polymers

Article
Fungal Screening for Potential PET Depolymerization
Lusiane Malafatti-Picca 1 , Elaine Cristina Bucioli 1 , Michel Ricardo de Barros Chaves 2 ,
Aline Machado de Castro 3 , Érika Valoni 3 , Valéria Maia de Oliveira 4 , Anita Jocelyne Marsaioli 5 ,
José Silvio Govone 1 , Dejanira de Franceschi de Angelis 6 , Michel Brienzo 7, * and Derlene Attili-Angelis 1,4,6

1 Environmental Studies Center (CEA), São Paulo State University (UNESP), Av. 24-A, 1515, Bela Vista,
Rio Claro 13506-900, SP, Brazil
2 Coordination of Natural Sciences, Federal University of Maranhão (UFMA), Av. João Alberto, 700,
Bacabal 65700-000, MA, Brazil
3 Department of Biotechnology, R&D Center, PETROBRAS, Av. Horácio Macedo, 950, Ilha do Fundão,
Rio de Janeiro 21941-915, RJ, Brazil
4 Division of Microbial Resources, CPQBA, State University of Campinas (Unicamp), Rua Alexandre
Cazellato, 999, Paulínia 13148-218, SP, Brazil
5 Institute of Chemistry, State University of Campinas (Unicamp), P.O. Box 6154, Campinas 13084-971, SP, Brazil
6 Department of Biochemistry and Microbiology, São Paulo State University (UNESP), Av. 24-A, 1515,
Bela Vista, Rio Claro 13506-900, SP, Brazil
7 Institute For Research in Bioenergy (IPBEN), São Paulo State University (UNESP), R. 10, 2527, Santana,
Rio Claro 13500-230, SP, Brazil
* Correspondence: michel.brienzo@unesp.br; Tel.: +55-193-531-8407

Abstract: Approximately 400 billion PET bottles are produced annually in the world, of which from
8 to 9 million tons are discarded in oceans. This requires developing strategies to urgently recycle
them. PET recycling can be carried out using the microbial hydrolysis of polymers when monomers
and oligomers are released. Exploring the metabolic activity of fungi is an environmentally friendly
way to treat harmful polymeric waste and obtain the production of monomers. The present study
addressed: (i) the investigation of potential of strains with the potential for the depolymerization
Citation: Malafatti-Picca, L.;
Bucioli, E.C.; de Barros Chaves, M.R.;
of PET bottles from different manufacturers (crystallinity of 35.5 and 10.4%); (ii) the search for
de Castro, A.M.; Valoni, É.; a culture medium that favors the depolymerization process; and (iii) gaining more knowledge
de Oliveira, V.M.; Marsaioli, A.J.; on fungal enzymes that can be applied to PET recycling. Four strains (from 100 fungal strains)
Govone, J.S.; de Franceschi de were found as promising for conversion into terephthalic acid from PET nanoparticles (npPET):
Angelis, D.; Brienzo, M.; et al. Fungal Curvularia trifolii CBMAI 2111, Trichoderma sp. CBMAI 2071, Trichoderma atroviride CBMAI 2073, and
Screening for Potential PET Cladosporium cladosporioides CBMAI 2075. The fermentation assays in the presence of PET led to the
Depolymerization. Polymers 2023, 15, release of terephthalic acid in concentrations above 12 ppm. Biodegradation was also confirmed
1581. https://doi.org/10.3390/ using mass variation analyses (reducing mass), scanning electron microscopy (SEM) that showed
polym15061581
evidence of material roughness, FTIR analysis that showed band modification, enzymatic activities
Academic Editors: Cristiano Varrone detected for lipase, and esterase and cutinase, confirmed by monomers/oligomers quantification
and Alessandro Pellis using high performance liquid chromatography (HPLC-UV). Based on the microbial strains PET
depolymerization, the results are promising for the exploration of the selected microbial strain.
Received: 21 December 2022
Revised: 13 February 2023
Keywords: biodegradation; enzymatic catalysis; polymers; terephthalic acid
Accepted: 15 February 2023
Published: 22 March 2023

1. Introduction
Copyright: © 2023 by the authors.
Despite the environmental damage caused by plastic, its current application in human
Licensee MDPI, Basel, Switzerland.
society has become so diverse that a short-term replacement is unlikely. In 2018, the
This article is an open access article
world production of polymers reached 360 million tons (Mtons). If the current treatment
distributed under the terms and
(i.e., production and disposal) of plastics persists by 2050, it is believed that 12 Mtons of
conditions of the Creative Commons
this material will be deposited in landfills or the natural environment [1]. Europe alone
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
was responsible for causing 62 Mtons of this global amount to be available, of which 7.7%
4.0/).
comprised polyethylene terephthalate (PET), a thermoplastic with an excellent mechanical

Polymers 2023, 15, 1581. https://doi.org/10.3390/polym15061581 https://www.mdpi.com/journal/polymers

Polymers 2023, 15, 1581 2 of 24

and thermal resistance [2,3]. The initiatives by the European Parliament intended to increase
PET recycling with the support of international companies and the promise to step up
recycling. However, a decline in the uptake by the selective collection of the polymer has
been observed, threatening the goal of the estimated amount for 2025 [4]. It is assumed that,
only in 2021, will the number of produced bottles reach 583.3 billion units worldwide [5],
which is a serious matter of concern for the environment.
The great persistence and low (bio-) degradability reported under natural conditions
are responsible for the huge environmental impact of inadequate PET disposal. The material
may require thousands of years to degrade [6,7]. The shortage of production associated
with excessive consumption and the timid reuse of PET bottles requires research and
development aimed at remediating this recalcitrant material. It is estimated that the amount
of plastic packaging on the market may quickly become equal to the quantity discarded,
reinforcing the urgency for establishing new recycling strategies for this material [8].
The bottles for beverage and food recycling relates to the production of fibers and
special films, laminated and thermoformed, as well as textiles [3]. PET recycling routes
may be mechanical, chemical, or energetic [9]. Among them, chemical recycling emerges
as a more interesting alternative because it prevents the deposition of solid waste in the
environment, besides providing monomers to obtain new bottles and packaging [10,11].
The types of chemical recycling are glycolysis, methanolysis, aminolysis, ammonolysis,
and hydrolysis. The first has been the most used by the industry despite the high cost
associated with separating and refining the products in the mixture [12]. The studies on the
depolymerization of PET search for innovative aspects and are certainly of great scientific,
economic, and industrial importance [13]. Alternatively, microorganism-mediated polymer
hydrolysis occurs with the advantage of not requiring solvents and reagents that usually
increase purification costs [14].
Microbial hydrolytic enzymes such as lipases (EC 3.1.1.3), esterases (EC 3.1.1.6 and
EC 3.1.1.2), and cutinases (EC 3.1.1.74) can assist in the biodegradation of the hydrophobic
polymer [15–17]. Several studies have addressed the use of microorganisms or their en-
zymes in PET depolymerization processes [18–20]. Recently, the species Ideonella sakaiensis
(Burkholderiales, Proteobacteria), isolated in Japan, has been in the limelight due to the
selectivity and efficiency of its enzymes in 18 h of activity [21]. Despite the satisfactory
activity of some hydrolases, the microbial conversion of PET is far from complete. It is
still not clear in which species or phyla these enzymes can be mainly found. According to
Lear et al. [22], these questions represent important notes that must be answered, which
justifies further studies.
Fungi are excellent degraders of organic matter, especially natural polymers, as they
grow under adverse conditions of pH and humidity. In addition, mycelial development
favors the colonization of the substrate, which, together with its multienzyme system,
speeds up the degradation of several compounds [23]. The literature highlights cuti-
nases from Fusarium solani [24] and esterases from Cladosporium cladosporioides [25] and
Penicillium citrinum [26], as well as lipases from Aspergillus oryzae [27], which have the po-
tential to increase the hydrophilicity of the PET polymer. Recently, Malafatti-Picca et al. [18]
selected nine strains of remarkable hydrolytic activity for converting PET. However, most
of the reports still focus only on bacterial species, while fungi remain unexplored for such
an application. This fact is evinced in the literature as highlighted in the reviews performed
by Taniguchi et al. [3] and Ru et al. [28].
Several methods are used to evaluate microbial activity on polymers. High-Performance
Liquid Chromatography (HPLC) is used to study microbial activity on polymers, al-
lowing for the quantification of the released terephthalic acid (PTA) monomers and
bis(2-hydroxyethyl) terephthalate (BHET) and mono(hydroxyethyl) terephthalate (MHET)
oligomers. Although efficient, the methodology is time-consuming and requires specific
infrastructure and adequate room [24,28]. Miniaturized screening approaches to detect
polyester hydrolases are considered of great value because they are quick and helpful for
the development of sustainable methodologies. Wei et al. [29], for example, implemented a
Polymers 2023, 15, 1581 3 of 24

high-performance screening technique with fluorescence detection (HTS-fluorescence) for

the quantification of terephthalic acid from PET nanoparticles (npPET) by converting PTA
to the free radical 2-hydroxyterephthalate (HOTP). The assays of this investigation were
carried out with recombinant cutinases of Thermobifida fusca (Actinomycetales, Bacteria).
Addressing the same principle, Chaves et al. [30] reported the bacteria, filamentous fungi,
and yeasts with the potential for depolymerization of npPET in PTA, although using the
entire cell structure of the tested isolates, not just the isolated enzymes.
Focusing on fungal strains from hydrocarbon-associated environments, this work eval-
uated their hydrolase production potential for npPET assimilation using microscale assays.
The effect of the strains with the best conversion rates on fragments of PET bottles from
two brands and different production technologies, “plant-bottle” and conventional, was
evaluated. For this purpose, the analyses of PTA, BHET, and MHET quantification through
HPLC-UV after liquid–liquid extraction, as well as total proteins and hydrolase activity
(lipase and esterase), were carried out on fermented liquid (free of mycelium). On PET
fragments, the analyses included weight variation, scanning electron microscopy (SEM),
and infrared spectroscopy (FTIR). The proposal of a culture medium to provide greater
PET conversion into PTA and oligomers was another contribution of the present study.

2. Material and Methods

2.1. Microorganisms
One hundred fungal strains were investigated in this work, which was the same
number Malafatti-Picca [18] used in their study. The strains were obtained from a culture
collection of interest to the petrochemical industry deposited in the Brazilian Collection
of Environmental and Industrial Microorganisms (CBMAI, Unicamp, SP, Brazil) and/or
preserved in the working research collection of the laboratory.

2.1.1. Enzymatic Assays with PET nanoparticles

The isolates were cultivated in Potato Dextrose Agar (PDA) purchased from Kasvi,
Spain, at 28 ◦ C for seven days. The analyses were performed in 96 well plates with a black
background divided into enzymatic assays and negative, positive, and microbial control,
as indicated in Table 1.

Table 1. Components per assay for analyses with PET nanoparticles.

Fungal Cells
PET Nanoparticles * Terephthalic
(Suspension, Borate Buffer
Assay (Suspension, Acid (Solution,
1 mg·mL−1 , in 20 mM (20 mM—pH 7.8)
0.11 mg·mL−1 ) 2.6 mM)
Borate Buffer—pH 7.8)
Enzymatic 100 µL 30 µL – —
Positive control 100 µL — 100 µL —
Negative control — 30 µL 100 µL —
Microbial control 100 µL — — 30 µL
* Diameter of approximately 60 nm [30,31].

Afterward, the plates were incubated at 28 ◦ C and agitated at 200 rpm. The enzyme
activities were monitored at zero, five, ten, and fifteen days. The following reagents
obtained from Sigma-Aldrich, (Saint Louis, MO, USA) were added per well, in the following
order: 30 µL of a 2% H2 O2 solution (CAS 7722-84-1), 20 µL of 2 mM EDTA (CAS 13235-
36-4), and 20 µL of 3 mM Fe2 SO4 ·7H2 O (CAS 7782-63-0), resulting, respectively, in the
final concentrations in the wells of 0.0026 mM, 0.2 mM, and 0.3 mM. After that, the plates
were incubated at room temperature for 25 min for the conversion of terephthalic acid into
HOTP, then the fluorescence was revealed [30].
The fluorescence was observed at wavelengths λex = 328 nm (excitation) and
λem = 421 nm (emission) using a TM 2300 EnSpire® multimode plate reader (PerkinElmer,
 the final concentrations in the wells of 0.0026 mM, 0.2 mM, and 0.3 mM. After that, the
plates were incubated at room temperature for 25 min for the conversion of terephthalic
Polymers 2023, 15, 1581 acid into HOTP, then the fluorescence was revealed [30]. 4 of 24
The fluorescence was observed at wavelengths λex = 328 nm (excitation) and λem =
421 nm (emission) using a TM 2300 EnSpire® multimode plate reader (PerkinElmer,
Waltham, MA, USA). The conversion calculations from PTA into HOTP were performed,
Waltham, MA, USA). The conversion calculations from PTA into HOTP were performed,
as mentioned by Chaves et al. [30] and Malafatti-Picca et al. [18].
as mentioned by Chaves et al. [30] and Malafatti-Picca et al. [18].
Figure 1 represents the PTA modification scheme into HOTP after adding the
Figure 1 represents the PTA modification scheme into HOTP after adding the fluores-
fluorescence developers.
cence developers.

Figure1.1. Conversion
Figure Conversion reaction
reaction of
of terephthalic
terephthalic acid
acid (PTA)
(PTA) into
into 2-hidroxyterephthalate
2-hidroxyterephthalate (HOTP).
(HOTP). Note.
Note.
Reagentsadded:
Reagents added:30 30µL
µL2%
2%HH2 2OO22;; 20
20 µL
µL2mM
2mMEDTA;
EDTA;and
and20 20µL
µLFeFe
2 SO
SO
2 4 ·
4 .7H
7H 22OO 3
3 mM.
mM. Adaptedfrom
Adapted from
Chaves et al. [30].
Chaves et al. [30].

2.1.2.
2.1.2. Assays
Assaysto to Detect
DetectCutinase
CutinaseProduction
Production
Plate Tests with Cutin and Polycaprolactone (PCL) as the Sole Carbon Sources
Plate Tests with Cutin and Polycaprolactone (PCL) as the Sole Carbon Sources
Agar
Agarblocks
blocks(3.0
(3.0mm
mmofofdiameter)
diameter)containing
containingfungal mycelium
fungal mycelium grown
grownforfor
seven days
seven in
days
PDA at 28 ◦ C were transferred to the center of two different Petri dishes (90 mm × 15 mm)
in PDA at 28 °C were transferred to the center of two different Petri dishes (90 mm × 15
with
mm)two with configurations: (i) minimal
two configurations: mineral medium
(i) minimal mineral supplemented with cutin with
medium supplemented (extracted
cutin
from Fuji apple peel, according to the methodology proposed by Macedo
(extracted from Fuji apple peel, according to the methodology proposed by Macedo and Pio [32]); and
and
(ii)
Piominimal
[32]); andmineral medium
(ii) minimal supplemented
mineral mediumwith polycaprolactone
supplemented with (Sigma Aldrich®(Sigma
polycaprolactone , Saint
Louis, MO, USA—average g·mol −1 The formulations of the culture
Aldrich ®, Saint Louis, MO, molarUSA -mass 10,000
average molar mass).10,000 g.mol−1). The formulations
media were the following:
of the culture media were the following:
1. Cutin: 3.0 g NaNO (CAS 7631-99-4); 1.0 g K HPO (CAS 7758-11-4); 0.5 g KCl (CAS
1. Cutin: 3.0 g NaNO33 (CAS 7631-99-4); 1.0 g K22HPO44 (CAS 7758-11-4); 0.5 g KCl (CAS
7447-40-7); 0.01 g FeSO4 ·7H2 O (CAS 7782-63-0); 0.2% cutin; 17 g agar (CAS 9002-18-0);
7447-40-7); 0.01 g FeSO4.7H2O (CAS 7782-63-0); 0.2% cutin; 17 g agar (CAS 9002-18-
and 1000 mL distilled water [33,34].
0); and 1000 mL distilled water [33,34].
2. Polycaprolactone: 4 g (NH )2 SO4 (CAS 7783-20-2); 6 g KH2 PO4 (CAS 7778-77-0);
2. Polycaprolactone: 4 g (NH4)42SO 4 (CAS 7783-20-2); 6 g KH2PO4 (CAS 7778-77-0); 0.2 g
0.2 g Na2 HPO4 (CAS 7558-79-4); 1 mg FeSO4 ·7H2 O (CAS 7782-63-0); 1 mg CaCl2
Na2HPO4 (CAS 7558-79-4); 1 mg FeSO4.7H2O (CAS 7782-63-0); 1 mg CaCl2 (CAS
(CAS 10043-52-4); 10 µg H3 BO3 (CAS 10043-35-3); 10 µg MnSO4 (CAS 10034-96-5);
10043-52-4); 10 µg H3BO3 (CAS 10043-35-3); 10 µg MnSO4 (CAS 10034-96-5); 70 µg
70 µg ZnSO4 (CAS 7446-20-0); 50 µg CuSO4 (CAS 7758-98-7); 10 µg MoO3 (CAS
ZnSO4 (CAS 7446-20-0); 50 µg CuSO4 (CAS 7758-98-7); 10 µg MoO3 (CAS 1313-27-5);
1313-27-5); 500 mg PCL (acetone:water); and 1 L distilled water [35].
500 mg PCL (acetone:water); and 1 L distilled water [35].
The reagents used in the above formulations were obtained from Sigma Aldrich and
The reagents used in the above formulations were obtained from Sigma Aldrich and
Merck (Darmstadt, Germany).
MerckThe(Darmstadt,
results wereGermany).
scored as the diameter of the colonies in centimeters in both culture
media, Thein results
additionwere scored
to the as the diameter
formation of the zone
of a whitening colonies in centimeters
at the center of theincolony
both culture
in the
media, in addition
medium with PCL. to the formation of a whitening zone at the center of the colony in the
medium with PCL.
2.2. PET Depolymerization Assays
2.2. PET Depolymerizationtests
The biodegradation Assays
were carried out by fermentation in a liquid medium with
The biodegradation
polymeric tests
films of different were carried
brands: PET1 wasoutaby fermentation
fragment in amL
of a 500 liquid ® mineral
medium
Crystal with
polymeric films of different brands: PET1 was a ®
fragment of a 500 mL Crystal
water bottle, and PET2 was a fragment of a 2 L Sprite diet soda bottle. The bottles were ® mineral

water bottle,
purchased fromand PET2
local wasand,
stores, a fragment of a 2 Lthe
after removing Sprite ® diet soda bottle. The bottles were
bottlenecks, caps, and labels, fragments
purchased
of from 4.5
approximately local
cm stores,
× 2.5 cm and,
(500after removing
mg) were the sterile
cut using bottlenecks,
scissorscaps, and labels,
and transferred
to Petri dishes (adapted from Sharon and Sharon [36]; Malafatti-Picca et al. [18]). The
thicknesses of the PET films were measured using a RoHS® digital micrometer (Newton,
NJ, USA), and thermal analyses of differential scanning calorimetry (DSC) were performed
to determine the melting temperature and crystallinity percentage of the PET samples
(Table 2). The differential scanning calorimetry (DSC) analyses to obtain the thermograms
were performed using the Netzsch DSC 200 PC equipment (Waldkraiburg, Germany) with
Polymers 2023, 15, 1581 5 of 24

PET1 and PET2 polymers. Then, they were studied in the temperature range from 30 ◦ C to
350 ◦ C with a heating ramp of 10 ◦ C·min−1 under a nitrogen flow (N2 ) of 50 mL·min−1 [37].

Table 2. Physical characteristics obtained using DSC analysis for the PET1 and PET2 samples.

Sample Thickness (mm) Tm (◦ C) ∆Hm (J·g−1 ) X (%)

PET1 0.10 ± 0.01 251.12 49.66 35.47
PET2 0.21 ± 0.01 253.41 14.57 10.41
Tm ◦ C = melting temperature; ∆Hm (J·g−1 ) = melting enthalpy; X (%) = crystallinity percentage. Reference: PET
100% Crystalline ∆Hm = 140 J·g−1 [38].

Figure S1 of the supplementary material contains the thermograms of the samples.

Equation S1 of the supplementary material presents the data to obtain the crystallinity
in percentage (%).
The fragments were weighed on an analytical balance (e = 0.001 g), washed with tap
water and common neutral detergent, and rinsed with sterile distilled water. Afterward,
they were immersed in 2% sodium hypochlorite for 1 h, rinsed again with sterile distilled
water, and kept for 30 min under ultraviolet light inside the biological safety cabinet
(492 watts of power at a 50 cm distance of PET fragments). The fragments were left in the
drying oven at 40 ◦ C until complete evaporation of the water.
The fungal strains were grown to produce fermented broth for the lipase and es-
terase activity. The fungal strains were grown for seven days at 28 ◦ C in a BOD chamber
(Biothec, Piracicaba, São Paulo, Brazil) and subcultured in test tubes containing PDA
(20 g·L−1 glucose) with approximately 100 mg of 0.5 cm × 0.5 cm PET1 bottle fragments.
A suspension of 106 spores per mL or, in the case of non-sporulating fungi, part of the
mycelial mass was aseptically transferred to 125 mL Erlenmeyer flasks containing 40 mL of
liquid medium (Table 3) plus approximately 500 mg of previously cleaned PET fragments
(as reported above).

Table 3. Culture media used in the PET depolymerization test.

Liquid Culture Media * Components and Amounts in g·L−1

KH2 PO4 1.0
KNO3 1.0
MgSO4 0.5
Minimal mineral KCl 0.5
media (MM1) Yeast extract 0.2
Sucrose 0.2
Glucose 0.2
Distilled water 1L
KH2 PO4 1.0
KNO3 1.0
Minimal mineral medium MgSO4 0.5
supplemented with palm KCl 0.5
oil (MM2) Yeast extract 0.2
Palm oil 0.4
Distilled water 1L
Glucose (Dextrose) 20
Sigma-Aldrich® Potato Potato infusion 4.0
dextrose broth (PDB) Distilled water 1L
* Culture media was based on published material elsewhere [39].

The flasks were incubated at 28 ◦ C and shaken at 150 rpm for fifteen or forty days.
The content was transferred to sterile Falcon tubes (50 mL) and centrifuged at 4472× g and
8 ◦ C. Then, the suspensions were filtered through a 0.45 µm cellulose membrane to separate
the PET fragments from the mycelium present in the fermented liquid. Each assay was per-
formed in triplicate with an abiotic control (only media and PET fragments, without fungi).
Polymers 2023, 15, 1581 6 of 24

The post-fermentation PET fragments were subjected to a new disinfection process, as

previously mentioned, until no mycelium could be seen (in the binocular stereomicroscope).
Later, they were dried at 40 ◦ C in a conventional drying oven until constant weight. The
mass variation of the fragments was calculated based on Equation (2), where BF and AF
represent the fragments before and after fermentation, respectively.

PET Mass BF − PET Mass AF

 
Mass variation(mg) = (1)
PET Mass BF

mass PET AF − mass PET PF

 
Mass variation (%) = × 100 (2)
mass PET AF

2.3. Analysis of Post-Fermentation PET Fragments

2.3.1. Attenuated total reflectance/Fourier transform infrared spectroscopy (FTIR/ATR)
The PET1 and PET2 samples were characterized using infrared spectroscopy with a
IRPrestige-21 spectrometer (Shimadzu, Chiyoda-ku, Tokyo, Japan) within the range from
4000 cm−1 to 400 cm−1 with 32 accumulations and a resolution of 2 cm−1 .

2.3.2. Scanning Electron Microscopy (SEM)

The PET fragments were covered with gold using a Sputter Coater SCD 050 (Bal-Tec,
Balzers, Liechtenstein) apparatus at 25 milliamps for 40 s under a pressure of 80 Pa. The
images were obtained using a TM 3000 Tabletop Microscope (Hitachi, Tokyo, Japan) with a
voltage acceleration of 15 k (analytical mode from 1 Kv to 30 Kv) (adapted from Sepperumal,
Markandan, Paljara [40]).

2.3.3. Analysis of the Post-Fermentation Broth

Total Proteins
The total protein content of the fermented broth was determined using the Bradford
method [41], and the concentrations were obtained through a standard curve of Bovine
Serum Albumin solution, BSA-Sigma Aldrich (Saint Louis, MO, USA) with a linear range
between 3.33 µg·mL−1 and 33.33 µg·mL−1 (R2 = 0.994, 6 calibrators, n = 3). The absorbance
readings were performed on a spectrophotometer at a wavelength of 595 nm, corresponding
to the anionic form of Coomassie Brilliant Blue G-250 (Bio-Rad, Mississauga, Ontario, CA,
USA) when associated with proteins.

2.4. Enzymatic Activities

Lipase: The lipolytic activity was determined by the titration of fatty acids released by
the hydrolysis of palm oil analytical grade, 76% (Supelco® , Bellefonte, PA, USA) [42]. Then,
1 g of the oil (lipid substrate), 4 mL of sterilized distilled water, and from 5 to 10 glass beads
were transferred to an Erlenmeyer flask (125 mL) to then receive 1 mL of the mycelium-free
fermented broth.
The flasks were incubated at 50 ◦ C and shaken at 150 rpm for 30 min, and the reaction
stopped by adding 10 mL of a solution of acetone:ethanol (1:1). The released fatty acids
were quantified using titration with a standardized NaOH solution (0.05 mol·L−1 ) and by
adding three drops of phenolphthalein (0.1% in absolute ethanol) as an indicator. A blank
was prepared with 1 mL of distilled water. These assays were processed in triplicate and
the enzyme activity was expressed in units of lipolytic activity (LA) corresponding to the
number of enzymes capable of providing a micromol of fatty acids per min of reaction.
Esterase: The esterase activity was estimated using the enzymatic hydrolysis of a
1.5 mmol·L−1 (alpha) α-naphthyl acetate solution (in a 300 mmol·L−1 phosphate buffer
containing isopropyl alcohol). The aim was the quantification of α-naphthol, revealed by
the formation of a diazo-complex after adding Fast Blue RR (0.1 mg·mL−1 in dimethyl
sulfoxide and ethanol, in a relation of 1:2) (Sigma-Aldrich, Saint Louis, MO, United States)
(Figure 2). The quantification was determined against an α-naphthol calibration curve
 number of enzymes capable of providing a micromol of fatty acids per min of reaction.
Esterase: The esterase activity was estimated using the enzymatic hydrolysis of a 1.5
mmol.L−1 (alpha) α-naphthyl acetate solution (in a 300 mmol.L−1 phosphate buffer
containing isopropyl alcohol). The aim was the quantification of α-naphthol, revealed by
Polymers 2023, 15, 1581 the formation of a diazo-complex after adding Fast Blue RR (0.1 mg.mL−1 in dimethyl 7 of 24
sulfoxide and ethanol, in a relation of 1:2) (Sigma-Aldrich, Saint Louis, MO, United States)
(Figure 2). The quantification was determined against an α-naphthol calibration curve at
concentrations
at concentrations from
from1010µmol.
µmolL·L−1toto100
−1
100µmol.
µmol·LL−1(5(5calibrators,
−1
calibrators, nn == 3,
3, R
R2 == 0.999).
2
0.999).
Spectrophotometric readings
Spectrophotometric readings were
were performed
performed using
using the
the 490
490 nmnm wavelength
wavelength [43].
[43]. The
The
samples were analyzed using test tubes, and 100 µL of the fermented broth
samples were analyzed using test tubes, and 100 µL of the fermented broth was added to was added to
2 mL of α-naphthyl acetate, then incubated in a water bath at 37 °C
◦ for 1
2 mL of α-naphthyl acetate, then incubated in a water bath at 37 C for 1 h. The reaction h. The reaction
was interrupted
was interrupted by by adding
adding 1.0
1.0 mL
mL of of sodium
sodium dodecyl
dodecyl sulfate
sulfate (10%
(10% in
in sterile
sterile water,
water, pH
pH
corrected to
corrected to 7.0);
7.0); 1.0
1.0 mL
mL of
of Fast
Fast Blue
Blue RRRR was
was added
added to
to reveal
reveal the
the α-naphthol
α-naphthol formed,
formed, and
and
the absorbances
the absorbances werewere determined
determined against
against aa blank
blank containing
containing 100 100 µL
µLof
ofsterile
sterilewater.
water.

Figure 2.
Figure 2. Diazo
Diazo complex
complex formation
formation by
by esterase
esterase action
action on
onalpha-naphthyl
alpha-naphthyl acetate.
acetate. Source:
Source: adapted
adapted
from He [43].
from He [43].

2.5.
2.5. Terephthalic
Terephthalic Acid (PTA) and
acid (PTA) and Oligomers
Oligomers (BHET
(BHET and and MHET)
MHET) Using HPLC-UV
using HPLC-UV
The PTA,
PTA, BHET,
BHET, andand MHET
MHET released
released in
in the
the fermented
fermented broth
broth were
were obtained
obtained using
using
liquid–liquid
liquid‒liquid extraction
extraction (adapted
(adapted from
fromKim
Kimand
andLee Lee[44])
[44]) (Figure
(Figure 3). The chromatographic
3). The chromatographic
separations
separationswerewereperformed
performed on on
a Shimadzu equipped
a Shimadzu with an
equipped octadecylsilane
with (C18) column
an octadecylsilane (C18)
Shim-pack VP-ODS (4.6 mm × 250 mm, 5 µm) coupled to a pre-column
column Shim-pack VP-ODS (4.6 mm × 250 mm, 5 µm) coupled to a pre-column of the of the same
material (Shimadzu,
same material Santa Clara,
(Shimadzu, CA, USA),
Santa Clara, with a manual
California, USA), withinjector and using
a manual the and
injector following
using
mobile phases: Solvent A: 0.5% (v/v) formic acid:acetonitrile, HPLC grade
the following mobile phases: Solvent A: 0.5% (v/v) formic acid:acetonitrile, HPLC grade 90:10, and
Solvent B: 0.5% (v/v) formic acid:acetonitrile, HPLC grade 60:40. These mobile phases were
followed by an elution gradient, according to Table S1 (supplementary material), in a flow of
0.5 mL·min−1 . The analytes were detected at a wavelength of 254 nm. Benzoic acid
(retention time = 23.4 min) was used as an internal standard. The method was the following:
linearity from 0.15 ppm to 300.0 ppm for PTA, BHET, and MHET, with a correlation
coefficient of 0.999 for the three analytes (6 calibration solutions n = 3); precision determined
by the relative standard deviation (variation coefficient) between 1.1% and 31.1%. The
latter was the lowest concentration of the curve. The chromatogram in Figure 4 shows the
separation efficiency of the methodology used.

2.6. Fungal Identification

The genomic fungal DNA was extracted following the modified method by
Aamir et al. [45] using phenol, chloroform, and isopropyl alcohol. The regions trans-
lation elongation factor-1α (tef1) (for Trichoderma spp.) and ITS (for other genera) were
amplified. The primers and amplification programs are shown in Table 4.
 nm. Benzoic acid (retention time = 23.4 min) was used as an internal standard. The method
was the following: linearity from 0.15 ppm to 300.0 ppm for PTA, BHET, and MHET, with
a correlation coefficient of 0.999 for the three analytes (6 calibration solutions n = 3);
precision determined by the relative standard deviation (variation coefficient) between
1.1% and 31.1%. The latter was the lowest concentration of the curve. The chromatogram
Polymers 2023, 15, 1581 8 of 24
in Figure 4 shows the separation efficiency of the methodology used.

Polymers 2023, 15, x FOR PEER REVIEW 9 of 25

Figure
Figure 3. Flowchart
3. Flowchart of theofliquid‒liquid
the liquid–liquid extraction
extraction forBHET,
for PTA, PTA, BHET, and MHET
and MHET purification
purification and pre-and
pre-concentration
concentration from
from the the fermented
fermented broth (adapted
broth (adapted fromLee
from Kim, Kim, Lee [44]).
[44]).

Figure 4. Chromatogram of terephthalic acid (PTA), bis(2-hydroxyethyl) terephthalate (BHET),

Figure
benzoic acid4.(BA),
Chromatogram of terephthalic
and 2-hydroxyethyl acid (PTA), bis(2-hydroxyethyl)
methyl terephthalate terephthalate
(MHET) analytes (standard (BHET),
solutions
benzoic
240 ppm, acid (BA),
injection and=2-hydroxyethyl
volume 3 µL). methyl terephthalate (MHET) analytes (standard solutions
240 ppm, injection volume = 3 µL).
The polymerase chain reactions (PCRs) for the ITS region were performed with a final
2.6. Fungal
volume containing 0.2 µL of dNTPs (25 mmol·L−1 , Invitrogen, Waltham, MA
Identification
of 25 µL
USA), 2.5The of Taq buffer (10x-Invitrogen), 1.5 µL of MgClthe −1 , Invitrogen),
mmol·Lmethod
µL genomic fungal DNA was extracted following 2 (50
modified by Aamir et
0.5 µL
al. of[45]
each primer
using (20 mmol
phenol, ·L−1 , Invitrogen),
chloroform, 0.2 µL of
and isopropyl Taq polymerase
alcohol. The regions µL−1 ),
(5 U·translation
3.45 elongation
µL of dilutedfactor-1α
genomic (tef1)
DNA (15 − 1
·µL ), and 16.15
(forngTrichoderma spp.)µL of sterile
and ultrapure
ITS (for other water. Thewere
genera)
reagent concentrations in the final solution were the following: 0.2 mmol · L −1 , 3 mmol·L−1 ,
amplified. The primers and amplification programs are shown in Table 4.

Table 4. Primers and amplification conditions.

Region Primer Sequence (5′–3′) Amplification Program Reference

ITS1 TCCGTAGGTGAACCTG Initial denaturation at 94 °C for 2 min, 30
Polymers 2023, 15, 1581 9 of 24

0.4 mmol·L−1 , 0.04 U·µL−1 , and 2.07 ng·µL−1 for dNTPs, primer, MgCl2 , Taq polymerase,
and genomic DNA, respectively.

Table 4. Primers and amplification conditions.

Region Primer Sequence (50 –30 ) Amplification Program References

Initial denaturation at 94 ◦ C for 2 min,
ITS1 (forward) TCCGTAGGTGAACCTGCGG 30 denaturation cycles at 94 ◦ C for 1 min, [46]
ITS annealing at 55 ◦ C for 1 min, extension at
ITS4 (reverse) TCCTCCGCTTATTGATATGC 72 ◦ C for 3 min, and final extension step at
72 ◦ C for 3 min and 4 ◦ C.
Initial denaturation at 94 ◦ C for 2 min,
EF1-728F (forward) CATCGAGAAGTTCGAGAAGG 15 denaturation cycles at 94 ◦ C for 30 s, [47]
annealing at 65 ◦ C for 30 s, extension at
Elongation factor 1α (tef1)
72 ◦ C for 1 min, followed by 35 cycles at
TEF1R (reverse) GCCATCCTTGGAGATACCAGC 94 ◦ C for 30 s, 48 ◦ C for 30 s, and final
extension step at 72 ◦ C for 1 min.

The PCR reactions for the Tef region had the same final volume with 0.2 µL of
dNTPs (25 mmol·L−1 , Invitrogen) plus 2.5 µL of Taq buffer (10x-invitrogen), 1.5 µL of
MgCl2 (50 mmol·L−1 , Invitrogen), 1.0 µL of each primer (10 mmol·L−1 ), Bovine Serum
Albumin—BSA (1 mg·mL−1 , Promega), 0.2 µL of Taq polymerase (5 U µL−1 , Invitrogen),
3.45 µL of diluted genomic DNA (15 ng.µL−1 ), and 14.15 µL of sterile ultrapure water.
The amplicons were purified using the Illustra GFX™ PCR DNA and Gel Band Purifi-
cation Kit (GE Healthcare, Buckinghamshire, UK) and subjected to the sequencing reaction
using the same primers with the following program: 95 ◦ C for 1 min followed by 28 cycles
at 95 ◦ C for 15 s, 50 ◦ C for 45 s, and 60 ◦ C. After the reaction, all the samples were removed
for further purification and sequenced with the BigDye Terminator (Life Technologies,
Waltham, MA USA) in an ABI3500XL series sequencer (Applied Biosystems, Waltham, MA
USA) according to the manufacturer instructions.
The BioEdit Sequence Alignment Editor v.7.0.5.3 [48] was used to generate the con-
sensus sequence, which was compared with sequences from organisms represented in the
GenBank nucleotide database (National Center for Biotechnology Information (nih.gov)
(accessed on 10 February 2023) and CBS database (Westerdijk Institute (knaw.nl)) (accessed
on 10 February 2023). The sequences of organisms related to the unknown fungi were
selected and used for further genetic distance analysis. After the alignment using the
CLUSTAL X software [49], a phylogenetic tree based on genetic distance was generated
using MEGA software version 4.0 [50] with the neighbor-joining method [51] and bootstrap
values calculated from 1000 replicates. The sequences of the genetic material of the fungi
highlighted in this work were deposited in the GenBank receiving the following accession
numbers: Curvularia trifolii CBMAI 2111 (OL804101); Trichoderma atroviride CBMAI 2073
(OM275355); and Cladosporium cladosporioides CBMAI 2075 (OL814981) and Trichoderma sp.
CBMAI 2071 (OM275356).

2.7. Statistical Analyses

The data assumed a non-parametric distribution and were analyzed using the Kruskal–
Wallis test, followed by mean comparison studies with the Student–Newman–Keuls test.
The analyses were performed using the Bioestat 5.3® software (Belém, PA, Brazil), consider-
ing a 95% confidence interval, p ≤ 0.05.

3. Results
3.1. Enzymatic Assays with PET Nanoparticles
From a total of 100 fungal isolates, 26 produced extracellular enzymes with the po-
tential to convert the polymer nanoparticles into terephthalic acid. Of these, five strains
exhibited conversion percentages of 2% or higher (Table 5). Table 5 shows the lineages (in
bold) that are part of this study. The selected strains presented good results in the tests
with PET nanoparticles, with a considerable mycelial aggregation to the PET polymer of
bottles during the biodegradation tests.
Polymers 2023, 15, 1581 10 of 24

Table 5. PET nanoparticle conversion (%), results after fifteen days of incubation.

npPET Conversion npPET Conversion

Code Identification Code Identification
(%) * (%) *
Paraconiothyrium
CBMAI 2111 Curvularia trifolii 9.0 ± 1.1 CBMAI 2203 0.6 ± 0.3
cyclothyrioides
CBMAI 2073 Trichoderma atroviride 6.1 ± 0.2 LMA 216 Phoma herbarum 0.6 ± 0.6
CBMAI 2071 Trichoderma sp. 3.6 ± 0.8 LMA 28 Aspergillus fumigatus 0.5 ± 0.0
Microsphaeropsis
CBMAI 2110 2.7 ± 0.9 LMA 1825 Fusarium sp. 0.4 ± 0.0
arundinis
Microsphaeropsis
CBMAI 2109 2.0 ± 0.4 LMA 1172 Fusarium sp. 0.4 ± 0.0
arundinis
LMA 1269 Fusarium sp. 1.9 ± 0.5 CBMAI 2190 Aspergillus fumigatus 0.4 ± 0.2
Pseudallescheria sp.
CBMAI 2159 (Complexo Pseu- 1.9 ± 1.0 CBMAI 2186 Talaromyces veerkampii 0.3 ± 0.2
dallescheria/Scedosporium)
Paraconiothyrium
CBMAI 2083 Paecylomyces sp. 1.7 ± 0.7 CBMAI 2187 0.3 ± 0.3
cyclothyrioides
CBMAI 2189 Aspergillus fumigatus 0.8 ± 0.6 CBMAI 2149 Trichoderma capillare 0.3 ± 0.0
Cladosporium Microsphaeropsis
CBMAI 2075 0.8 ± 0.6 CBMAI 2155 0.3 ± 0.2
cladosporioides arundinis
LMA1251 Trichoderma sp. 0.7 ± 0.4 LMA 167 Penicillium sp. 0.3 ± 0.1
Paraconiothyrium
CBMAI 2158 0.7 ± 0.1 LMA 11 Paecilomyces-like 0.2 ± 0.0
cyclothyrioides
CBMAI 2191 Penicillium koreense 0.7 ± 0.1 LMA 1145 Fusarium sp. 0.1 ± 0.0
* Conversion results from NPPET into HOTP expressed as mean percentage ± standard deviation (n = 3).

3.2. Cutinase Production

Figure 5 shows the growth of isolates capable of assimilating cutin or polycaprolactone
as the sole carbon sources. Curvularia trifolii CBMAI 2111 (A) and Cladosporium cladosporioides
CBMAI 2075 (D) exhibited colonies with 1.5 cm and 1.8 cm diameters in the presence
of cutin and 3.5 cm and 4.5 cm for the medium with PCL, respectively. In addition, the
decolorization zones were observed in the culture plate with PCL, indicating polymer
degradation (see white arrows). Figure S2 of the supplementary material shows overlays
of FTIR images of the cutin and PCL.

3.3. PET Depolymerization Assays

Due to the growth in cutin and polycaprolactone media and with npPET studies,
the strains T. atroviride CBMAI 2073 and C. cladosporioides CBMAI 2075 were chosen for
further tests with culture media containing different rates of glucose and palm oil as the
sole carbon source. After 40 days of fermentation, a tendency for a mass gain of the PET1
fragments was observed, while the PET2 fragments lost mass in the three tested culture
media (Figure 6). MM1 and PDB showed a greater reduction in the mass of the PET2
polymers for both isolates studied, showing a variation between 1.2 mg and 2.2 mg.
The enzymatic activities were evaluated in the fermented broth (Table 6). T. atroviride
(CBMAI 2073) grown in MM2 showed higher esterase and lipolytic activity on PET1 and
PET2 fragments, respectively. C. cladosporioides CBMAI 2075 had more evident esterase
activity in MM1 and PDB (on PET1), while a higher lipase value was found in MM2 (on
PET2). The activity determined showed high standard deviation, which could be attributed
to the variability in the microorganism growth and enzyme production. Both strains were
able to depolymerize PET in by-products such as terephthalic acid, bis(2-hydroxyethyl)
terephthalate, and 2-hydroxyethyl methyl terephthalate (Figure 7).
 Figure 5 shows the growth of isolates capable of assimilating cutin or
polycaprolactone as the sole carbon sources. Curvularia trifolii CBMAI 2111 (A) and
Cladosporium cladosporioides CBMAI 2075 (D) exhibited colonies with 1.5 cm and 1.8 cm
diameters in the presence of cutin and 3.5 cm and 4.5 cm for the medium with PCL,
respectively. In addition, the decolorization zones were observed in the culture plate with
Polymers 2023, 15, 1581 11 of 24
PCL, indicating polymer degradation (see white arrows). Figure S2 of the supplementary
material shows overlays of FTIR images of the cutin and PCL.

(A) (B)

(C) (D)
Polymers 2023, 15, x FOR PEER REVIEW 12 of 25

as the sole carbon sources. White arrows indicate the consumption of polycaprolactone and cutin
polymer by fungi, in addition to microbial growth.

3.3. PET Depolymerization Assays

Due to the growth in cutin and polycaprolactone media and with npPET studies, the
strains T. atroviride CBMAI 2073 and C. cladosporioides CBMAI 2075 were chosen for further
Figure
Figure 5.
5. Qualitative
tests with Qualitative assay
assay
culture media for probing
for
containing cutinase
probing production
cutinase
different ofusing
production
rates promising
using
glucose strains.
promising
and palm Note.
strains.
oil (A).
as the C.
Note.
sole
trifolii
(A). CBMAI
C. trifolii 2111;
CBMAI (B). T. atroviride
2111;40(B). CBMAI
T. atroviride 2073; (C).
CBMAI 2073;a (C).T. sp. CBMAI
T. sp. CBMAI 2071; (D). C. cladosporioides
C. cladosporioides
carbon source. After days of fermentation, tendency for a 2071;
mass(D).
gain of the PET1
CBMAI 2075. Plates with minimal mineral media containing cutin (left) and polycaprolactone (right)
CBMAI 2075. Plates with minimal mineral media containing cutin (left)
fragments was observed, while the PET2 fragments lost mass in the three tested cultureand polycaprolactone (right)
as the sole carbon sources. White arrows indicate the consumption
media (Figure 6). MM1 and PDB showed a greater reduction in the mass of the PET2 of polycaprolactone and cutin
polymer
polymers by for
fungi, in addition
both isolates to microbial
studied, growth.a variation between 1.2 mg and 2.2 mg.
showing

Figure6.6. Mass
Figure Mass variation
variation ofofthe
thePET
PETfragments
fragmentsafter
afterfermentation.
fermentation. C.
C.cladosporioides
cladosporioides CBMAI
CBMAI 2075
2075
(light gray) and T. atroviride CBMAI 2073 (dark gray). Data below the x-axis (negative values)
(light gray) and T. atroviride CBMAI 2073 (dark gray). Data below the x-axis (negative values) indicate
indicate mass gain at the end of the process.
mass gain at the end of the process.

Table The enzymatic

6. Lipase activities
and esterase wereinevaluated
activities in the
the fermented fermented broth (Table 6). T. atroviride
broth.
(CBMAI 2073) grown in MM2 showed higher esterase and lipolytic activity on PET1 and
T. atroviride PET2 fragments, PET 1 respectively. C. cladosporioides CBMAI 2075 PET had2 more evident esterase
CBMAI 2073 MM1 MM2 PDB MM1 MM2 PDB
activity in MM1 and PDB (on PET1), while a higher lipase value was found in MM2 (on
Lipase (UA) 0.69 ± 0.0 0.64 ± 0.2 0.47 ± 0.1 0.58 ± 0.1 0.87 ± 0.3 0.18 ± 0.3
Esterase (µmol α-naftol PET2). The activity determined showed high standard deviation, which could be
535.6 ± 310.8 1968.2 ± 772.8 761.03.0 ± 384.9 1635.8 ± 681.0 631.7 ± 230.2 860.5 ± 341.5
per µg of protein) attributed to the variability in the microorganism growth and enzyme production. Both
C. cladosporioides
MM1strains were MM2 able to depolymerize PDB PET in by-products
MM1 such asMM2 terephthalic acid, PDB bis(2-
CBMAI 2075
hydroxyethyl) terephthalate, and 2-hydroxyethyl methyl terephthalate (Figure 7).
Lipase (UA) 0.97 ± 0.4 0.64 ± 0.3 0.83 ± 0.0 0.69 ± 0.2 1.47 ± 0.4 0.87 ± 0.0
Esterase (µmol α-naftol
1239.78 ± 727.3
The statistical
1.91 ± 1.49
analyses suggested that in
1034.1 ± 437.28
the PDB medium,
392.3 ± 278.4
CBMAI 2073 139.1
30.35 ± 28.83
had ±a 75.9
greater
per µg of protein)
release of the PTA monomer on both PET types (p < 0.05). It was also observed that BHET
(Results expressed inas amean ± standard deviation, n =(p
3).<Fermentation ◦ C at 150 rpm.
was available greater amount in PDB 0.05) usingtime = 40 unlike
PET1, days, 28the result for
PET1 = PET water bottle fragments (Crystal® ); PET2 = PET soft drink bottle fragments (Sprite® ); MM1 = mineral
MHET,supplemented
medium which did not withshow
glucoseany
andsignificant
sucrose; MM2difference regarding
= mineral medium the treatment
supplemented applied
with palm to
oil; and
® ).
both= Potato
PDB types dextrose
of polymers (p > 0.05).
broth (Sigma
Figure 8 presents the infrared spectra for PET1 and PET2. In general, CBMAI 2073
and CBMAI 2075 revealed a greater number of molecular changes for PET2, as seen in
Table 7. The disappearance of bands was observed in the PET, suggesting a modification
of the chemical structure. The disappearance of bands was noted at the region of 983 cm−1,
962 cm−1, and 835 cm−1, which could be related to the aromatic ring. The bands at the region
 500–400 Disappearance of bands at 499 cm , 437 cm , and 428 cm Disappearance of band at 437 cm

Fewer modifications were observed with PET1 (Table 7). The fermentation of CBMAI
2073 showed an increase in band intensity at 1579 cm−1 and 1573 cm−1, band displacement
from 630 cm−1 to 632 cm−1, band appearance at 613 cm−1, and band disappearance at 656
Polymers 2023, 15, 1581 cm−1. The only change with CBMAI 2075 was the increase in the band intensity at 1579 12 of 24
cm−1 and 1573 cm−1.

Polymers 2023, 15, x FOR PEER REVIEW 14 of 25

Figure 7.Figure 7. PTA,

PTA, BHET, BHET,
and MHET andconcentrations
MHET concentrations
released released
from PET1 from
andPET1
PET2and PET2
with with
three three different
different
culture media
culture(time = (time
media 40 days).
= 40 (a) Trichoderma
days). sp CBMAI
(a) Trichoderma 2073;2073;
sp. CBMAI and (b)
andCladosporium sp CBMAI
(b) Cladosporium sp. CBMAI 2075.
2075.
The statistical analyses suggested that in the PDB medium, CBMAI 2073 had a greater
release of the PTA monomer on both PET types (p < 0.05). It was also observed that BHET
was available in a greater amount in PDB (p < 0.05) using PET1, unlike the result for MHET,
which did not show any significant difference regarding the treatment applied to both
types of polymers (p > 0.05).
Figure 8 presents the infrared spectra for PET1 and PET2. In general, CBMAI 2073
and CBMAI 2075 revealed a greater number of molecular changes for PET2, as seen in
Table 7. The disappearance of bands was observed in the PET, suggesting a modification of
the chemical structure. The disappearance of bands was noted at the region of 983 cm−1 ,
962 cm−1 , and 835 cm−1 , which could be related to the aromatic ring. The bands at
the region of 1481 and 1427 cm−1 could be related to stretching of the C-O group, and
deformation of the O-H group. The vibration of the aromatic skeleton (C=C) could be
attributed to the band at 1579 cm−1 .
Fewer modifications were observed with PET1 (Table 7). The fermentation of CBMAI
2073 showed an increase in band intensity at 1579 cm−1 and 1573 cm−1 , band displacement
from 630 cm−1 to 632 cm−1 , band appearance at 613 cm−1 , and band disappearance at
656 cm−1 . The only change with CBMAI 2075 was the increase in the band intensity at
1579 cm−1 and 1573 cm−1 .
Figure S3A–P in the supplementary material contains the FTIR spectra in the zoomed
view for the best observation of the alterations promoted by the treatments. Based on these
results, PDB was selected for the depolymerization tests with two more strains: Curvularia
trifolii CBMAI 2111 and Trichoderma sp. CBMAI 2071. Both strains were selected because
Polymers 2023, 15, 1581 13 of 24

Figure
they 7. PTA, BHET,
indicated and MHET concentrations
the degradation released
of the polymers PCLfrom
andPET1
cutinand
byPET2
theirwith threerates.
growth different
Thus,
culture media (time = 40 days). (a) Trichoderma sp CBMAI 2073; and (b) Cladosporium sp CBMAI
15-day fermentations were carried out. Figure 9 shows the variation data of the PET masses,
2075.
as well as the concentrations of monomers and oligomers released by the enzymatic action.

Figure 8. FTIR spectra of PET1 and PET2 polymers after 40 days in contact with T. atroviride CBMAI
2073 and C. cladosporioides CBMAI 2075. Note. Culture media PDB, t = 28 ◦ C, shaking at 150 rpm.
The FTIR analysis was performed in duplicate treatments, indicated as A and B in the figure.

Table 7. Chemical modifications to PET2 after fermentation with T. atroviride and C. cladosporioides
using FTIR analysis.

Wavelength in cm−1 T. atroviride CBMAI 2073 C. cladosporioides CBMAI 2075

Increased absorption intensity with the disappearance
3000–2500 No changes
of bands between 2980 cm−1 and 2953 cm−1
2500–2000 No changes No changes
Disappearance of bands at 1764 cm−1 and 1666 cm−1 ,
Increased absorption intensity of the bands
intensity reduction in band at 1579 cm−1 , and
2000–1500 at 1579 cm−1 , 1573 cm−1 , 1510 cm−1 ,
increase in absorption intensity of bands at 1502 cm−1
and 1508 cm−1
and 1500 cm−1
Disappearance of bands at 1481 cm−1 and 1008 cm−1
1500–1000 No changes
Intensity reduction in the band at 1427 cm−1
 Polymers 2023, 15, x FOR PEER REVIEW 15 of 25

Polymers 2023, 15, 1581 14 of 24

Figure 8. FTIR spectra of PET1 and PET2 polymers after 40 days in contact with T. atroviride CBMAI
2073 and C. cladosporioides CBMAI 2075. Note. Culture media PDB, t = 28 °C, shaking at 150 rpm.
The FTIR analysis was performed in duplicate treatments, indicated as A and B in the figure.
Table 7. Cont.
Figure S3 (A‒P) in the supplementary material contains the FTIR spectra in the
Wavelength in cm−1 T. atroviride
zoomed view for the best
CBMAIobservation
2073 of the alterationsC.promoted
cladosporioides
by theCBMAI
treatments.
2075 Based
on these results, PDB was selected for the depolymerization tests with
Intensity reduction twoatmore
in bands strains:
860 cm −1
Disappearance of bands at 983 cm−1 , 962 cm−1 ,
1000–500 Curvularia trifolii −
CBMAI 2111 and Trichoderma sp. and CBMAI 2071.absorption
increased Both strains were of
intensity selected
the
835 cm 1 , and 507 cm−1 −1
because they indicated the degradation of the polymers PCL band at 740
and cmby
cutin their growth
rates. Thus, 15-day
Disappearance fermentations
of bands were
at 499 cm−1 , 437 cmcarried
−1 , out. Figure 9 shows the variation −data of
500–400 − 1 Disappearance of band at 437 cm 1
the PET masses,and as well as
428 cm the concentrations of monomers and oligomers released by the
enzymatic action.

Figure9.9.Mass
Figure Massvariation
variation(mg)
(mg)and
andPTA,
PTA,BHET,
BHET,and
andMHET
MHETconcentrations
concentrationsreleased
releasedininthe
thefermented
fermented
broth of C. trifolii (CBMAI 2111) (color dark grey) and T. sp. (CBMAI 2071) (color light grey).
broth of C. trifolii (CBMAI 2111) (color dark grey) and T. sp. (CBMAI 2071) (color light grey).
Fermentation time = 15 days, t = 28 °C, and 150 rpm. (Data expressed as mean + standard deviation,
Fermentation time = 15 days, t = 28 ◦ C, and 150 rpm. (Data expressed as mean + standard deviation,
n = 3. Values below the x-axis indicate the mass gain of the fragment).
n = 3. Values below the x-axis indicate the mass gain of the fragment).
The data in Table 8 indicate that extracellular hydrolases were produced by the
The data in Table 8 indicate that extracellular hydrolases were produced by the strains
strains studied in the presence of PET fragments.
studied in the presence of PET fragments.
Table 8. Lipase and esterase activities in the fermented broth.
Table 8. Lipase and esterase activities in the fermented broth.
Enzymatic Activities in Fermented Broth Per Strain PET1 PET2
Enzymatic Activities in Fermented Broth Per Strain PET1 PET2
C. trifolii CBMAI 2111
C. trifolii CBMAI 2111 Lipase (UA) 0.31 ± 0.2 0.47 ± 0.1
Lipase (UA) 0.31 ± 0.2 0.47 ± 0.1
Esterase
Esterase (µmol α-naphthol per µg (µmol α-naphthol per0.55
of protein) µg±of0.2
protein) 0.55 ± 0.2 1.04 ± 0.4
1.04 ± 0.4
Trichoderma sp. CBMAI 2071
Trichoderma sp. CBMAI 2071
Lipase (UA) Lipase (UA) 0.6 ± 0.1 0.6 ± 0.1 0.42 ± 0.1
0.42 ± 0.1
Esterase (µmol α-naftol per µg ofEsterase
protein) (µmol α-naftol per µg
0.48of±protein)
0.1 0.48 ± 0.1 2.37 ± 0.5
2.37 ± 0.5
Fermentation
Fermentation timetime
= 15 = 15 28
days, days,
◦ C at28
150°C at culture
rpm; 150 rpm; culture
medium: medium:
Potato dextrosePotato dextrose
broth; results broth;as results
expressed media
±expressed as median±=standard
standard deviation, 3. deviation, n = 3.

Compared
Comparedto tothe
theabiotic
abioticcontrol,
control,the
theinfrared
infraredspectra
spectraofofPET1
PET1and
andPET2
PET2fragments
fragments
(Figure C. trifolii CBMAI 2111 and T.
(Figure 10) treated with C. trifolii CBMAI 2111 and T. sp. CBMAI 2071 showed thechanges
10) treated with sp. CBMAI 2071 showed the changes
highlighted
highlightedin inTable
Table9.9.
Figure S4A–H in the supplementary material contains the FTIR spectra in the zoomed
view
Tablefor
9. the best observation
Polymeric modificationsof onthePET1
alterations
and PET2promoted by the treatments.
after fermentation with T. sp. and C. trifolii
Figure 11 shows
using FTIR analysis. the SEM micrographs for the PET1 and PET2 fragments after fermen-
tation in PDB media, highlighting the effect on the polymers for all treatments.
 2000–1500 increase in band at 1504 increase in band at increase in band at 1502 No changes
cm−1 1504 cm−1 cm−1
Increase in absorption Disappearance of band at
intensity increase in 656 cm−1,
Appearance of a new
1000–500 No changes peaks at 956 cm and 630
−1 absorption intensity
Polymers 2023, 15, 1581 band at 658 cm−1 15 of 24
cm−1, disappearance of reduction in band at 956
band at 656 cm−1 cm−1

Figure 10. FTIR spectra for PET1 and PET2 obtained after 15 days in contact with C. trifolii CBMAI
Figure 10. FTIR spectra for PET1 and PET2 obtained after 15 days in contact with C. trifolii CBMAI
2111 and Trichoderma sp. CBMAI 2071. Culture media PDB, t = 28 °C, ◦150 rpm. The FTIR analysis
2111 and
was Trichoderma
performed sp. CBMAI
in duplicate 2071. indicated
treatments, Culture media PDB,
as A and B in tthe
= 28 C, 150 rpm. The FTIR analysis
figure.
was performed in duplicate treatments, indicated as A and B in the figure.
Figure S4 (A–H) in the supplementary material contains the FTIR spectra in the
zoomed view for
Table 9. Polymeric the best observation
modifications of the
on PET1 and alterations
PET2 promoted by
after fermentation theT.treatments.
with sp. and C. trifolii using
FTIR analysis.

Trichoderma sp. Trichoderma sp.

Wavelength in cm−1 C. trifolii CBMAI 2111 C. trifolii CBMAI 2111
CBMAI 2071 CBMAI 2071
PET 1 PET 2
Disappearance of peaks Disappearance of peaks
at 3645 cm−1 and at 3645 cm−1 and
3626 cm−1 , absorption 3626 cm−1 , absorption Absorption intensity
4000–3000 intensity increase in intensity increase in increase in peak at No changes
peaks at 3341 cm−1 , peaks at 3341 cm−1 , 3646 cm−1
3334 cm−1 , and 3334 cm−1 , and
3226 cm−1 3226 cm−1
Absorption intensity
increase in peaks at Absorption intensity
2974 cm−1 , 2904 cm−1 , increase in peaks at Absorption intensity
3000–2500 2276 cm−1 , 2389 cm−1 , 2974 cm−1 , 2904 cm−1 , No changes reduction in peak at
and 2340 cm−1 , 2276 cm−1 , 2389 cm−1 , 2740 cm−1
appearance of a new and 2340 cm−1
peak at 2540 cm−1
Absorption intensity
increase in peaks at Disappearance of peaks
2500–2000 No changes No changes
2380 cm−1 , 2264 cm−1 , at 2264 cm−1
and 2112 cm−1
Absorption intensity Absorption intensity Absorption intensity
2000–1500 increase in band at increase in band at increase in band at No changes
1504 cm−1 1504 cm−1 1502 cm−1
Increase in absorption
Disappearance of band
intensity increase in
at 656 cm−1 ,
Appearance of a new peaks at 956 cm−1 and
1000–500 No changes absorption intensity
band at 658 cm−1 630 cm−1 ,
reduction in band at
disappearance of band
956 cm−1
at 656 cm−1
Polymers 2023, 15, x FOR PEER REVIEW 17 of 25

Polymers 2023, 15, 1581 Figure 11 shows the SEM micrographs for the PET1 and PET2 fragments 16after of 24
fermentation in PDB media, highlighting the effect on the polymers for all treatments.

11. Scanning Electron

Figure 11.
Figure ElectronMicroscopy
Microscopy(SEM)(SEM)demonstrating
demonstrating thethe
effect of T.ofatroviride
effect CBMAI
T. atroviride 2073,
CBMAI
2073, C. cladosporioides
C. cladosporioides CBMAI CBMAI
2075, 2075, C. trifolii
C. trifolii CBMAI CBMAI
2111, 2111,
and T.and
sp.T.CBMAI
sp. CBMAI 2071
2071 on on PET1
PET1 and
and PET2
PET2 fragments compared to the abiotic control (PDB medium, no inoculum).
fragments compared to the abiotic control (PDB medium, no inoculum). Note. The images were Note. The images
were obtained
obtained after after cleaning
cleaning the fragments
the PET PET fragmentsafter after 40 days
40 days in PBD,
in PBD, 28 ◦ C,28and
°C,150
andrpm.
150 rpm.

4.4.Discussion
Discussion
AA total
total ofof2626
strains showed
strains showedthe potential to enzymatically
the potential hydrolyze
to enzymatically PET nanopar-
hydrolyze PET
ticles. The strains
nanoparticles. The with the with
strains abilitythe
to depolymerize are known are
ability to depolymerize to be good producers
known to be good of
hydrolasesofsuch
producers as lipases,
hydrolases esterases,
such andesterases,
as lipases, cutinasesand
[52].
cutinases [52].
The preliminary
The preliminaryuse use of
of npPET
npPETto to test
test the
the enzymatic
enzymatic activity
activity was
wasaddressed
addressedtoto select
select
the representatives that produce polyester hydrolases. In general, nanoparticles
the representatives that produce polyester hydrolases. In general, nanoparticles have have a high
a
ratio of exposed surface by volume occupied, which allows for greater
high ratio of exposed surface by volume occupied, which allows for greater enzymatic enzymatic access
compared to other structural forms such as films or fibers [53]. Using the high-throughput
screening test (HTS), six strains with values above 2% of npPET conversion were identi-
Polymers 2023, 15, 1581 17 of 24

fied, while the best results in previous works were limited to 1%, except for a strain of
Trichoderma sp. L1239 with 7.1% [30].
In this screening, four isolates were selected for further analysis: Curvularia trifolii
CBMAI 2111, Trichoderma sp. CBMAI 2071, Trichoderma atroviride CBMAI 2073, and
Cladosporium cladosporioides CBMAI 2075 (Table 2). The selection was based on the best
results of the NPPET analysis and for presenting strong mycelial adhesion to the PET-bottle
polymer, as per the preliminary tests reported for strains Microsphaeropsis arundinis CBMAI
2109 and CBMAI 2110 [18].
The evaluation of the enzymatic activities of the selected strains on short (two car-
bons) and long (eight carbons) esterified fluorescent probes was previously performed
(Table S1). In general, it was observed that the strains did not show good results for this
former type of tested probe (two and eight carbons) with conversion rates below 50%
according to the criteria established by Malafatti-Picca et al. [18]. The strain T. sp. CBMAI
2071, for example, was not able to convert the probes under the conditions tested (Table S1),
showing no conversion for probes (substrates) with two and eight carbons. However, these
data corroborate those found by Yoshida et al. (2016) [21], who identified a new bacterial
species, Ideonella sakaiensis, capable of adhering to the PET surface and secreting enzymes
characterized as cutinase-like (PETases), which assimilated the PET polymer in preference
to other substrates.
Plate tests with minimal mineral media containing cutin and polycaprolactone (MM
10,000 g·mol−1 ) were performed with the selected isolates (Figure 6) and revealed their
ability to assimilate both polymers. Nimchua et al. [19] used a minimal medium with PCL
in the isolation of enzyme-producing filamentous fungi, which increased the hydrophilicity
of PET fibers. Polycaprolactone is considered an analog of cutin, an insoluble biopolyester
and structural component of plant cuticles [35]. Figure S2 of the supplementary mate-
rial overlays the FTIR spectra of these polymers and indicates similarity between the
two compounds.
The genera Curvularia [54], Cladosporium [55], and Trichoderma [56] contain plant
pathogen species but also others that benefit the growth of many plants. They are ubiquitous
with representatives that are considered “indoor fungi”, and well-known for producing
different enzymes [57]. The literature reports the presence of genes encoding cutinase in
the genome of representatives of Curvularia lunata, Trichoderma reesei, and Cladosporium
fulvum [58–60]. The results obtained herein by the qualitative test in plates were consistent
and justified the affinity of these enzymes with the NPPET substrate and their low affinity
with the esterified fluorogenic probes, which agrees with the data reported by Yoshida
et al. [21]. However, it is important to highlight that a more in-depth investigation of the
type of enzyme produced by the selected strains is recommended.
Although the nanoparticles are considered structurally favorable to the enzymatic
action when aiming at the depolymerization of PET, they do not correspond to the final
disposition of the polymer. The transformation of all PET to be recycled into nanoparticles to
undergo enzymatic hydrolysis could also be a good alternative; however, this process may
use halogenated or metallic organic solvents that are miscible in water and unsafe for the
environment [61]. Therefore, further tests were carried out with the most promising strains
on PET bottle fragments, which is the structure most found in different environments.
The present investigation used two types of polymers denominated PET1 and PET2.
The former comes from the “plant bottle” technology and uses 30% of PET derived from
sugar cane, referring to mono-ethylene glycol (MEG) and called BioMEG [62]. The sec-
ond uses conventional technology based on non-renewable fossil resources as precursors.
Table 2 shows the different crystallinity percentages determined using DSC analyses: 35.47%
and 10.41% (PET1 and PET2, respectively). Wei and Zimmerman [63] reported that PET
from bottles and fibers with a high degree of crystallinity (above 30%) represent the most
abundant type of post-consumer polymer and may not be readily hydrolyzed efficiently in
enzymatic processes. The “plant bottle” technology manufacturer reports that the biodegra-
dation of the polymer does not differ from conventional technologies; however, some
Polymers 2023, 15, 1581 18 of 24

studies showed greater enzymatic degradation efficiency for polymers with crystallinity of
around 10% [24,64].
The strains T. atroviride CBMAI 2073 and C. cladosporioides CBMAI 2075 were chosen
to test the culture medium that best favored PET depolymerization. Among the media
tested (MM1, MM2, and PDB—Table 3), both strains expressed better activities in PDB,
promoting the depolymerization of PET into PTA and BHET with a significant difference
at the 95% confidence level (p < 0.05). Both the minimal mineral medium [65–67] and
those rich in glucose [68] have been used in polymer biodegradation or depolymerization
studies. In this study, the parameters used to evaluate the polymer degradation were mass
variation, FTIR spectra, and scanning electron microscopy images. In the fermented broth,
concentrations of monomers (PTA) and oligomers (BHET and MHET) were measured, as
well as enzymatic activities.
As most studies on biodegradation apply mass variation to assess the effect of strains
on the polymer [36,69,70], it was also included here, but the results were considered incon-
sistent (Figures 7 and 10). El-Saffei et al. [71] also considered this approach inconclusive as
mass gain may occur either by the adhesion of the mycelia to the fragment or the oxidation
or water absorption of the culture medium.
The PET recalcitrance characteristics discourage depolymerization studies, causing
little information to be available in the literature on polymer analyses using FTIR. According
to Holland and Hay [72] and Vijayakumar and Rajakumar [73], the spectra from bottles
must contain some vibrations from groups that confirm the presence of important chemical
bonds functioning as “fingerprints” for that material. They may be 1713 cm−1 (presence
of carbonyl group C=O conjugated to the aromatic ring), 1234 cm−1 (asymmetric C-C-O
stretching involving carbon in the aromatic ring), 728 cm−1 (aromatic ring C-H movement
outside the plane), 872 cm−1 (C-H stretching of the aromatic ring outside the plane),
1128 cm−1 and 1091 cm−1 (O-C-C split asymmetric stretching), 2960 cm−1 (asymmetric
stretching of C-H), 1505 cm−1 (aromatic ring C-C stretching), 1453 cm−1 (deviation/folding
of C-H), and bands at 1408 cm−1 and 1339 cm−1 (C-H deformation of the alkane). The
vibrations, stretching, and folding may vary from 0.5 cm−1 to 1.5 cm−1 on average. The
treatments with C. trifolii CBMAI 2111, T. sp. CBMAI 2071, T. atroviride CBMAI 2073, and
C. cladosporioides CBMAI 2075 led to changes at various points of the spectrum in the
regions mentioned above (Figures 9 and 11). Analyzing Penicillium spp. and PET, Nowak
et al. [70] and Yamada-Onodera et al. [74] obtained similar results to those found in this
work. After studying the biodegradation of polyethylene, Jumaah [75] concluded that some
modifications observed using FTIR indicate the microbial action on the recalcitrant element.
This is considered a good result because it reveals that a strain capable of promoting such
modifications (albeit small) may also synergistically interact with others, approaching the
mineralization of the compound. It was clear that the FTIR spectra of PET2 in treatments
with the most promising strains (C. trifolii CBMAI 2111, T. sp. CBMAI 2071, T. atroviride
CBMAI 2073, and C. cladosporioides CBMAI 2075) were more likely to have molecular
changes than PET1 samples, thus showing that they are better degraded by the strains. The
results from Table 4 highlight the high crystallinity of PET1, which would proportionally
have a smaller amount of the polymer in its amorphous form and is preferred for the
enzymatic action of hydrolases [76].
The enzymatic activities quantified after the fermentation of PET1 and PET2 with all
strains studied (Tables 6 and 8) proved the production of extracellular enzymes (lipases
and esterases), which could act on the polymer. The wide use of Trichoderma strains to
produce industrial biomolecules is well-known and scientifically reported as one of the
most promising genera for biotechnology. The better lipase and esterase activities observed
in the fermented broth of CBMAI 2071 was expected (Table 8). On the contrary, the good
performance of CBMAI 2111 (Curvularia trifolii) was considered a novelty for this species.
According to Yamada-Onodera [74], extracellular biological catalysts produced by hyphae
may help in the rapid degradation of polymers. Hiraga et al. [23] consider it is important
Polymers 2023, 15, 1581 19 of 24

to elucidate the mechanisms of cell adhesion to polymers, as it is certainly what could

implement the PET biodegradation process.
To confirm the PET depolymerization, the determination of monomers and oligomers
is the most important among the evaluated parameters since they are the by-products that
will originate new bottles. This approach meets the needs of the current recycling context
and allows the selection of strains with greater effectiveness in the depolymerization of
this material.
The quantification of monomers and oligomers is a difficult task as it may involve a
slow process such as the assimilation of a polymer by the microorganism [77]. The previous
experiments carried out using chromatographic determinations of PTA in fermented broth
without pre-concentration led to quantification data below the established limit for chro-
matographic separation under the conditions established for this work. Pre-concentration
strategies such as liquid-liquid extraction are often necessary to increase analyte recovery
and result in reliability [44].
In this research, the chromatographic separation of the PTA, BHET, and MHET analytes
was achieved after liquid–liquid extraction by reverse-phase high-performance liquid
chromatography. The results showed that the strains under study were able to convert
the PET1 and PET2 fragments into concentrations of terephthalic acid monomer (PTA)
between 12 ppm and 45 ppm (for PET1) and between 17 ppm and 55 ppm (for PET2).
Considering the visible increase in microbial biomass, it is possible that the fungi tested
may have assimilated the mobilized compounds (PTA, BHET, and MHET) as reported by
Gong et al. [78], thus the concentration of monomers and oligomers released from PET
were possibly higher.
Some previous works that evaluated PET biodegradation/depolymerization often
used microbial enzymes and the biocatalysis promoted by isolated enzymes. The process
was improved by applying the polymer with different physical characteristics (amorphous
PET and low-crystallinity product). Zhang et al. [79] demonstrated the degradation of
PET fibers mediated by unidentified microorganisms (synergism between bacteria and
fungi) with conversions into terephthalic acid at concentrations between 0.3 ppm and
3.0 ppm. Danso et al. [13] evaluated the biodegradation potential of an enzyme from
the marine environment using a metagenomic approach (called PET 2 in their work) on
14 mg of amorphous PET and obtained 900 µM (149 ppm) of terephthalic acid after 24 h.
Another study used isolated cutinases produced by Thermobifida fusca (TfCut2) (Actinobac-
teria) and recombinant cutinases (TfCut2 G62A/F209A) designed based on the cutinase
gene sequence of Ideonella sakaiensis. In the presence of a cationic surfactant, the cutinases
degraded low-crystallinity (3% to 5%) PET with 200 µm thickness and PET with high
crystallinity (40%) and 190 µm thickness. The polymer studied was obtained commercially,
corresponding to a very homogeneous material [80]. The strains studied in this work are
considered highly promising for PET depolymerization when the results are compared
with those reported in the literature. The highlights of this study may be listed as follows:
1. the application of microbial strains as whole cells under room temperature (approxi-
mately 28 ◦ C); 2. PET samples from commercial bottles, thus corresponding to heteroge-
neous material with different crystallinities; and 3. there are no reports of PET biodegrada-
tion capacity for the fungal species identified here except for C. cladosporioides [25], which
highlights the novelty of the data obtained.
A hypothesis for the promising result of the Trichoderma atroviride strain CBMAI 2073
is based on Espino-Hammer et al. [81], who reported that some species of Trichoderma can
produce class II hydrophobin molecules that stimulate the activity of cutinases on PET.
Although analysis using scanning electron microscopy (SEM) is usually considered
only qualitative to evaluate the effects of microbial growth on polymers [82], its use was con-
sidered highly valuable here. The images obtained (Figure 11) clearly indicated that the four
selected strains were able to promote structural changes on the material and corroborated
the results obtained in the other analyses carried out in the present investigation.
Polymers 2023, 15, 1581 20 of 24

The work with the selected strains enabled us to gain insights into important appli-
cations in PET depolymerization. It is recommended that further studies focus on the
isolation, identification, and use of these enzymes in biodegradation assays, in addition to
promoting synergistic interactions between the isolates to try to optimize this process.

5. Conclusions
Considering that this work aimed to elucidate important points, better guide PET
biodegradation studies, which are scarce, and highlight the fungal strains with the potential
to assimilate the polymer, the contributions are as follows: between the two types of PET
addressed in this study, the material with the highest crystallinity (here called PET1) showed
greater resistance to enzymatic action. Trichoderma sp. CBMAI 2071, Trichoderma atroviride
CBMAI 2073, Cladosporium cladosporioides CBMAI 2075, and Curvularia trifolii CBMAI 2111
are possible cutinase-producers because they can grow in a culture medium with cutin and
polycaprolactone as the sole carbon sources, according to qualitative analyses. Compared
to other culture media, Potato Dextrose Broth (PDB) favored the conversion of Polyethylene
Terephthalate into PTA, BHET, and MHET during fermentation with the strains Trichoderma
sp. CBMAI 2071 and C. cladosporioides CBMAI 2075. The studied strains Trichoderma sp.
CBMAI 2071, Trichoderma atroviride CBMAI 2073, Cladosporium cladosporioides CBMAI 2075,
and Curvularia trifolii CBMAI 2111 showed action on depolymerization according to the
analysis of the enzymatic activities and the release of monomers (concentrations above
12 ppm) and oligomers (concentrations above 0.6 ppm) in the fermented liquid. They are
also capable of promoting important changes in the chemical structure and surface of the
polymer (according to FTIR and SEM). The evaluation of mass variation, however, seems
to be an inconclusive parameter of inconstant results.

Supplementary Materials: The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/polym15061581/s1, Figure S1. The thermograms for PET1 (Crystal
brand) and PET2 (Sprite brand) fragments, with melting temperatures of 251.12 ◦ C for PET1 and
253.41 ◦ C for PET2; Figure S2. Infrared absorption spectra for Polycaprolactone (in dichloromethane)
and powdered cutin extracted from Fuji apple peels. The samples were prepared in KBr tablets;
Figure S3A. FTIR spectra of the 4000 cm−1 to 3000 cm−1 region of the treatment with the isolate
Trichoderma sp. CBMAI 2073 in PET1; Figure S3B. FTIR spectra of the 3000 cm−1 to 2000 cm−1 region
of the treatment with the isolate Trichoderma sp. CBMAI 2073 in PET1; Figure S3C. FTIR spectra of
the 2000 cm−1 to 1000 cm−1 region of the treatment with the isolate Trichoderma sp. CBMAI 2073 in
PET1; Figure S3D. FTIR spectra of the 1000 cm−1 to 400 cm−1 region of the treatment with the isolate
Trichoderma sp. CBMAI 2073 in PET1; Figure S3E. FTIR spectra of the 4000 cm−1 to 3000 cm−1 region
of the treatment with the isolate Trichoderma sp. CBMAI 2073 in PET2; Figure S3F. FTIR spectra of
the 3000 cm−1 to 2000 cm−1 region of the treatment with the isolate Trichoderma sp. CBMAI 2073
in PET2; Figure S3G. FTIR spectra of the 2000 cm−1 to 1000 cm−1 region of the treatment with the
isolate Trichoderma sp. CBMAI 2073 in PET2; Figure S3H. FTIR spectra of the 1000 cm−1 to 400 cm−1
region of the treatment with the isolate Trichoderma sp. CBMAI 2073 in PET2; Figure S3I. FTIR spectra
of the 4000 cm−1 to 3000 cm−1 region of the treatment with the isolate Cladosporium cladosporioides
CBMAI 2075 in PET1; Figure S3J. FTIR spectra of the 3000 cm−1 to 2000 cm−1 region of the treatment
with the isolate Cladosporium cladosporioides CBMAI 2075 in PET1; Figure S3K. FTIR spectra of the
2000 cm−1 to 1000 cm−1 region of the treatment with the isolate Cladosporium cladosporioides CBMAI
2075 in PET1; Figure S3L. FTIR spectra of the 1000 cm−1 to 400 cm−1 region of the treatment with the
isolate Cladosporium cladosporioides CBMAI 2075 in PET1; Figure S3M. FTIR spectra of the 4000 cm−1
to 3000 cm−1 region of the treatment with the isolate Cladosporium cladosporioides CBMAI 2075 in
PET2; Figure S3N. FTIR spectra of the 3000 cm−1 to 2000 cm−1 region of the treatment with the
isolate Cladosporium cladosporioides CBMAI 2075 in PET2; Figure S3O. FTIR spectra of the 2000 cm−1 to
1000 cm−1 region of the treatment with the isolate Cladosporium cladosporioides CBMAI 2075 in PET2;
Figure S3P. FTIR spectra of the 1000 cm−1 to 400 cm−1 region of the treatment with the isolate Cladospo-
rium cladosporioides CBMAI 2075 in PET2; Figure S4A. FTIR spectra of the 4000 cm−1 to 3000 cm−1
region of the treatment with the isolates Curvularia trifolii CBMAI 2111 and Trichoderma atroviride
CBMAI 2071 in PET1; Figure S4B. FTIR spectra of the 3000 cm−1 to 2000 cm−1 region of the treatment
with the isolates Curvularia trifolii CBMAI 2111 and Trichoderma atroviride CBMAI 2071 in PET1;
Polymers 2023, 15, 1581 21 of 24

Figure S4C. FTIR spectra of the 2000 cm−1 to 1000 cm−1 region of the treatment with the isolates
Curvularia trifolii CBMAI 2111 and Trichoderma atroviride CBMAI 2071 in PET1; Figure S4D. FTIR spec-
tra of the 1000 cm−1 to 400 cm−1 region of the treatment with the isolates Curvularia trifolii CBMAI
2111 and Trichoderma atroviride CBMAI 2071 in PET1; Figure S4E. FTIR spectra of the 4000 cm−1 to
3000 cm−1 region of the treatment with the isolates Curvularia trifolii CBMAI 2111 and Trichoderma
atroviride CBMAI 2071 in PET2; Figure S4F. FTIR spectra of the 3000 cm−1 to 2000 cm−1 region
of the treatment with the isolates Curvularia trifolii CBMAI 2111 and Trichoderma atroviride CBMAI
2071 in PET2; Figure S4G. FTIR spectra of the 2000 cm−1 to 1000 cm−1 region of the treatment
with the isolates Curvularia trifolii CBMAI 2111 and Trichoderma atroviride CBMAI 2071 in PET2;
Figure S4H. FTIR spectra of the 1000 cm−1 to 400 cm−1 region of the treatment with the isolates
Curvularia trifolii CBMAI 2111 and Trichoderma atroviride CBMAI 2071 in PET2; Table S1. Gradient
programming applied to the chromatographic separations; Table S2. PET nanoparticle conversion (%)
results after fifteen days of analysis; Table S3. Lipase and esterase activities determined by HTS with
esterified fluorescent probes (results expressed as mean ± standard deviation, n = 4, analysis time
of 96 h)
Author Contributions: Conceptualization: D.A.-A., L.M.-P., V.M.d.O., É.V. and A.M.d.C.; methodol-
ogy, D.A.-A., L.M.-P., D.d.F.d.A., A.J.M., M.B. and J.S.G.; software, L.M.-P., E.C.B., M.B. and D.A.-A.;
formal analysis, L.M.-P., E.C.B. and M.R.d.B.C.; investigation, L.M.-P., E.C.B. and M.R.d.B.C.; re-
sources, D.A.-A., D.d.F.d.A., A.J.M., M.B. and J.S.G.; data curation, L.M.-P., D.A.-A.; writing—original
draft preparation, D.A.-A. and L.M.-P.; writing—review and editing, L.M.-P., E.C.B., M.R.d.B.C.,
A.M.d.C., É.V., V.M.d.O., A.J.M., J.S.G., D.d.F.d.A., M.B. and D.A.-A.; visualization, L.M.-P., E.C.B.,
M.R.d.B.C., A.M.d.C., É.V., V.M.d.O., A.J.M., J.S.G., D.d.F.d.A., M.B. and D.A.-A.; su-pervision,
D.A.-A., É.V., V.M.d.O. and A.J.M.; project administration, D.A.-A., A.M.d.C., É.V., V.M.d.O. and
A.J.M.; funding acquisition, D.A.-A. and V.M.d.O. All authors have read and agreed to the published
version of the manuscript.
Funding: The authors received financial support from PETROBRAS (2012/00327-7). This study was
financed in part, by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brasil
(CAPES), one of the authors (L.M.-P)–Finance Code 001.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data that support the findings of this study are available on request
from the corresponding author.
Acknowledgments: The authors are grateful to Túlio de Lucca Capelini for his technical assistance.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Geyer, R.; Jambeck, J.R.; Law, K.L. Production, uses, and fate of all plastics ever made. Sci. Adv. 2017, 3, e1700782. [CrossRef]
2. Plastics Europe’s Market Research and Statistics Group; Conversio Market Strategy GmbH. Plastics—The Facts 2019. 2019,
Volume 14, p. 35. Available online: https://plasticseurope.org/knowledge-hub/plastics-the-facts-2019/ (accessed on
15 January 2020).
3. Taniguchi, I.; Yoshida, S.; Hiraga, K.; Miyamoto, K.; Kimura, Y.; Oda, K. Biodegradation of PET: Current Status and Application
Aspects. ACS Catal. 2019, 9, 4089–4105. [CrossRef]
4. Goldsberry, C. Packaging Sustainability, Recycling, Consumer Products, Materials. Plastics Today. 2019. Available online:
https://www.plasticstoday.com/packaging/europe-will-miss-2025-recycling-target-if-current-trends-continue/2394990926
1315 (accessed on 15 January 2020).
5. Euromonitor International. Global Trends in Food and Drinks Packaging a Report Compiled for Auspack. 2017. Available online:
https://go.euromonitor.com/00-EV-APAC2017-AUSPACK_Landing-Page.html (accessed on 15 January 2020).
6. Gregory, M.R.; Andrady, A.L. Plastics in the Marine Environment. Biogeosciences 2016, 6, 1–13. [CrossRef]
7. Koelmans, A.A.; Gouin, T.; Thompson, R.; Wallace, N.; Arthur, C. Plastics in the marine environment. Environ. Toxicol. Chem.
2014, 33, 5–10. [CrossRef] [PubMed]
8. Thiounn, T.; Smith, R.C. Advances and approaches for chemical recycling of plastic waste. J. Polym. Sci. 2020, 58, 1347–1364.
[CrossRef]
9. Grigore, M.E. Methods of recycling, properties and applications of recycled thermoplastic polymers. Recycling 2017, 2, 24.
[CrossRef]
Polymers 2023, 15, 1581 22 of 24

10. Kalita, N.K.; Hakkarainen, M. Integrating biodegradable polyesters in a circular economy. Curr. Opin. Green Sustain. Chem. 2022,
40, 100751. [CrossRef]
11. Kalita, N.K.; Kalamdhad, A.; Katiyar, V. Recent Trends and Advances in the Biodegradation of Conventional Plastics. In Advances
in Sustainable Polymers. Materials Horizons: From Nature to Nanomaterials; Katiyar, V., Kumar, A., Mulchandani, N., Eds.; Springer:
Singapore, 2020. [CrossRef]
12. Al-Sabagh, A.M.; Yehia, F.Z.; Eshaq, G.; Rabie, A.M.; ElMetwally, A.E. Greener routes for recycling of polyethylene terephthalate.
Egypt. J. Pet. 2016, 25, 53–64. [CrossRef]
13. Danso, D.; Schmeisser, C.; Chow, J.; Zimmermann, W.; Wei, R.; Leggewie, C.; Li, X.; Hazen, T.; Streit, W.R. New insights into the
function and global distribution of polyethylene terephthalate (PET)-degrading bacteria and enzymes in marine and terrestrial
metagenomes. Appl. Environ. Microbiol. 2018, 84, e02773-17. [CrossRef]
14. Di Souza, L.; Torres, M.C.M.; Ruvolo Filho, A.C. Despolimerização do poli (tereftalato de etileno)—PET: Efeitos de tensoativos e
excesso de solução alcalina. Polímeros 2008, 18, 334–341. [CrossRef]
15. Billig, S.; Oeser, T.; Birkemeyer, C.; Zimmermann, W. Hydrolysis of cyclic poly(ethylene terephthalate) trimers by a car-
boxylesterase from Thermobifida fusca KW3. Appl. Microbiol. Biotechnol. 2010, 87, 1753–1764. [CrossRef]
16. Eberl, A.; Heumann, S.; Brückner, T.; Araujo, R.; Cavaco-Paulo, A.; Kaufmann, F.; Kroutil, W.; Guebitz, G.M. Enzymatic surface
hydrolysis of poly(ethylene terephthalate) and bis(benzoyloxyethyl) terephthalate by lipase and cutinase in the presence of
surface active molecules. J. Biotechnol. 2009, 143, 207–212. [CrossRef]
17. Guo, C.; Zhou, L.; Lv, J. Effects of expandable graphite and modified ammonium polyphosphate on the flame-retardant and
mechanical properties of wood flour-polypropylene composites. Polym. Polym. Compos. 2013, 21, 449–456. [CrossRef]
18. Malafatti-Picca, L.; de Barros Chaves, M.R.; de Castro, A.M.; Valoni, É.; de Oliveira, V.M.; Marsaioli, A.J.; de Franceschi de
Angelis, D.; Attili-Angelis, D. Hydrocarbon-associated substrates reveal promising fungi for Poly (ethylene terephthalate) (PET)
depolymerization. Braz. J. Microbiol. 2019, 50, 633–648. [CrossRef]
19. Nimchua, T.; Eveleigh, D.E.; Punnapayak, H. Screening of tropical fungi producing polyethylene terephthalate-hydrolyzing
enzyme for fabric modification. J. Ind. Microbiol. Biotechnol. 2008, 35, 843–850. [CrossRef] [PubMed]
20. Zimmermann, W.; Billig, S. Enzymes for the biofunctionalization of Poly (ethylene Terephthalate). Adv. Biochem. Eng. Biotechnol.
2011, 125, 97–120. [CrossRef]
21. Yoshida, S.; Hiraga, K.; Takehana, T.; Taniguchi, I.; Yamaji, H.; Maeda, Y.; Toyohara, K.; Miyamoto, K.; Kimura, Y.; Oda, K. A
bacterium that degrades and assimilates poly(ethylene terephthalate). Science 2016, 351, 1196–1199. [CrossRef]
22. Lear, G.; Kingsbury, J.M.; Franchini, S.; Gambarini, V.; Maday, S.D.M.; Wallbank, J.A.; Weaver, L.; Pantos, O. Plastics and the
microbiome: Impacts and solutions. Environ. Microbiomes 2021, 16, 2. [CrossRef] [PubMed]
23. Hiraga, K.; Taniguchi, I.; Yoshida, S.; Kimura, Y.; Oda, K. Biodegradation of waste PET. EMBO Rep. 2019, 20, e49365. [CrossRef]
[PubMed]
24. Ronkvist, Å.M.; Xie, W.; Lu, W.; Gross, R.A. Cutinase-Catalyzed hydrolysis of poly(ethylene terephthalate). Macromolecules 2009,
42, 5128–5138. [CrossRef]
25. Sato, M. Deterioration of filaments and films of Polyethyleneterephthalate with enzyme of Cladosporium cladosporioides FERM J-8.
Sen-I Gakkaishi 1983, 39, T209–T219. [CrossRef]
26. Liebminger, S.; Eberl, A.; Sousa, F.; Heumann, S.; Fischer-Colbrie, G.; Cavaco-Paulo, A.; Guebitz, G.M. Hydrolysis of PET and
bis-(benzoyloxyethyl) terephthalate with a new polyesterase from Penicillium citrinum. Biocatal. Biotransform. 2007, 25, 171–177.
[CrossRef]
27. Wang, X.; Lu, D.; Jönsson, L.J.; Hong, F. Preparation of a PET-hydrolyzing lipase from Aspergillus oryzae by the addition of
bis(2-hydroxyethyl) terephthalate to the culture medium and enzymatic modification of PET fabrics. Eng. Life Sci. 2008, 8, 268–276.
[CrossRef]
28. Ru, J.; Huo, Y.; Yang, Y. Microbial degradation and valorization of plastic wastes. Front. Microbiol. 2020, 11, 442. [CrossRef]
[PubMed]
29. Wei, R.; Oeser, T.; Billig, S.; Zimmermann, W. A high-throughput assay for enzymatic polyester hydrolysis activity by fluorimetric
detection. Biotechnol. J. 2012, 7, 1517–1521. [CrossRef] [PubMed]
30. Chaves, M.R.B.; Lima, M.L.S.O.; Malafatti-Picca, L.; de Angelis, D.A.; de Castro, A.M.; Valoni, É.; Marsaioli, A.G. A practical
fluorescence-based screening protocol for polyethylene terephthalate degrading microorganisms. J. Braz. Chem. Soc. 2018, 29,
1278–1285. [CrossRef]
31. Welzel, K.; Müller, R.J.; Deckwer, W.D. Enzymatischer Abbau von Polyester-Nanopartikeln. Chem. Ing. Tech. 2002, 74, 1496–1500.
[CrossRef]
32. Macedo, G.A.; Pio, T.F. A rapid screening method for cutinase producing microorganisms. Braz. J. Microbiol. 2005, 36, 388–394.
[CrossRef]
33. Chen, Z.; Franco, C.F.; Baptista, R.P.; Cabral, J.M.S.; Coelho, A.V.; Rodrigues, C.J.; Melo, E.P. Purification and identification of
cutinases from Colletotrichum kahawae and Colletotrichum gloeosporioides. Appl. Microbiol. Biotechnol. 2007, 73, 1306–1313. [CrossRef]
34. Dickman, M.; Patil, S. A rapid plate assay for detection of cutinases produced by plant pathogenic fungi. Phytopathology 1986, 76,
473–475. [CrossRef]
35. Murphy, C.A.; Cameron, J.A.; Huang, S.J.; Vinopal, R.T. Fusarium polycaprolactone depolymerase is cutinase. Appl. Environ.
Microbiol. 1996, 62, 456–460. [CrossRef]
Polymers 2023, 15, 1581 23 of 24

36. Sharon, C.; Sharon, M. Studies on Biodegradation of Polyethylene terephthalate: A synthetic polymer Studies on Biodegradation
of Polyethylene terephthalate: A synthetic polymer. J. Microbiol. Biotechnol. Res. 2012, 2, 258–264.
37. De Castro, A.M.; Carniel, A.; Nicomedes Junior, J.; da Conceição Gomes, A.; Valoni, E. Screening of commercial enzymes for
poly(ethylene terephthalate) (PET) hydrolysis and synergy studies on different substrate sources. J. Ind. Microbiol. Biotechnol.
2017, 44, 835–844. [CrossRef]
38. Khanna, Y.P.; Kuhn, W.P. Measurement of crystalline index in nylons by DSC: Complexities and recommendations. J. Polym. Sci.
Part B Polym. Phys. 1997, 35, 2219–2231. [CrossRef]
39. Gams, W.; Hoekstra, E.S.; Aptoot, A. CBS-Course of Mycology, 4th ed.; Centraalbureau voor Schimmelculturesthe: Baarn, The
Netherlands, 1998; p. 165.
40. Sepperumal, U.; Markandan, M.; Palraja, I. Micromorphological and chemical changes during biodegradation of Polyethylene
terephthalate (PET) by Penicillium sp. J. Microbiol. Biotechnol. Res. 2013, 3, 47–53.
41. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of
protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [CrossRef]
42. Shafei, M.S.; Mohamed, T.A.; Elsalam, I.S.A. Optimization of extracellular lipase production by Penicillium chrysogenum using
factorial design. Malays. J. Microbiol. 2011, 7, 71–77. [CrossRef]
43. He, X. A continuous spectrophotometric assay for the determination of diamondback moth esterase activity. Arch. Insect. Biochem.
Physiol. 2003, 54, 68–76. [CrossRef]
44. Kim, D.J.; Lee, K.T. Determination of monomers and oligomers in polyethylene terephthalate trays and bottles for food use
by using high performance liquid chromatography- electrospray ionization-mass spectrometry. Polym. Test 2012, 31, 490–499.
[CrossRef]
45. Aamir, S.; Sutar, S.; Singh, S.K.; Baghela, A. A rapid and efficient method of fungal genomic DNA extraction, suitable for PCR
based molecular methods. Plant Pathol Quar. 2015, 5, 74–81. [CrossRef]
46. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. 38-Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics.
In PCR Protocols, a Guide to Methods and Applications; Academic Press: London, UK, 1990; pp. 315–322.
47. Carbone, I.; Kohn, L.M. A Method for Designing Primer Sets for Speciation Studies in Filamentous Ascomycetes. Mycologia 1999,
91, 553–556. [CrossRef]
48. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic
Acids Symp. Ser. 1999, 41, 95–98.
49. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; Mcwilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.;
Lopez, R.; et al. Clustal W and Clustal X version. Bioinformatics 2018, 23, 2947–2948. [CrossRef]
50. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol.
Biol. Evol. 2007, 24, 1596–1599. [CrossRef]
51. Saitou, N.; Nei, M.; Saitou, N.N.M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol.
Evol. 1987, 4, 406–425. [CrossRef]
52. Barth, M.; Oeser, T.; Wei, R.; Then, J.; Schmidt, J.; Zimmermann, W. Effect of hydrolysis products on the enzymatic degradation of
polyethylene terephthalate nanoparticles by a polyester hydrolase from Thermobifida Fusca. Biochem. Eng. J. 2015, 93, 222–228.
[CrossRef]
53. Walter, T.; Augusta, J.; Muller, R.J.; Widdecke, H.; Klein, J. Enzymatic Degradation of a Model Polyester by Lipase from Rhizopus
delemar. Enzym. Microb. Technol. 1995, 17, 218–224. [CrossRef]
54. Dos Santos, P.R.R.; Leão, E.U.; Aguiar, R.W.d.S.; de Melo, M.P.; dos Santos, G.R. Morphological and molecular characterization of
Curvularia lunata pathogenic to andropogon grass. Bragantia 2018, 77, 326–332. [CrossRef]
55. Bensch, K.; Braun, U.; Groenewald, J.Z.; Crous, P.W. The genus Cladosporium. Stud. Mycol. 2012, 72, 1–401. [CrossRef] [PubMed]
56. Verma, D.; Jin, S.; Kanagaraj, A.; Singh, N.D.; Daniel, J.; Kolattukudy, P.E.; Miller, M.; Daniell, H. Expression of Fungal Cutinase
and Swollenin in Tobacco Chloroplasts Reveals Novel Enzyme Functions and/or Substrates. PLoS ONE 2013, 8, e57187. [CrossRef]
57. Crous, P.W.; Verkleij, G.J.M.; Groenewald, J.Z.; Houbraken, J. Fungal Biodiversity; Westerdijk Laboratory Manual Series No. 1;
Westerdijk Fungal Biodiversity Institute: Utrecht, The Netherlands, 2019; 425p.
58. De Wit, P.J.G.M.; van der Burgt, A.; Ökmen, B.; Stergiopoulos, I.; Abd-Elsalam, K.A.; Aerts, A.L.; Bahkali, A.H.; Beenen, H.G.;
Chettri, P.; Cox, M.P.; et al. The Genomes of the fungal plant pathogens Cladosporium fulvum and Dothistroma septosporum reveal
adaptation to different hosts and lifestyles but also signatures of common ancestry. PLoS Genet. 2012, 8, e1003088. [CrossRef]
[PubMed]
59. Roussel, A.; Amara, S.; Nyyssölä, A.; Mateos-Diaz, E.; Blangy, S.; Kontkanen, H.; Westerholm-Parvinen, A.; Carrière, F.;
Cambillau, C. A Cutinase from Trichoderma reesei with a lid-covered active site and kinetic properties of true lipases. J. Mol. Biol.
2014, 426, 3757–3772. [CrossRef] [PubMed]
60. Liu, T.; Hou, J.; Wang, Y.; Jin, Y.; Borth, W.; Zhao, F.; Liu, Z.; Hu, J.; Zuo, Y. Genome-wide identification, classification and
expression analysis in fungal–plant interactions of cutinase gene family and functional analysis of a putative ClCUT7 in Curvularia
lunata. Mol. Genet. Genom. 2016, 291, 1105–1115. [CrossRef]
61. Wurm, F.R.; Weiss, C.K. Nanoparticles from renewable polymers. Front. Chem. 2014, 2, 49. [CrossRef] [PubMed]
62. THE COCA-COLA COMPANY. PlantBottle Frequently Asked Questions: The Coca-Cola Company. 2020. Available online:
https://www.coca-cola.co.uk/our-business/faqs/what-is-plantbottle (accessed on 15 January 2020).
Polymers 2023, 15, 1581 24 of 24

63. Wei, R.; Zimmermann, W. Microbial enzymes for the recycling of recalcitrant petroleum-based plastics: How far are we? Microb.
Biotechnol. 2017, 10, 1308–1322. [CrossRef] [PubMed]
64. Müller, R.J.; Schrader, H.; Profe, J.; Dresler, K.; Deckwer, W.D. Enzymatic degradation of poly(ethylene terephthalate): Rapid
hydrolyse using a hydrolase from T. fusca. Macromol. Rapid Commun. 2005, 26, 1400–1405. [CrossRef]
65. Belal, E.B. Biodegradation of Aliphatic-aromatic Coplyester under Thermophilic Conditions. Res. J. Environ. Earth Sci. 2013, 5,
677–690. [CrossRef]
66. Bonhomme, S.; Cuer, A.; Delort, A.M.; Lemaire, J.; Sancelme, M.; Scott, G. Environmental biodegradation of polyethylene. Polym.
Degrad. Stab. 2003, 81, 441–452. [CrossRef]
67. Shah, A.A.; Hasan, F.; Hameed, A.; Ahmed, S. Isolation and characterization of poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
degrading bacteria and purification of PHBV depolymerase from newly isolated Bacillus sp. AF3. Int. Biodeterior. Biodegrad. 2007,
60, 109–115. [CrossRef]
68. Awasthi, S.; Srivastava, N.; Singh, T. Biodegradation of thermally treated low density polyethylene by fungus Rhizopus oryzae NS
5. 3 Biotech 2017, 7, 73. [CrossRef]
69. Das, M.P.; Kumar, S. An approach to low-density polyethylene biodegradation by Bacillus amyloliquefaciens. 3 Biotech 2015, 5,
81–86. [CrossRef]
70. Nowak, B.; PajaK, ˛ J.; Labuzek, S.; Rymarz, G.; Talik, E. Biodegradation of poly(ethylene terephthalate) modified with polyester
“Bionolle® ” by Penicillium funiculosum. Polymery 2011, 56, 35–44. [CrossRef]
71. El-Shafei, H.A.; El-Nasser, N.H.A.; Kansoh, A.L.; Ali, A.M. Biodegradation of disposable polyethylene by fungi and Streptomyces
species. Polym. Degrad. Stab. 1998, 62, 361–365. [CrossRef]
72. Holland, B.J.; Hay, J.N. The thermal degradation of poly(vinyl acetate) measured by thermal analysis-Fourier transform infrared
spectroscopy. Polymer 2002, 43, 2207–2211. [CrossRef]
73. Vijayakumar, S.; Rajakumar, P.R. Infrared spectral analysis of waste PET samples. Int. Lett. Chem. Phys. Astron. 2012, 4, 58–65.
[CrossRef]
74. Yamada-Onodera, K.; Mukumoto, H.; Katsuyaya, Y.; Saiganji, A.; Tani, Y. Degradation of polyethylene by a fungus, Penicillium
simplicissimum YK. Polym. Degrad. Stab. 2001, 72, 323–327. [CrossRef]
75. Jumaah, O.S. Screening of Plastic Degrading Bacteria from Dumped Soil Area. IOSR J. Environ. Sci. Toxicol. Food Technol. 2017, 11,
93–98. [CrossRef]
76. Webb, H.K.; Arnott, J.; Crawford, R.J.; Ivanova, E.P. Plastic degradation and its environmental implications with special reference
to Poly(ethylene terephthalate). Polymers 2013, 5, 1–18. [CrossRef]
77. Restrepo-Flórez, J.M.; Bassi, A.; Thompson, M.R. Microbial degradation and deterioration of polyethylene—A review.
Int. Biodeterior. Biodegrad. 2014, 88, 83–90. [CrossRef]
78. Gong, J.; Li, Y.; Wang, H.; Li, H.; Zhang, J. Depolymerization and Assimilation of Poly (Ethylene Terephthalate) by Whole-Cell
Bioprocess. IOP Conf. Ser. Mater. Sci. Eng. 2018, 394, 022047. [CrossRef]
79. Zhang, J.; Wang, X.; Gong, J.; Gu, Z. A study on the biodegradability of Polyethylene terephthalate fiber and diethylene glycol
terephthalate. J. Appl. Polym. Sci. 2004, 93, 1089–1096. [CrossRef]
80. Furukawa, M.; Kawakami, N.; Tomizawa, A.; Miyamoto, K. Efficient Degradation of Poly(ethylene terephthalate) with Thermobifida
fusca Cutinase Exhibiting Improved Catalytic Activity Generated using Mutagenesis and Additive-based Approaches. Sci. Rep.
2019, 9, 16038. [CrossRef] [PubMed]
81. Espino-Rammer, L.; Ribitsch, D.; Przylucka, A.; Marold, A.; Greimel, K.J.; Acero, E.H.; Guebitz, G.M.; Kubicek, C.P.; Druzhinina,
I.S. Two novel class ii hydrophobins from Trichoderma spp. stimulate enzymatic hydrolysis of poly(ethylene terephthalate) when
expressed as fusion proteins. Appl. Environ Microbiol. 2013, 79, 4230–4238. [CrossRef] [PubMed]
82. Shah, A.A.; Hasan, F.; Hameed, A.; Ahmed, S. Biological degradation of plastics: A comprehensive review. Biotechnol. Adv. 2008,
26, 246–265. [CrossRef] [PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.