectra of A2E standard, A2E from control, ECO/pRHO-ABCA4 treated,
sion than ECO/pCMV-ABCA4 due to the effect of the introduction of and ECO/pRHO-ABCA4-SV40 treated mice were compared and found to
SV40 enhancer. However, sorbitol addition significantly reduced the contain the same peaks at 336 nm and 439 nm (Fig. 8B). The area of A2E
ABCA4 mRNA expression for ECO/pCMV-ABCA4-SV40 nanoparticles peaks reduced significantly after treatments of ECO/pRHO-ABCA4 and
(Fig. 6D). The results indicated that SV40 enhancer could enhance ECO/pRHO-ABCA4-SV40 nanoparticles compared with the control
ABCA4 expression in vitro and sucrose had no effect on the transfection group (Fig. 8C). Quantitative analysis demonstrated an average A2E
efficiency of ECO/pDNA nanoparticles, while sorbitol demonstrated level of 71.78 ± 25.60% (ca. 29% reduction) for ECO/pRHO-ABCA4-
unpredictable effects on ECO/pDNA transfection efficiency. SV40 and 63.95 ± 27.54% (ca. 36% reduction) for ECO/pRHO-ABCA4
The cytotoxicity of ECO/pDNA nanoparticles were evaluated using treated mice (Fig. 8D). A large variation of in vivo efficacy was observed
pRHO-ABCA4 and pCMV-ABCA4 (with or without enhancer SV40) at with ECO/pRHO-ABCA4-SV40 nanoparticles. The modification of
different N/P ratios (6 and 8) and different doses in ARPE-19 cells. As pRHO-ABCA4 with the SV40 enhancer did not result in improvement of
shown in Fig. 7, ECO/pRHO-ABCA4 (with and without enhancer) in vivo efficacy than the unmodified plasmid. This could be explained
demonstrated better cell viability than ECO/pCMV-ABCA4 (with and from the ABCA4 mRNA expression after subretinal treatments using
without enhancer). Higher pDNA doses were correlated with lower cell ECO/pRHO-ABCA4 and ECO/pRHO-ABCA4-SV40 nanoparticles. ECO/
viabilities across all the nanoparticles. At N/P ratio of 6, almost all pRHO-ABCA4-SV40 resulted in slightly higher ABCA4 mRNA expression
nanoparticles demonstrated more than 80% cell viability, except for than ECO/pRHO-ABCA4 at 4 days although difference was not signifi­
higher doses groups. At N/P ratio of 8, reduced cell viability was cant (Fig. 8E). In contrast, ABCA4 mRNA expression with ECO/pRHO-
observed for higher doses, especially for pCMV-ABCA4. Overall, ECO/ ABCA4-SV40 was slightly less than ECO/pRHO-ABCA4 at 4.5 months
pABCA4 nanoparticles demonstrated good cell viability and low (Fig. 8F). It implies that the plasmid pRHO-ABCA4-SV40 with the viral
cytotoxicity. enhancer might be cleared faster than the one without the enhancer.
The efficacy of preventing Stargardt disease (STGD) progression
using gene therapy with ECO/pRHO-ABCA4 and ECO/pRHO-ABCA4- 3. Discussion
SV40 was assessed based on the accumulation of A2E in the retinal
pigmented epithelium (RPE) of Abca4− /− mice. A2E, a photo-toxic Gene therapy holds great promise for the treatment of monogenic
dimer of vitamin A, is a main component of lipofuscin. A2E accumula­ retinal disorders, but still faces challenges for efficient and specific de­
tion is commonly used as an indicator of STGD progression [45,46]. One livery of therapeutic genes, especially large genes. The clinical appli­
of the therapeutic strategies for treating STGD is to slow down the cations of adeno-associated viruses (AAVs) are limited to the genes that
production of A2E to minimize chronic oxidative damage that ultimately can fit in the viral cavities. The multifunctional pH-sensitive amino lipid
leads to atrophy. In previous work, we demonstrated prolonged ABCA4 ECO can encapsulate genetic materials of unlimited sizes from siRNAs

331
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 2. Size distributions of the nanoparticles of ECO with pCMV-ABCA4, pCMV-ABCA4-SV40, pRHO-ABCA4, and pRHO-ABCA4-SV40 in the presence of sucrose and
sorbitol as measured by dynamic light scattering.

and miRNAs to large plasmid DNAs [25,26,37–44]. ECO has demon­ nucleic acids in cytoplasm, the PERC effect, which allows highly effi­
strated high transfection efficiency both in vitro and in vivo for various cient cytosolic delivery of therapeutic nucleic acids [25,26,37–44].
applications from cancer therapies to retinal gene therapies Here, ECO readily formed stable nanoparticles with ABCA4 plasmids via
[25,26,37–44]. ECO based nanoparticles can facilitate pH-sensitive self-assembly with uniformed size distributions and complete encapsu­
amphiphilic endosomal membrane destabilization and endosomal lations, and mediated efficient intracellular gene delivery and
escape as well as reductive dissociation of the nanoparticles to release expression.

332
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 3. Zeta potential distributions of the nanoparticle formulations of ECO with pCMV-ABCA4, pCMV-ABCA4-SV40, pRHO-ABCA4, and pRHO-ABCA4-SV40 in
existence with sucrose and sorbitol as stabilizers.

Clinical translation of nanoparticle-based non-viral gene therapies work that they behaved differently on the stability of the ECO/pDNA
for retinal genetic disorders requires the development of stable nano­ nanoparticles. Although the presence of both excipients resulted in
particle formulations to ensure safety and efficacy of drug products. complete encapsulation of the DNA plasmids in the nanoparticles, sor­
Excipients are commonly used in nanoparticle formulations to preserve bitol caused substantial aggregation and change of zeta potentials of the
the nanoparticles with consistent physicochemical properties. Sucrose nanoparticles in aqueous solution, while sucrose did not have a
and sorbitol are the commonly used excipients for the stabilization of the noticeable effect on particle formulations (Figs. 2, 3 and 4). Sucrose has
nucleic acid nanoparticle formulations. Interestingly, we found in this been tested previously as a stabilizer for ECO/siRNA nanoparticles,

333
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 4. Agarose gel electrophoresis showing the encapsulation of plasmid DNA in the nanoparticles formulated by ECO with pCMV-ABCA4, pCMV-ABCA4-SV40,
pRHO-ABCA4, and pRHO-ABCA4-SV40 in the presence of sucrose and sorbitol.

which also demonstrated no negative effects on particle formulations, bovine rhodopsin specific promoter (RHO) in the plasmid facilitates
retained transfection efficiency, and improvements in nanoparticle long- specific expression of ABCA4 in the outer segment (OS) previously [25].
term storage [33]. The formulations with sucrose also resulted in higher Enhancer sequences are often incorporated in the plasmid DNA to in­
expression of a reporter gene and ABCA4 than those with sorbitol. The crease gene expression with non-viral nanoparticles. The SV40 enhancer
difference between sucrose and sorbitol may be associated with their containing a 72 base pair repeat could enhance the expression of non-
structures. Sucrose is a disaccharide of glucose and fructose, which can viral genes in cells and in vivo [49,50]. It was incorporated in pRHO-
form an inert and rigid glass matrix that can immobilize the nano­ ABCA4-SV40 to explore the potential for enhanced long-term expression
particles to stabilize the formulation [47]. Sorbitol is linear polyols but of ABCA4 for treating Stargardt disease. Since it is difficult to culture
possibly facilitates the nanoparticles via hydrogen binding [48]. photoreceptor cells, we constructed a different plasmid with a common
The pRHO-ABCA4 plasmid was modified by adding an enhancer CMV promotor and SV40 enhancer (pCMV-ABCA4-SV40) to assess the
SV40 with an expectation of augmenting the gene expression for effi­ effect of SV40 enhancer in vitro with ARPE-19 cells. Significantly
cacious treatment of Stargardt disease. We have shown previously that augmented gene expression was observed for ECO/pCMV-ABCA4-SV40
ECO/pRHO-ABCA4 was effective to mediate gene expression specifically when compared to ECO/pCMV-ABCA4 (Fig. 5).
in the outer segments of the photoreceptor cells. The tissue specific We have shown previously that ECO/pRHO-ABCA4 nanoparticles

334
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

solvents such as, acetonitrile (ACN), ethanol and methanol were ordered
from Thermo Fisher Scientific (Hampton, NH). The synthesis of Lipid
ECO followed the procedures reported previously [37,38]. For cell cul­
ture, penicillin fetal bovine serum, and streptomycin were purchased
from Invitrogen (Carlsbad, CA). The ABCA4 plasmid (pCMV-ABCA4)
was kindly gifted by Dr. Robert S. Molday (University of British
Columbia), which included human ABCA4 cDNA sequence of full-length
(NCBI Accession # NM_000350.2) on a pCEP4 backbone. pRHO-ABCA4
was prepared as previously described [25].

4.2. Plasmid construction

The pRHO-ABCA4 plasmid was constructed by molecular cloning of

the cDNA for the ABCA4 gene into the linearized pRHO-DsRed plasmid
with the DsRed reporter gene removed [25]. The cDNA for the ABCA4
gene was amplified by polymerase chain reaction (PCR) with the Q5
High-Fidelity DNA Polymerase enzyme. The forward primer was 5’-
AATACCGGTATGGGCTTCGTGAGACAGATA-3′ and the reverse primer
was 5’-TATATAGCGGCCGCTAGCTCAGTCTGCTGTTT-3′ for adding the
AgeI and NotI restriction sites to the 5′ - and 3′ -ends of ABCA4, respec­
Fig. 5. In vitro transfection of ECO/pCMV-ABCA4 and ECO/pCMV-ABCA4-SV40 tively. All enzymes were purchased from New England Biolabs (Ipswich,
nanoparticles in ARPE-19 cells demonstrated by qRT-PCR of ABCA4 mRNA MA). SV40 polyA and SV40 enhancer was copied from plasmid pGL3-
expression 48 h after transfections. ABCA4 mRNA expressions were normalized control vector (Promega, Madison, WI) by PCR with forward primer 5′ -
to the expression of ECO/pCMV-ABCA4 at N/P ratio of 6 and 1 μg/mL dose. (*p ATGCGGCCGCTACCACATTTGTAGAGGTTTTAC and reverse primer 5′ -
< 0.05, relative to the mRNA expression of ECO/pCMV-ABCA4 at the same
AAGCTAGCGCTGTGGAATGTGTGTCAG containing NotI and NheI sites
condition. #p < 0.05, relative to the same nanoparticle formulation at 1
on both ends. Digested and purified SV40 polyA and enhancer fragment
μg/mL.)
was ligated to pRHO-ABCA4 plasmid. Final plasmid stocks were
confirmed by Sanger sequencing.
can induce up to 8-month expression of ABCA4 in mice and can delay the
disease progression by reducing A2E accumulation in Abca4− /− mice 4.2.1. Cell culture
[25]. The efficacy of ECO/pRHO-ABCA4-SV40 was assessed in compar­ ARPE-19 (ATCC, Manassas, Virginia) cells were passaged and
ison with ECO/pRHO-ABCA4 at 8 months after a single subretinal in­ maintained in a Dulbecco’s modified Eagle’s medium containing fetal
jection in Abca4− /− mice. Both nanoparticles demonstrated about 29% bovine serum (10%), streptomycin (100 μg/mL), and penicillin (100
and 36% A2E reduction on average compared to the PBS injected con­ units/mL). Cells were kept in a humidified incubator at 37 ◦ C and 5%
trols (Fig. 8). No significant difference was observed between ECO/ CO2.
pRHO-ABCA4-SV40 and ECO/pRHO-ABCA4 as was shown in the in vitro
experiments. The inclusion of the SV40 enhancer did not demonstrate 4.2.2. Animal
better efficacy, possibly due to the cell type preference of SV40 and the
Pigmented Abca4− /− knockout mice were obtained as described
fluctuating nature of the virus origin [51]. Another explanation could be previously and maintained with mixed backgrounds of 129Sv/Ev or
fast clearance of the pRHO-ABCA4-SV40 plasmid with the viral enhancer
C57BL/6 [25,26]. Animals were housed and bred in the Animal
from the eye based on the reduction of mRNA expression in the eye over Resource Center at CWRU. All procedures followed approved protocols
time, (Fig. 8E,F). The other cause could be the variability for subretinal
by the CWRU Institutional Animal Care and Use Committee
injections, which is a challenging task as well. Nevertheless, the obser­ (IACUC#2014–0053), which were also in compliance with recommen­
vation is helpful to explore different strategies on the optimization of the
dations from the Association for Research for Vision and Ophthalmology
ABCA4 plasmid for enhanced therapeutic efficacy. Currently, we are and the American Veterinary Medical Association Panel on Euthanasia.
exploring modifications of ABCA4 plasmid with a human promoter and
a human enhancer for clinical translation. 4.2.3. Preparation of ECO/pDNA nanoparticles
In conclusion, multifunctional pH-sensitive amino lipid ECO and
The preparation of ECO/pDNA nanoparticles was as previously
ABCA4 plasmids form stable nanoparticle formulations through self- described [25,26]. Briefly, ECO (25 mM) in ethanol was added and
assembly in both 5% and 10% sucrose stabilizer. The addition of su­ mixed with a plasmid DNA (0.5 mg/mL) aqueous solution at pre­
crose as stabilizer produced no effect on the transfection efficiency of determined volume from the N/P ratio (amine to phosphate ratio) of 6, 8
ECO/pABCA4 nanoparticles. Modification of ABCA4 plasmids with an or 10. The mixture was first vortexed at 3000 rpm for 1 min and left on a
SV40 enhancer induced significantly higher gene expression in ARPE-19 shaker for 30 min. For some of the nanoparticles, sucrose (5% or 10%) or
cells, and demonstrated a similar level of A2E reduction in treated sorbitol (5% or 10%) was added after the first shaking and further
Abca4− /− mice as ECO/pRHO-ABCA4 nanoparticles. Therefore, the shaken for another 20 min. The final DNA concentration in the nano­
ECO/pABCA4 nanoparticles with a modified enhancer sequence and the particle for characterization and in vivo experiments was 200 ng/μL. For
stabilizer can be a promising, reliable, and safe non-viral gene therapy in vitro transfection, an ECO stock solution of 2.5 mM was used to
platform to deliver large therapeutic genes for the treatment of Stargardt formulate nanoparticles. Encapsulations of pDNA by lipid ECO in
disease. nanoparticle formulations were characterized by an agarose gel elec­
trophoresis method. Agarose gel (0.7%) in TBE buffer (0.5%) was per­
4. Materials and methods formed at 120 V for 25 min.

4.1. Reagents 4.2.4. Dynamic light scattering

The sizes and zeta potentials were characterized for nanoparticle
All reagents ordered from vendors were directly used without extra formulations of ECO/pDNA using a dynamic light scattering method
purification unless they were otherwise detailed in this section. Organic with an Anton Paar Litesizer 500 (Anton Paar USA Inc., Ashland, VA).

335
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

(caption on next page)

336
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 6. In vitro transfection of ECO/pDNA nanoparticles in ARPE-19 cells in the presence of sucrose or sorbitol. Confocal images (A) and flow cytometry (B, C) of GFP
expression in ARPE-19 cells 48 h after transfection using ECO/pCMV-GFP nanoparticles (N/P = 8, DNA concentration of 1 μg/mL, under 0%, 5% and 10% sucrose or
sorbitol). (D) ABCA4 mRNA expression 48 h after transfections demonstrated by qRT-PCR using ECO/pCMV-ABCA4 and ECO/pCMV-ABCA4-SV40 nanoparticles (N/P
ratios of 6, 8 and 10, DNA concentration of 1 μg/mL, under 0%, 5% and 10% sucrose or sorbitol). ABCA4 mRNA expressions of ECO/pCMV-ABCA4-SV40 nano­
particles were normalized to those of ECO/pCMV-ABCA4 nanoparticles. (Scale bars represent 20 μm. *p < 0.05, relative to the non-treated control in B and C. #p <
0.05, relative to the GFP expression in 5% sorbitol. *p < 0.05, between the two groups under the line in D).

Each sample was analyzed at 25 ◦ C. cells per well. The nanoparticles were incubated with ARPE-19 cells as
previously described. After 48 h, fluorescence images of GFP expression
4.2.5. In vitro transfection were acquired using an Olympus FV1000 confocal microscope.
Transfections were performed on 12-well plates, where ARPE-19
cells were seeded at a concentration of 4 × 104 cells/well. Cells were 4.2.6. Cytotoxicity
allowed to grow for 24 h before transfection. Nanoparticles of different Cytotoxicity of ECO/pABCA4 nanoparticles was investigated using a
N/P ratios at pDNA concentrations of 1 or 2 μg/mL in DMEM with 10% CCK-8 assay (Dojindo Molecular Technologies, Inc., Washington, D.C.).
serum were added to ARPE-19 cells and incubated for 8 h at 37 ◦ C. The Cell viability was evaluated using ARPE-19 cells on 96-well plates,
media containing nanoparticles was then replaced with fresh DMEM where cells were seeded at a concentration of 1 × 104 cells per well.
(10% serum). ARPE-19 cells were further incubated for an additional 48 ARPE-19 cells were incubated with ECO/pABCA4 nanoparticles at
h. Expression of ABCA4 was evaluated by qRT-PCR at mRNA level. different DNA doses of (10 ng, 25 ng, 50 ng, 100 ng, 200 ng, 400 ng, and
Transfection of ECO/pCMV-GFP nanoparticles of N/P = 8 was also 800 ng) in 100 μL DMEM (10% serum) medium for 8 h at 37 ◦ C. Then the
conducted similarly in ARPE-19 cells, where DMEM (10% serum) and a nanoparticle containing DMEM was replaced with fresh DMEM (10%
pDNA concentration of 1 μg/mL were used. The transfection was per­ serum). The cells were allowed to grow until 48 h and washed with PBS.
formed in a 12-well plate with ARPE-19 cell concentration of 4 × 104 The CCK-8 reagent was added to each well followed by an incubated of
1.5 h at 37 ◦ C. The absorbance at 450 nm was recorded using a plate
reader. Cell viability was characterized by normalizing to the absorption
of non-treated control.

4.2.7. qRT-PCR
The analysis was performed as previously described [25,26]. A
scraper was used for cell lysis and homogenization. The RNA extractions
for cell samples were conducted using a QIAGEN RNeasy kit following
the manufacturer’s instructions. cDNAs were synthesized from mRNA
transcripts using a QIAGEN miScriptII reverse transcriptase kit (Ger­
mantown, MD). For animal experiments, the eye tissue samples were
homogenized using a glass tube loaded with 0.6 mL of the lysis buffer on
ice. The RNA extractions and cDNAs synthesis were performed using the
same kits as described previously for cell samples. The qRT-PCR analysis
was performed in a Mastercycler instrument (Eppendorf, Hauppauge,
NY) using a SYBR Green Master mix (AB Biosciences, Allston, MA). Fold
changes of mRNA levels were determined by normalization to 18S.
Primers for ABCA4 can be found in previous work [25].

4.2.8. In vivo subretinal transfection with ECO/pDNA nanoparticles

Subretinal injection was performed as previously described [25]. The
nanoparticle solution (1 μL) was injected by a pump with a steady speed
of 150 nL/s into the mouse eye. Successful administration was
confirmed by bleb formation in the subretinal space. A total of 200 ng
plasmid or pABCA4 was delivered. Mice injected with 1 μL of PBS were
used as controls.

4.3. Synthesis and HPLC analysis of A2E

Synthesis of A2E standard was the same as described previously [25].

A mixture of all-trans-retinal (100 mg, 352 μmol) and ethanolamine (9.5
mg, 155 μmol) in ethanol (3.0 mL) was stirred in the presence of acetic
acid (9.3 μL, 155 μmol) at room temperature with a sealed cap in the
dark for 2 days. After the mixture was concentrated in vacuo, the residue
was purified by silica gel column chromatography. After elution with
MeOH:CH2Cl2 (5:95), further elution with MeOH: CH2Cl2: trifluoro­
acetic acid (8:92:0.001) gave A2E. Pure samples were obtained by HPLC
purification [ZORBAX 300 SB-C18, 9.4 × 250 mm, 84–100% water/
acetonitrile for 30 min, 1.0 mL/min flow detected at UV 430 nm]. A2E
Fig. 7. CCK-8 assay of cytotoxicity of (A) ECO/pRHO-ABCA4, ECO/pRHO- was detected at retention time (tR = 35.2 min). Collection of the fraction
ABCA4-SV40, (B) ECO/pCMV-ABCA4, and ECO/pCMV-ABCA4-SV40 nano­ provided pure A2E for further analysis. A2E was characterized by mass
particles in ARPE-19 cells 48 h after transfection (*P < 0.05 relative to non- spectrometry.
treated control). A2E samples were extracted from the deep-frozen (− 80 ◦ C) eye

337
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

Fig. 8. Efficacy of ECO/pRHO-ABCA4 and ECO/pRHO-ABCA40-SV40 nanoparticles for preventing A2E accumulation in Abca4− /− mice. (A) HPLC analysis of
synthesized A2E standard. (B) A2E spectra of synthesized A2E standard, and samples from nanoparticle treated and control mice. (C) HPLC chromatograms of A2E
from control, ECO/pRHO-ABCA4, and ECO/pRHO-ABCA40-SV40 nanoparticles treated Abca4− /− mice 8 months after subretinal injections. (D) Quantitative A2E
levels of ECO/pRHO-ABCA4 and ECO/pRHO-ABCA40-SV40 nanoparticles treated Abca4− /− mice relative to PBS control mice 8 months after subretinal injections.
ABCA4 mRNA expression (E) 4 days and (F) 4.5 months after subretinal treatments of ECO/pRHO-ABCA4 and ECO/pRHO-ABCA4-SV40 nanoparticles in Abca4− /−
mice. (error bars = ± SD, **P < 0.05 relative to control eyes. Statistical analysis was conducted with one-way ANOVA).

samples. The extraction was performed in 1 mL of acetonitrile after is listed in the figure captions. Experimental data are presented as av­
homogenization with a Brinkmann Politron homogenizer (Kinematica, erages with standard deviations. Statistical analysis was performed with
Lucerne, Switzerland). After evaporation of solvent, extracts were dis­ one-way ANOVA and two-tailed Student’s t-tests. A 95% confidence
solved in 120 μL acetonitrile with 0.1% TFA. Samples (100 μL) were interval was used and P ≤ 0.05 was accepted as statistically significant.
loaded on a C18 column (Gemini® 5 μm 110 Å HPLC Column 250 × 4.6
mm) (Phenomenex, Torrance, CA) and analyzed by an Agilent 1260 Author contributions
infinity II reverse-phase HPLC (Agilent Technologies, Santa Clara, CA).
A2E was eluted with the following gradients of acetonitrile in water Z.R.L. and D.S. conceived the conceptualization of the project. D.S.
(containing 0.1% trifluoroacetic acid): 85–96% (10 min), 96% (5 min), and W.S. were involved in all aspects of this work including data cura­
96–100% (2 min), and 100% (13 min) (flow rate, 1 mL/min), and they tion, analysis, investigation, methodology, project administration and
were monitored at 439 nm. For A2E quantification by reverse phase validation. S.Q.G performed HPLC analysis of the samples (data curation
HPLC, areas of the A2E peaks from the treated mice were normalized to and analysis). C.W., A.N., A.L.S., and J.S. performed nanoparticle
the average of controls. Total of 4 ECO/pRHO-ABCA4 treated eyes, 5 formulation, characterization, and qRT-PCR analysis (methodology,
ECO/pRHO-ABCA4-SV40 treated eyes and 10 control eyes were data curation and formal analysis). S.L. performed on cytotoxicity
analyzed. experiment and data analysis (methodology, data curation and formal
analysis). T.K. and K.P. provided assistance with animal model resources
4.3.1. Statistical analysis and experiment design and conceptualization (conceptualization, re­
Experiments were performed in triplicate and the number of animals sources). D.S. prepared the first draft (writing-original draft). D.S. and Z.

338
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

R.L. revised and completed the final version (writing- review & editing). [19] J. Bennett, M. Ashtari, J. Wellman, K.A. Marshall, L.L. Cyckowski, D.C. Chung,
S. McCague, E.A. Pierce, Y. Chen, J.L. Bennicelli, X. Zhu, G.-s. Ying, J. Sun, J.
All authors read and approved the final paper.
F. Wright, A. Auricchio, F. Simonelli, K.S. Shindler, F. Mingozzi, K.A. High, A.
M. Maguire, AAV2 gene therapy readministration in three adults with congenital
blindness, Sci. Transl. Med. 4 (120) (2012), 120ra15-120ra15.
Declaration of competing interest [20] E.A. Pierce, J. Bennett, The status of RPE65 gene therapy trials: safety and efficacy,
Cold Spring Harbor Persp. Med. 5 (9) (2015).
[21] M. Federico, A.H. Katherine, Immune responses to AAV in clinical trials, Curr.
The authors have declared that no conflict of interest exists. Gene Therapy 11 (4) (2011) 321–330.
[22] R. Zulliger, S.M. Conley, M.I. Naash, Non-viral therapeutic approaches to ocular
diseases: an overview and future directions, J. Control. Release 219 (2015)
Acknowledgements 471–487.
[23] G.-J. Ye, E. Budzynski, P. Sonnentag, T.M. Nork, N. Sheibani, Z. Gurel, S.L. Boye, J.
J. Peterson, S.E. Boye, W.W. Hauswirth, J.D. Chulay, Cone-specific promoters for
This project was supported by the Gund-Harrington Scholars Award
gene therapy of Achromatopsia and other retinal diseases, Hum. Gene Ther. 27 (1)
from the Harrington Discovery Institute and by the Foundation Fighting (2015) 72–82.
Blindness. Further support was obtained through grants from the NIH [24] W.A. Beltran, A.V. Cideciyan, S.E. Boye, G.-J. Ye, S. Iwabe, V.L. Dufour, L.
F. Marinho, M. Swider, M.S. Kosyk, J. Sha, S.L. Boye, J.J. Peterson, C.
(NEI R24-EY-024864 and NEI R24-EY-027283), the Canadian Institute
D. Witherspoon, J.J. Alexander, G.-S. Ying, M.S. Shearman, J.D. Chulay, W.
for Advanced Research (CIFAR), the Alcon Research Institute (ARI), W. Hauswirth, P.D. Gamlin, S.G. Jacobson, G.D. Aguirre, Optimization of retinal
unrestricted grants from Research to Prevent Blindness to the De­ gene therapy for X-linked retinitis Pigmentosa due to RPGR mutations, Mol. Ther.
partments of Ophthalmology at UCI, Grant BX003604 from the 25 (8) (2017) 1866–1880.
[25] D. Sun, R.M. Schur, A.E. Sears, S.-Q. Gao, A. Vaidya, W. Sun, A. Maeda, T. Kern,
Department of Veterans Affairs. K.P. is Chief Scientific Officer of Pol­ K. Palczewski, Z.-R. Lu, Non-viral gene therapy for Stargardt disease with ECO/
genix Inc. Z.R.L. is an M. Frank Rudy and Margaret Domiter Rudy Pro­ pRHO-ABCA4 self-assembled nanoparticles, Mol. Ther. 28 (1) (2020) 293–303.
fessor of Biomedical Engineering. [26] D. Sun, R.M. Schur, A.E. Sears, S.-Q. Gao, W. Sun, A. Naderi, T. Kern,
K. Palczewski, Z.-R. Lu, Stable retinoid analogue targeted dual pH-sensitive smart
lipid ECO/pDNA nanoparticles for specific gene delivery in the retinal pigment
References epithelium, ACS Appl. Bio. Mater. 3 (5) (2020) 3078–3086.
[27] E. Ostad-Saffari, M. Moosajee, S.P. Wong, D.C. Tracey-White, T. Tolmachova, R.
P. Harbottle, M.C. Seabra, Persistent expression of non-viral S/MAR vectors in the
[1] J.M. Sullivan, Focus on molecules: ABCA4 (ABCR)–an import-directed
RPE for Choroideremia gene therapy, Invest. Ophthalmol. Vis. Sci. 51 (13) (2010)
photoreceptor retinoid flipase, Exp. Eye Res. 89 (5) (2009) 602–603.
3122.
[2] W. Wiszniewski, C.M. Zaremba, A.N. Yatsenko, M. Jamrich, T.G. Wensel, R.
[28] H. Ragelle, F. Danhier, V. Préat, R. Langer, D.G. Anderson, Nanoparticle-based
A. Lewis, J.R. Lupski, ABCA4 mutations causing mislocalization are found
drug delivery systems: a commercial and regulatory outlook as the field matures,
frequently in patients with severe retinal dystrophies, Hum. Mol. Genet. 14 (19)
Exp. Opin. Drug Deliv. 14 (7) (2017) 851–864.
(2005) 2769–2778.
[29] G.A. Rodrigues, E. Shalaev, T.K. Karami, J. Cunningham, N.K.H. Slater, H.
[3] J. Schimmer, S. Breazzano, Investor outlook: significance of the positive LCA2 gene
M. Rivers, Pharmaceutical development of AAV-based gene therapy products for
therapy phase III results, Human Gene Therapy Clin. Dev. 26 (4) (2015) 208–210.
the eye, Pharm. Res. 36 (2) (2018) 29.
[4] F. Simonelli, A.M. Maguire, F. Testa, E.A. Pierce, F. Mingozzi, J.L. Bennicelli,
[30] N. Clément, J.C. Grieger, Manufacturing of recombinant adeno-associated viral
S. Rossi, K. Marshall, S. Banfi, E.M. Surace, J. Sun, T.M. Redmond, X. Zhu, K.
vectors for clinical trials, Mol. Therapy Methods Clin. Dev. 3 (2016) 16002.
S. Shindler, G.-S. Ying, C. Ziviello, C. Acerra, J.F. Wright, J.W. McDonnell, K.
[31] W. Abdelwahed, G. Degobert, S. Stainmesse, H. Fessi, Freeze-drying of
A. High, J. Bennett, A. Auricchio, Gene therapy for Leber’s congenital amaurosis is
nanoparticles: formulation, process and storage considerations, Adv. Drug Deliv.
safe and effective through 1.5 years after vector administration, Mol. Ther. 18 (3)
Rev. 58 (15) (2006) 1688–1713.
(2010) 643–650.
[32] P. Fonte, S. Reis, B. Sarmento, Facts and evidences on the lyophilization of
[5] A. Koirala, S.M. Conley, R. Makkia, Z. Liu, M.J. Cooper, J.R. Sparrow, M.I. Naash,
polymeric nanoparticles for drug delivery, J. Control. Release 225 (2016) 75–86.
Persistence of non-viral vector mediated RPE65 expression: case for viability as a
[33] N.R. Ayat, Z. Sun, D. Sun, M. Yin, R.C. Hall, A.M. Vaidya, X. Liu, A.L. Schilb, J.
gene transfer therapy for RPE-based diseases, J. Control. Release 172 (3) (2013)
H. Scheidt, Z.-R. Lu, Formulation of biocompatible targeted ECO/siRNA
745–752.
nanoparticles with long-term stability for clinical translation of RNAi, Nucleic Acid
[6] D.A. Prado, M. Acosta-Acero, R.S. Maldonado, Gene therapy beyond luxturna: a
Therap. 29 (4) (2019) 195–207.
new horizon of the treatment for inherited retinal disease, Curr. Opin. Ophthalmol.
[34] A. Bonaccorso, T. Musumeci, C. Carbone, L. Vicari, M.R. Lauro, G. Puglisi,
31 (3) (2020).
Revisiting the role of sucrose in PLGA-PEG nanocarrier for potential intranasal
[7] D.M. Lipinski, M. Thake, R.E. MacLaren, Clinical applications of retinal gene
delivery, Pharm. Dev. Technol. 23 (3) (2018) 265–274.
therapy, Prog. Retin. Eye Res. 32 (2013) 22–47.
[35] S. Doktorovova, R. Shegokar, E.B. Souto, Chapter 30 - Role of Excipients in
[8] Z. Wu, H. Yang, P. Colosi, Effect of genome size on AAV vector packaging, Mol.
formulation development and biocompatibility of lipid nanoparticles (SLNs/NLCs),
Therapy 18 (1) (2010) 80–86.
in: D. Ficai, A.M. Grumezescu (Eds.), Nanostructures for Novel Therapy, Elsevier,
[9] J.L. Santiago-Ortiz, D.V. Schaffer, Adeno-associated virus (AAV) vectors in cancer
2017, pp. 811–843.
gene therapy, J. Control. Release 240 (2016) 287–301.
[36] F. Molavi, M. Barzegar-Jalali, H. Hamishehkar, Polyester based polymeric nano
[10] H.L. Schulz, F. Grassmann, U. Kellner, G. Spital, K. Rüther, H. Jägle, K. Hufendiek,
and microparticles for pharmaceutical purposes: a review on formulation
P. Rating, C. Huchzermeyer, M.J. Baier, B.H.F. Weber, H. Stöhr, Mutation
approaches, J. Control. Release 320 (2020) 265–282.
Spectrum of the ABCA4 gene in 335 Stargardt disease patients from a multicenter
[37] A.S. Malamas, M. Gujrati, C.M. Kummitha, R. Xu, Z.-R. Lu, Design and evaluation
German cohort-impact of selected deep Intronic variants and common SNPs,
of new pH-sensitive amphiphilic cationic lipids for siRNA delivery, J. Control.
Invest. Ophthalmol. Vis. Sci. 58 (1) (2017) 394–403.
Release 171 (3) (2013) 296–307.
[11] D.S. Williams, Usher syndrome: animal models, retinal function of usher proteins,
[38] M. Gujrati, A. Malamas, T. Shin, E. Jin, Y. Sun, Z.-R. Lu, Multifunctional cationic
and prospects for gene therapy, Vis. Res. 48 (3) (2008) 433–441.
lipid-based nanoparticles facilitate Endosomal escape and reduction-triggered
[12] V. Delplace, S. Payne, M. Shoichet, Delivery strategies for treatment of age-related
cytosolic siRNA release, Mol. Pharm. 11 (8) (2014) 2734–2744.
ocular diseases: from a biological understanding to biomaterial solutions,
[39] D. Sun, B. Sahu, S. Gao, R.M. Schur, A.M. Vaidya, A. Maeda, K. Palczewski, Z.-
J. Control. Release 219 (2015) 652–668.
R. Lu, et al., Mol. Therapy Nucleic Acids 7 (2017) 42–52.
[13] A. Palfi, N. Chadderton, A.G. McKee, A. Blanco Fernandez, P. Humphries, P.
[40] D. Sun, H. Maeno, M. Gujrati, R. Schur, A. Maeda, T. Maeda, K. Palczewski, Z.-
F. Kenna, G.J. Farrar, Efficacy of Codelivery of dual AAV2/5 vectors in the murine
R. Lu, Self-assembly of a multifunctional lipid with Core–Shell Dendrimer DNA
retina and Hippocampus, Hum. Gene Ther. 23 (8) (2012) 847–858.
nanoparticles enhanced efficient gene delivery at low charge ratios into RPE cells,
[14] A. Maddalena, P. Colella, I. Trapani, R. Minopoli, C. Iodice, A. Auricchio, Triple
Macromol. Biosci. 15 (12) (2015) 1663–1672.
AAV vectors to expand AAV cargo capacity in the retina, Invest. Ophthalmol. Vis.
[41] M. Gujrati, A. Vaidya, Z.-R. Lu, Multifunctional pH-sensitive amino lipids for siRNA
Sci. 56 (7) (2015) 3631.
delivery, Bioconjug. Chem. 27 (1) (2016) 19–35.
[15] M. Allocca, M. Garcia-Hoyos, M. Doria, M. Petrillo, S. Kim, A. Maguire, U.
[42] D. Sun, R.M. Schur, Z.-R. Lu, A novel nonviral gene delivery system for treating
D. Vicino, J.R. Sparrow, J. Bennett, A. Auricchio, Gene therapy of a mouse model
Leber’s congenital amaurosis, Ther. Deliv. 8 (10) (2017) 823–826.
of Stargardt’s disease using Adeno-associated viral vectors packaging large genes,
[43] A.M. Vaidya, Z. Sun, N. Ayat, A. Schilb, X. Liu, H. Jiang, D. Sun, J. Scheidt, V. Qian,
Invest. Ophthalmol. Vis. Sci. 49 (13) (2008) 1129.
S. He, H. Gilmore, W.P. Schiemann, Z.-R. Lu, Systemic delivery of tumor-targeting
[16] H. Miyoshi, M. Takahashi, F.H. Gage, I.M. Verma, Stable and efficient gene transfer
siRNA nanoparticles against an oncogenic LncRNA facilitates effective triple-
into the retina using an HIV-based lentiviral vector, Proc. Natl. Acad. Sci. 94 (19)
negative breast Cancer therapy, Bioconjug. Chem. 30 (3) (2019) 907–919.
(1997) 10319–10323.
[44] D. Sun, Z. Sun, H. Jiang, A.M. Vaidya, R. Xin, N.R. Ayat, A.L. Schilb, P.L. Qiao,
[17] T. Bordet, F. Behar-Cohen, Ocular gene therapies in clinical practice: viral vectors
Z. Han, A. Naderi, Z.-R. Lu, Synthesis and evaluation of pH-sensitive
and nonviral alternatives, Drug Discov. Today 24 (8) (2019) 1685–1693.
multifunctional lipids for efficient delivery of CRISPR/Cas9 in gene editing,
[18] M. Mashal, N. Attia, G. Martinez-Navarrete, C. Soto-Sanchez, E. Fernandez,
Bioconjug. Chem. 30 (3) (2019) 667–678.
S. Grijalvo, R. Eritja, G. Puras, J.L. Pedraz, Gene delivery to the rat retina by non-
[45] U.T. Brunk, A. Terman, Lipofuscin: mechanisms of age-related accumulation and
viral vectors based on chloroquine-containing cationic niosomes, J. Control.
influence on cell function12 1Guest Editor: Rajindar S. Sohal 2 This article is part
Release 304 (2019) 181–190.

339
D. Sun et al. Journal of Controlled Release 330 (2021) 329–340

of a series of reviews on “Oxidative Stress and Aging.” The full list of papers may be [48] D.M. Piedmonte, C. Summers, A. McAuley, L. Karamujic, G. Ratnaswamy, Sorbitol
found on the homepage of the journal, Free Radic. Biol. Med. 33 (5) (2002) crystallization can Lead to protein aggregation in frozen protein formulations,
611–619. Pharm. Res. 24 (1) (2007) 136–146.
[46] R.A. Radu, N.L. Mata, S. Nusinowitz, X. Liu, P.A. Sieving, G.H. Travis, Treatment [49] P. Moreau, R. Hen, B. Wasylyk, R. Everett, M.P. Gaub, P. Chambon, The SV40 72
with isotretinoin inhibits lipofuscin accumulation in a mouse model of recessive base repair repeat has a striking effect on gene expression both in SV40 and other
Stargardt’s macular degeneration, Proc. Natl. Acad. Sci. 100 (8) (2003) chimeric recombinants, Nucleic Acids Res. 9 (22) (1981) 6047–6068.
4742–4747. [50] Z.-L. Xu, H. Mizuguchi, A. Ishii-Watabe, E. Uchida, T. Mayumi, T. Hayakawa,
[47] M.G. Anhorn, H.-C. Mahler, K. Langer, Freeze drying of human serum albumin Strength evaluation of transcriptional regulatory elements for transgene expression
(HSA) nanoparticles with different excipients, Int. J. Pharm. 363 (1) (2008) by adenovirus vector, J. Control. Release 81 (1) (2002) 155–163.
162–169. [51] J. de Villiers, L. Olson, C. Tyndall, W. Schaffner, Transcriptional ‘enhancers’ from
SV40 and polyoma virus show a cell type preference, Nucleic Acids Res. 10 (24)
(1982) 7965–7976.

340