Fungal Ecology 57-58 (2022) 101158

Contents lists available at ScienceDirect

Fungal Ecology
journal homepage: www.elsevier.com/locate/funeco

Cultivable fungal community associated with the tropical orchid

Dichaea andina
Yasmin A. Alomía a, *, J. Tupac Otero b, Jana Jersáková c, Pablo R. Stevenson a
a
Department of Biological Sciences, Faculty of Sciences, Universidad de Los Andes, Cra. Nº 18A-12, Bogotá, Colombia
b
Department of Basic Sciences, Faculty of Engineering and Administration, Universidad Nacional de Colombia, Cra. 32 Nº 12-00, Palmira, Colombia
c
Faculty of Sciences, University of South Bohemia, Branišovská 1760, 37005, České Budějovice, Czech Republic

A R T I C L E I N F O A B S T R A C T

Corresponding editor: Maarja Öpik The orchid–fungus relationship has been studied since the discovery that the minute seeds of orchids depend on
fungi to support the germination process. With the aim of describing the biodiversity of cultivable endophytic
Keywords: and mycorrhizal fungi from the orchid Dichaea andina, we isolated pure fungal cultures from its roots and
Endophytic fungi identified them by sequencing the internal transcribed spacer. We recorded 22 fungal operational taxonomic
Mycorrhiza
units belonging to eight orders of Ascomycota: Eurotiales, Hypocreales, Xylariales, Helotiales, Boliniales,
Orchidaceae
Chaetothyriales, Chaetosphaeriales and Pleosporales. The only Basidiomycota isolated belonged to the genus
Andes
Eurotiales Ceratobasidium from the order Cantharellales, whose members are known as orchid mycorrhizal fungi. At the
Ceratobasidium. Byssochlamys genus level, we identified 16 genera, the most common of which were Byssochlamys, Camarops, Trichoderma,
Camarops Cladophialophora, Fusarium and Xylaria; some of them had been reported previously as orchid endophytes. The
Trichoderma, internal transcribed spacer relevance of endophytic fungi to their hosts is still unclear, but this widely distributed interaction deserves
further investigation.

1. Introduction plants of the genus Solanum (Solanaceae) (Vieira et al. 2011) and fodder
of the genus Lolium (Poaceae) (Rodrigo et al. 2017). Similarly, some
Plant–microorganism interactions are important for understanding endophytic fungi enhance host resistance to insect herbivory in other
the complex functional diversity of nature. The great diversity of non- grasses (Patterson et al. 1991; Tintjer and Rudgers 2006). Surprisingly,
pathogenic fungi interacting with plants throughout their life cycle endophytic fungi have been poorly studied in highly diverse plant
has suggested a possible symbiotic role with important effects on plant families such as Orchidaceae (Bayman and Otero 2006; Kohout et al.
ecology and evolution (Clay and Holah 1999; Brundrett 2006). For 2013; Li et al. 2021b).
example, Sarmiento et al. (2017) demonstrated that soilborne fungi that The relationship between orchid roots and fungi has been studied
interact with seeds, propagules and juvenile plants play a key role in since the early twentieth century, when Bernard (1904) proposed that a
shaping forest dynamics in the tropics, contributing to the maintenance certain fungal group supported the germination processes of orchid
of diversity. An interesting group of non-pathogenic fungi that is seeds by supplying carbon to an embryo that lacks an endosperm (Arditti
frequently associated with plants are the endophytic fungi. The scientific 1967; Rasmussen 1995; Baskin and Baskin 2014). These fungi have been
community began to pay attention to this enigmatic fungal group 100 called orchid mycorrhizal fungi (OMF), and they form a particular type
years ago (Rodriguez et al. 2009), and advances in this field have shown of endomycorrhiza; the orchidoid mycorrhiza (Harley and Smith 1983;
that fungal endophytes are hyper diverse (Arnold et al. 2000). Today, Brundrett 2004, 2017). Most of these fungi belong to Rhizoctonia
exciting findings in plants with nutritional or medicinal importance aggregated (Rasmussen 1995) and represent a phylogenetically het­
have encouraged more research about the role of these fungi in nature. erogeneous group of Basidiomycetes and some Ascomycetes, including
For instance, the antimicrobial activity that these fungi can exert for the endophytic, saprophytic and parasitic fungi (Taylor and McCormick
prevention of diseases caused by pathogens in plants has been proven, 2008; Kottke and Suárez 2009; Roche et al. 2010). In tropical epiphytic
and they can act as antagonists through the production of secondary orchids, members of Ceratobasidiaceae, Tulasnellaceae and Serendip­
metabolites in cocoa (Malvaceae) (Samuels et al., 2016), medicinal itaceae, are the most frequently reported OMF (Suárez and KottKe,

* Corresponding author.
E-mail address: ya.alomia10@uniandes.edu.co (Y.A. Alomía).

https://doi.org/10.1016/j.funeco.2022.101158
Received 26 July 2021; Received in revised form 27 January 2022; Accepted 12 April 2022
Available online 21 April 2022
1754-5048/© 2022 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

2016; Cevallos et al. 2017). Fusarium, Penicillium, Trichoderma and Xylaria, that are the most widely
An extensive body of literature has been published about the struc­ reported as orchid endophytes around the world (Bayman and Otero
ture, mechanisms of attraction and infection, nutrient exchange, phy­ 2006; Ma et al. 2015; Hernández and Alomía 2020). Regarding OMF, we
logeny and isolation techniques of OMF (Peterson et al. 2004; Smith and expected to find members of the genus Ceratobasidium, since it has been
Read 2008; Dearnaley et al. 2012, 2016; Selosse et al. 2016; Swarts and reported to be associated with other Dichaea species (Mosquera-Es­
Dixon 2017; Zettler and Corey 2018). However, the diversity and roles pinosa et al. 2010), and it seems to have some degree of specificity with
of orchid endophytic fungi, also known as orchid non-mycorrhizal fungi the Cymbidieae tribe (Kottke and Suárez 2009). We also compared the
(ONMF), have received much less attention (Currah et al. 1997; Vaz fungal community across four study populations. Since the fungi asso­
et al. 2009; Li et al. 2021a). In a strict sense, as long as it has not been ciated with orchid roots show a certain ecological adaptability that fa­
verified that a fungus associated with a root tissue has a role in seed cilitates their wide distribution (Ma et al. 2015; Li et al. 2021b), we
germination or nutrient transfer, it should be considered simply an hypothesized that fungal communities would be similar among orchid
endophytic fungus and not necessarily a mycorrhizal one (Bayman and populations. Finally, we inquire about the ecological roles of fungal
Otero 2006). However, some authors frequently refer to fungi which species to propose possible functions for future research. Because D.
form pelotons (hyphal coils within the host cortical parenchyma cells) as andina has been found only in forests with a favourable conservation
potential OMF (Li et al. 2021a) without evaluating their real physio­ status, understanding these interactions will shed light on the mutual­
logical role. Therefore, Rhizoctonia-like fungi are overrepresented in the istic partners that this orchid requires for its establishment and could be
orchid literature. valuable in reintroduction programs.
Currah et al. (1997) isolated and characterized the mycorrhizal fungi
of American orchids and noted that a significant number of other fungi, 2. Materials and methods
especially those of the Ascomycotina subdivision, were commonly
associated with orchid roots whilst lacking an obvious biological role. 2.1. Study species and study sites
Detailed reviews of studies conducted in the field of orchid endophytes
can be found in Ma et al. (2015), Sarsaiya et al. (2019) and Hernández Dichaea andina (subtribe Zygopetalinae) is a recently described
and Alomía (2020). Some of the roles that have been proven for these Colombian species (Alomía et al., 2021) which inhabits cloud forests
fungi in orchids include potential inhibition of certain compounds or with a healthy conservation status (Fig. 1A–D). For this reason, its dis­
microorganisms (Vaz et al. 2009; Barnes et al. 2016), production of tribution is restricted to Andean Forest remnants (Fig. 1A). Since D.
bioactive (Bungtongdee et al. 2019) and medicinal compounds (Zhang andina has a caespitose growth (Fig. 1B), we considered as an individual
et al. 2013), promotion of orchid seed germination (Fracchia et al. 2014; plant all the stems that inhabited the same host tree. We collected only
Maldonado et al. 2020; Salazar et al. 2020) and stimulation of plant roots that had direct contact with the substrate (bark), which was
growth (Yu et al. 2015; Shah et al. 2019). Notwithstanding those posi­ located at the base of the plant and was covered with mosses and liv­
tive strides and a growing interest in the study of orchid endophytic erworts (Fig. 1C).
fungi, information is limited considering the great diversity of species We collected roots from four populations of D. andina located in the
within this plant family (ca. 28 000; The Plant List, 2013). The continent Andes Mountain Range of Colombia. From south to north (Fig. 2), Na­
with the most reports in this field is Asia, including a narrow group of tional Natural Park Cueva de los Guácharos (GUA), Bosque San Antonio
ornamental and medicinal species in 16 studies (Hernández and Alomía (BSA), Reserva Comunitaria Cerro El Inglés (RCI) and Bosque El Agua­
2020). In hyper-diverse countries with more than 4000 species, such as pante (BAP). All sites have an elevation of approximately 2200 m.a.s.l.
Colombia and Ecuador, few studies have been published (Ordóñez et al., (Supplementary Table S1).
2012; Gamboa-Gaitán 2014; Rodríguez and Lora 2016; Díaz et al. 2017;
Salazar-Orellana 2017; Novotná et al. 2018; Salazar et al. 2020). Recent 2.2. Sampling
publications have highlighted the importance of studying in greater
depth the diversity and functionality of ONMF to determine their In the rainy season (April–June and September–December 2017, and
possible physiological and ecological advantages, as well as to better September–November 2018), we collected 80 healthy roots from 10
understand the associations between orchids and fungi as a whole (Li individuals in each population, except for BAP, where the abundance
et al. 2021a, b). was lower, and the roots were collected from four individuals (Supple­
The greatest diversity within the genus Dichaea Lindl. is present in mentary Table S2). Roots were collected in Ziploc® bags moisturized
South America (Pupulin 2007). Colombia, home to about 40% of 118 with distilled water and stored in a portable fridge during translocation
recognized species, is one of the richest countries in this respect (Bernal to the laboratory.
et al. 2015; Chase et al. 2015; Betancur et al. 2015; WCSP, 2021). Its
diversity is particularly notable in the Andes, even though Colombian 2.3. Fungal endophyte isolation
Andean forests face the highest degree of threat to orchid flora because
of deforestation (Armenteras et al. 2007; Betancur et al. 2015). Despite Roots were washed in tap water and carefully brushed to remove the
its great species richness, the genus Dichaea has received little attention, material adhered to the surface (Fig. 3A and B). Cross sections about 1
in part due to its inconspicuous flowers and complex taxonomy, as well mm thick were checked for hyphal colonization under a Zeiss light mi­
as special ex situ cultivation requirements and the lack of commercial croscope at 40x magnification (Bayman et al. 1997), and portions of
interest. Since no aspect of the biology of this genus has been explored in roots (0.5 cm long) with the highest colonization (>50% of the area)
detail, understanding the symbiotic relationships with fungi (both were selected. The sections were surface sterilized in a laminar flow box
mycorrhizal and non-mycorrhizal) represents an opportunity to expand using a 70% ethanol solution for 1 min, followed by 1.5% sodium
the knowledge of this threatened orchid group. chloride solution for 30 s, and triple-rinsed in sterile water. With a sterile
The aim of this study was to describe the biodiversity of root- scalpel, the roots with pelotons were sectioned transversally to finer cuts
associated cultivable OMF and ONMF from Dichaea andina Alomía & (1 mm thick) and inoculated in 9-cm Petri dishes with Potato Dextrose
Sambin (Orchidaceae), a recently discovered species from the Colom­ Agar (PDA; Oxoid®) acidulated with 0.8% lactic acid (PanReac Appli­
bian Andean forests (Alomía et al. 2021). We isolated pure strains into a Chem®) to avoid bacterial contamination (Fig. 3C). The Petri dishes
culture and identified them on the molecular level by sequencing the were sealed with Parafilm® and incubated at 25 ◦ C in the dark. Cultures
internal transcribed spacer (ITS) region of the ribosomal RNA. Since were checked daily, and growing hyphae were transferred to new PDA
ONMF have a wide distribution throughout ecosystems (Li et al. 2021b), plates to generate pure cultures (Fig. 3D). The axenic cultures were
we expected to find fungi of the genera Aspergillus, Colletotrichum, inspected for their macroscopic (type and colour of mycelium, colony

2
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Fig. 1. Forest architecture and Dichaea andina growth habits. A. Typical Andean cloud forest with occurrence of D. andina. B. Caespitose growth habits on a
phorophyte. C. Roots covered with mosses and liverworts. D. Single flower emerging under the foliage.

shape) and microscopic (presence and shape of spores, type and diam­ The amount of DNA and the size of the PCR fragment were estimated
eter of hyphae) traits to select morphotypes for molecular identification. using 1.5% agarose electrophoresis. PCR products were purified with an
Exo-AP enzymatic mix that included the enzymes Exo-nuclease I and
alkaline Phosphatase (1:1). A 0.8-μL Exo-AP aliquot was transferred to a
2.4. DNA extraction and sequencing
0.5-mL microcentrifuge tube with 2.8 μL of PCR product. Tubes were
incubated in the thermal-cycler at 37 ◦ C for 15 min followed by 85 ◦ C for
Fungal DNA was extracted from pure cultures using the following
15 min. Purified products were sent for commercial sequencing in
modification of the NaOH method (Wang et al., 1993): a portion of pure
SEQme company (Prague, Czech Republic) and DNA Sequencing Center
mycelium (0.5 cm2) was placed in a 1.5-mL Eppendorf tube and 40 μL of
(Gencore, Universidad de Los Andes, Colombia).
0.5 M NaOH was added. The mycelium was ground for 2 min with a
sterile micro-tube pestle and then centrifuged for 2 min at 13 800 rpm.
Four microliters of supernatant were added to a new 1.5-mL Eppendorf 2.5. Sequence analysis
with 40 μL 100 mM Tris-HCL, pH 8.3 and stored at − 20 ◦ C.
We performed a fungal-specific PCR amplification of the nuclear ri­ Sequence files were transformed to .fas format and edited manually
bosomal internal transcribed spacer (ITS; ITS1-5.8S-ITS2) using the using Staden software with the packages GAP Y PREGAP (Staden et al.
primers ITS1F (5′ CTTGGTCATTTAGAGGAAGTAA3′ ; Gardes and Bruns 2003). The sequences were then compared against those available in the
1993) and ITS4 (5′ TCCTCCGCTTATTGATATGC3′ ; White et al. 1990). GenBank database of the National Center for Biotechnology Information
Amplification reactions of 10 μL were carried out with 5 μL TP 2X buffer (NCBI 2021) using the BLAST algorithm (blastn). The identity of each
Master Mix (Top-Bio), 1.2 μL of each primer, 1.6 μL de H2O and 1.0 μL of isolate was assigned based on the GenBank accession with a similarity
DNA template. The PCR conditions consisted of 45 cycles in a XP >97%. The operational taxonomic units (OTUs) were delimited at the
Cycler-Bioer Technology Thermal-cycler and required 4 min for initial 97% similarity threshold by alignment of sequences using Mesquite
denaturation at 95 ◦ C before thermocycling, followed by a 30 s dena­ software v. 2.75 (Maddison and Maddison 2007) and MAFFT software v.
turation at 95 ◦ C, 30 s of annealing at 53 ◦ C and elongation at 72 ◦ C for 1 7 (Katoh et al. 2019). Finally, DNA sequences obtained in this study
min. The final extension was performed at 72 ◦ C for 10 min. were submitted to the public sequence repository from GenBank.

3
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Fig. 2. Collection sites of Dichaea andina roots for endophytic fungal isolation. A. General location of Colombia in South America, B. Distribution of study sites across
the Colombian Andes: National Natural Park Cueva de los Guácharos (GUA), Bosque de San Antonio (BSA), Reserva Comunitaria Cerro El Inglés (RCI), Bosque El
Aguapante (BAP).

2.6. Fungal community comparisons and Pleosporales (1). We found only one Basidiomycetous strain from
the order Cantharellales (Fig. 4). At the genus level, we found 16 genera,
A presence/absence matrix at the fungal genus level was constructed, and Trichoderma (3 OTUs), Xylaria (2 OTUs), Fusarium (2 OTUs) and
and non-metric multidimensional scaling (NMDS) was used to visualize Cladophialophora (2 OTUs) were the most representative.
and evaluate patterns of dissimilarity among the four studied sites using At the species level, some of them were shared among populations.
Jaccard distances. A permutational multivariate analyses of variance This was the case of Byssochlamys spectabilis, which was present in three
(PERMANOVA) (Anderson 2008) was performed to test the null hy­ of the four populations (BSA; MW578824, GUA; MW578827 and RCI;
pothesis (H0): there are no differences in the fungal community MW578831). Similarly, one species of Camarops of the two reported,
composition among the four study sites. P-values were obtained from was present in two of the four populations (BAP; MW578810 and GUA;
999 permutations. For multilevel pairwise comparison, a post hoc MW578815). The only species associated with the Rhizoctonia aggre­
analysis using a Bonferroni correction was performed. All statistical gate was isolated from the GUA population and was determined to be
analyses were performed using R Software (“vegdist”, “adonis” and Ceratobasidium sp. (MW578826).
“pairwiseAdonis” functions from the vegan package) v. 4.0.5 (R Core The NMDS ordination of the root-associated fungal communities
Team 2021). Finally, we assigned the isolated fungi to ecological guilds using Jaccard distances yielded distinct endophyte communities among
using the FUNGuild database (Nguyen et al. 2016; www.funguild.org) to orchid populations (Fig. 5), and the stress value indicated an acceptable
propose possible functions for future research. We completed the in­ fit (Stress = 0.10; R2 = 0.99). PERMANOVA analysis revealed that fungi
formation by recording whether or not these species of fungi have been associated with D. andina differed significantly among sites (Pr (>F) =
reported as endophytic fungi in orchids and the known roles or func­ 0.001). The subsequent pairwise test indicated that all sites differed
tions. Some species that were reported with more than one category, significantly from each other (p < 0.01) (Supplementary Table S3).
including endophyte, we counted as endophytes. The ecological guilds extracted from the FUNGuild database for the
isolated fungal species are presented in Table 2. We found that, of the 22
3. Results different species identified, 45,5% fell into the saprotroph category,
followed by the endophyte category with 27,3%. The rest of the species
We obtained 239 strains isolated from the root sections from our belonged to one of the following categories: animal pathogen (4,5%),
study sites: GUA = 67, BSA = 57, RCI = 62 and BAP = 53. Using the fungal parasite (4,5%) and plant pathogen (4,5%). Three species
morphological features of the mycelium, we identified 25 fungal strains (13,6%) were not assigned to any category. Four fungal species (18,3%)
for sequencing: GUA = 7, BSA = 8, RCI = 3 and BAP = 7. Overall, we have been reported as orchid endophytes, and representatives of the
detected 22 OTUs of putative OMF and ONMF based on a BLASTn search genera Fusarium, Trichoderma and Xylaria have been verified as pro­
(Table 1). Most OTUs (21) belonged to Ascomycetes, including repre­ motors of orchid growth or germination.
sentatives of nine orders: Hypocreales (5), Xylariales (4), Eurotiales (3),
Helotiales (3), Boliniales (2), Chaetothyriales (2), Chaetosphaeriales (1)

4
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Fig. 3. Isolation of endophytic fungi from the roots of Dichaea andina. A. roots with organic remains, B. roots brushed and washed in tap water, C. a fine cross section
with hyphal colonization (pelotons; 200x), D. axenic cultures on PDA medium.

4. Discussion suggested that fungal lifestyle can switch rapidly between endophytic
and pathogenic, making these categories an unstable trait. The impor­
In our study, we found 22 cultivable fungal OTUs associated with D. tance of classifying fungi by their trophic guilds, as well as identifying
andina roots. Our first hypothesis was partially fulfilled, since we their functional roles, is that it allows to assess their biotechnological
detected representatives of Fusarium, Trichoderma and Xylaria, which and orchid conservation potential.
have been commonly reported as orchid endophytes (Ma et al. 2015; The most common fungal genera found in this study were Fusarium,
Hernández and Alomía 2020). However, other genera as Aspergillus, Trichoderma, and Xylaria. Fusarium species are known mainly as fungal
Colletotrichum and Penicillium, widely reported in the literature, were not pathogens in several crops of economic importance (Viljoen et al. 1994;
isolated. As expected, the data reinforced our second hypothesis about Borras et al. 2001; Cavaglieri et al. 2005; Michel-Aceves et al. 2009;
finding Ceratobasidium within the OMF, since this genus has been re­ Duncan and Howard 2010). Some authors suggest that Fusarium spp.
ported as mycorrhizal fungi in other Dichaea species (Mosquera-Es­ could exist as endophytes and latent pathogens, especially when the
pinosa et al. 2010) and it shows some degree of specificity with the plant faces stress situations (Ma et al. 2015). Despite their reputation as
Cymbidieae tribe (Kottke and Suárez 2009). Finally, contrary to our a plant pathogen, Fusarium spp. have been reported to play beneficial
third hypothesis about ecological adaptability and wide distribution of roles in orchids. For example, in Brazil, F. oxysporum, the fungus with
fungi (Li et al. 2021b; Ma et al. 2015), the results of PERMANOVA the highest antibacterial activity among the endophytes isolated from
analysis indicated that the fungal communities differed significantly orchids, was recorded as a root endophyte in the orchid Scuticaria
among orchid populations. irwiniana Pabst and as a stem endophyte in Epidendrum secundum Jacq. y
The isolated strains had a high similarity with DNA sequences re­ Acianthera teres (Lindl.) Borba (Vaz et al. 2009). In the same study, three
ported in GenBank mainly as endophytic and occasionally as pathogenic root endophytic Fusarium species were effective in limiting the growth of
fungi in several plant families (Table 1). However, based on the FUN­ pathogenic yeasts. Fusarium spp. were also reported as endophytic fungi
Guild database, more than 45% of species fell into the saprotrophic in the roots of multiple orchid species, such as Cattleya skinneri Bateman
category (Table 2). Martos et al. (2009) proposed that the temperature in México (Ovando et al. 2005), Dendrobium nobile Lindl. in China (Yuan
and moisture conditions in tropical Asiatic rainforests favour high et al. 2009), Cyrtochilum myanthum (Lindl.) Kraenzl. in Ecuador
metabolic activity and thus greater availability of saprotrophic fungi, (Novotná et al. 2018) and Vanilla spp. in Colombia (Gamboa-Gaitán
which facilitates their association with orchids. It can be the case for D. 2014). Future research should focus on the role of these fungi and their
andina, since this species inhabits in very wet mountain forest in potential to stimulate important processes for plants such as germination
Colombian Andes. In addition to saprotrophic and endophytic strategies, and defence against pathogens in epiphytic orchids.
pathogenic fungi were also observed (Table 2). Delaye et al. (2013) We isolated three OTUs associated with the genus Trichoderma and

5
 Y.A. Alomía et al.
Table 1
Identification of endophytic fungi from Dichaea andina root sections based on BLASTn searches (internal transcribed spacer sequences). Population codes: BSA - Bosque San Antonio, BAP - Bosque Aguapante, GUA -
National Natural Park Cueva de los Guácharos, RCI - Reserva Comunitaria Cerro El Inglés.
OTU Isolate Population Assigned identity Country Isolation Source Closest match found by Order Family Similarity GenBank Accession
(Blast) BLAST analysis (%) Number (this study)

1 FD-29 BSA GUA Byssochlamys Nigeria Fungal endophyte of cashew nuts MG518449.1 Eurotiales Trichocomaceae 99.7 MW578827
RCI spectabilis Anacardium occidentale (Anacardiaceae)
2 FD-05 BSA Fusarium subglutinans Mexico Fungal endophyte of Pinus pseudostrobus KX276597.1 Hypocreales Nectriaceae 100 MW578805
(Pinaceae)
3 FD-32 BSA Glutinomyces sp. USA Pathogenic fungus from Rhododendron JQ272327.1 Helotiales Hyaloscyphaceae 99.0 MW578821
(Ericaceae)
4 FD-37 BSA Hyphodiscus sp. Netherlands Root-associated fungi from Arabidopsis MN310262.1 Helotiales Hyaloscyphaceae 99.8 MW578823
thaliana (Brassicaceae).
5 FD-04 BSA Cryptosporiopsis China Fungal endophyte of Cymbidium spp. HQ889715.1 Helotiales Dermateaceae 99.3 MW578804
radicicola (Orchidaceae)
6 FD-02 BSA Xylaria enteroleuca Costa Rica Fungal endophyte of Psychotria aubletiana KU204564.1 Xylariales Xylariaceae 98.4 MW578803
(Rubiaceae)
7 FD-60 BSA Xylaria ophiopoda Ecuador Fungal fruiting body KP133441 Xylariales Xylariaceae 99.0 MW583044
8 FD-12 BAP Camarops sp. Panama Fern-affiliated endophytes KU747785.1 Boliniales Boliniaceae 98.0 MW578810
9 FD-11 BAP, GUA Camarops sp. China Fungal endophyte of Dendrobium officinale KT224813.1 Boliniales Boliniaceae 97.5 MW578809
(Orchidaceae)
10 FD-46 BAP Chloridium sp China Submerged wood MN598812.1 Chaetosphaeriales Chaetosphaeriaceae 99.2 MW578829
11 FD-10 BAP Cladophialophora Spain Root-associated fungi from Arabidopsis MN365769.1 Chaetothyriales Herpotrichiellaceae 93.0 MW578808
thaliana (Brassicaceae).
6

12 FD-47 BAP Fusarium verticillioides China Pathogen on sugarcane Saccharum KJ765857 Hypocreales Nectriaceae 100 MW578830
officinarum (Poaceae)
13 FD-26 BAP Trichoderma asperellum Brazil Fungal endophyte of Zygopetalum FJ605246.1 Hypocreales Hypocreaceae 100 MW578817
maxillare (Orchidaceae)
14 FD-07 BAP Trichoderma viride Canada Microfungi Associated with Roots of GU934567.1 Hypocreales Hypocreaceae 100 MW578807
willow Salix sp. (Salicaceae)
a
15 FD-41 GUA Ceratobasidium sp. Taiwan Mycorrhizal fungi from Anoectochilus JX514382.1 Cantharellales Ceratobasidiaceae 98.3 MW578826
formosanus (Orchidaceae)
16 FD-40 GUA Cladophialophora sp. Brazil Root endophytic fungi from Myrcia KT777711.1 Chaetothyriales Herpotrichiellaceae 98.4 MW578825
spectabilis (Myrcinaceae)
17 FD-16 GUA Lecanicillium China Fungal endophyte of Rubia ssp. MN856373.1 Hypocreales Clavicipitaceae 99.5 MW578812
fusisporum (Rubiaceae)
18 FD-18 GUA Nemania sp. Ecuador Fungal endophyte of Caryodaphnopsis KP133230.1 Xylariales Xylariaceae 99.0 MW578814
theobromifolia (Lauraceae)
19 FD-25 GUA Paraphaeosphaeria Croatia Stem endophytic fungi from Fraxinus KY977581.1 Pleosporales Didymosphaeriaceae 99.0 MW578816
sporulosa angustifolia (Oleaceae)
20 FD-44 GUA Talaromyces radicus China Fungal endophyte of Polygonatum MH889152 Eurotiales Trichocomaceae 98.7 MW578828
sibiricum (Asparagaceae)

Fungal Ecology 57-58 (2022) 101158

21 FD-28 RCI Nodulisporium sp. China Fungal endophyte of Cymbidium insigne HQ889720.1 Xylariales Xylariaceae 96.8 MW578819
(Orchidaceae)
22 FD-01 RCI Trichoderma China Rhizosphere-associated fungus of MT217122.1 Eurotiales Trichocomaceae 100 MW547441
caerulescens Phragmites communis (Poaceae)
a
Ceratobasidium was the only operational taxonomic unit of the Basidiomycota Phylum.
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Fig. 4. Composition of fungi isolated from Dichaea andina roots at the order level.

Fig. 5. Fungal communities isolated from four

Dichaea andina populations. BSA - Bosque San Anto­
nio, BAP - Bosque Aguapante, GUA - National Natural
Park Cueva de los Guácharos, RCI - Reserva Comu­
nitaria Cerro El Inglés. The grey convex hulls connect
the vertices of the points (i.e. plants), and the red
codes represent the genera. Stress value = 0.10. BY:
Byssochlamys; CA: Camarops; CE: Ceratobasidium; CH:
Chloridium; CL: Cladophialophora; FU: Fusarium; HE:
Glutinomyces; HY: Hyphodiscus; LE: Lecanicillium; NE:
Nemania; NO: Nodulisporium; PA: Paraphaeosphaeria;
CR: Cryptosporiopsis; TA: Talaromyces; TR: Tricho­
derma; XY: Xylaria. (For interpretation of the refer­
ences to colour in this figure legend, the reader is
referred to the Web version of this article.)

reported as plant endophytic fungi. In tropical orchids, a recent study by Two representatives of the genus Xylaria associated with D. andina
Novotná et al. (2018) reported Trichoderma as the most frequently iso­ roots were isolated (Table 1). Xylaria species have been commonly re­
lated taxon from Ecuadorian epiphytic orchids found in all study species ported as endophytes from numerous orchid species from Costa Rica
and sites. Trichoderma species have shown to have beneficial effects on (Richardson and Currah 1995), Lepanthes species in Puerto Rico
seed germination of Cattleya aurantiaca (Bateman ex Lindl.) P.N. Don (Bayman et al. 1997), several species associated with volcanic areas of
(Ovando et al. 2005) and growth promotion in Vanilla planifolia seed­ central Mexico (Beltrán-Nambo et al. 2018), several species of orchids
lings (Ordóñez et al., 2012). Species such as Trichoderma asperellum was from the Ecuadorian Andes (Cevallos et al. 2018), Vanilla species in
reported as orchid endophyte from Zygopetalum maxillare Lodd. Colombia (Gamboa-Gaitán 2014) and in medicinal Dendrobium species
(Orchidaceae) from Brazil, showing a significant antimicrobial activity in China (Chen et al. 2011; Wang et al. 2017). Further, a study in
(Vaz et al. 2009). Colombia found that Xylaria strains promoted vegetative growth of

7
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Table 2
Ecological guilds of the isolated fungal species and their reported endophytic functions.
Species Guild Reported as endophytic Reported functions as plant endophyte Source
fungi in orchids

Byssochlamys Saprotroph No Antibacterial and antifungal activity Hyung et al. (2013); Wu et al. (2018), Wahid
spectabilis et al. (2001); Rodrigo et al. (2017).
Camarops sp. Saprotroph Yes Production of biologically active compounds Gubiani et al. (2014); Gubiani et al. (2016)
Ceratobasidium sp. Endomycorrhizal Yes (OMF) Orchid seed germination and promotion of plant Mosquera-Espinosa et al. (2010); Valadares
Plant pathogen growth et al. (2015); Alomía et al. (2017).
Undefined
saprotroph
Chloridium sp. Ectomycorrhizal No Strong antibacterial activity Kharwar et al. (2009)
Endophyte
Plant pathogen
Wood saprotroph
Cladophialophora sp. Saprotroph No – –
Cryptosporiopsis Saprotroph No – –
radicicola
Fusarium subglutinansa Plant pathogen No – –
Fusarium verticillioidesa Animal pathogen No – –
Endophyte
Plant pathogen
Glutinomyces sp. Endophyte No Ability to solubilize phosphates Mujahidah et al. (2019)
Hyphodiscus sp. Fungal Parasite No – –
Lecanicillium Animal Pathogen No – –
fusisporum
Nemania sp. Saprotroph No Production of metabolites against gram-negative Ibrahim et al. (2017); Farsi and Farokhi (2018).
and gram-positive bacteria
Nodulisporium sp. Saprotroph Yes Herbicidal, antifungal and antibacterial activities; Dai et al. (2006);
Production of volatile organic compounds with Mends et al. (2012); Hassan et al. (2013)
biological potential against plant pathogens
Paraphaeosphaeria Saprotroph No Production of anti-bacterial and antifungal Carrieri et al. (2020); De Amorim et al. (2019)
sporulosa metabolites
Talaromyces radicus Saprotroph No Production of methanolic compounds with potent Begum and Tamilselvi, 2019
antimicrobial activity
Trichoderma Endophyte Yes Effective biocontrol agent for several soilborne Trillas et al. (2006); Shoresh et al. (2005);
asperellumb plant pathogens Cotxarrera et al. (2002)
Trichoderma Not assigned No – –
caerulescensb
Trichoderma virideb Not assigned No Production of gliotoxin and viridin with high Brian & Hemming 1945; Brian & McGowan
fungistatic activity 1945
c
Xylaria enteroleuca Endophyte No – –
Xylaria ophiopodac Not assigned No – –
a
Other Fusarium species have been found as endophytes of orchids with roles such as the production of metabolites against bacteria and yeasts, promotion of plant
growth and stimulation of seed germination.
b
Trichoderma isolates have been reported as promotors that increase orchid seed germination and plant growth.
c
Xylaria strains were reported as promoters of plant growth in some orchid species.

Vanilla planifolia Andrews seedlings, suggesting that they may be useful common fungi in the species D. andina play any important physiological
in the development of bioinoculants (Ordóñez et al., 2012). role for the plant.
Interestingly, Byssochlamys spectabilis was isolated in three of the four Of the all strains sequenced, only one belonged to the orchid
study populations (BSA, GUA and RCI). This fungus has been reported as mycorrhizal fungi from the Rhizoctonia aggregate. The isolate Cerato­
a potent antagonist against phytopathogens. Its antibacterial ability has basidium sp. (MW578826) was genetically most similar to the one re­
been demonstrated (Hyung et al. 2013; Wu et al. 2018), as has its ported in GenBank as an orchid mycorrhizal fungus from Anoectochilus
antifungal power through the production of secondary metabolites formosanus Hayata from Taiwan (Table 1). As we expected, this result is
(Wahid et al. 2001; Rodrigo et al. 2017). Although it is a widely consistent with the only record made for the Dichaea genus, where the
distributed species associated with decomposition of plant matter genus Ceratobasidium was reported as OMF of D. morrisii Fawc. and
(Mioso et al. 2015), to date it has not been reported as an orchid Rendle (Mosquera-Espinosa et al. 2010). Likewise, Kottke and Suárez
endophyte. Just one study conducted in South Korea reported the fungal (2009) indicated a certain degree of specificity of the family Ceratoba­
species Byssochlamys nivea associated with the rhizosphere of the sidiaceae to the Cymbidieae tribe to which our study orchid species
endemic orchid Cypripedium japonicum Thunb. (Gang et al. 2017). belongs. Since the Dichaea genus has been poorly studied ecologically, it
Similarly, the same strain of Camarops sp. was isolated in two of the four is necessary to increase the sampling effort to evaluate the degree of
study populations (BAP, GUA). This fungal genus was reported in Gen­ specificity with the Ceratobasidiaceae family as OMF. It is worth
Bank as a fungal endophyte of the Dendrobium officinale Kimura and mentioning that the taxonomic determination of fungi based on com­
Migo orchid from China (Table 1). Camarops ustulinoides was recorded as parison with GenBank sequences may not be completely reliable, given
an endophytic fungus in the Ecuadorian orchids Cyrtochilum myanthum the low resolution and errors that occur in the determination of the
(Lindl.) Kraenzl. and Scaphyglottis punctulata (Rchb. f.) C. Schweinf. accessions registered in that database (Ko et al. 2011). In that sense, the
(Novotná et al. 2018). Although a possible beneficial role of this fungal reference specimen and its morphological characterization, together
genus in orchids has not yet been shown, it has been found that endo­ with the molecular results, provide a more precise determination (Ma
phytic Camarops strains of a plant Alibertia macrophylla K. Schum. et al. 2015).
(Rubiaceae) produce biologically active compounds (Gubiani et al. The results of NMDS analysis indicated that, contrary to our expec­
2014, 2016). It would be worth evaluating whether these seemingly tations, the fungal communities differ significantly among orchid

8
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

populations. There could be a difference in the local availability of fungi, communities, we need to understand the possible ecological and/or
associated with the geo-climatic history of the study sites and/or nu­ physiological roles that endophytes exert on plants and determine if, as
trients availability. Some studies have indicated that there may be a symbionts, they have had an impact on the evolutionary success of the
habitat-specificity of mycorrhizal or endophyte communities as a result Orchidaceae family (Zettler et al. 2004; Waterman et al. 2011). Finally,
of local conditions. These findings are most evident when it comes to understanding hyperdiverse communities of endophytic fungi inhabit­
contrasting niches such as dry areas vs. humid areas (Jacquemyn et al. ing orchids, the most diverse plant family with many threatened species
2016) or different vegetation formations (Oliveira et al. 2014). How­ (including Andean species), will shed light on complex tropical biodi­
ever, a study conducted in southern Ecuador (Cevallos et al. 2018), also versity networks and can be useful to support conservation programs.
found a differentiation in the community composition of root associated More specifically, this study is a first approach to understand the fungal
fungal endophytes from different epiphytic orchids. The authors sug­ diversity associated with D. andina orchid.
gested that despite being the same type of ecosystem (evergreen upper Here, we found a fraction of species, but once the sampling is
montane forests), each site had particular temperature and rain condi­ expanded by also exploring non-culture dependent techniques, we can
tions. In our study, the four explored sites belong to the same vegetation determine with greater precision if there is some degree of specificity in
formation (high Andean forest) and previous explorations (data not these relationships at the species level or if it is a generalist species that
shown) show that the humidity and temperature conditions are very adapts to the local availability of fungi. We know the importance of
similar to each other. Perhaps other factors could be conditioning the OMFs for seed germination and seedling establishment processes, but
presence of certain groups of fungi. For example, studying orchids the role of other fungi (endophytes) is largely unknown. The first step is
endemic to Patagonia, Luukas (2015) found significant host effects on to recognize the associations, and in a later phase to evaluate the role of
the composition of the endophytic fungal community. Other plausible fungi that could have implications for the survival of plants in situ. For
option, given the wide distribution of endophytic and mycorrhizal fungi example, for future symbiotic seed germination experiments, it would be
(McCormick and Jacquemyn 2014; Ma et al. 2015; Li et al. 2021b), is convenient to evaluate the stimulatory effects of strains of the genera
that few strains were isolated in each population, underestimating Fusarium, Trichoderma and Xylaria. It would also be worthwhile to
species richness. This could occur due to the fact that some fungi require include fungi that have been frequently reported as endophytes in or­
very strict culture conditions, or because superficial root disinfestation chids, such as Camarops sp. and Nodulisporium sp., strains for which no
processes can kill reproductive structures, making it difficult to obtain specific functionality is yet known.
mycelium in vitro. A greater sampling effort and the use of more complex
culture media (e.g. fungal isolating medium; FIM (Clements et al. 1986) Declaration of competing interest
or Melin-Norkrans agar; MMN (Stewart et al. 2003)), could increase the
representativeness of the fungal community. The authors declare that they have no known competing financial
Sometimes, fungi may not be present or not active in the roots at the interests or personal relationships that could have appeared to influence
time of collection. In the case of peloton-forming fungi (e.g. Ceratoba­ the work reported in this paper.
sidium), the hyphae could be in a high state of digestion by the plant
decreasing the pelotons viability and thus, limiting their culture in Acknowledgements
laboratory conditions (Zhu et al. 2008). Similarly, some plants may use
mycorrhizal fungi only in the early stages and they do not necessarily This study was funded by the San Diego County Orchid Society
continue to be associated with them in the adult stage, which is when the through Conservation Award (2017) and by Fondo de Investigaciones de
roots were sampled. We want to highlight that, although the new la Facultad de Ciencias from Universidad de Los Andes (Doctoral stu­
methods for the study of endophytic fungi obviate the time-consuming dents, call 2019–1, Project code: INV-2019-86-1799). We thank the DNA
process of fungal isolation, strains will be needed in experiments to Sequencing Center-GENCORE (Vicerectoría de Investigación y Creación,
test the symbiotic seed germination capacity and even to propose rein­ Universidad de Los Andes) for generating and subsidizing part of the
troduction initiatives in degraded ecosystems. sequence data sets. Special thanks to Colciencias (MinCiencias) for
It would be useful to integrate these results with analyses of the non- financing of the doctoral project through the National Doctoral Grant
cultivable fraction (culture-independent screening) in order to obtain a (call 617-2013). We would to express gratitude to the institutions and
broader and more precise view of the composition of these communities people who facilitated the study in the field (Parque Nacional Natural
(Kristiansen et al. 2001) and detect possible geographic structures. Cueva de los Guácharos, Corporación Serraniagua, Mr. Carlos Mesa), as
Previous studies have shown how the molecular sequencing of fungi well as Sophie Mennicken for the support in the laboratory and two
directly from colonized plant tissues allows the discovery of other fungi anonymous reviewers for their valuable comments and suggestions.
spectrum that is not found from culture-dependent techniques (Kohout
et al. 2013). In addition to molecular techniques traditionally used (ITS Appendix A. Supplementary data
sequencing by PCR), modern tools such as next-generation sequencing
(NGS), allows multiple “barcodes” of fungi present in a sample of plant Supplementary data to this article can be found online at https://doi.
tissue, increasing the precision of the screening (Huang et al. 2014). org/10.1016/j.funeco.2022.101158.
Studies of endophytic fungi conducted in various plant groups sug­
gested an important role for these fungi in relation to their ability to
References
facilitate the assimilation of nitrogen compounds, to protect plants
against the effects of water stress, to stimulate mycorrhizal fungi growth, Alomía, Y.A., Mosquera-Espinosa, A.T., Flanagan, N., Otero, J.T., 2017. Seed viability
and to prevent diseases in plants induced by pathogens through the and symbiotic seed germination in Vanilla spp. (Orchidaceae). Res. J. Seed Sci. 10
(2), 43–52.
production of secondary metabolites (Jumpponen et al. 2017; Rodrigo
Alomía, Y.A., Sambin, A., Otero, J.T., Stevenson, P.R., 2021. A new species of Dichaea
et al. 2017; Scervino et al. 2009; Vieira et al. 2011). In Orchidaceae, (Orchidaceae: Zygopetalinae) from the Andes of Colombia. Phytotaxa 521 (1),
endophytic fungi are an under-sampled group (Bayman and Otero 2006; 39–47.
Ma et al. 2015). Some studies have reported endophytic orchid fungi as Anderson, M.J., 2008. A new method for non-parametric multivariate analysis of
variance. Austral Ecol. 26 (1), 32–46.
facilitators of the seed germination and seedling growth processes Arditti, J., 1967. Factors affecting the germination of orchid seeds. Bot. Rev. 33, 1–197.
(Ovando et al. 2005; Bonnardeaux et al. 2007; Vujanovic and Vujanovic, Armenteras, D., Cadena-V, C., Moreno, R.P., 2007. Evaluación del estado de los bosques
2007; Ordóñez et al., 2012; Fracchia et al. 2014; Maldonado et al. 2020; de niebla y de la meta 2010 en Colombia. Instituto de Investigación de Recursos
Biológicos Alexander von Humboldt. Bogotá, D.C. Colombia, p. 72.
Salazar et al. 2020), a role reserved exclusively for mycorrhizal fungi. Arnold, A.E., Maynard, Z., Gilbert, G.S., Coley, P.D., Kursar, T.A., 2000. Are tropical
Besides studying the taxonomic diversity of orchid endophytic fungal fungal endophytes hyperdiverse? Ecol. Lett. 3 (4), 267–274.

9
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Barnes, E.C., Jumpathong, J., Lumyong, S., Voigt, K., Hertweck, C., 2016. Daldionin, an Delaye, L., Guzman, G.G., Heil, M., 2013. Endophytes versus biotrophic and necrotrophic
unprecedented binaphthyl derivative, and diverse polyketide congener from a fungal pathogens – are fungal lifestyles evolutionarily stable traits? Fungal Divers. 60,
orchid endophyte. Chemistry–A European Journal 22 (13), 4551–4555. 125–135.
Baskin, C.C., Baskin, J., 2014. Seeds- Ecology, Biogeography and Evolution of Dormancy Díaz, J.A.C., Gerlach, G., Otero, T., 2017. Hongos endófitos de Stanhopea tricornis
and Germination. Academic Press, Elsevier, p. 1600. (Orchidaceae) en Colombia. Orquideología 32 (1), 4–13.
Bayman, P., Lebron, L.L., Tremblay, R.L., Lodge, D.J., 1997. Variation in endophytic Duncan, K.E., Howard, R.J., 2010. Biology of maize kernel infection by Fusarium
fungi from roots and leaves of Lepanthes (Orchidaceae). New Phytol. 135 (1), verticillioides. Molecular plant-microbe interactions 23 (1), 6–16.
143–149. Farsi, M., Farokhi, S., 2018. Biosynthesis of antibacterial silver nanoparticles by
Bayman, P. & Otero, J. T. (2006). Microbial endophytes of orchid roots. In: Barbara J. E. endophytic fungus Nemania sp. isolated from Taxus baccata L. (Iranian yew).
Schulz, B., Boyle, C. & Sieber, T. (Eds). Microbial root endophytes. Springer, Berlin, Zahedan Journal of Research in Medical Sciences 20 (6).
Heidelberg, pp. 153-177. Fracchia, S., Silvani, V., Flachsland, E., Terada, G., Sede, S., 2014. Symbiotic seed
Begum, S.R., Tamilselvi, K.S., 2019. Biotechnological application of Talaromyces radicus germination and protocorm development of Aa achalensis Schltr., a terrestrial orchid
associated with Cucumis Dipsaceusehrenb. Ex Spach. Plant Archives 19 (1), endemic from Argentina. Mycorrhiza 24 (1), 35–43.
1938–1946. Gamboa-Gaitán, M.Á., 2014. Vainillas colombianas y su microbiota II. Diversidad,
Beltrán-Nambo, M., Martínez-Trujillo, M., Montero-Castro, J.C., Salgado-Garciglia, R., cultivo y microorganismos endófitos. Univ. Sci. 19 (3), 287–300.
Otero-Ospina, J.T., Carreón-Abud, Y., 2018. Fungal diversity in the roots of four Gang, G.H., Cho, G., Kwak, Y.S., Park, E.H., 2017. Distribution of rhizosphere and
epiphytic orchids endemic to Southwest Mexico is related to the breadth of plant endosphere fungi on the first-class endangered plant Cypripedium japonicum.
distribution. Rhizosphere 7, 49–56. MYCOBIOLOGY 45 (2), 97–100.
Bernal, R., Gradstein, S.R., Celis, M., 2015. Catálogo de plantas y líquenes de Colombia. Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced specificity for Basidiomycetes-
Instituto de Ciencias Naturales, Universidad Nacional de Colombia, Bogotá. application to the identification of mycorrhizae and rusts. Mol. Ecol. 2, 113–118.
http://catalogoplantasdecolombia.unal.edu.co/es/. (Accessed 1 October 2021). Gubiani, J.R., Zeraik, M.L., Oliveira, C.M., Ximenes, V.F., Nogueira, C.R., Fonseca, L.M.,
Bernard, N., 1904. Recherches experimentales sur les Orchidées I-III. Methodes de et al., 2014. Biologically active eremophilane-type sesquiterpenes from Camarops
culture; champignon endophyte; La germination des orchidées, vol. 16. Reveu sp., an endophytic fungus isolated from Alibertia macrophylla. J. Nat. Prod. 77 (3),
Générale de Botanique, pp. 405–451. 668–672.
Betancur, J., Sarmiento, H., Toro-González, L., Valencia, J., 2015. Plan para el estudio y Gubiani, J.R., Habeck, T.R., Chapla, V.M., Silva, G.H., Bolzani, V.S., Araujo, A.R., 2016.
la conservación de las orquídeas en Colombia. Ministerio de Ambiente y Desarrollo One strain-many compounds (OSMAC) method for production of phenolic
Sostenible, Universidad Nacional de Colombia, Bogotá, p. 336. compounds using Camarops sp., an endophytic fungus from Alibertia macrophylla
Bonnardeaux, Y., Brundrett, M., Batty, A., Dixon, K., Koch, J., Sivasithamparam, K., (Rubiaceae). Quím. Nova 39 (10), 1221–1224.
2007. Diversity of mycorrhizal fungi of terrestrial orchids: compatibility webs, brief Harley, J.L., Smith, S.E., 1983. Mycorrhizal Symbiosis. Academic Press Inc. Ltd., London,
encounters, lasting relationships and alien invasions. Mycol. Res. 111 (1), 51–61. UK, p. 483.
Borras, O., Santos, R., Matos, A.P., Cabral, R.S., Arzola, M., 2001. A first attempt to use a Hassan, S.R.U., Strobel, G.A., Geary, B., Sears, J., 2013. An endophytic Nodulisporium sp.
Fusarium subglutinans culture filtrate for the selection of pineapple cultivars resistant from Central America producing volatile organic compounds with both biological
to fusariose disease. Plant Breed. 120 (5), 435–438. and fuel potential. J. Microbiol. Biotechnol. 23 (1), 29–35.
Brundrett, M.C., 2004. Diversity and classification of mycorrhizal associations. Biol. Rev. Hernández, L.V., Alomía, Y.A., 2020. Hongos endófitos en orquídeas: un meta-análisis
79 (3), 473–495. global. Undergraduate Monograph. Facultad de Ciencias, Universidad de Los Andes,
Brundrett, M.C., 2006. Understanding the roles of multifunctional mycorrhizal and Bogotá, Colombia, p. 61. Available in: https://documentodegrado.uniandes.edu.co/
endophytic fungi. In: Schulz, B.J.E., Boyle, C.J.C., Sieber, T.N. (Eds.), Microbial Root acepto201699.php?id=21930.pdf.
Endophytes. Springer-Verlag, Berlin, Germany, pp. 281–293. Huang, C.L., Jian, F.Y., Huang, H.J., Chang, W.C., Wu, W.L., Hwang, C.C., et al., 2014.
Brundrett, M.C., 2017. Global diversity and importance of mycorrhizal and Deciphering mycorrhizal fungi in cultivated Phalaenopsis microbiome with next-
nonmycorrhizal plants. In: Tedersoo, L. (Ed.), Biogeography of Mycorrhizal generation sequencing of multiple barcodes. Fungal Divers. 66 (1), 77–88.
Symbiosis. Springer, Cham, pp. 533–556. Hyung, J.J., Kang, H., Joong, J.J., Soo, K.Y., 2013. Paecilomyces variotii Extracts for
Bungtongdee, N., Sopalun, K., Laosripaiboon, W., Iamtham, S., 2019. The chemical Preventing and Treating Infections Caused by Fish Pathogenic Microorganisms. KR
composition, antifungal, antioxidant and antimutagenicity properties of bioactive Patent, p. 2013051523.
compounds from fungal endophytes associated with Thai orchids. J. Phytopathol. Ibrahim, A., Sørensen, D., Jenkins, H.A., Ejim, L., Capretta, A., Sumarah, M.W., 2017.
167 (1), 56–64. Epoxynemanione A, nemanifuranones A–F, and nemanilactones A–C, from Nemania
Carrieri, R., Borriello, G., Piccirillo, G., Lahoz, E., Sorrentino, R., Cermola, M., et al., serpens, an endophytic fungus isolated from Riesling grapevines. Phytochemistry
2020. Antibiotic activity of a Paraphaeosphaeria sporulosa-produced 140, 16–26.
Diketopiperazine against Salmonella enterica. Journal of Fungi 6 (2), 83. Jacquemyn, H., Waud, M., Lievens, B., Brys, R., 2016. Differences in mycorrhizal
Cavaglieri, L., Orlando, J.R.M.I., Rodríguez, M.I., Chulze, S., Etcheverry, M., 2005. communities between Epipactis palustris, E. helleborine and its presumed sister species
Biocontrol of Bacillus subtilis against Fusarium verticillioides in vitro and at the maize E. neerlandica. Ann. Bot. 118 (1), 105–114.
root level. Res. Microbiol. 156 (5–6), 748–754. Jumpponen, A., Herrera, J., Porras-Alfaro, A., Rudgers, J., 2017. Chapter 10-Biogeog­
Cevallos, S., Sánchez-Rodríguez, A., Decock, C., Declerck, S., Suárez, J.P., 2017. Are raphy of root-associated fungal endophytes. In: Tedersoo, L. (Ed.), Biogeography of
there keystone mycorrhizal fungi associated to tropical epiphytic orchids? Mycorrhizal Symbiosis. Springer, Cham, pp. 195–222.
Mycorrhiza 27 (3), 225–232. Katoh, K., Rozewicki, J., Yamada, K.D., 2019. MAFFT online service: multiple sequence
Cevallos, S., Herrera, P., Sánchez-Rodríguez, A., Declerck, S., Suárez, J.P., 2018. alignment, interactive sequence choice and visualization. Briefings Bioinf. 20 (4),
Untangling factors that drive community composition of root associated fungal 1160–1166.
endophytes of Neotropical epiphytic orchids. Fungal Ecology 34, 67–75. Kharwar, R.N., Verma, V.C., Kumar, A., Gond, S.K., Harper, J.K., Hess, W.M., et al., 2009.
Chase, M.W., Cameron, K.M., Freudenstein, J.V., Pridgeon, A.M., Salazar, G., Van den Javanicin, an antibacterial naphthaquinone from an endophytic fungus of neem,
Berg, C., Schuiteman, A., 2015. An updated classification of Orchidaceae. Bot. J. Chloridium sp. Curr. Microbiol. 58 (3), 233–238.
Linn. Soc. 177 (2), 151–174. Ko, T.W.K., Stephenson, S.L., Bahkali, A.H., Hyde, K.D., 2011. From morphology to
Chen, J., Hu, K.X., Hou, X.Q., Guo, S.X., 2011. Endophytic fungi assemblages from 10 molecular biology: can we use sequence data to identify fungal endophytes? Fungal
Dendrobium medicinal plants (Orchidaceae). World J. Microbiol. Biotechnol. 27 (5), Divers. 50 (1), 113.
1009–1016. Kohout, P., Těšitelová, T., Roy, M., Vohník, M., Jersáková, J., 2013. A diverse fungal
Clay, K., Holah, J., 1999. Fungal endophyte symbiosis and plant diversity in successional community associated with Pseudorchis albida (Orchidaceae) roots. Fungal Ecology 6
fields. Science 285, 1742–1745. (1), 50–64.
Clements, M.A., Muir, H., Cribb, P.J., 1986. A preliminary report on the symbiotic Kottke, I., Suárez, J.P., 2009. Mutualistic, root-inhabiting fungi of orchids identification
germination of European terrestrial orchids. Kew Bull. 437–445. and functional types. In: Pridgeon, A.M., Suárez, J.P. (Eds.), Proceedings of the
Cotxarrera, L., Trillas-Gay, M.I., Steinberg, C., Alabouvette, C., 2002. Use of sewage Second Scientific Conference on Andean Orchids. Universidad Técnica Particular De
sludge compost and Trichoderma asperellum isolates to suppress Fusarium wilt of Loja, Loja, Ecuador, pp. 84–99.
tomato. Soil Biol. Biochem. 34 (4), 467–476. Kristiansen, K.A., Taylor, D.L., Kjøller, R., Rasmussen, H.N., Rosendahl, S., 2001.
Currah, R.S., Zelmer, C.D., Hambleton, S., Richardson, K.A., 1997. Fungi from orchid Identification of mycorrhizal fungi from single pelotons of Dactylorhiza majalis
mycorrhizas. In: Arditti, Pridgeon (Eds.), Orchid Biology: Reviews and Perspectives (Orchidaceae) using single-strand conformation polymorphism and mitochondrial
7, 117–170. Kluwer Academic Publishers. ribosomal large subunit DNA sequences. Mol. Ecol. 10 (8), 2089–2093.
Dai, J., Krohn, K., Flörke, U., Draeger, S., Schulz, B., Kiss-Szikszai, A., et al., 2006. Li, T., Wu, S., Yang, W., Selosse, M.A., Gao, J., 2021a. How mycorrhizal associations
Metabolites from the endophytic fungus Nodulisporium sp. from. Juniperus cedre. influence orchid distribution and population dynamics. Front. Plant Sci. 12, 833.
European Journal of Organic Chemistry 3498–3506. Li, T., Yang, W., Wu, S., Selosse, M.A., Gao, J., 2021b. Progress and prospects of
De Amorim, M.R., Hilário, F., dos Santos Junior, F.M., Junior, J.M.B., Bauab, T.M., mycorrhizal fungal diversity in orchids. Front. Plant Sci. 12, 820.
Araújo, A.R., et al., 2019. New benzaldehyde and benzopyran compounds from the Luukas, E., 2015. Root Associated Fungi of Patagonian Endemic Orchids. Master Thesis.
endophytic fungus Paraphaeosphaeria sp. F03 and their antimicrobial and cytotoxic University of Tartu, Tartu-Estonia, p. 25.
activities. Planta Med. 85 (11/12), 957–964. Ma, X., Kang, J., Nontachaiyapoom, S., Wen, T., Hyde, K.D., 2015. Non-mycorrhizal
Dearnaley, J., Martos, F., Selosse, M.A., 2012. Orchid mycorrhizas: molecular ecology, endophytic fungi from orchids. Curr. Sci. 72–87.
physiology, evolution and conservation aspects. In: Hock, B. (Ed.), Fungal Maddison, W.P., Maddison, D.R., 2007. Mesquite: a modular system for evolutionary
Associations. Springer- Verlag, Heidelberg, Germany, pp. 207–230. analysis. Mesquite v. 2.72. http://mesquiteproject.org.
Dearnaley, J., Perotto, S., Selosse, M.A., 2016. Structure and development of orchid Maldonado, G.P., Yarzábal, L.A., Cevallos-Cevallos, J.M., Chica, E.J., Peña, D.F., 2020.
mycorrhizas. In: Martin, F. (Ed.), Molecular Mycorrhizal Symbiosis. John Wiley & Root endophytic fungi promote in vitro seed germination in Pleurothallis coriacardia
Sons Inc., Hoboken, New Yersey, USA, pp. 63–86. (Orchidaceae). Lankesteriana 20 (1), 107–122.

10
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Martos, F., Dulormne, M., Pailler, T., Bonfante, P., Faccio, A., Fournel, J., et al., 2009. Sarsaiya, S., Shi, J., Chen, J., 2019. A comprehensive review on fungal endophytes and
Independent recruitment of saprotrophic fungi as mycorrhizal partners by tropical its dynamics on Orchidaceae plants: current research, challenges, and future
achlorophyllous orchids. New Phytol. 184 (3), 668–681. possibilities. Bioengineered 10 (1), 316–334.
McCormick, M.K., Jacquemyn, H., 2014. What constrains the distribution of orchid Scervino, J.M., Gottlieb, A., Silvani, V.A., Pérgola, M., Fernández, L., Godeas, A.M., 2009.
populations? New Phytol. 202 (2), 392–400. Exudates of dark septate endophyte (DSE) modulate the development of the
Mends, M.T., Yu, E., Strobel, G.A., Hassan, S.R.U., Booth, E., Geary, B., et al., 2012. An arbuscular mycorrhizal fungus (AMF) Gigaspora rosea. Soil Biol. Biochem. 41 (8),
endophytic Nodulisporium sp. producing volatile organic compounds having 1753–1756.
bioactivity and fuel potential. J. Petrol Environ. Biotechnol. 3 (3). Selosse, M.A., Bocayuva, M.F., Kasuya, M.C.M., Courty, P.E., 2016. Mixotrophy in
Michel-Aceves, A.C., Otero-Sánchez, M.A., Solano-Pascacio, L.Y., Ariza-Flores, R., mycorrhizal plants: extracting carbon from mycorrhizal networks. In: Martin, F.
Barrios-Ayala, A., Rebolledo-Martínez, A., 2009. Biocontrol in vitro con Trichoderma (Ed.), Molecular Mycorrhizal Symbiosis. John Wiley & Sons Inc., Hoboken, New
spp. de Fusarium subglutinans (Wollenweb. y Reinking) Nelson, Toussoun y Marasas y Yersey, USA, pp. 451–471.
F. oxysporum Schlecht., Agentes Causales de la" Escoba de Bruja" del Mango Shah, S., Shrestha, R., Maharjan, S., Selosse, M.A., Pant, B., 2019. Isolation and
(Mangifera indica L.). Rev. Mex. Fitopatol. 27 (1), 18–26. characterization of plant growth-promoting endophytic fungi from the roots of.
Mioso, R., Toledo-Marante, F.J., Herrera-Bravo de Laguna, I., 2015. The chemical Dendrobium moniliforme. Plants 8 (1), 5–15.
diversity of the ascomycete fungus, Paecilomyces variotii. Appl. Biochem. Biotechnol. Shoresh, M., Yedidia, I., Chet, I., 2005. Involvement of jasmonic acid/ethylene signaling
177, 781–791. pathway in the systemic resistance induced in cucumber by Trichoderma asperellum
Mosquera-Espinosa, A.T., Bayman, P., Otero, J.T., 2010. Ceratobasidium como hongo T203. Phytopathology 95 (1), 76–84.
micorrízico de orquídeas en Colombia. Acta Agronómica 59 (3), 316–326. Smith, S.E., Read, D.J., 2008. Mycorrhizal Symbiosis, third ed. Academic Press Inc. Ltd.,
Mujahidah, S., Sukarno, N., Kanti, A., Sudiana, I.M., 2019. Identification of London, UK, p. 787.
ectomycorrhiza-associated fungi and their ability in phosphate solubilization. Jurnal Staden, R., Judge, D.P., Bonfield, J.K., 2003. Analysing sequences using the staden
Biologi Indonesia 14 (2). package and EMBOSS. In: Krawetz, S.A., Womble, D.D. (Eds.), Introduction to
NCBI, 2021. National center for Biotechnology information, Bethesda (MD): National Bioinformatics. A Theoretical and Practical Approach. Human Press Inc., Springer
Library of medicine (US). National Center for Biotechnology Information. Available Science+Business Media, pp. 393–412. New York, USA.
from: https://www.ncbi.nlm.nih.gov/. (Accessed 12 February 2021). Stewart, S.L., Zettler, L.W., Minso, J., Brown, P.M., 2003. Symbiotic germination and
Nguyen, N.H., Song, Z., Bates, S.T., Branco, S., Tedersoo, L., Menke, J., Schilling, J.S., reintroduction of Spiranthes brevilabris Lindley, an endangered orchid native to
Kennedy, P.G., 2016. FUNGuild: an open annotation tool for parsing fungal Florida. Selbyana 64–70.
community datasets by ecological guild. Fungal Ecology 20, 241–248. Available Suárez, J.P., KottKe, I., 2016. Main fungal partners and different levels of specificity of
from: www.funguild.org. orchid mycorrhizae in the tropical mountain forests of Ecuador. Lankesteriana 16
Novotná, A., Benítez, Á., Herrera, P., Cruz, D., Filipczyková, E., Suárez, J.P., 2018. High (2), 299–305.
diversity of root-associated fungi isolated from three epiphytic orchids in southern Swarts, N.D., Dixon, K.W., 2017. Conservation Methods for Terrestrial Orchids. J. Ross
Ecuador. Mycoscience 59 (1), 24–32. Publishing, p. 235.
Oliveira, S.F., Bocayuva, M.F., Veloso, T.G.R., Bazzolli, D.M.S., da Silva, C.C., Pereira, O. Taylor, D.L., McCormick, M., 2008. Internal Transcribed Spacer primers and sequences
L., Kasuya, M.C.M., 2014. Endophytic and mycorrhizal fungi associated with roots of for improved characterization of basidiomycetous orchid mycorrhizas. New Phytol.
endangered native orchids from the Atlantic Forest, Brazil. Mycorrhiza 24 (1), 177 (4), 1020–1033.
55–64. The Plant List. (2013). Version 1.1. Available from: http://www.theplantlist.org/
Ordóñez, N.F., Otero, J.T., Díez, M.C., 2012. Hongos endófitos de orquídeas y su efecto (accessed: 05.25.2021).
sobre el crecimiento en Vanilla planifolia Andrews. Acta Agronómica 61 (3), Tintjer, T., Rudgers, J.A., 2006. Grass-herbivore interactions altered by strains of a native
282–290. endophyte. New Phytol. 170, 513–521.
Ovando, I., Damon, A., Bello, R., Ambrosio, D., Albores, V., Adriano, L., Salvador, M., Trillas, M.I., Casanova, E., Cotxarrera, L., Ordovás, J., Borrero, C., Avilés, M., 2006.
2005. Isolation of endophytic fungi and their mycorrhizal potential for the tropical Composts from agricultural waste and the Trichoderma asperellum strain T-34
epiphytic orchids Cattleya skinneri, C. aurantiaca and Brassavola nodosa. Asian J. suppress Rhizoctonia solani in cucumber seedlings. Biol. Control 39 (1), 32–38.
Plant Sci. 4 (3), 309–315. Valadares, R.B.D.S., Otero, J.T., Pereira, M.C., Cardoso, E.J.B.N., 2015. The epiphytic
Patterson, C.G., Potter, D.A., Fanin, F.F., 1991. Feeding deterrence of alkaloids from orchids Ionopsis utricularioides and Psygmorchis pusilla associate with different
endophyte-infected grasses to Japanese beetle grubs. Entomol. Exp. Appl. 61, Ceratobasidium lineages at Valle del Cauca, Colombia. Acta Bot. Bras. 29 (1), 40–44.
285–289. Vaz, A.B., Mota, R.C., Bomfim, M.R.Q., Vieira, M.L., Zani, C.L., Rosa, C.A., Rosa, L.H.,
Peterson, R.L., Massicotte, H.B., Melville, L.H., 2004. Mycorrhizas: Anatomy and Cell 2009. Antimicrobial activity of endophytic fungi associated with Orchidaceae in
Biology. National Research Council of Canada, CABI Publishing, Ottawa, Ontario Brazil. Can. J. Microbiol. 55 (12), 1381–1391.
K1A 0R6, Canada, p. 173. Vieira, M.L., Hughes, A.F., Gil, V.B., Vaz, A.B., Alves, T.M., Zani, C.L., et al., 2011.
Pupulin, F., 2007. Contributions toward a reassessment of Costa Rican Zygopetalinae Diversity and antimicrobial activities of the fungal endophyte community associated
(Orchidaceae). 3. A systematic revision of Dichaea in Costa Rica. Harv. Pap. Bot. 12 with the traditional Brazilian medicinal plant Solanum cernuum Vell. (Solanaceae).
(1), 15–153. Can. J. Microbiol. 58 (1), 54–66.
R Core Team, 2021. R: A Language and Environment for Statistical Computing. R Viljoen, A., Wingfield, M.J., Marasas, W.F.O., 1994. First report of Fusarium subglutinans
Foundation for Statistical Computing, Vienna, Austria. Available from: http://www. f. sp. pini on pine seedlings in South Africa. Plant Dis. 78 (3), 309–312.
R-project.org/. Vujanovic, V., Vujanovic, J., 2007. Mycovitality and mycoheterotrophy: where lies
Rasmussen, H.N., 1995. Terrestrial Orchids: from Seeds to Mycotrophic Plants. dormancy in terrestrial orchid and plants with minute seeds? Symbiosis 44, 93–99.
Cambridge University Press, Cambridge, UK, p. 444. Wahid, O.A.A., Moustafa, A.F., Ibrahim, M.E., 2001. Integrated control of tomato
Richardson, K.A., Currah, R.S., 1995. The Fungal Community Associated with the Roots Fusarium-wilt through implementation of soil solarization and filamentous fungi. J.
of Some Rainforest Epiphytes of Costa Rica. Selbyana, pp. 49–73. Plant Dis. Prot. 108, 345–355.
Roche, S.A., Carter, R.J., Peakall, R., Smith, L.M., Whitehead, M.R., Linde, C.C., 2010. A Wang, H., Qi, M., Cutler, A.J., 1993. A simple method of preparing plant samples for
narrow group of monophyletic Tulasnella (Tulasnellaceae) symbiont lineages are PCR. Nucleic Acids Res. 21 (17), 4153.
associated with multiple species of Chiloglottis (Orchidaceae): implications for orchid Wang, X., Li, Y., Song, X., Meng, Q., Zhu, J., Zhao, Y., Yu, W., 2017. Influence of host tree
diversity. Am. J. Bot. 97 (8), 1313–1327. species on isolation and communities of mycorrhizal and endophytic fungi from
Rodrigo, S., Santamaria, O., Halecker, S., Lledó, S., Stadler, M., 2017. Antagonism roots of a tropical epiphytic orchid, Dendrobium sinense (Orchidaceae). Mycorrhiza
between Byssochlamys spectabilis (anamorph Paecilomyces variotii) and plant 27 (7), 709–718.
pathogens: involvement of the bioactive compounds produced by the endophyte. Waterman, R.J., Bidartondo, M.I., Stofberg, J., Combs, J.K., Gebauer, G., Savolainen, V.,
Ann. Appl. Biol. 171 (3), 464–476. et al., 2011. The effects of above-and belowground mutualisms on orchid speciation
Rodriguez, R.J., White Jr., J.F., Arnold, A.E., Redman, A.R.A., 2009. Fungal endophytes: and coexistence. Am. Nat. 177 (2), E54–E68.
diversity and functional roles. New Phytol. 182 (2), 314–330. WCSP, 2021. World Checklist of selected plant families. Facilitated by the Royal Botanic
Rodríguez, J.S., Lora, F.M., 2016. Microbiota endófita del género Maxillaria Ruiz & Pav. Gardens, Kew. Available from: http://wcsp.science.kew.org/.
(Orchidaceae) en dos reservas naturales del departamento del Quindío. Revista de White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of
Investigaciones Universidad del Quindío 28 (1), 23–31. fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,
Salazar, J.M., Pomavilla, M., Pollard, A.T., Chica, E.J., Peña, D.F., 2020. Endophytic Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods and
fungi associated with roots of epiphytic orchids in two Andean forests in Southern Applications. Academic Press,Inc., San Diego, CA, USA, pp. 315–322.
Ecuador and their role in germination. Lankesteriana 20 (1), 37–47. Wu, Y.Z., Zhang, H.W., Sun, Z.H., Dai, J.G., Hu, Y.C., Li, R., et al., 2018. Bysspectin A, an
Salazar-Orellana, M.J., 2017. Estudio comparativo de la riqueza de hongos endófitos unusual octaketide dimer and the precursor derivatives from the endophytic fungus
asociados a la diversidad de orquídeas epífitas en los bosques de Mazán y la zona de Byssochlamys spectabilis IMM0002 and their biological activities. Eur. J. Med. Chem.
influencia del Parque Nacional El Cajas. Doctoral Dissertation, Universidad de 145, 717–725.
Cuenca, Ecuador, p. 49. Yu, Y., Cui, Y.H., Hsiang, T., Zeng, Z.Q., Yu, Z.H., 2015. Isolation and identification of
Samuels J., G., Suárez, C., Solís, K., Holmes A., K., Thomas E., S., Ismaiel, A., Evans C., H., endophytes from roots of Cymbidium goeringii and Cymbidium faberi (Orchidaceae).
2016. Trichoderma theobromicola and T. paucisporum: two new species isolated from Nova Hedwigia 101 (1–2), 57–64.
cacao in South America. Mycological Research (4), 381–392. Yuan, Z.L., Chen, Y.C., Yang, Y., 2009. Diverse non-mycorrhizal fungal endophytes
Sarmiento, C., Zalamea, P.C., Dalling, J.W., Davis, A.S., Stump, S.M., U’Ren, J.M., inhabiting an epiphytic, medicinal orchid (Dendrobium nobile): estimation and
Arnold, A.E., 2017. Soilborne fungi have host affinity and host-specific effects on characterization. World J. Microbiol. Biotechnol. 25 (2), 295.
seed germination and survival in a lowland tropical forest. Proc. Natl. Acad. Sci. Zettler, L.W., Sharma, J., Rasmussen, F., 2004. Mycorrhizal diversity. In: Dixon, K.,
Unit. States Am. 114 (43), 11458–11463. Cribb, P., Kell, S., Barrett, R. (Eds.), Orchid Conservation. Natural History
Publications, Kota Kinabalu, Sabah, Malaysia, pp. 185–203.

11
Y.A. Alomía et al. Fungal Ecology 57-58 (2022) 101158

Zettler, L.W., Corey, L.L., 2018. Chapter 2- orchid mycorrhizal fungi: isolation and Hayata, a rare and threatened medicinal Orchidaceae plant. J. Zhejiang Univ. - Sci. B
identification techniques. In: Lee, Y.I., Yeung, E.C.T. (Eds.), Orchid Propagation: 14 (9), 785–792.
from Laboratories to Greenhouses—Methods and Protocols. Springer Protocols Zhu, G.S., Yu, Z.N., Gui, Y., Liu, Z.Y., 2008. A novel technique for isolating orchid
Handbooks, pp. 27–59. mycorrhizal fungi. Fungal Divers. 33 (12), 123.
Zhang, F.S., Lv, Y.L., Zhao, Y., Guo, S.X., 2013. Promoting role of an endophyte on the
growth and contents of kinsenosides and flavonoids of Anoectochilus formosanus

12