Final Thesis (1) - Merged - Compressed

LIST OF PUBLICATIONS
1-Immunomodulatory effects of bone marrow-derived Mesenchymal stem

cells in a BALB/c mouse model on induced Systemic lupus erythematosus
(SLE)
Ghassan Khudhair Esmael1, Tarek Rebai2, Khalil Gazar Chelab Al-Nailey3
Cellular and Molecular Biology E-ISSN: 1165-158X / P-ISSN: 0145-5680

(published)
Ghassan Khudhair Esmael et al. / Effects of bone marrow-derived

Mesenchymal stem cells, 2023, 69(1): 19-24
2- Molecular Effects of bone marrow derived-Mesenchymal stem cells (BM-

MSCs) on some the cytokines encoding-genes in BALB/c mice with systemic
lupus erythematosus (SLE)
Ghassan Khudhair Esmael 1, and Tarek Rebai2
Eurasian Medical Research Periodical, ISSN: 2795-7624, (published) Volume 21 |

June 2023
II
Dedication
To the cradle of the first letter
The first word
The first history
((Iraq))
To my parents, my father and my mother,
To My wife, for her support,
To My daughter, Asawer,
To My son, Yaman,
To All members of my Family
My brothers and sisters
Ghassan
III
Acknowledgments
It is of great pleasure for me to express my sincere
appreciation to my supervisor Dr. Tarek Rebai, Professor in
Laboratory Histo-embryology and Cytogenetics department,
Faculty of Medicine of Sfax, Tunisia, for his supervision,
guidance, understanding, patience, motivation, and assistance to
start and successfully finish this work.
My thanks go to Prof. Dr. Ali Mohammed Ghazi Vet.
Medicine college of Al-Qadisiyah, Iraq, for his effort in the
statistical analysis. Special thanks to Assistant prof. Dr. Hassan
Khalaf Ulaiwi Al-Karagoly in Vet. Medicine college of Al-
Qadisiyah, Iraq, for helping in the reading and analysis of the
histopathological sections. I would like to express sincere thanks
to instructor Dr. Abdulrazzaq B. Kadhim in Vet. Medicine
College of Al-Qadisiyah, Iraq, for helping me Perform the
laboratory animal anatomy. I would like to thank for Mrs.
Mounira Hmani-Aifa (Committee President), Mrs. Noura
Bougacha (Reporter), Mrs. Rim Frikha (Reporter), Mr. Mongi
Saoudi (Examiner) for their valuable advices and sound
guidance in evaluating this work.
I would also like to thank everyone who supported me and
helped me, and provided the appropriate environment for the
success of this current research plan, even with a kind word.
Ghassan
IV
The content list
Title N.
- Title
- List Of Publications II
- Dedication III
- Acknowledgments IV
- Abbreviations List XII
Abstract XIV
- Introduction 1
- Aims of the study 3
1. Literature 4
1.1. The stem cell history 4
1.2 Classification of the stem cells 5
I Types of stem cells according to the source 5
II Types of stem cells according to the differentiation 16
1.3. Therapeutic uses of the stem cells 20
1.4. Lupus disease 22
1.4.1. Lupus Epidemiology 23
1.4.2. Causes of lupus 25
1.4.3. Types of LUPUS 25
1.4.4. Clinical signs of lupus 26
1.4.5. Pathophysiology of the lupus 27
1.4.6. The genes related to the Lupus 32
1.4.7. Lupus Diagnosis 32
1.4.8. Lupus treatment 33
1.5. Role of the mesenchymal stem cells in lupus therapy 34
Materials and Methods 36
1.1 The materials 37
1.2. The study animals 38
1.3. The study designs 39
1.4. BALB/C model mice 39
1.5. The experimental designs 40
1.6. Collection of blood 42
1.7. The lupus diagnosis confirmation 43
1.8. The BALB/c BM-MSCs preparation 43
1.9. Administration of BALB/c- BM- MSCs 44
V
1.10. The used ELISA kits 44
1.10.1. Mouse Anti-nuclear antibody (ANA) ELISA Kit 44
1.10.2. Mouse anti -ds DNA ELISA Kit 45
1.10.3. Mouse CCL2 (MCP-1) Uncoated ELISA 45
1.10.4. Mouse RANTES ELISA Kit (CCL5) 45
1.10.5 Mouse ICAM-1 ELISA Kit 46
1.10.6. Mouse IL‑6 ELISA Kit 46
1.10.7. Mouse IL-10 ELISA Kit 46
1.10.8. Mouse Interferon gamma ELISA Kit 47
1.10.9 Mouse TGF beta 1 ELISA Kit 47
1.10.10 Mouse VEGF kit 48
1.11 The molecular examination 48
1.11.1 The used primers 49
1.11.2 Total RNA Extraction and Reverse Transcriptase 66
1.12. Histopathological examination 49
1.13. Morphometry 51
1.14. Statistical analysis 51
The results and the discussion 52
1.1. ANA and Anti dsDNA levels (The serological tests) 52
1.2. The cytokine and chemokines levels (Serological tests) 54
1.3. The molecular examination (RT-PCR) 60
1.4. The histopathological examination 70
1.4.1 Liver 70
1.4.2 Kidney 75
1.5. The correlation study 81
The conclusion and Perspectives 87
1.1. The conclusion 87
1.2. The Perspectives 89
References 91
Annexes 118
The published papers 153
VI
The tables list
Table N. Title Page N.

Table 1 types of the stem cells that mentioned in the current 19
study with sources
Table 2 illustrate the used materials and equipment’s in the 37
current work
Table 3 The ELISA kits used in the study 44
Table 4 The used primers in the study 48
Table 5 ANA and Anti dsDNA level before and after BM-MSCs 53
therapy in the lupus group (G1) and treated group (G2)
Table 6 The fold change values of the IL-10 gene 60
Table 7 Values of the fold change of IL-6 encoding gene 61
Table 8 The fold change values of the TGF-β1 gene 62
Table 9 The fold change values of the CCL-2/MCP-1 gene 63
Table 10 Values of the fold change of CCL-5/RANTES encoding 64
gene
Table 11 Values of the fold change of the VEGF-A encoding gene 65
Table 12 Values of the fold change of the ICAM-1 gene in study 66
groups
Table 13 Values of the fold change of IFN-γ-encoding gene in study 67
groups
Table 14 The correlation relationship between the cytokines and 81
chemokines that used in the first group (G1) by using
liner R Pearson tests
VII
The figures list
Figure N. Title Page N.

Figure 1 Immunostaining for alkaline phosphatase, GM-CSF-R, 6
RANK-L, and Cbfa-1 in differentiating murine
embryonic stem cell cultures after induction and
enrichment for the osteoblast lineage. Numerous
discrete cell colonies can be seen which, on the basis of
this pattern of immunostaining, were identified as
osteoblasts
Figure 2 Whartons Jelly Human Mesenchymal Stem Cells, 9
wherever, A: control UCB-MSCs, B: differentiated
UCB-MSCs, C: control WJ-MSCs, D: differentiated
WJ-MSCs
Figure 3 Human Mesenchymal Stem Cells-Bone Marrow 10
(HMSC-bm)
Figure 4 Characterization of hPSC and hPSC-derived 12
endothelial progenitor cells (A) Immunostaining
analysis for OTC4 and SSEA4 expression on human
pluripotent stem cells. (B) Immunostaining analysis for
Sox17 and VE-cadherin expression on hPSC-derived
endothelial progenitors (EPs) on day 6. Scale bars, 50
μm
Figure 5 Phenotypes of NESCs at different differentiation stages 13
in vitro. Differentiated NESCs (12 days in vitro) stained
for Sox2 (red), beta III tubulin (Tuj1, green) and DAPI
(blue). Scale bar= 30 µm.
Figure 6 Oral mucosa in mice. Diagram of buccal mucosa taken 14
from C57BL/6 model. There are several layers (basal,
spinous, granular and cornified). The epithelial stem
cells are seen in below the layers
Figure 7 Clinical signs of cutaneous lupus in the human, the 27
lesion placed in different site, A: on the back, B: on the
lips, C: on the hand, D: on the face.
Figure 8 Illustrative chart showing simple Pathophysiology of 29
the lupus
Figure 9 Illustrated study design of the current work 39
Figure 10 Steps of preparation of the activated lymphocyte DNA 42
(ALD DNA) according to (Qiao et al. 2005)
Figure 11 Concentration of IL-10 in study groups 54
VIII
Figure 12 Concentration of IL-6 in study groups 55
Figure 13 Concentration of TGF-β1 in study groups 56
Figure 14 Concentration of CCL-2/MCP-1 in study groups 57
Figure 15 Concentration of CCL-5 in study groups 57
Figure 16 Concentration of VEGF-A in study groups 58
Figure 17 Concentration of ICAM-1 in study groups 58
Figure 18 Concentration of IFN-γ in study groups 59
Figure 19 The chart shows the fold changes values of the IL-10 61
gene
Figure 20 The chart shows the fold changes values of the IL-6 62
gene
Figure 21 The chart shows the fold changes values of the TGF-β1 63
gene
Figure 22 The chart shows the fold changes values of the CCL- 64
2/MCP-1 gene
Figure 23 The chart shows the fold changes values of the CCL-5 65
gene
Figure 24 The chart shows the fold changes values of the VEGF-A 66
gene
Figure 25 The chart shows the fold changes values of ICAM-1 66
gene
Figure 26 The chart showed the fold changes values of IFN-γ gene 67
Figure 27 Liver section with hepatocytes necrosis (black arrow), 70
hydropic degenerated hepatocytes (blue arrows), and
dilated sinusoids (yellow arrows), viable cells (red
arrow) (G1). H&E, 100X.
Figure 28 Liver section with sinusoids dilatation (black arrows) 70
and hepatocytes atrophy (G1). H&E, 40X.
Figure 29 Liver section with severe hemorrhage, hepatocytes 70
necrosis, sinusoids dilatation (G1). H&E, 400X.
Figure 30 Liver section with loss of normal striation of 70
hepatocytes, atrophy and necrosis of hepatocytes and
sinusoids dilatation (G1). H&E, 40X.
Figure 31 A- The engorged central vein (CV), loss of normal 71
striation of the hepatocytes (black arrow), hepatocytes
necrosis (blue arrow), and sinusoids dilation (red
arrow). H&E, 100X. B- The engorged central vein (CV),
loss of normal striation of hepatocytes, severe necrosis
IX
of hepatocytes (blue arrow), and dilation of sinusoids
(black arrow) (G1). H&E, 400X.
Figure 32 A- Normal liver architecture. H&E, 40X. B- Normal 71
hepatocytes (black arrows), focal area of necrosis (blue
arrow). H&E, 100X. C- The normal hepatocytes with
prominent nuclei and deeply eosinophilic cytoplasm;
necrotic hepatocytes and sinusoids dilation (G2). H&E,
400X.
Figure 33 Liver Section with normal liver architectures. H&E 72
(G3), 40X.
Figure 34 Liver Section with normal liver architectures (G3). 72
H&E, 100X.
Figure 35 Liver section with normal hepatocytes. H&E, 400X 72
(control group)
Figure 36 Kidney section with atrophy of glomeruli (black arrow); 75
some glomeruli are normal (yellow arrows) (G1), H&E,
4X and 400X.
Figure 37 The severe necrosis of renal tubules of the kidney (blue 76
arrows), vascular dilatation (yellow arrow), obliteration
of some renal tubules (black arrow), fibrosis (pink
arrow) of interstitial tissue between renal tubules,
hemorrhage (H), and deposition of eosinophilic
materials (green arrow) in the lumen of the renal tubule
(G1) H&E, 400X.
Figure 38 Almost normal renal tubules of the kidney, but 76
sloughing of the epithelial lining of a few renal tubules
(yellow arrows) was also seen (G2), H&E, 400X.
Figure 39 Normal renal glomeruli of the kidney (black arrows) 77
and few atrophied glomeruli (blue arrow) were also
seen; almost normal renal tubules with slightly sloughed
lining epithelium (yellow arrows) of renal tubules were
evident (G2). H&E, 40X and 400X.
and renal tubules, but mild sloughing of lining
epithelium (red arrow) were also evident (G2). H&E,
40X, 100X, and 400X.
and renal tubules in (G3). H&E, 400X.
Figure 42 Normal renal glomeruli and renal tubules of the kidney 78
X
(G4) (control group), H&E, 100X and 400X
XI
Abbreviations List
Abbreviations The details

(AANA) Anti-ANA
(AD-MSC) Adipose tissue-derived mesenchymal stem cell
(Ads DNA) Anti-dsDNA
(ASC) Adult stem cells
(ASCs) Adipose tissue-derived mesenchymal stem cells
(BAFF) B-cell activating factor
(BM) Bone marrow
(BM-MSCs) Bone marrow mesenchymal stem cells
(Bregs) Regulatory B cells
(CCLE) Chronic Cutaneous Lupus Erythematosus
(CFSE) carboxyfluorescein diacetate succinimidyl ester
(CFU) Colony-forming unit
(CK) Cytokeratins
(DRL) Drug Related Lupus
(dsDNA) Anti-double-stranded DNA
(EGCs) Embryonic germ cells
(ESCs) Embryonic stem cells
(EVs) Extracellular vehicles
(gDNA) genomic DNA
(HMGB-1) High-mobility group box 1
(hMSC) cells Human bone marrow-derived mesenchymal stem
(HSC) Hemopoietic stem cells
(hUCMSCs) cells Human umbilical cord mesenchymal stem
(IFN-γ) Interferon-gamma
(IL-17) Interleukin-17
(iPSCs) Induced pluripotent stem cells
(ISC) Infant stem cells
(MCP-1) Monocyte chemotactic protein-1
(MHC) Major histocompatibility complex
(MIT) Massachusetts Institute of Technology
(MRL/lpr) Lupus-prone MRL/Mp-lpr/lpr
(MSC) Multipotent stem cells
XII
(MSC-EVs) MSC-derived extracellular vesicles
(MSCs) Multipotent mesenchymal stem cells
(MSCT) MSC transplantation
(NSC) Nullipotent stem cells
(NZB/NZW) hybrid New Zealand mice
(OS) Overlap Syndromes
(OSC) Oligopotent stem cells
(PB) Peripheral blood
(PBS) Phosphate-buffered saline
(PGCs) Primordial germ cells
(PSC) Pluripotent stem cells
(SCLE) Subacute Cutaneous Lupus Erythematosus
(SCNT) Somatic cell nuclear transfer
(SLE) Systemic Lupus Erythematosus
(SLEDAI) SLE disease activity index
(ST-HSC) Short term HSC
(Tfh) T follicular helper
(Tfh) Th1, Th2, T follicular helper
(TGF-β1) Transforming growth factor beta1
(Th) T helper
(TSC) Totipotent stem cells
(U.S.FDA) United States food and agriculture association
(UCB) Umbilical cord blood
(UC-MSCc) Umbilical cord mesenchymal stem cell
(USC) Unipotent stem cells
(WJ-MSCs) Wharton's jelly mesenchymal stem cells
XIII
Abstract:
Systemic lupus erythematosus (SLE) causes inflammatory reactions in the
body's organs. SLE causes disturbance and bad regulation of the immune response,
particularly in the immune cells and cytokines. The work aims to evaluate the
levels of some cytokines levels in mice with SLE, and then treated by bone marrow
Mesenchymal stem cells (BM-MSCs), determine the expression genes of some of
the cytokines encoding genes, and investigate the histopathological changes in the
liver and kidney. This study was carried out for the first time, especially
concerning studying most of the cytokines that have a close relationship with lupus
disease and also with regard to studying the genes that encode those cytokines to
determine the relationship between them. (40) Male BALB/c mice are randomly
divided into four groups, each consisting of ten mice. The experiment study was
done in the animal house of Veterinary Medicine College, Al-Qadisiyah
University. G1 is injected activated lymphocytes Derivative (ALD-DNA) S/C
(three doses) at the (0, 14, and 28) day of the experiment beginning for induction
lupus. G2 was injected (ALD-DNA) S/C (three doses) on the (0, 14, and 28) day of
the experiment beginning for induction SLE, then treated with a single dose of
BM-MSCs (0.5×106) IV for 10 grams. G3 was administered a single dose of BM-
MSCs (0.5×106) IV for 10 grams. G4 administrated PBS only. After finishing the
induction and treatment time, all the animals were sacrificed to collect the blood
and tissue samples to determine the cytokines and chemokines levels by Eliza kits
and determine the gene expression of the cytokines and chemokines encoding
genes by RT-PCR techniques; moreover, determine the histopathological changes
of the liver and kidney. The results showed a significant increase in ANA and anti-
dsDNA in G1 and a decrease in G2 compared with G3 and G4. There is no
significant difference between G3 and G4 in ANA and anti-dsDNA levels. G1
showed a significant increase in IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2,
and IFNγ levels and a decrease in IL-10 and TGFβ1 than in the control group. G2
reveals low levels of IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2/MCP-1, and
IFNγ but showed higher levels of IL-10 and TGFβ1 than in control. Furthermore,
G3 has no significant differences from G4 at. G1 showed significantly higher gene
expression of IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2, and IFNγ-encoding
genes and low gene expression of IL-10 and TGFβ1-encoding genes than in
control. G2 reveals a low significant gene expression of IL-6, CCL-5/RANTES,
VEGF, ICAM, CCL-2/MCP-1, and IFNγ-encoding genes while showing
significantly high gene expression of IL-10 and TGFβ1-encoding gene as
compared with the control group. G3 doesn't show any changes in the gene
expression of the cytokines and chemokines as compared to the control group. The
histopathological changes in the liver in G1 included hepatocyte necrosis, dilated
sinusoids, hemorrhage, and normal striation of hepatocyte loss. G2 showed normal
XIV
hepatocytes but also a focal area of necrosis. G3 and G4 showed normal
architecture of the liver tissue. The kidney in G1 showed glomeruli atrophy, tubule
necrosis, vascular dilatation, obliteration of some tubules, and interstitial fibrosis.
There are hemorrhages and deposition of eosinophilia in the tubule lumen. G2
showed almost normal tubules but slight sloughing of the epithelial lining of a few
tubules and a few atrophied glomeruli. G3 and G4 have normal glomeruli, normal
proximal, distal, and convoluted tubules. The correlation study was done between
the used cytokines and chemokines and showed that G1 showed a positive
correlation between IL-10 and IL-6 and CCL2 and VEGF. However, it showed a
negative correlation between IL-10 and CCL2, IL-10 and VEGF, IL-6 and VEGF,
and TGF- β1 and CCL2. G2 doesn't show any correlation relationship between the
used parameters. G3 showed a negative correlation between TGF β1 and CCL-2
and IL-6 and INF- γ, while the rest of the relationships between the criteria used
did not show a clear correlation relationship. G4 doesn't show a relationship
between the used parameters, except correlation between CCL-5 and INF- γ
(positive correlation) and between TGF β1 and VEGF (negative correlation). BM-
MSCs have an essential and effective therapeutic role in treating lupus at the
serological and molecular levels of the cytokines and the histopathological levels
by regulating cytokine production and gene expression of the cytokines treating the
lupus disease.
Keywords: ELIZA, RT-PCR, mice, mesenchymal stem cells, cytokines, Balb/c
SLE
XV
Résumé:
Le lupus érythémateux disséminé (LED) provoque des réactions

inflammatoires dans les organes du corps. Le LED provoque des perturbations et
une mauvaise régulation de la réponse immunitaire, en particulier dans les cellules
immunitaires et les cytokines. Le travail vise à évaluer les niveaux de certaines
cytokines chez les souris atteintes de LED, puis traitées par des cellules souches
mésenchymateuses de la moelle osseuse (CS-MMO), à déterminer l'expression de
gènes de certains gènes codant pour les cytokines, et à étudier les changements
histopathologiques dans le foie et les reins. Cette étude a été réalisée pour la
première fois, notamment en ce qui concerne l'étude de la plupart des cytokines qui
ont une relation étroite avec la maladie lupique, ainsi qu'en ce qui concerne l'étude
des gènes qui codent pour ces cytokines afin de déterminer la relation entre
elles.Les souris mâles BALB/c sont réparties en quatre groupes au hasard, chacun
comprenant dix souris. L'étude expérimentale a été réalisée à la maison des
animaux de la Faculté de médecine vétérinaire de l'université Al-Qadisiyah. Le G1
est injecté avec des lymphocytes activés dérivés (ALD-DNA) S/C (trois doses) aux
jours 0, 14 et 28 du début de l'expérience pour induire le lupus. Le G2 est injecté
avec (ALD-DNA) S/C (trois doses) aux jours 0, 14 et 28 du début de l'expérience
pour induire le LES, puis traité avec une seule dose de BM-MSCs (0,5×106) IV
pour 10 grammes. Le G3 reçoit une seule dose de BM-MSCs (0,5×106) IV pour 10
grammes. Le G4 reçoit uniquement du PBS. Après avoir terminé l'induction et le
traitement, tous les animaux ont été sacrifiés pour prélever des échantillons de sang
et de tissus afin de déterminer les niveaux de cytokines et de chimiokines à l'aide
de kits Eliza, et pour déterminer l'expression génique des gènes codant pour les
cytokines et chimiokines par des techniques de RT-PCR; de plus, déterminer les
changements histopathologiques du foie et des reins. Les résultats ont montré une
augmentation significative de l'ANA et de l'anti-dsDNA dans le groupe G1, tandis
qu'il y a une diminution dans le groupe G2 par rapport aux groupes G3 et G4. Il n'y
a pas de différence significative entre les groupes G3 et G4 dans les niveaux
d'ANA et d'anti-dsDNA. Le groupe G1 a montré une augmentation significative
des niveaux d'IL-6, de CCL-5/RANTES, de VEGF, d'ICAM, de CCL-2 et d'IFNγ,
ainsi qu'une diminution de l'IL-10 et du TGFβ1 par rapport au groupe témoin. Le
groupe G2 présente des niveaux faibles d'IL-6, de CCL-5/RANTES, de VEGF,
d'ICAM, de CCL-2/MCP-1 et d'IFNγ, mais des niveaux plus élevés d'IL-10 et de
TGFβ1 que le groupe témoin, de plus, le groupe G3 ne présente pas de différences
significatives par rapport au groupe G4. G1 a montré une expression génique
significativement plus élevée des gènes codant pour l'IL-6, le CCL-5/RANTES, le
VEGF, l'ICAM, le CCL-2 et l'IFNγ, et une faible expression des gènes codant pour
l'IL-10 et le TGFβ1 par rapport au groupe témoin. G2 révèle une faible expression
XVI
génique significative de l'IL-6, du CCL-5/RANTES, du VEGF, de l'ICAM, du
CCL-2/MCP-1 et des gènes codant pour l'IFNγ, tout en montrant une expression
génique significativement élevée des gènes codant pour l'IL-10 et le TGFβ1 par
rapport au groupe témoin. G3 ne montre aucun changement dans l'expression
génique des cytokines et des chimiokines par rapport au groupe témoin. Les
changements histopathologiques dans le foie de G1 comprenaient une nécrose
hépatocytaire, des sinusoïdes dilatés, des hémorragies et une perte normale de
striation des hépatocytes. G2 a montré des hépatocytes normaux mais aussi une
zone focale de nécrose. G3 et G4 ont montré une architecture normale du tissu
hépatique. Le rein de G1 a montré une atrophie des glomérules, une nécrose des
tubules, une dilatation vasculaire, une oblitération de certains tubules et une fibrose
interstitielle. Il y a des hémorragies et un dépôt d'éosinophiles dans la lumière des
tubules. G2 a montré des tubules presque normaux mais un léger décollement de la
muqueuse épithéliale de quelques tubules et quelques glomérules atrophiés. G3 et
G4 ont des glomérules normaux, des tubules proximaux, distaux et alambiqués.
L'étude de corrélation est réalisée entre les cytokines et les chémokines utilisées et
a montré que G1 a montré une corrélation positive entre IL-10 et IL-6, ainsi
qu'entre CCL2 et VEGF. Cependant, il a montré une corrélation négative entre IL-
10 et CCL2, entre IL-10 et VEGF, entre IL-6 et VEGF, et entre TGF-β1 et CCL2.
G2 ne montre aucune relation de corrélation entre les paramètres utilisés. G3 a
montré une relation de corrélation négative entre TGF β1 et CCL-2, ainsi qu'entre
IL-6 et INF-γ, tandis que le reste des relations entre les critères utilisés n'a pas
montré de relation de corrélation claire. G4 ne montre pas de relation de
corrélation entre les paramètres utilisés, à l'exception de la corrélation entre CCL-5
et INF-γ (corrélation positive), ainsi qu'entre TGF β1 et VEGF (corrélation
négative). Les BM-MSCs ont un rôle thérapeutique essentiel et efficace dans le
traitement du lupus au niveau sérologique en transmettant les cytokines aux
niveaux normaux et au niveau moléculaire en régulant l’expression des gènes et le
niveau histopathologique en traitant les changements histopathologiques
pathologiques pathologiques.
Mots-clés: ELIZA, RT-PCR, souris, cellules souches mésenchymateuses,
cytokines, Balb/c SLE
XVII
Introduction
Introduction
An immune system disorder against the body tissues causes Systemic Lupus
Erythematosus (SLE) or Lupus. Lupus is an inflammatory hereditary chronic
disease. The children inherit their parents' genetic factors predisposing them to
SLE (García-Carrasco et al., 2013).
The causes of Lupus are unknown, but the genetic, environmental, and
hormonal factors greatly affect lupus development. Lupus occurs nine times more
commonly in women than men (Ameer et al., 2022). Lupus appears in all ages and
both genders. The environmental agents include sunlight, medicine, viruses, food,
and chemical substances that have a role in the occurrence of Lupus (Justiz
Vaillant et al., 2023). The main cause of Lupus is not precisely known yet
(Fernandez and Kirou, 2016). Lupus includes inflammation of the skin, joints, and
membranes of the lung, heart, and kidneys, and also development to impair the
immune system (D'Cruz, 2006).
Lupus has six types: SLE, Neonatal Lupus, Chronic Cutaneous Lupus
Erythematosus, Overlap Syndromes, Drug Related Lupus, and Subacute Cutaneous
Lupus (Ameer et al., 2022). Lupus usually includes skin rashes on the face, which
increase after exposure to sunlight (butterfly shape), and rashes can make marks on
other parts of the body (Metry et al., 2019).
Also, lupus symptoms included fatigue, fever, appetite, and weight loss. The
whitening bruising on the fingertips is demonstrated in some patients (Batool et al.,
2016). Lupus affects various organs, such as the brain and spinal cord.
Neurological symptoms can occur in some individuals with Lupus, ranging from
mild to severe. Lupus causes cognitive Dysfunction, Seizures, Psychiatric
Symptoms, Headaches, and Vasculitis. Lupus Patients have pain and swelling of
the joints. The kidney is the important and greater organ that is the target of Lupus,
and nearly 50% of the patients have impaired renal. The edema in the legs is
formed in some patients with protein loss. Some patients may have renal failure
(Justiz et al., 2023).
The classical therapy of lupus disease is to stop the disease progression and
complications. Immunosuppressive and Anti-inflammatory drugs are used against
the inflammations that occur due to Lupus (Kuhn et al., 2015). The long uses and
high doses of Corticosteroids have negative effects on health. The studies show the
side effects of Anti-inflammatory drugs include weight gain due to fluid retention,
1
Introduction
high blood sugar, osteoporosis, mood changes, insomnia, gastrointestinal Issues,

skin Changes, cataracts and glaucoma, suppression of the Immune System, and
adrenal Suppression. Therefore, there is an urgent need to find new treatments for
Lupus due to the disadvantages and negatives caused by anti-inflammatory drugs
(McKeon et al., 2020). New and modern ways to treat Lupus use stem cells, which
decrease inflammation, especially in cases that don't respond to the classical way.
The stem cells can be used for the same honor to prevent cross-reaction. Stem cells
can transform into cells in the damaged organs as part of treating SLE (Li et al.,
2021).
Many types of stem cells are prepared from the fetus, embryo, and adult. The
stem cells are promised to revolutionize regenerative medicine's future in treating
autoimmune diseases (Charitos et al., 2021). The mesenchymal stem cells can
differentiate into many types of specific cells after the continued division. The
division has two kinds: symmetric (formed by two stem cells) and asymmetric
(started by one stem cell and one specialized cell). The specialized cells include
differentiated tissues like neurons, oligodendrocytes, and astrocytes (Tuazon et al.,
2019).
Stem cell therapy may be one of the most promising new medical dimensions
for treating Lupus, especially for people who do not respond well to more
traditional forms of treatment. Physicians have treated Lupus patients with
mesenchymal stem cells for over ten years. Many studies have been conducted on
the safety and efficacy of cell therapy for Lupus, with over 200 participants (Cheng
et al., 2021).
Mesenchymal stem cells treat patients with autoimmune diseases and

degenerative disorders (Hoang et al., 2022). The study of lupus disease has its own
set of limitations. The limitations and challenges of the lupus study include that
Lupus is a complex and heterogeneous disease. Patients can present with a wide
range of symptoms, and the disease can vary in severity. The exact cause of Lupus
is not well understood. Some studies on Lupus may have limited sample sizes,
which can affect the generalizability of the findings. Some studies rely on
retrospective data, meaning researchers analyze existing data rather than collecting
new ones. Lupus has been observed to affect different ethnic groups and
geographical regions differently. It can be challenging to establish a direct cause-
and-effect relationship in lupus studies. Long-term studies that follow individuals
2
Introduction
over many years are crucial for understanding the progression of Lupus. Some
biomarkers are associated with Lupus; the search for specific and reliable
biomarkers to aid in diagnosis, prognosis, and treatment response is ongoing. The
medications used to treat Lupus can also introduce confounding variables in
studies. Some studies rely on patient self-reported data, which may introduce recall
bias or be subject to interpretation (Piga et al. 2021).
Aims of the study:
The main aim of the current work is to treat Lupus by mesenchymal stem
cells in mice, and this aim includes many objectives:
1- Determination of some of the cytokines and chemokines levels in BALB/C

Mice with SLE.
2- Determination of some of the cytokines and chemokines levels in BALB/C in
SLE mice treated by with bone marrow-mesenchymal stem cells.
3- Determination of the gene expression of some cytokines and chemokines
encoding genes in the study groups.
4- Determination of the histopathological changes of the liver and kidney tissues
in all the study groups.
5- Determination of the correlation relationship between the used parameters.
3
Literature
Literature
1.1. The stem cell history:

The stem cells emerge from the germ, embryo, and mature cells. The Stem cells
promise to treat some diseases, such as autoimmune diseases and regenerative
medicine (Charitos et al., 2021).
Politics, religion, ethics, and morality all factor into the widespread fascination
with and discussion of stem cell research. Controversies have arisen regarding
which form of stem cell should be used in the future, given the enormous
adaptability of embryonic stem cells and the unprecedented studies revealing the
plasticity of adult stem cells (Zakrzewski et al., 2019). The human fascination with
creatures that can heal themselves has a long history. The extraordinary
physiological process of regeneration is the organization of neighboring tissues to
replace an injured or severed body section. Despite all the necessary directions for
producing the tissue from the embryonic tissues of the mammals have lost the
regenerative ability, perhaps as a trade-off for more proficient wound healing
ability, compared to several invertebrates like planarian flatworms and Hydra
(Boroviak et al., 2014).
The majority of dedifferentiation-independent events that occur throughout the

process of tissue healing in mammals are events that come from the activation of
the stem cells. On the other hand, some vertebrates, such as salamanders, can
restore damaged body parts by dedifferentiating specialized cells into precursor
cells. This process is called regenerative capability. Stem and progenitor cells are
the fundamental building blocks for almost all kinds of regenerative processes.
Either they have always been there, as is the case with mammals, or they came into
being due to a process called dedifferentiation (Vazin and Freed., 2010).
The root of plants contain stem cells in their respective tissues. The phrase
"stem cell" may be traced back to early botanical monographs documenting plant
meristems' regenerative capability. These publications served as the term's
etymological origin (Liu et al., 2020).
Stem cells promise to regeneration medicine and improve our lives with
panaceas for every possible ailment. This rhetoric also suggests that stem cell
treatment may someday be able to halt the process of aging in the future. Several
political objectives, in addition to a large number of religious and real ethical
issues, are now caught up in the frenzy that the media have generated. To add
4
Literature
gasoline to the ongoing controversy, embryonic stem cell research is linked to

reproductive cloning (Granot Storb, 2020).
Many patients with leukemia and immunological and other blood disorders
inspire the hope that someday, in the not-too-distant future, stem cell therapy will
be used to treat a large number of debilitating diseases affecting humans. There is
little doubt that research on stem cells that might eventually lead to new cures in
the field of reparative medicine has the potential to improve the lives of millions of
people all over the globe, and there is strong cause to be excited about this
possibility. The route to creating a cell-based treatment that is both effective and
safe for broad use is a long one, and it requires the resolution of many
technological, regulatory, ethical, and safety challenges (Rodrigues et al., 2019).
1.2. Classification of the stem cells

I- Types of stem cells according to the source:
A-Embryos stem cells
1-Embryonic stem cells:
Embryonic stem cells (ESCs) are cells derived from the inner cell mass of the
blastocyst before implantation. They are pluripotent, have an unlimited capacity
for self-renewal, and can differentiate into any somatic cell type (Young, 2011).
ESCs were cultured with the necessary growth factors to maintain ESCs in an
undifferentiated state. ESCs, developed for clinical use, are cultured and
maintained in serum- and feeder-free conditions and undergo extensive
microbiologic testing per recommendations from the International Stem Cell
Banking Initiative (Dupont et al., 2019). Many human embryonic stem cell lines,
including those for Huntington's disease and cystic fibrosis, have been generated
from embryos that had monogenic hereditary illnesses or chromosomal
abnormalities. The modeling of illnesses using these cell lines leads to a deeper
comprehension of the factors contributing to the diseases' genesis and pathology
(Lee and Lee, 2011).
Healthy MSC lines can differentiate into specific cells to reconstruct tissues
such as traumatic and infective lesions. Human ESCs treat tissue degeneration,
heart and blood vessel diseases, and tumors (Golchin et al., 2020). Human ESCs
have high effects in treating degenerative diseases (Pera et al., 2000). ESCs can
also self-renew indefinitely, in addition to their wide pluripotential, which puts
5
Literature
them at increased risk for uncontrolled growth and the development of tumors
(Rippon and Bishop, 2004).
Blastomeric proliferation is necessary for the shift from blastocysts to ESCs,
which affects the blastocysts' cells and genes. The undifferentiated ESCs do not
provoke an immune response upon transplantation; this is not true for more
differentiated cells derived from ESCs, which begin to express major
histocompatibility complex (MHC). MHC matching is indicated when ESCs are
used clinically (Vazin and Freed, 2010), as shown in Figure 1.
Figure 1: Immunostaining for alkaline phosphatase, GM-CSF-R, RANK-L,

and Cbfa-1 in differentiating murine embryonic stem cell cultures after
induction and enrichment for the osteoblast lineage. Numerous discrete cell
colonies can be seen, which, based on this pattern of immunostaining, were
identified as osteoblasts (Bishop et al., 2002).
6
Literature
2-Embryonic Germ Stem Cells:

Embryonic germ cells (EGCs) are pluripotent stem cells derived from primordial
(PGCs). PGCs are progenitors of adult gametes, which diverge from the somatic
lineage between late embryonic and early fetal development. First derived from the
mouse, EGCs are derived from humans, chickens, and pigs (National Research
Council, 2002).
EGCs are capable of long-term self-renewal through clonal expansion in an
undifferentiated state, and they can differentiate in vitro to form embryoid bodies
that contain cells representing all three germ layers and mixed cells with
low differentiated progenitors and precursors (Kerr CL et al., 2006).
This is also confirmed in vivo by producing artificially produced
teratocarcinoma in these cells after they have been transplanted. In addition, it has
been shown that embryonic germ cells from mice, pigs, and chickens all contribute
to the experimental production of chimera animals, including germline transfer. It
is essential to note that EGCs exhibit regular and stable karyotypes in addition to
typical genomic imprinting, including X-inactivation. There are many reports that
transplant stem cells in a wide variety that affect humans, including diabetes and
autoimmune diseases (Pelosi et al., 2011).
3- Fetal stem cells:

Fetal stem cells can be isolated from fetal blood and bone marrow as well as
from other fetal tissues, including the liver and kidney (O'Donoghue, and Fisk,
2004).
The hemopoietic stem cells in fetal blood multiply faster than those in adult
bone marrow or cord blood. Fetal blood is a rich source of HSC. A population of
MSC may also be seen in fetal blood during the first trimester. These cells can
sustain hemopoiesis and develop along numerous lineages (Pei and Pei, 2022)
(Ishii and Eto, 2014).
The ethical debate around fetal stem cells is far less heated than those
surrounding embryonic stem cells. Yet, their differentiation potential seems larger
than that of adult stem cells. The use of fetal stem cells as potential therapeutic
tools for cell transplantation has shown tremendous promise, and fetal stem cells
are strong instruments that may be used to investigate many aspects of cell biology
(Witt et al., 2017).
7
Literature
B-Infant stem cells:

1- Umbilical cord stem cells:
The umbilical cord is a rich supply of hematopoietic stem cells, which may be
utilized to rebuild the blood system. These cells are simple to extract and
cryopreserve. Umbilical cord blood is a rich source of hematopoietic stem cells.
The stem cells can differentiate into non-hematopoietic cell types, such as bone,
neural, and endothelial cells (Forraz and McGuckin, 2011) (Ruhil et al., 2009). As
of right now, the amount of these specialized cells that are capable of the
differentiation process into non-hematopoietic cells is limited, and this continues to
be a barrier to the clinical development of umbilical cord stem cells for use in non-
hematopoietic cell therapy (Gupta, and Wagner, 2020). Due to increased potential,
stem cells derived from umbilical cords may be used in treating certain cell and
tissue conditions (Weiss and Troyer, 2006).
2- Wharton's jelly stem cells:

Wharton's jelly mesenchymal stem cells (WJ-MSCs) are a class of stem cells
with high differentiation potential, an immuno-privileged status, and easy access
for collection, which raise no legal or ethical issues (Marino et al., 2019).
WJ-MSCs have many characteristics with embryonic stem cells, both in terms
of their phenotype and genetic makeup (Varaa et al., 2019).
WJ-MSCs may exert immunomodulatory effects. In patients with Graft-versus-

host disease (GvHD) who were unresponsive to conventional therapy, the infusion
of WJ-MSCs was shown to have a positive impact. This benefit was shown even
when the WJ-MSCs were not entirely HLA identical (Davies et al., 2017) (Liau et
al., 2020), as shown in Figure 2.
8
Literature
Figure 2: Whartons Jelly Human Mesenchymal Stem Cells, wherever, A:

control UCB-MSCs, B: differentiated UCB-MSCs, C: control WJ-MSCs, D:
differentiated WJ-MSCs (El-Demerdash, et, al. 2015).
A- Adult stem cells

1-Mesenchymal stem cells:
MSCs can differentiate into many cells, such as bone, cartilage, nerve, and
muscle (Li et al., 2019). The number of MSCs present in bone marrow is restricted
and declines with age as well as after illness. Curiously, a decline in the number of
functional MSCs has been shown to often correspond with an increase in adiposity.
According to (Ullah et al., 2015), this is one of the primary reasons osteoporotic
diseases prevent bone regeneration. According to (Ding et al., 2011), Dr. Chandra
uses lineage-tracing methodologies to correctly define mesenchymal destiny and
discover the mechanisms that influence cell fate.
Through the use of age- and radiation-related bone marrow adiposity in vivo
and in vitro, he was able to evaluate whether or not senescence plays a part in the
9
Literature
loss of MSCs that occurs as a result of their transformation into adipocytes.

According to (Andrzejewska et al., 2019) research, multidrug screening is now
looking for molecules that may control this process and have the potential to act as
possible medications to treat osteoporosis, as shown in Figure 3.
Figure 3: Human Mesenchymal Stem Cells-Bone Marrow (HMSC-bm)

(Elena, and Friedenstein, 2009).
2-Hematopoietic stem cells:

HSCs are primordial multipotent cells that have the potential to differentiate
into any kind of blood cell, including myeloid-lineage cells and lymphoid-lineage
cells (Skulimowska et al., 2022). HSCs may be found in various organs, including
bone marrow, peripheral blood, and umbilical cord blood. Peripheral blood is
another organ that contains HSCs. The functional maturity of a limited number of
multipotent HSCs that can proliferate via self-renewal and differentiation is
10
Literature
required to produce all blood cell lineages (Mosaad YM, 2014) (Morrison et al.,
1995).
In addition to their capacity for self-renewal, one characteristic that sets HSCs
apart from other mature cells is their capacity to differentiate into cells of various
lineages in a targeted and extensive manner. These results demonstrated HSC
activity and additional measurement of the potential of HSCs to create mature
blood cells in patients after myeloablation was carried out (Hawley et al., 2006).
Similar to LT-HSC, HSC/progenitors may either directly or indirectly contribute to
the process of repairing tissues and treating blood diseases (Khaddour et al., 2023).
HSCs have a high ability to differentiate into mature blood cells. Since the initial
transplantation experiments hinted at their existence over 50 years ago, the
capacity to proactively isolate HSCs has been the topic of intense inquiry (Lee and
Hong, 2020).
Despite significant advances in enrichment protocols, the continuous in vitro
propagation of human HSCs has not yet been achieved. This chapter describes
current procedures used to phenotypically and functionally characterize candidate
human HSCs and initial efforts to derive permanent human HSC lines (Bryder et
al., 2006). Hematopoietic stem cells are considered one of the most important cell
sources when treating degenerative illnesses. The adult hematopoietic stem cells
are used in many therapeutic techniques. It is considered an essential cell source in
stem cell biology. HSCs have been used in clinical and fundamental scientific
research up to this point (Eaves, 2015) (Ng and Alexander, 2017), as shown in
Figure 4.
11
Literature
Figure 4: Characterization of hPSC and hPSC-derived endothelial progenitor

cells (A) Immunostaining analysis for OTC4 and SSEA4 expression on human
pluripotent stem cells. (B) Immunostaining analysis for Sox17 and VE-
cadherin expression on hPSC-derived endothelial progenitors (EPs) on day 6.
Scale bars, 50 μm (Jung et al., 2023).
3-Neural Stem Cells:

Neural stem cells (NSCs) are self-renewing, multipotent cells that first generate
the radial glial progenitor cells that generate the neurons and glia of the nervous
system of all animals during embryonic development (Zhao et al., 2021) (Kennea,
2002). Stem cells are distinguished from other cells by their ability to undergo
differentiation into a wide variety of specialized cell types. They eventually split
into two daughter cells, the cell division (Tuazon et al., 2019), as shown in figure
5.
12
Literature
Figure 5: Phenotypes of NESCs at different differentiation stages in vitro.

Differentiated NESCs (12 days in vitro) stained for Sox2 (red), beta III tubulin
(Tuj1, green) and DAPI (blue). Scale bar= 30 µm. (Xu et al., 2022).
4-Gastrointestinal stem cells:

Turnover of the epithelial cell lineages within the gastrointestinal tract is a
constant process, occurring every (2–7) days under normal homeostasis and
increasing after damage, that give rise to all gastrointestinal epithelial cell lineages
and generate whole intestinal crypts and gastric glands (Brittan and wright, 2002).
Although the precise location of the stem cells that make up the gastrointestinal
tract has not been identified as of yet, it is widely accepted that these cells reside in
a "niche" inside the intestinal crypts and gastric glands (Umar, 2010).
The single stem cell can undergo asymmetrical cell division, allowing it to
make an identical daughter cell and reproduce. The single stem cell can also
produce a committed progenitor cell, which can later develop into an adult
epithelial cell type. Because of the evidence that they uncovered, they came to this
13
Literature
conclusion (Andersson-Rolf et al., 2017). When treated for fibrosis and Crohn's
disease by mesenchymal diseases, the stem cell has plasticity ability in many
tissues, such as differentiating into intestinal subepithelial myofibroblasts (Liand
jasper, 2016). Many studies are showed that stem cells proliferate into adult cell
lineages of the gut (Quante and wang, 2009). Adult stem cells can survive long and
regenerate large amounts of tissue (Potten, 1998). Although the stem cells of the
gastrointestinal system are among the most diligent in the body owing to the quick
pace of cell turnover in this tissue, they have not been recognized because of their
immature, undifferentiated phenotype because the rate of cell turnover in this
tissue is so high (Brittan and Wright, 2004), as shown in figure 6.
Figure 6: Oral mucosa in mice. A diagram of the buccal mucosa was taken
from the C57BL/6 model. There are several layers (basal, spinous, granular,
and cornified). The epithelial stem cells are below the layers (Jones and Klein,
2013).
14
Literature
5-Epidermal stem cells:

Understanding the biology of epidermal stem cells has various applications in
clinical medicine. The early study into the development of epidermal keratinocytes
in vitro has been of assistance to thousands of burn sufferers all over the globe.
Recent discoveries suggest that the epidermis has several stem cell reservoirs, two
of which, the interfollicular epidermis area of the hair follicle, may be able to
provide stem cells to each other in the event that one of these reservoirs is
compromised (Lenkiewicz, 2019). The skin has the potential to be an easily
accessible source of stem cells for therapeutic intervention. Furthermore, evidence
of the adaptability of skin stem cells is emphasized (Alberts et al., 2002) (Blanpain
and Fuchs, 2006). The epidermis is made of keratinocytes, Melanocytes,
Langerhans cells, and Merkel cells. The primitive epidermis emerges as a single-
cell layer throughout the process of development. This takes place at the same
time. A third intermediate layer develops between the estimated ages of 4 and 9
weeks of gestation in humans, corresponding to days 13 and 16 in mice (Lapouge
and Blanpain, 2008). The epidermis is a renewed epithelium during seven days in
mice and two months in humans due to the rapid demands of the epithelial tissues
(Morasso and Tomic-Canic, 2005).
The stem cells have an elevated capacity for self-renewal and can complete
terminal differentiation. As cells migrate upward from the bottom layer, linked to
the basement membrane, they go through the differentiation process. The dividing
cells of the skin are found in the basal layer, which also includes the basement
membrane. Packed with insoluble proteins in water, this cell serves as a barrier
between the body and its surrounding environment (Blanpain and Fuchs, 2006).
6-Hepatic stem cells:

In recent years, proof of the presence of a population of liver stem cells has only
been available thanks to the findings of research conducted on animals. It is
believed that these cells may be found in the terminal bile ductules (Forbes et al.,
2002). Hepatocyte division is the primary mechanism by which the liver recovers
from most injuries. The stem cells contribute to hepatocyte regeneration or take
over this function if the liver damage is severe and accompanied by an impairment
of hepatocyte proliferation, such as in cirrhosis or submassive/massive necrosis,
which medications, poisons, or viruses may cause. In this scenario, stem cells are
more likely to contribute to hepatocyte regeneration (Tsuchiya, 2019) (Kordes and
15
Literature
Häussinger, 2013). The oval cells may have positive staining for pyruvate kinase
isoenzyme L-PK, albumin, and alpha-fetoprotein in transforming into hepatocytes.
There is mounting evidence that stem cells derived from bone marrow may play a
role in liver regeneration (Alison et al., 2004) (Habeeb et al., 2015). The
hepatocyte transplants in animals have demonstrated that a specific percentage of
hepatocytes are can proliferate, which mean that hepatocytes have same the
functional stem cells. This gives birth to cords of potential so-called oval cells
within the lobules that can develop into hepatocytes and biliary epithelial cells
(Zhang et al., 2003).
7- Pancreatic stem cells:

Recent improvements in the success rate of islet transplantation as a beta-cell
replacement therapy have sparked fresh interest in this treatment option. New
sources of insulin-producing cells must be widely accessible if this treatment is to
be made for thousands of individuals with diabetes (Murtaugh, Kopinke, 2008)
(Bonner-Weir and Sharma, 2002) (Jiang and Morahan, 2014). Both the islets and
the ducts have been analyzed for the presence of stem cells. There is substantial
evidence that adult pancreatic stem cells exist, and multiple candidate cells have
been identified; however, no definitively recognizable pancreatic stem cell has yet
been detected (Wszoła et al., 2021) (Habener, 2004) (Memon and Abdelalim,
2020).
Expanded cells displayed near-normal insulin content and could normalize
glycemia in diabetic mice. In the second publication, multistep neural cell culture
settings were employed to grow nestin-positive cells, and then modified
circumstances caused 15% to form the clusters. These experiments demonstrate
embryonic stem cells' potential and hope that human embryonic stem cells may
yield comparable outcomes (Jiang and Morahan, 2014) (Chela et al., 2020).
II- Types of stem cells according to the differentiation:

1-Totipotent stem cells:
TPSCs can develop into the embryo's three germ cells, such as the placenta. The
fertilization can develop into a specialized cell (Ghazimoradi et al., 2022). TPSC
can differentiate into embryonic and extraembryonic cells. These cells are
produced by the first few divisions of the fertilized egg and are also totipotent. The
16
Literature
zygotic genome is demethylated by enzymatic modification of 5-methylcytosine.

The totipotent zygote lacks DNA methylation (Baker and Pera, 2018) (Cai et al.,
2022) (Mitalipov and Wolf, 2009). Totipotent stem cells are embryonic stem cells
characterized by their ability to generate all portions of a product of conception,
including the embryo and extraembryonic tissues, such as placental tissues and
fetal membranes. In the case of humans, the gametes, sperm, and egg, fuse to form
a zygote (Malik and Wang, 2022) (Morgani et al., 2013).
2-Pluripotent stem cells:

PSCs can self-renewal to produce specific cells. PSCs increase the cell lines in
human and mouse embryos (Liu et al., 2020). In Japan, the iPSC technique was
discovered by Shinya Yamanaka and Kazutoshi Takahashi in 2006 by four genes;
the encoding transcription genes convert somatic cells into pluripotent stem cells
(Kumar et al., 2015). PSCs promise in regenerative medicine. PSCs give rise to
every other cell type (liver, nerve, heart, and pancreatic); they represent a single
source of cells that replace those damaged tissues (Ye et al., 2013) (Romito and
Cobellis, 2015) (Shi et al., 2017).
Yamanaka named iPSCs with a lowercase "i" due to the popularity of the iPod
and other products. In his Nobel seminar, Yamanaka cited the earlier seminal work
of Harold Weintraub on the role of myoblast determination protein 1 in
reprogramming cell fate to a muscle lineage as an important precursor to the
discovery of iPSCs (Bragança et al., 2019). PPSCs can develop into three primary
cell groups (Abu-Dawud et al., 2018). All developed cell types are precious in
regeneration medicine and organ formation (Worku, 2021) (Zhu and Huangfu,
2013).
3-Multipotent stem cells:

Multipotent stem cells can self-renew by dividing and developing into
specialized cell types in a specific tissue or organ. Most adult stem cells are
multipotent stem cells. Stem cells are self-renewing and undifferentiated cell types
that can be differentiated into functional cells (Sobhani et al., 2017) (Lin et al.,
2019).
17
Literature
Multipotent stem cells can differentiate into all cell types within one particular
lineage. Plentiful advantages and usages exist for multipotent stem cells (Alberts B
et al., 2002). Multipotent stem cells can develop, repair, and protect tissue.
Multipotent Stem cells could be used in treating spinal cord injury, bone fracture,
autoimmune diseases, rheumatoid arthritis, and fertility preservation (Khanlarkhani
et al., 2016). MPSCs are unspecialized cells that can differentiate into body cells
with specific functions. MPSCs in bone marrow can give all blood cells. MSCs can
produce many body cell types (Mirzaei, 2018).
4-Unipotent stem cells:
These stem cells can produce only one cell type but have the property of self-
renewal that distinguishes them from non-stem cells. Examples of unipotent stem
cells are germline stem cells and epidermal stem cells. Unipotent stem cells have
the narrowest differentiation capabilities, making them a promising candidate for
therapeutic use in regenerative medicine (Zakrzewski et al., 2019) (Dulak et al.,
2015). Unipotent stem cells are derived from multipotent cells, which can only
become a limited number of cell types. Multipotent stem cells are known to create
bone, muscle, cartilage, fat, and other similar tissues. Unipotent stem cells are
derived from other types of stem cells but, at some point, differentiate them to
become a specific tissue type (De Kretser, 2007).
5-Oligopotent stem cells:

Oligopotent stem cells can differentiate into several cell types. A myeloid stem
cell is an example of a cell that can divide into white blood cells but not red blood
cells (Majo et al., 2008).
6- Nullipotent stem cells:

Non-dividing cells differentiate. Erythrocytes are nullipotent. Stem cell injury
may cause multipotency. If basal cells are not destroyed, undifferentiated stem
cells create differentiated cells (Sennerstam and Strömberg, 1984).
Because the basal cell layer is not permanently destroyed, reddened skin or
blistered skin burns will heal by producing new skin. Bone marrow is transplanted
18
Literature
frequently to treat blood and bone marrow illnesses, blood malignancies, and
immunological problems. Recently, peripheral blood and umbilical cord stem cells
have been employed to treat several blood-based disorders (Duran et al., 2001),
edtiales of the mentioned stem cells in the current study are listed in the following
tables 1.
Table 1: types of the stem cells that mentioned in the current study with
sources
Types of stem cells according to the source
Source The stem cell Abbreviation Collection
name site
Embryos Embryonic ESCs The inner cell
stem cells mass of the
blastocyst
before
implantation
Embryonic EGCs The somatic
Germ Stem lineage
Cells between late
embryonic and
early fetal
development
Fetal stem cells FSC fetal blood and
bone marrow,
fetal liver and
kidney
infant Umbilical cord UCSC Umbilical
stem cells cord
Wharton's jelly WJSC Umbilical
stem cells cord
Adults Mesenchymal MSCs Bone marrow
stem cells and adipose
tissues
Hematopoietic HSC -bone marrow,
stem cells -peripheral
blood,
-umbilical
cord
19
Literature
Neural Stem NSC CNS (brian

Cells and spinal
cord)
Gastrointestinal GISC Stomach and
stem cells intestine
Epidermal stem EDSC skin
cells
Hepatic stem HSC liver
cells
Pancreatic stem PSC Pancreas
cells
Types of stem cells according to the differentiation
Stem cell Abbreviation differentiation Samples
name Ability
Totipotent TPSC -Embryonic Embryonic
stem cells cells cells
-extraembryonic
cells
Pluripotent PPSC most of the Mesenchymal
stem cells specific cells stem cells
Multipotent MPSC Many of the Heamopetic
stem cells specific cells stem cells
Unipotent UPSC Produce only -germline
stem cells one cell type stem cells
-epidermal
stem cells
Oligopotent OPSC several cell myeloid stem
stem cells types cell
Nullipotent NPSC Non-dividing Erythrocytes
stem cells cells
differentiate
1.3. Therapeutic uses of the stem cells:

Study on human embryonic stem cells has the potential to help patients suffering
from genetic and degenerative diseases by providing transplantable cells that have
been grown in culture. In 2007, researchers from the Massachusetts Institute of
Technology (MIT) introduced the corrected gene into iPS cells derived from the
fibroblasts of the mouse. These cells had been taken from the animal. According to
20
Literature
(Hoang et al., 2022), the genes for the mouse's alpha-globin were replaced with
human alpha-globin genes, and the genes for the beta-globin were changed with
human sickle beta-globin genes (Siham, 2020).
These cells were then implanted into hs/hs mice that had been irradiated. Blood
smears taken from untreated mice revealed an excess of the sickle-shaped cells
characteristic of sickle cell anemia. Blood smears from treated mice revealed a
significantly reduced number of sickle-shaped cells. Additionally, many red blood
cells were seen in the treated mice. It is believed that a similar approach could be
made in human embryonic stem cells to replace genetic defects and test iPS cells
for effective disease-specific medications (Biehl and Russell, 2009). In 2012, a
newspaper in the United Kingdom announced that the patient who had been the
first in the country to get a transplant of embryonic stem cells had regained part of
his central vision. Marcus Hilton is one of the participants in a human clinical
safety study involving two other persons with Stargardt's disease in the United
States. Stargardt's disease is when the retina starts to deteriorate and thin, affecting
the patient's central vision (Watt and Driskell, 2010). Marcus Hilton is one of the
participants in this experiment.
At the time of his diagnosis, Hilton was ten years old and could only see in the
periphery of his field of vision. In January 2012, at age 34, he had a procedure in
which 50,000 retinal pigment epithelium cells were injected into the area behind
the retina in his right eye (Ebrahimi et al., 2021). Tiny plastic fibers seeded with
stem cells taken from the patient's bone marrow have been used to fabricate the
trachea. After being put within a container known as a bioreactor, the tissue-
engineered scaffold was then doused in a solution that made it possible for the cells
to be completely absorbed. According to (Nadig, 2009), the cells continued
proliferating even after the modified trachea was transplanted.
In 2008, a lady whose trachea had collapsed as a result of the problems caused
by TB had the first-ever trachea transplant procedure. In 2013, five years after the
incident, she was in excellent health, had good lung function, and had no
complications related to rejection. A trachea transplant created from the patient's
stem cells was performed on a patient in Eritrea in July 2011 and on a patient in
Baltimore in January 2012 by the same surgeon, Dr. Paolo Macchiarini. The
transplants were performed to replace tracheas that had been damaged by cancer.
These two cancer patients, however, did not make it through their ordeals. The
tracheal transplants have been attempted in a few youngsters (Musial and Gorska-
21
Literature
Ponikowska, 2021) (Fontes and Thomson, 1999). Both human embryonic stem
cells and induced pluripotent stem cells need a significant amount of further
investigation at the fundamental level. It does not seem that these cells are the
same as embryonic stem cells acquired from mice. It seems that embryonic stem
cells from mice proliferate and develop slower than embryonic stem cells from
humans (Mahla RS., 2016).
These cells might be used to treat various conditions, including cancer. Some
early investigations involving the transplantation of fetal neurons into Parkinson's
patients indicate improvement in some, but not all, of the patients, while some
patients have significant side effects. In addition, ethical concerns about the
beginning of life, the beginning of a parent's responsibilities, embryo rights, and
the rights of embryo donors continue to be raised concerning human embryonic
tissue use (Mousaei et al., 2022).
1.4. Lupus disease:

The autoimmune condition known as systematic lupus erythematosus (SLE) is
idiopathic. It affects all organs, most often seen in the skin, joints, kidneys, blood
cells, and nervous system, and is caused by a compromised immune system. SLE
is a chronic inflammatory illness. SLE may run in families. Unknown genetic
variables predisposing children to develop SLE may be passed on to them. It is
characterized by relapses and exacerbations (García-Carrasco et al., 2013).
The severity of the condition will determine how it is treated. It has to be

monitored often. The impacts of genetics and environment have been recognized
despite the actual cause being unclear. One of its recognized symptoms is
sensitivity to sunlight. It affects fertile women between the ages of 15 and 45 and
is nine times more frequent in women than in males. Rarely, SLE may manifest in
younger and older age groups. Hormonal variables are known to contribute to the
onset of SLE. Patients with Lupus should be aware of the possibility of infection
and coronary heart disease and take precautions against the sun. It is well-
established that various environmental elements, including sunshine, viruses,
chemicals, meals, and medications, may also function as triggers in people with
SLE (Ameer et al., 2022) (Cojocaru et al., 2011).
22
Literature
1.4.1. Lupus Epidemiology:

The epidemiological estimates of Systemic lupus erythematosus (SLE) vary
substantially worldwide due to the variability in study design, environmental
exposures, location, and characteristics of the surveyed population, including race,
sex, and age (Carter et al., 2016; Barber et al., 2021). Moreover, SLE incidence
and prevalence trends are not unified across studies (Bae et al., 2020; Leong, et al.,
2021).
The incidence of SLE in different age groups and sexes is regarding prevalence;
only three lifetime prevalence data points were self-reported, and a physician or
dermatologist diagnosed other prevalent SLE. The 1 year prevalence was the most
reported type of data and was chosen for our prevalence estimation. The detailed 1-
year period prevalence and point prevalence of SLE in different age groups and
sexes were reported in online supplemental tables (Hochberg, 1997; Flor et al.,
2020; Black et al., 2021).
Certain ethnic groups are more vulnerable than others to developing SLE, and
experience increased morbidity and mortality. Reports of the global incidence and
prevalence of SLE vary widely, owing to inherent variation in population
demographics, environmental exposures, and socioeconomic factors. Differences
in study design and case definitions also contribute to inconsistent reporting. Very
little is known about the incidence of SLE in Africa and Australasia. Mortality
from SLE is still two to three times higher than that of the general population.
Internationally, the frequent causes of death for patients with SLE include infection
and cardiovascular disease. Even without new therapies, mortality can be mitigated
with enhanced quality of care (Barber et al., 2021).
The Lupus Foundation of America estimates that (1.5) million Americans, and
at least five million people worldwide, have a form of Lupus. Lupus strikes mostly
women of childbearing age. However, men, children, and teenagers develop
Lupus, too. Ninety percent (90%) of people living with Lupus are women. Most
people with Lupus develop the disease between the ages of 15 and 44 (Pons-Estel
et al., 2010).
The best estimate based on available data on incidence is 16,000 new cases per
year (Wallace & Hahn, 2013). Systemic lupus erythematosus (SLE) may be more
prevalent among most ethnic groups in the low-and-middle-income countries; still,
23
Literature
these countries are under-represented in epidemiological data on SLE. A study

used the MEDLINE, CINHAL, Web of Science, Scopus and Global Index
Medicus databases to search for relevant studies published up to July 2022. The
study found that the mean age at diagnosis ranged from 25.5 to 45.8 years. The
SLE prevalence and incidence varied from 3.2 to 159 per 100,000 and 0.3–8.7 per
100,000 persons, respectively (Fatoye et al., 2022). The incidence and prevalence
of SLE vary widely in population demographics, socioeconomic factors, and
certain ethnic populations, such as Hispanic population, black and Asian (Carter et
al., 2016; Rees et al., 2017).
Specifically, in Europe and North America, people of African descent,
American Indians, and Alaska Natives have higher predilection and worse
outcomes from SLE than Caucasians within the same contexts (Danchenko et al.,
2006; Pons-Estel et al., 2010; Ferucci et al., 2014).
Therefore, there are numerous indications that SLE is less severe in patients of
European ancestry than in Asian, African, and certain "Hispanic" or various
indigenous populations. In Australia, Canada, and the USA, SLE disease among
aboriginal/indigenous individuals is twofold to fourfold more common compared
to non-aboriginal individuals (González et al., 2013). Furthermore, patients of Asia
and African ancestry are also likely to have a greater number of clinical
manifestations, active SLE onset, and higher mortality than white populations
(Lerang et al., 2012). The clinical technicalities and complexity of diagnosing SLE
may have contributed to assertions that the disease is infrequent in Africa.
However, emerging reports indicate that the prevalence of SLE in sub-Saharan
African was 1.7% (0.8–2.9), lower than in Asian–Pacific countries (Bertsias et al.,
2016; Barber et al., 2021).
SLE's overall incidence and prevalence across Asian–Pacific countries ranged
from 0.9 to 3.1 and 4.3 to 45.3 per 100,000, respectively. Furthermore, the
incidence of SLE in North America and Europe ranged from 3.7 to 49 and 1.5 and
7.4 per 100,000 person-years, respectively (Campbell et al., 2008; Essouma et al.,
2020). Evidence also suggests a gradual increase in SLE prevalence in North
America, Europe, and Asia. However, study design reporting bias, case definitions,
and SLE classification criteria may also result in a variation in the proportion of
the population that has SLE (Barber et al., 2021).
Despite the variation of SLE across all age groups, it is more common between
the ages of 15 and 45 years. Evidence showed that 10–20% of patients with SLE
24
Literature
disease start in childhood; this is due to increased renal, neuropsychiatric, and

cardiopulmonary disease (Lewandowski et al., 2017; Dave et al., 2020). The
gender disparity of SLE is also widely recognized, with a 1:9 ratio of male to
female patients. The incidence and prevalence of SLE in females are usually
highest at 15–44 and 45–64 years of age, respectively (Danchenko et al., 2006).
Due to environmental, genetic, and racial factors, the prevalence and incidence
of SLE varies across the world's various regions. For instance, changes in
environmental factors are associated with increased SLE (Fessel, 1974).
Furthermore, the severity and course of SLE may often be related to the difference
in education, health insurance status, income level, ethnicity, medication
compliance, and level of social support. The survival rate of SLE patients in
LMICs is lower than in high-income countries; this is due to higher mortality, poor
intervention, and co-morbidities of infection (Tikly and Navarra, 2008).
1.4.2. Causes of Lupus:

The primary etiologies of this condition and the elements that contribute to the
development of this disease are not yet fully understood. The word "wolf"
translates to "lupus" in Latin. Systemic lupus erythematosus is a form of lupus
illness. Its abbreviation, SLE, stands for SLE. Genetically predisposed people and
environmental variables contribute to the development and progression of systemic
lupus erythematosus (Maidhof and Hilas, 2012) (Fernandez and Kirou, 2016).
SLE is a disease associated with skin, heart, joints, kidneys, liver, and lung
inflammation and has a different course, resulting from impaired immune system
functioning systemic Lupus (D'Cruz, 2006) (Mok and Lau, 2003).
1.4.3. Types of LUPUS:

Lupus has six types (Ameer et al., 2022):
1- Systemic Lupus Erythematosus: spread at 70 %
2- Chronic Cutaneous Lupus Erythematosus: spread at 10%
3- Subacute Cutaneous Lupus Erythematosus: It is limited to the skin; it
occurs at (30-50) % with skin rashes.
4- Drug Related Lupus: It occurs due to taking some drugs and chemicals.
5- Neonatal Lupus occurs in the baby during the pregnancy period in the
patient with Lupus.
6- Overlap Syndromes: Lupus clinical signs mixed with the other diseases.
25
Literature
1.4.4. Clinical signs of Lupus:

Exacerbation and improvement are both possible outcomes of living with SLE.
It is possible to develop red rashes on the skin, which become more noticeable
when the person is hypersensitive to the sun. This rash, which appears on the face
as a butterfly and other rashes that may leave markings on other body regions, can
be noticed (Metry et al., 2019).
At the beginning and throughout the active course of the illness, you may
experience symptoms such as exhaustion, lack of appetite, fever, and weight loss.
These symptoms are not unique to a single disease and are typical during the active
course of many systemic diseases. Whitening of the bruises on the fingers can be
seen in certain people (Batool et al., 2016).
In addition to the typical aching in the muscles, patients may also have joint
pain and swelling; however, this does not result in any long-term harm to the joint.
The kidneys, an essential organ system, are the focus of the illness, and nearly half
of the patients may be said to be impacted by the condition. In certain cases, the
loss of protein may be accompanied by the development of edema in the legs. The
condition must be diagnosed and treated immediately for the best results. If this
does not occur, some people may develop renal failure and be forced to undergo
dialysis (Nyman et al., 2020) (Justiz et al., 2023).
Discomfort on the side of the chest that worsens with coughing or inhaling deep
may be a symptom that you have an illness that inflames the membranes
surrounding the heart and may also produce discomfort on the side of the chest.
Patients risk developing inflammation in the heart's layers and valve involvement if
they have this condition (Ballou et al., 1982).
Patients may appear with headaches, convulsions in the form of seizures, and
occasionally psychosis owing to the symptoms of the illness or the high-dose
cortisone medication that has been delivered. Patients may present with these
symptoms if the central nervous system is compromised. The central nervous
system, as well as the peripheral nervous system, may be affected by SLE.
Vasculitis is a potential complication of active SLE, and it has the potential to
impact a wide variety of organs. Vasculitis may cause impairments in organ
function, depending on which organs are involved. 10% of people have vein
blockages caused by clotting in their bodies (Fava and Petri, 2019), as shown in
Figure 7.
26
Literature
Figure 7: clinical signs of cutaneous Lupus in the humans, the lesion placed in
different sites, A: on the back, B: on the lips, C: on the hand, D: on the face
(Internet source).
1.4.5. Pathophysiology of the Lupus:

The pathophysiology of systemic lupus erythematosus involves the immune
system. Lupus Pathophysiology depends on the genetic factors, hormonal
abnormalities, and environmental factors that also play a role in disease
development. The most important environmental factors involved in the
pathogenesis of SLE include ultraviolet (UV) light and some bacterial and viral
infections. The most important genes involved in the pathogenesis of SLE include
HLA-DR2, HLA-DR3, HLA class 3, C1q, and interferon (IFN) regulatory factor 5
(Mok et al., 2003).
The most prominent events involving immune abnormalities are related to

persistent activation of B cells and plasma cells that make auto-antibodies during
disease progression. The disease developmental process begins with releasing
microparticles and pro-inflammatory cytokines from the cells undergoing
apoptosis. Due to excess apoptosis, the body cannot clear these microparticles
entirely, and these microparticles are presented to dendritic cells as antigens
(Karrar et al., 2018).
Dendritic cells process these microparticles and mature and present these as
antigens to T-cells. T-cells, microparticles, and pro-inflammatory cytokines trigger
B-cell activation and autoantibody production. As a result, body tissues lose their
self-tolerance. The most prominent events involving hormonal abnormalities are
due to prolactin and estrogen (Gallo and Gallucci, 2013).
27
Literature
On microscopic histopathological analysis, apoptotic keratinocytes,

vacuolization of the basement membrane, and dermal mucin deposition are
characteristic findings of SLE dermatitis, and active or inactive end capillary or
extra capillary segmental glomerulonephritis are characteristic findings of lupus
nephritis (Okon, and Werth, 2013). IL-10 may have a regulatory role in lupus. Role
of IL-10 in lupus is depend on the stage of the disease, the immune response kind,
and the genetic factors. IL-10 has high activity for treatment of the lupus (Karrar et
al., 2018).
There is often an increase in IL-6 levels in the lupus. Elevated IL-6 is

contributes to the activation of immune cells, the inflammatory molecules,
Contribution to Autoimmunity, and Therapeutic effects (Ding et al., 2011). TGF-
β1 has role in immune regulation, inflammation, and tissue repair. TGF-β1 has role
in lupus pathophesiological activites due to its immunoregulatory Function, tissue
Repair, and therapeutic effects (Gómez-Bernal et al., 2022). In the lupus, CCL2
has been studied for its potential role in the pathogenesis of the disease. CCL-2 has
role in inflammation, cell Recruitment and Tissue Damage, association with Lupus
Nephritis, CCL-2 has role in treatment of the lupus (Geneva-Popova et al., 2022).
CCL5 has great role in the lupus inviroment and lupus pathogenesis. It have ability
to activation of various immune cells, including T cells, monocytes, and
eosinophils. CCL5 has role in attracting immune cells to sites of inflammation, T
Cell Activation (Vyshkina et al., 2008). VEGF-A have role in growth, and vessels
formation. VEGF-A has role in lupus deu to its ability to angiogenesis is a process
involving the formation of new blood vessels, and it is a component of tissue repair
and regeneration in lupus, Lupus can affect blood vessels, and vascular damage.
VEGF-A increase in lupus for reform the damage in blood vessesls (Kuryliszyn-
Moskal et al., 2007). ICAM has role in adhesion molecules in the infection
diseases and autoimmune disease. ICAM-1 help to cell Adhesion and Immune
Response, endothelial Activation in Lupus, role in Organ Involvement, and
Potential Therapeutic Target (Sabry et al., 2007).
Interferon-gamma is a cytokine involved in the immune response, In lupus,

there is a complex interplay of various cytokines, including IFN-γ. IFN-γ increased
in lupus. IFN-γ is associated with the inflammation, and Autoimmunity (Liu et al.,
2022). as shown in Figure 8.
28
Literature
Figure 8: Illustrative chart showing simple Pathophysiology of Lupus

(Wikipedia, 2017).
29
Literature
1.4.6. The genes related to the Lupus:

Systemic lupus erythematosus is transmitted in a polygenic
inheritance pattern. Genes involved in the pathogenesis of systemic lupus
erythematosus include HLA class II (especially DR2 and DR3), HLA class III
(especially complement genes including C2 and C4 genes), IFNRF5 gene, and
other genes related to the immunologic system. The following evidence is also
suggestive of the genetic predisposition of SLE:
 Increase occurrence of disease in identical twins

 Increased disease frequency among first-degree relatives
 The disease's increased occurrence in SLE patients' siblings (Thorburn et al.,
2007).
SLE is a chronic inflammatory disease characterized by a loss of tolerance to

self-antigens and the production of high titers of autoantibodies directed against
native DNA and other cellular constituents. Approximately 90% of individuals
affected with SLE are female, predominately of childbearing age. SLE patients can
present with a wide spectrum of clinical manifestations involving multiple organ
systems (Kyogoku et al., 2022).
Recently, more direct evidence for the role of genetic variation in the
pathogenesis of SLE and LN has emerged. Until 2007, only a handful of candidate
gene polymorphisms had been convincingly implicated in SLE risk. Remarkable
technological advances such as high-throughput genotyping, the completion of the
human genome sequence, the International HapMap Project, and parallel
development of analytical and bioinformatic methods have occurred. The Alliance
for Lupus Research funding has facilitated the International Consortium on
Systemic Development. These efforts and those of many individual researchers
have triggered an explosion of discoveries on the genetics of SLE. In spite of the
complex genetic architecture of SLE, these discoveries demonstrate that a broad
array of pathways underlines the genetic heterogeneity of SLE (Quintero-Del-Rio
et al., 2002). The number of validated genetic regions predisposing to SLE is
approximately 30. Current follow-up efforts are focused on identifying the
causative genetic variants and their effects and the biological mechanisms they
predispose to SLE (Ramos et al., 2010).
30
Literature
The role of other forms of genetic variation is an exciting new frontier. Some
copy number variants have already been shown to be important for SLE.
Epigenetic variation is clearly involved in the pathogenesis of SLE. Such change
may be the result of environmental exposures and can have a profound impact on
gene expression. These new findings are creating new hypotheses about
mechanisms of disease that may be potential therapeutic targets and will
revolutionize our knowledge of SLE (Ptacek et al., 2008).
In the last few years, we have witnessed tremendous progress in identifying
genetic factors that contribute to the risk of developing SLE. An important
contribution to the progress in the genetics of SLE has been the unprecedented
collaborations among various research groups. Unfortunately, less effort has been
focused on the genetics of LN, but this appears to be changing (Kyogoku et al.,
2004). A recent estimate suggests that most genetic variation identified so far only
explains about 8% of genetic SLE risk. Once association to a region or
polymorphism is established, identifying the true causal variant is complicated and
time-consuming. Establishing the role of a gene in SLE pathogenesis requires
multiple lines of evidence. Clearly, much remains to be done before the etiology of
SLE and LN becomes fully understood. Despite these qualifications, the near-term
potential to understand much of SLE's etiology has never looked so promising
(Tsao and Wu, 2007).
Many of the SLE susceptibility genes have known immune functions and can
be placed into several focal pathways. These pathways highlight the importance of
immune complex clearance, lymphocyte signaling, and the innate immune
response in SLE predisposition. The genes without immunological function may
reveal novel pathways, and other forms of genetic regulation, such as epigenetic
modifications and miRNAs, promise to unveil novel disease mechanisms. The
development of high-throughput methods and parallel analytical strategies are
expected to provide unprecedented novel insights into the genetic factors and
immune pathways that contribute to the pathogenesis of SLE (Pan and Sawalha,
2009).
There are many genes that related with the lupus diseases. These genes
contribute to predisposing factors for the disease occurance. Its are included HLA-
31
Literature
DR2, -DR3, C2, C4, C1q, FCGR2A, FCGR3A, FCGR2B, PDCD1, PTPN22,
IRF5, TYK2, FCGR3B, STAT4, IRAK1, TREX1, MECP2, TNFSF4, CRP,
PTTG1, UBE2L3, PXK, PHRF1, ICA1, NMNAT2, ITGAM, TNFAIP3, BLK,
BANK1, and TNIP1 (Ramos et al., 2010).
1.4.7. Lupus Diagnosis:

Diagnosing Lupus is difficult because signs and symptoms vary considerably
from person to person. Signs and symptoms of Lupus may change over time and
overlap with those of many other disorders. No one test can diagnose Lupus, but
the combination of blood and urine tests, signs and symptoms, and physical
examination findings leads to the diagnosis.
1- Complete blood count:

This test measures the number of RBC, WBC, and platelets and the amount of
hemoglobin, a protein in red blood cells. Results may include anemia, which
commonly occurs in Lupus. A low white blood cell or platelet count may also
occur in Lupus (Fayyaz et al., 2015).
2- Erythrocyte sedimentation rate.

This blood test determines the rate at which red blood cells settle to the bottom
of a tube in an hour. A faster-than-normal rate may indicate a systemic disease,
such as Lupus. The sedimentation rate isn't specific for any one disease. It may be
elevated in the Lupus, an infection, another inflammatory condition, or cancer
(Tishkowski et al., 2023).
3- Kidney and liver assessment:

Blood tests can assess how well the kidneys and liver are functioning. Lupus
can affect these organs (Imran et al., 2021).
4- Urinalysis:
An examination of the urine sample may show an increased protein level or red
blood cells in the urine, which may occur if Lupus has affected the kidneys
(Bessone et al., 2014).
32
Literature
5- Antinuclear antibody (ANA) test:

A positive test for these antibodies produced by the immune system indicates a
stimulated immune system. While most people with Lupus have a positive
antinuclear antibody (ANA) test, most people with a positive ANA do not have
Lupus (Bakshi et al., 2023).
6- Imaging tests:
A- X-ray:
Lupus affects the lungs or heart. A chest X-ray is suggested. An image of the
chest may reveal abnormal shadows that suggest fluid or lung inflammation
(Sudoł-Szopińska et al., 2022).
B- Echocardiogram:
This test uses sound waves to produce real-time images of the heart. It can check
for problems with the valves and other portions of the heart (Mohamed et al.,
2019).
7- Biopsy
Lupus can harm the kidneys in many ways, and treatments can vary depending
on the damage type. In some cases, it's necessary to test a small sample of kidney
tissue to determine what the best treatment might be. The sample can be obtained
with a needle or through a small incision. Skin biopsy is sometimes performed to
confirm a diagnosis of Lupus affecting the skin (Jatwani and Hearth, 2023).
1.4.8. Lupus treatment:

The classical treatment:
The condition known as Lupus cannot be effectively treated in any way. Early
identification is essential since it is not feasible to turn back the clock on severe
disease, and treatment aims to halt the advancement of the illness, avoid potentially
life-threatening consequences, and provide symptom relief (Mckeon and Jiang,
2020). Drugs that reduce inflammation are often prescribed for conditions that may
affect various organs and tissues throughout the body. For individuals who have a
higher risk of developing blood clots, immunosuppressive steroid medications and
blood thinners like aspirin are also favored treatment options (Kugn et al., 2015).
33
Literature
B-Lupus treatment by the stem cells:

Since a genetic flaw is the root cause of this illness, the patient may be treated
by having genetically healthy stem cells transplanted into them, which are often
acquired from fetal tissue. It is also possible to utilize the patient's own stem cells
if it can be shown beyond a reasonable doubt that the stem cells collected from the
patient are healthy and unaffected by the condition. Because stem cells are able to
transform into the cells of damaged organs when they come into contact with those
organs, they are a viable therapeutic option for Lupus. Stem cells are also used to
treat other autoimmune diseases (Cras et al., 2015) (Li et al., 2021).
It works in a similar fashion to cure nerves and muscles that have been injured.
They hope that by doing so, they can either fully halt the course of the illness or
cause it to regress. If the illness has significantly advanced, the therapy may have
to be administered on more than one occasion. The length of time they have had
the illness and current state all impact the likelihood that they will benefit from the
therapy (Yang et al., 2021).
1.5. Role of the mesenchymal stem cells in lupus therapy:
A study found that human umbilical cord-derived mesenchymal stem cells

have therapeutic effects on SLE. The macrophages from mice showed a low level
of CD206, the marker for alternatively activated macrophages. The phagocytic
activity of macrophages was decreased. UCMSC improved the proportion of
CD206+ macrophages and their phagocytic activity in mice. IL-6 was required for
the up-regulation of CD206 expression and the phagocytic activity of UCMSC-
treated SLE macrophages (Wei et al., 2015). Another study found that Lupus mice
treated with BM-MSCs- IV showed amelioration of lupus nephritis. MSCs
decrease IL-21 gene expression and pro-inflammatory cytokine. BM-MSCs block
T follicular helper cells and IL-21, leading to treating lupus nephritis (Yang et al.,
2018).
Immunopathology of the Lupus showed aberrant T cell and autoantibody

synthesis by B cells. Also, human umbilical cord MSCs have shown promise in
treating Lupus. Extracellular vesicles are a kind of nanoparticles that are released
by a paracellular process and are considered to be a type of subcellular component.
Extracellular vesicles have a role in cell-to-cell communication. MSC exosomes
34
Literature
have immunomodulatory effects. Human umbilical cord MSC. may regulate the
aberrant immunological responses of T cells or B cells in SLE. The study found
that hUCMSCs and hUCMSC-EVs increased (Th) 17 cell numbers and IL-17 and
TGF-1 in lupus cases (Xie et al., 2022) (Qiaoli et al., 2023). B6-MSC and lupus-
MSC from young mice suppressed splenic CD3+CD4+ T cells and CD19+CD21+
B lymphocytes in MRL/lpr mice and (NZB/NZW)F1 mice. Lupus-MSC from older
(NZB/NZW) F1 mice did not substantially lower spleen weights, glomerular IgG
deposits, inflammation, CD3+CD4+ T cells, or CD19+CD21+ B lymphocytes (Fei
et al., 2012).
C3.MRL-Faslpr/J lupus mice have high levels of anti-dsDNA, mild glomerular

nephritis, and severe lymphoproliferation symptoms. MSCs reduced anti-dsDNA
and rebalanced the ratio of Th1/Th2. MSCs can change miRNAs and decrease the
CD138 and the Th1/Th2 ratio (Choi et al., 2016). MSCs have shown promising
therapeutic potential for Podocyte injury associated with lupus nephritis. UC-
MSCs decreased TNF-α, IL-1, and kidney macrophage infiltration in the lupus
disease (Zhuoya et al., 2019). MSCs inhibit T cells and stimuli Treg cells in lupus
mice. MSCs decrease inflammatory chemokines such as CCL2. CCL2 enables the
prolonged MSC–T cell interactions needed for sufficient suppression of
autoreactive T cells and helps to understand how MSCs ameliorate symptoms in
lupus-prone MRL.Faslpr mice (Lee et al., 2017).
Lupus nephritis causes proteinuria, hypertension, and renal failure in more than
half of patients with SLE. MSC treatment resulted in lower levels of ANA, Scr,
BUN, proteinuria, and renal sclerosis score, and MSC treatment could get higher
albumin levels. The MSC treatment group had lower IL-2, IL-12, IL-17, and IFN-γ
(Zhou et al., 2002). MSCs have immunoregulatory and therapeutic effects on
Lupus. MSCs produce anti-inflammatory cytokines and inhibit the pro-
inflammatory cytokines. IL-1 has immunosuppressive activity that enhances the
therapeutic SLE (Xu et al., 2020). MSCs are considered a promising tool for
treating autoimmune diseases like Lupus. MSCs decreased Th1 and Th17 cells by
stimulating Foxp3 in Treg cells (Park et al., 2015).
Another study found that MSCs taken from SLE patients are defective. It can't
be used for treating Lupus. Normal MSCs increase the survival rate and decrease
the disease activity and autoantibodies level (Wang et al., 2013). MSCs
35
Literature
transplantation inhibiting Akt/GSK3β of T cells in lupus mice (Ji et al., 2012). The
intra-renal injection of MSCs in mice's lupus nephritis showed a decrease in
inflammation (Bukulmez et al., 2021) (Nan et al., 2014). Adipose tissue MSCs
have a high effect in lupus mice at a dose (5×105) IV. MSCs ameliorated improved
Lupus histopathological and serological markers (Choi et al., 2012). MSCs reduced
the glomerular immune complex formation and cell infiltration (Schena et al.,
2010) (Ma et al., 2013).
Another study found that transplantation of MSCs decreases proteinuria,

creatinine, and injury in MRL/lpr mice. MSCs inhibited MCP-1 and HMGB-1 that
have a role in lupus therapy (Gu et al., 2010) (Fathollahi et al., 2018). MSCs have a
high value in the treatment of graft-versus-host disease (Youd et al., 2010) (Carp et
al., 2022) (Cras et al., 2015) (Liang et al., 2010). MSCT was contributing to the
recovery of regulatory T-cells. The patients showed clinical amelioration (sun et
al., 2009). MSCs can regenerate the damaged tissues. MSCs transplantation causes
amelioration in Activity Index scores, albumin, WBC, platelets, and complements
C3 (Wang et al., 2018). Extracellular vesicles of MScs have great benefits in the
treatment of autoimmune diseases. MSCs and their EVs increased TGF-β1 (Xie et
al., 2022) (Li et al., 2021). MSCs taken from healthy donors decrease T cells in
MRL/lpr mice compared with MSCs taken from ill donors (Zhou et al., 2008).
36
Materials and
Methods
Materials and Methods
Background:
The current work is an experimental study. The study includes four groups, each
comprising ten animals (BalB/c mice).
1- The first group (lupus group) is administered ALD-DNA for lupus
induction.
2- The second group (treated group) is administered ALD-DNA, then treated
by mesenchymal stem cells IV.
3- The third group (positive control) is administered mesenchymal stem cells
(MSCs) in a single dose via IV.
4- The fourth group (negative control) is administrated PBS.
The study aims to treat lupus disease by mesenchymal stem cells in BalB/c
mice.
1.1. The materials:

The used materials and equipment’s in the current study are list in table 2.
Table 2: illustrate the used materials and equipment’s in the current work
n The material The origin
1 BALB/c-MSCs CellBiologics company, USA
2 RPMI-1640 Gibco, Ireland
3 fetal bovine serum Gibco, Ireland
4 Mglutamine Sigma, USA
5 penicillin G and streptomycin GIBCO
6 proteinase K Sigma, USA
7 S1 nuclease TaKaRa, Japan
8 DNA extraction kit Genetech, China
9 The nanodrop Thermo Fisher Scientific, USA
10 PBS Sigma, USA
11 chloroform, cotton swap, China
syringe, needles, gel tube
12 ELISA kit antinuclear antibodies (MyBioSource, USA)
(ANA)
13 ELISA kit anti-double strand (MyBioSource, USA)
DNA (Anti-dsDNA)
14 The ELISA kit Interleukin-10 Abcam™ UK
37
15 The ELISA kit Interleukin-6 Invitrogen™ USA

16 The ELISA kit TGFβ1 Invitrogen™ USA
17 The ELISA kit CCL-2/ MCP-1 Invitrogen™USA
18 The ELISA kit(CCL-5/RANTES) Abcam™ Uk
19 The ELISA kit(VEGF) Quantikine™ USA
20 The ELISA kit(ICAM -1) Invitrogen™ USA
21 The ELISA kit (IFNγ) abcamTM USA
22 RT-PCR Quantabio/Germany
23 RNA Extraction Kit (Addbio/Korea)
24 Hematoxylin Himedia India
25 Eosin Himedia India
26 Xylene Himedia India
27 Slides, cover slide, test tubes, China
glass container, gloves
28 alcohol Tukey
29 DW Local Iraq
30 Microscope Olympus japan
1.2. Study animals:

Forty BALB/c model mice provided at (6) weeks old with (20-30) grams
purchased from (Jackson Laboratory, USA). It was housed in a pathogen-free
animal house and under the same conditions. The experiment was done in the
animal house of Veterinary Medicine College, Al-Qadisiyah University, from
January to June 2021. Mice are typically housed in specialized animal facilities
that adhere to strict standards and regulations. Mice are housed in cages designed
to meet their specific needs. Cages often include bedding material for comfort,
shelters or huts for nesting, and food and water dispensers. The temperature and
humidity in the animal facility are carefully controlled to provide a stable
environment. The lighting in mouse facilities is controlled to regulate the light-
dark cycle. Adequate ventilation is provided to maintain air quality and reduce the
buildup of contaminants. To promote the well-being of mice and prevent stress-
related behaviors, enrichment items may be provided in the cages. Mice are
regularly monitored for signs of illness or distress. Mice have a nutritionally
balanced diet to meet their specific dietary requirements.
38
1.3. The study designs:

The study designs included four groups, each consisting of (10) male mice. Each
group was treated as follows, as shown in Figure 9.
Figure 9: illustrated study design of the current work

1.4. BALB/C model mice:
Also known as C, BALBc, BALB, BALB/c, and BALB/cJ, it is a commonly

used inbred. Key traits include susceptibility to developing the demyelinating
disease upon infection with Theiler's murine encephalomyelitis virus. The
BALB/cJ substrain is susceptible to Listeria, all Leishmania species, and several
Trypanosoma species but is resistant to experimental allergic orchitis (EAO).
39
Detailed Description
BALB/c mice are particularly well known for producing plasmacytomas
following injection with mineral oil, forming the basis for the production of
monoclonal antibodies. Although not all BALB/c substrains have been examined
for plasmacytoma induction, substrains derived from the Andervont (An) lineage
(which includes BALB/cByJ) typically are susceptible, while those descended
from BALB/cJ are resistant. BALB/c mice immunized with PLP180-199 develop
an atypical form of experimental autoimmune encephalomyelitis (EAE) in which
location determines susceptibility. BALB/c mice are predisposed to dystrophic
cardiac calcinosis. They use BALB/cByJ and BALB/cJ mice obtained from
Jackson Laboratory. This is a substrain of BALB derived initially from the BALB
strain maintained by MacDowell at Cold Spring Harbor, eventually sent to G.D.
Snell at the University of Texas and brought by Snell to the Jackson Laboratory in
1932 at generation F26.
Cardiovascular Research, Diet-Induced Atherosclerosis, induction autoimmune
disease, lupus, Cancer Research, Mammary Gland Tumors: late onset, Research
Tools, Monoclonal antibodies, Myeloma, Infectious Disease, Neurodevelopmental
Defects, Inflammation, Autoimmunity, Allergic encephalomyelitis, Hematological
Research, Hemoglobin Defects and Thalassemia beta (see Annexes 4).
1.5. The experimental designs:

Forty BALB/c mice formed four groups; each group consisted of ten mice. G1
was administered by ALD DNA (2000) ug /kg-S/C (ALD DNA was previously
prepared from DNA of lymphocytes of the mice spleen) in three doses at (0, 14,
28) days for inducing SLE in BALB/c mice. G2 is also administered ALD-DNA
(2000) ug /kg-S/C, three doses at (0, 14, and 28) days for inducing SLE; after the
onset of the clinical signs, ANA and anti-dsDNA are examined for final
confirmation of SLE. The positive cases of SLE in G2 are treated by BALB/c-
MSCs (CellBiologics company, USA) (0.5×106) cells/for 10g/IV. G3 is
administrated BALB/c-MSCs only (0.5×106) cells/for 10g/IV. G4 (control group)
administrated BPs only. Preparation of activated lymphocyte DNA (ALD DNA) is
done according to (Qiao et al., 2005) in the following steps:
40
1-Preparation of splenocyte:
Removing the BALB/c mice spleens and keeping them in RPMI-1640 (Gibco,
Ireland), then passing the cells several times on nylon mesh, then washing by
RPMI-1640, Add fetal bovine serum (Gibco, Ireland) (10%) with Mglutamine 2m
(Sigma, USA), penicillin G and streptomycin (100) mg/ml each one to prevent the
contamination. Then, splenocytes were diluted to (2×10 6) cells/ml with
concanavalin A (5 ug/ml) for 48 hours.
2-DNA extraction:
gDNA extracted activated splenocytes were treated with proteinase K (Sigma,
USA) and S1 nuclease (TaKaRa, Japan) and then purified by kit (Genetech,
China). The nanodrop (Thermo Fisher Scientific, USA) is used at (260) nm for
determining DNA concentrations.
The immunization:
The mice were classified into four groups. Each consists of ten mice (G1, G2,
G3, and G4). G1 and G2 groups were only immunized with activated ALD DNA
(2000 ug /kg) SC with PBS and (CFA) (Sigma, USA) at three doses of ALD DNA;
the period between one and another was two weeks, at (0, 14, 28) day. Before the
third dose, the animals showed clinical signs of SLE syndrome (nose bleeding), as
shown in Figure 10.
41
Figure 10: Steps of preparation of the activated lymphocyte DNA (ALD DNA)
according to (Qiao et al., 2005)
1.6. Collection of blood:

The animals were given anesthesia chloroform, put over cotton swap, and
breathed for animals. The blood samples (2ml) were obtained from the heart by
stabbing with a syringe of 5 ml. The blood samples are put in anticoagulant-free
tubes (gel tube), left for a few minutes at room temperature to clot, then placed in a
centrifuge, 3000 RPM for 5 minutes after the separate serum is conserved in
Eppendorf tubes and stored at (-4 c).
42
1.7. The lupus diagnosis confirmation:

ELISA kit antinuclear antibodies (ANA) (MyBioSource, USA) and ELISA kit
anti-double strand DNA (Anti-dsDNA) (MyBioSource, USA) are used for the
detection of antibodies levels in animals in all the study groups before and after
treatment by BM-MSCs and PBS, according to company directions.
1.8. The BALB/c BM-MSCs preparation:

Jackson Laboratory, USA, provided bone marrow-MSCs. The animals were
sacrificed with Na- pentobarbital. Three mice's femoral and tibial bone marrow
were harvested for MSCs by introducing a syringe (26) gauge into the bone cavity
and washing the tissue with high-glucose DMEM and DMEM. Cells of the bone
marrow were suspended in culture fluid (1) ml after centrifuging at 1200 rpm for
(10) minutes to count and verify the cells by Neubauer camera, following
Freshney's method for the cell suspension used with trypan blue and media. MSCs
are Cultured on Dulbecco's modified Eagle's medium, streptomycin 10ug/ml and
penicillin G10U/ml, FBS (10%), and amphotericin B 25mg/ml GIBCO).
Determination of the cell number is based on:
NC x D x 104/#Q
NC= the cell count
D= the sample dilution
#Q= the squares number of the Neubauer
Cell Recovery from Cryovial:

1- Quickly thaw cells in a cryo-vial by incubating them in a 37°C water bath for <1
min until just a small bit of ice is left in the vial.
2- Promptly remove the vial and wipe it down with 70% ethanol.
3- Transfer cells from the vial to a sterile centrifuge tube. Add 8-10 ml of pre-warmed
Cell Biologics' Cell Culture Medium.
4- Flush the vial with an additional 0.5-1 ml of medium to ensure complete transfer of
cells to the centrifuge tube.
5- Centrifuge cells at 120 g for 5 minutes.
6- Aspirate the supernatant and suspend the cell pellet in 6 ml of Cell Biologics' Cell
Culture Growth Medium.
7- Add suspended cells into a flask or plate.
43
8- Place the T25 flask in a humidified, 5% CO2 incubator at 37°C.

9- Change culture media the following day to remove non-adherent cells and replenish
nutrients.
10- Change the cell culture medium daily when cells are >70% confluent.
11- Cells should be checked daily under a microscope to verify appropriate cell
morphology (see Annexes 1)
1.9. Administration of BALB/c- BM- MSCs:

The 2nd and 3rd groups received BALB/c- BM-MSCs at a dose (0.5×106) Cells
(IV) for 10 grams through the tail vein to prevent the cells from trapping in the
lung.
1.10. The used ELISA kits:

The used ELISA kits: The tested cytokines in the study are IL-10, IL-6, CCL-2,
TGFβ1, IFNγ, CCL-5, ICAM, and VEGF using ELISA kits to the company
directions as shown in Table 3.
Table 3: The ELISA kits used in the study
The ELISA kit Symbol The company Origen
Interleukin-10 (IL-10) Abcam™ UK
Interleukin-6 (IL-6) Invitrogen™ USA
Transforming growth factor β1 (TGFβ1) Invitrogen™ USA
chemokine ligand Monocyte chemotactic (CCL-2/ MCP-1) Invitrogen™ USA
protein-1
C-C motif ligand 5 (CCL-5/RANTES) Abcam™ UK
Vascular endothelial growth factor (VEGF) Quantikine™ USA
Intercellular adhesion molecule -1 (ICAM -1) Invitrogen™ USA
Interferon-gamma (IFNγ) abcamTM USA
Mouse Antinuclear antibody (ANA) MyBioSource TM USA
Anti -double-stranded DNA (Anti-dsDNA) MyBioSource TM USA
1.10.1Mouse Antinuclear antibody (ANA) ELISA Kit:

This product is suitable for the in vitro quantitative detection of ANA
concentration using Mouse serum. For the detection of other special sample types,
please get in touch with our technical support. This kit employs the "Double
Antigen Sandwich" technique. The principle of Double Antigen Sandwich is based
on the characteristics of the target antibody, which contains two available
44
paratopes that can be identified by both the pre-coated capture antigen and the
detection antigen simultaneously (see Annexes 2).
1.10.2. Mouse anti –ds DNA ELISA Kit:

This product is suitable for in vitro quantitative detection of Mouse serum and
organizations in the natural and recombinant anti-ds DNA concentration. This kit
employs the Double Antigen Sandwich Technique. The principle of a Double
Antigen Sandwich is based on characteristics of the tested antigen with more than
two valances, which can identify coated antigen and detection antigen at the same
time (see Annexes 3)
1.10.3. Mouse CCL2 (MCP-1) Uncoated ELISA:
Enzyme-linked immunosorbent assay for quantitative detection of mouse CCL2

(MCP-1) Catalog Number 88-7391, This Mouse CCL2 (MCP-1) Uncoated ELISA
contains the necessary reagents, standards, buffers, and diluents for performing
quantitative enzyme-linked immunosorbent assays (ELISA). This ELISA set is
specifically engineered to measure mouse CCL2 protein levels from serum
samples accurately and precisely (see Annexes 5).
1.10.4. Mouse RANTES ELISA Kit (CCL5):
Mouse Product Overview Abcam's RANTES Mouse ELISA kit is an in vitro

enzyme-linked immunosorbent assay for quantitatively measuring mouse
RANTES in serum. This assay employs an antibody specific for Mouse RANTES
coated on a 96-well plate. Standards and samples are pipetted into the wells, and
RANTES present in a sample are bound to the wells by the immobilized antibody.
The wells are washed, and a biotinylated anti-mouse RANTES antibody is added.
After washing away unbound biotinylated antibodies, HRP-conjugated streptavidin
is pipetted to the wells. The wells are again washed, a TMB substrate solution is
added to the wells, and color develops in proportion to the amount of RANTES
bound. The Stop Solution changes the color from blue to yellow, and the intensity
of the color is measured at 450 Function Chemoattractant for blood monocytes,
memory T-helper cells, and eosinophils. Causes the release of histamine from
basophils and activates eosinophils (see Annexes 6)
45
1.10.5. Mouse ICAM-1 ELISA Kit
Prepare 1X Wash Buffer

1. Allow Wash Buffer Concentrate (20X) to reach room temperature and mix to
dissolve any precipitated salts.
2. Dilute 20 mL of the Wash Buffer Concentrate into 380 mL of deionized or
distilled water. Label as 1X Wash Buffer.
3. Store the concentrate and 1X Wash Buffer in the refrigerator. Use the diluted
buffer within one month (see Annexes 7).
1.10.6. Mouse IL‑6 ELISA Kit:
This kit contains materials with small quantities of sodium azide. Sodium azide
reacts with lead and copper plumbing to form explosive metal azides. Upon
disposal, flush drains with a large volume of water to prevent azide accumulation.
Avoid ingestion and contact with eyes, skin, and mucous membranes. In case of
contact, rinse the affected area with plenty of water. Observe all federal, state, and
local regulations for disposal (see Annexes 8).
1.10.7. Mouse IL-10 ELISA Kit:
Species reactivity Reacts with: Mouse Product overview Abcam's Mouse IL-10
ELISA kit is an in vitro enzyme-linked immunosorbent assay for quantitatively
measuring IL-10 in serum. This assay employs an antibody specific for Mouse IL-
10 coated on a 96-well plate. Standards and samples are pipetted into the wells,
and IL-10 present in a sample is bound to the wells by the immobilized antibody.
The wells were washed, and a biotinylated anti-mouse IL-10 antibody was added.
After washing away unbound biotinylated antibodies, HRP-conjugated streptavidin
is pipetted to the wells. The wells are again washed, a TMB substrate solution is
added to the wells, and color develops in proportion to the amount of IL-10 bound.
The Stop Solution changes the color from blue to yellow, and the intensity of the
color is measured at 450 nm (see Annexes 9).
46
1.10.8. Mouse Interferon gamma ELISA Kit:
Sample type Milk, Serum, Assay type Sandwich (quantitative), Assay duration
multiple steps standard assay Species reactivity Reacts with: Mouse Product
overview Mouse interferon gamma ELISA kit (IFN Gamma) is designed for the
quantitative measurement of IFN gamma in mouse serum, buffered solutions, and
cell culture medium. A monoclonal antibody specific for IFN gamma has been
coated onto the wells of the microtiter strips provided. Samples are pipetted into
these wells, including standards of known IFN gamma concentrations, control
specimens, or unknowns. The standards or samples and a biotinylated monoclonal
antibody specific for IFN gamma are simultaneously incubated during the first
incubation. After washing, the enzyme Streptavidin-HRP, which binds the
biotinylated antibody, is added, incubated, and washed. A TMB substrate solution
is added, which acts on the bound enzyme to induce a colored reaction product.
The intensity of this colored product is directly proportional to the concentration of
IFN gamma present in the samples. This kit will recognize both endogenous and
recombinant mouse IFN gamma. Get results in 90 minutes with the Human IFN
gamma ELISA Kit from our Simple Step ELISA range. Platform Microplate
Function is produced by lymphocytes activated by specific antigens or mitogens
(see Annexes 10).
1.10.9. Mouse TGF beta 1 ELISA Kit:
The mouse TGF beta 1 ELISA is an enzyme-linked immunosorbent assay for

quantitatively detecting mouse TGF beta 1. TGF beta is a pleiotropic cytokine that
exhibits a broad spectrum of biological and regulatory effects on the cellular and
organism levels. It plays a critical role in cellular growth, development,
differentiation, proliferation, extracellular matrix (ECM™) synthesis and
degradation, control of mesenchymal-epithelial interactions during embryogenesis,
immune modulation, apoptosis, cell cycle progression, angiogenesis, adhesion and
migration, and leukocyte chemotaxis. It has both tumor-suppressive and promoting
activities and is highly regulated at all levels (see Annexes 11).
47
1.10.10. Mouse VEGF kit:
Quantikine™ ELISA: This package insert must be read in entirety before using
this product. It is not for use in diagnostic procedures but for the quantitative
determination of Mouse VEGF helical Growth Factor concentrations in serum
samples. Vascular endothelial growth factor, or vascular permeability factor,
potentiates both angiogenesis and vasculogenesis in the fetus and adults (see
Annexes 12).
1.11. The molecular examination:

1.11.1 The used primers:
The tested genes are IL-10, IL-6, CCL-2, TGFβ1, IFNγ, CCL-5, ICAM, and
VEGF genes are detected in mice by using designed primers by NCBI site while
designing of the primers is done by primer 3 plus (online tool), as shown in Table
4.
Table 4: list of used primers
Gene Product Direction Seq.
size
IL-10 242 bp L 5'TCAGAGCTCCTGGAACTGGT3'
R 5'TGCTAGAGCCCGGAGTTAAA3'
IL-6 185 bp L 5'TTTCTCCACGCAGGAGACTT3'
R 5'TCCACGATTTCCCAGAGAAC3'
TGF-β1 160 bp L 5'ATTTTAGGGTGGCCCATTTC3'
R 5'GAACTGACCCTGCTTCTTGC3'
CCL-2/MCP- 200 bp L 5'CCCAATGAGTAGGCTGGAGA3'
1 R 5'GAACTGCCTTTGCCTTCTTG3'
CCL- 197 bp L 5'GTGCCCACGTCAAGGAGTAT3'
5/RANTES R 5'CTGGAGACGAGGAGCCATAG3'
VEGF-A 199 bp L 5'ACCCGTGACTGAGGTTTGAC3'
R 5'TTTCTTGCGCTTTCGTTTTT3'
ICAM-1 160 bp L 5'AGCACCTCCCCACCTACTTT3'
R 5'AGCTTGCACGACCCTTCTAA3'
IFN-γ 181 bp L 5'ACTTTGCTTCTGCCTTTCCA3'
R 5'ACAAGGTCACCCACAGGAAG3'
β-actin 99 bp L 5'TCCCTTGGATCTTTGCAGTT3'
(HKG) R 5'CCCACAGCACTGTAGGGTTT3'
48
1.11.2. Total RNA Extraction and Reverse Transcriptase:

RNA was extracted from animal serum using an RNA Extraction Kit
(Addbio/Korea). SYBR Green Master Mix RT-PCR (Quantabio/Germany)
converted all RNA extraction mixtures to cDNA in 25 μl according to the
manufacturer's recommendations. 12.5 microns total: 1 μl F and R primer, 6.5 μl of
DNA water, RNA (3) μl, and qScript RT3 1 μl, then incubation of the reaction by
the thermocycler (BioRad. the USA). The first stage was cDNA synthesis at 50 0C
for (10) min and Taq activation at 95 C0 for (2) min. The fold change (indicator for
the gene expression) was measured according to (the Livak method) as:
CT sample - CT (HKG) = ΔCT sample …..1

CT control - CT (HKG) = ΔCT control …..2
ΔCT sample - ΔCT control = ΔΔCT …….3
Fold change = 2 (-ΔΔCT) ……..4
CT: Cycle Threshold

HKG: housekeeping gene
1.12. Histopathological examination:

Histological methods can stain and visualize four human tissue types. Each
stain highlights a key tissue component. Eosin stains proteins pink, whereas
Hematoxylin stains them blue. These stains identify proteins. This review will
address stains that highlight certain proteins due to the diversity of proteins.
Special stains highlight certain proteins. Its distinctiveness hides other structures.
Many slides are made to obtain the information from the specimen.
Tissue Preparation: The preparation steps are Fixation, processing, embedding,

sectioning, and staining. In modern laboratories, they are done automatically.
Collection of organs: The animal's abdomen was opened by scalpel blade and
scissors, and the organs (Liver and Kidney) were excluded and then weighed. After
that, put them in containers to wash them with distal water if it's contaminated with
blood, and then use dissection papers to dry them. After the desiccation of animals,
the organs of the Kidney and Liver are taken away and washed with NS
49
physiological solution to remove blood. A small part of Kidney and Liver tissue
for each sample was frozen in liquid nitrogen and kept at −70 °C for molecular
assy. Series steps depending on the method mentioned by Cook (1973) and
Suvarna and Layton (2013) for histological exam include:
1- Fixation: After putting tissues for 48 hours in formalin solution (10%), then
removing and cleaning with continuous water for two hours; this method is called
(Fixation) to save tissue and cells through link protein, prevent shrinking, swelling,
and inactive lysis enzyme.
2- Washing: Washing samples in water for 3 hours to remove the fixative effect on
the samples.
3- Dehydration: Then samples were entered into a graded series of increasing
ethanol concentrations (70%, 80%, 90%, 95%, and 100%) for about 1-2 h. for each
concentration. Using gradual ethanol concentration, the tissue is extracted from
water and transferred from one concentration of alcohol to another.
4- Clearing: The tissue is extracted from alcohol and put in Xylene for 1 hour to get
rid of alcohol to facilitate the next step.
5- Infiltration: Using liquid paraffin at 56-58°C 2 times.
6- Embedding: Then the samples were entered in containers containing liquid
paraffin in 56-58 °C and left in room temperature to be hard, then released from
the containers and put in freeze.
7- Sectioning: the sample is fixed on the sample holder in Rotary Microtome and
cutes to a thick of 5 micron, then the Ribbon is transferred to a water bath (40-45
°C) for float, leaving for (1-2 min). The slide is passed under this Ribbon and
caught so that it sticks to the center of the slide by lifting the slide to word the
sectors to the top while not allowing any air bubbles to form. Leave the slide to dry
on the strip dryer at room temperature for one hour.
8- Deparaffinization and rehydration: Deparaffinization of the slide by putting it in
an oven (55-70 °C) for five h., then in Xylene. Redehydration by putting it in a
graded series of alcohol (100%, 100%, 90%, 80%, 70%) respectively.
9- Staining: Two dyes are used in this study. Hematoxylin, which is prepared,
depends on the method described (Suvarna et al., 2013). The dye powder melted in
absolute alcohol (99%) after adding it to Alk(So4)2-12H2O in warm DW. After
the mix is boiled, red mercury oxide is added to the mixture. The mixture is cooled
by putting it in a beaker with cold water and then adding acetic acid after the
50
mixture is filtered for use. Another dye is eosin, which is also prepared depending
on Suvarna and Layton's (2013) method. The dye powder melts in absolute alcohol
(99%) concentration, then adds Glacial Acetic Acid and filters the mixture before
use. The slide was dyed with Hematoxylin for one minute, and after washing the
slide for two minutes, distal water was used to remove the access dye. After that,
twice or three times, it was submerged in alcohol to eliminate access dye. It is
stained with eosin dye and then passed through a series of ethanol concentrations
for (2min) in each concentration (70%, 80%,90%, 100%, 100%) respectively,
except the last concentration for (5 min), after for (10 min) clearing with Xylene.
10- Mounting: Using Distrine Plasticizer Xylene to fix the cover slide, the slide is left
on the plate for (8 hours) to dry and prepare for exams.
1.13. Morphometry
Photomicrograph:
After preparation of sections, slides were examined by Cam Light Microscope,
and the alternative in tissue sections was detected. They were taken on 20X, 40X,
and 100X lenses.
1.14. Statistical analysis:

The results were analyzed by ANOVA (one-way and two-way) using SPSS,
V27; the USA). Using an LSD test was used to determine the statistical difference.
The correlation study calculates the R-value by the Pearson test (Schiefer, 1980).
51
Results and
Discussion
Results and Discussion
General background:
The current study found that the lupus group (G1) had a high level of pro-
inflammatory cytokines and increased gene expression. It also decreased the anti-
inflammatory cytokines and decreased its gene expression. The treated group (G2)
has a low level of pro-inflammatory cytokines with a decrease in gene expression
and an increase in anti-inflammatory cytokines with an increase in gene
expression. The histopathological examination of the liver and kidney showed
negative histopathological changes in the liver and kidney in the lupus group,
while the treated group (G2) showed positive histological amelioration of the liver
and kidney tissues.
Our study aims to treat lupus in BALB/C mice by administration of bone

marrow-derived mesenchymal stem cells (BM-MSCs) (IV). Treatment of lupus by
BM-MSCs includes many objectives:
1- Determination of some of the cytokines and chemokines levels in BALB/C

Mice with SLE before treatment and after treatment by bone marrow-
mesenchymal stem cells in the study group.
2- Determination of the gene expression of some cytokines and chemokines
encoding genes before and after treatment by bone marrow-mesenchymal
stem cells in the study group.
3- Determination of the histopathological examination of the liver and kidney
before and after treatment by bone marrow-mesenchymal stem cells in the
study group.
1.1. ANA and Anti dsDNA levels (The serological tests):
Our results showed anti-dsDNA levels in the lupus group (G1) were (17.38) ng
/ml. The G1 is left without treatment. Anti-dsDNA levels in the treated group (G2)
before treatment were (17.29) ng/ml, and after treatment was (2.45) ng/ml at
(P≥0.05). The anti-dsDNA levels showed negative significant differences in the
treated group (G2) after treatment as compared with the before treatment at
(P≥0.05). There are no significant differences between Anti-dsDNA levels between
G1 and G2 before treatment at (P<0.05), as shown in Table 3.
52
Our results showed that ANA levels in the lupus group (G1) were (18.15) ng
/ml. The G1 is left without treatment. ANA levels in the treated group (G2) before
treatment were (17.55) ng/ml, and after treatment was (2.71) ng/ml at (P≥0.05).
The ANA levels showed negative significant differences in the treated group (G2)
after treatment as compared with the before treatment at (P≥0.05). There are no
significant differences between ANA levels between G1 and G2 before treatment
(P≥0.05), as shown in Table 5.
Table 5: ANA and Anti dsDNA level before and after BM-MSCs therapy in
the lupus group (G1) and treated group (G2)
AB Anti-dsDNA ng/ml
Group Before treatment after treatment
G1 17.38 ±0.83 Aa -
G2 17.29 ±0.77 Aa 2.45 ±0.52 b
LSD 2.9
AB ANA ng/ml
Group Before treatment after treatment
G1 18.15±1.45 Aa -
G2 17.55±0.83 Aa 2.71±0.61 b
LSD 2.1
Different letters mean there is a significant difference at p ≤ 0.05 indicates significantly
different, p ≥ 0.05 indicates no significantly different. The capital letters (A and B) indicate
the vertical comparison and the small letters (a, b) indicate the horizontal comparison.
Lupus includes increasing pro-inflammatory cytokines and decreasing anti-

inflammatory cytokines (Lourenço & La Cava, 2009). In biochemistry, lupus has
high autoantibody levels that target RNA and DNA, leading to death (Pisetsky &
Lipsky, 2020). The autoantibodies are causing a dramatic series of clinical findings
of SLE (Dema & Charles, 2016) (Becker et al., 2019). MSCs treat autoimmune
diseases by regulating immunological responses (Dazzi and Krampera, 2011).
Moreover, MSCs have immunomodulatory effects (Qinjun et al., 2016). Lupus
includes immune disorder and the absence of immune regulation (Lu R et al.,
2016). Our findings showed that anti-dsDNA levels decreased after administration
of BM-MSCs in the second group and showed significant negative differences
compared with other groups. However, no significant differences exist between the
second and control groups after treatment. In the second group, ANA levels had
53
significant positive differences before the administration of BM-MSCs. However,

after the administration of BM-MSCs, the second group showed normal values of
ANA.
The anti-dsDNA and ANA are antibodies the lymphocytes produce against self-
DNA due to poor identification of the exact antigenic components (Giles &
Boackle, 2013) (Bai et al., 2018). Anti-dsDNA and ANA antibodies are increased
in lupus, according to many reports (Rekvig, 2019) (Sohrabian et al., 2019), as
found in our results.
1.2. The cytokine and chemokines levels (Serological tests):

According to Figure 11, the first group decreased significant differences in IL-
10 levels (7.18±0.47) ng/ml as compared with the second group (29.1±1.1) ng/ml,
the third group (32.09±2.89), and the fourth group (32.14±3.54) ng/ml. In contrast,
the fourth group showed a higher level of IL-10 than the study groups. The first
group showed negative significant differences compared to the other groups at
(P≥0.05).
Figure 11: Concentration of IL-10 in study groups, Different letters mean is a significant
difference; the similar letters mean no significant differences. A is mean low in the
significant differences as compared with B. p ≤ 0.05 mean significantly different. p ≥ 0.05
indicates no significantly different.
IL-10 has anti-inflammatory effects, is produced at low levels in lupus cases
compared with healthy individuals (Godsell et al., 2016), and is suppressed by
many immunobiological factors secreted in lupus involvement (Yuan et al., 2011).
The group treated by MSC showed an increase in IL-10 cytokine levels due to
MSC effects that are yet unknown (Waterman et al., 2012). Some reports indicated
54
that MSC could produce exosomes that directly regulate and control the immune
response (Sharma et al., 2017) (Wang et al., 2020). According to Figure 12, the
first group showed a significant increase (360.89±4.48) ng/ml of IL-6 levels as
compared with the second group (201.14±5.55) ng/ml, the third group
(190.89±3.7c) ng/ml, and the fourth group (191.37±3.26). The first group showed
positive significant differences as compared with the other groups at (P≥0.05)
Figure 12: Concentration of IL-6 in study groups, Different letters mean there is a
significant difference; the similar letters mean no significant differences. A is mean high in
IL-6, TGF-β, CCL-2/MCP-1, CCL-5, VEGF-A, ICAM-1, and IFN-γ levels

significantly increased in the SLE group compared with other groups based on our
study. All mentioned cytokines are pro-inflammatory cytokines. SLE is an acute
autoimmune condition with high pro-inflammatory cytokines, antibodies, and
immune cells (Davis et al., 2011). SLE includes cytokine imbalances that trigger
inflammation, immune dysfunction, and cytokine storm. The primer cytokine of
the SLE pathogenesis is interferon-alpha, which is stimuli by immune compounds
that increase some inflammatory proteins (Ohl and Tenbrock, 2011). Serum levels
of IL-8, IL-8, and IL-18 have clinical indications in SLE (Ruchakorn et al., 2019).
Increased cytokines are clear in target organs in SLE with their receptors
expressed (Davis et al., 2011). Another study found that cytokines, such as
Interferons (IFN), play the primary role in SLE. Interferons can activate rest
55
cytokines, preventing or blocking interferons and leading to successful therapies,

such as TNF-α used for rheumatoid arthritis, providing a good prognosis (Idborg et
al., 2021). Cytokine dysregulation is important for the loss of immune tolerance in
SLE. IL-21 concentrations are increased in SLE, while IL-17 is dysregulated in
SLE. IL-21 and IL-17 are pro-inflammatory cytokines that have a role in SLE
development and loss of tolerance (Poole et al., 2010).
According to figure 13, levels of TGF-β1 were (2354.2±341.7),

(8222.54±570.3), (8225.6±390.1), and (8250.8±384.8) ng/ml in G1, G2, G3, and
G4 respectively. The first group showed a decrease significant in TGF-β1 levels
compared with G2, G3, and G4. However, there are no significant differences
between the second, third, and fourth groups in the TGF-β1 level. The first group
showed negative significant differences compared to the other groups at (P≥0.05).
Figure 13: Concentration of TGF-β1 in study groups, Different letters mean there is a
significant difference; the similar letters mean no significant differences. A is mean low in
the significant differences as compared with B. p ≤ 0.05 mean significantly different. p ≥
0.05 indicates no significantly different.
According to Figure 14, the first group showed an increase in significant
differences (162.98±11.48) ng/ml of CCL-2/MCP-1 levels as compared with G2
(52.09±6.15) ng/ml, G3 (48.1±10.2) ng/ml, and G4 (49.4±9.75) ng/ml. There are
no significant differences between the second, third, and fourth groups. The first
group showed positive significant differences compared to the other groups at
(P≥0.05).
56
Figure 14: Concentration of CCL-2/MCP-1 in study groups. Different letters mean there is
a significant difference; the similar letters mean no significant differences. A is mean high
in the significant differences as compared with B. p ≤ 0.05 mean significantly different. p ≥
G1 showed an increase in significant differences in CCL-5 level (41.74±4.9)

ng/ml as compared with G2 (7.37±1.45) ng/ml, G3 (7.68±1.47) ng/ml, and G4
(7.61±1.51) ng/ml. There are no significant differences among G2, G3, and G4. G1
showed significant positive differences compared with the other groups at
(P≥0.05), as shown in Figure 15.
Figure 15: Concentration of CCL-5 in study groups, Values represent mean ± SD;
Different letters mean there is a significant difference at (P≥0.05); the similar letters mean
no significant differences at (P≥0.05). A is mean high in the significant differences as
compared with B.
57
G1 showed increasing significant (41.84±2.89) ng/ml of VEGF-A levels as

compared with G2 (11.03±3.30), G3 (9.63±2.97), G4 (9.72±3.46). G1 showed
positive significant compared to the other groups at (P≥0.05), as figure 16.
Figure 16: Concentration of VEGF-A in study groups, Values represent mean ± SD;
Different letters mean there is a significant difference at (P≥0.05); the similar letters mean
no significant differences at (P≥0.05). A is mean high in the significant differences as
compared with B.
According to Figure 17, the 1st group showed increased significant
differences (302.9±28.31) ng/ml of ICAM-1 level as compared with the 2nd group
(226.8±11.69) ng/ml, the 3rd group (225.3±6.26) ng/ml, and the 4th group
(225.1±8.33) ng/ml. At the same time, there are no significant differences among
the 2nd, the 3rd, and the 4th group. The first group showed positive significant
differences compared to the other groups at (P≥0.05).
Figure 17: Concentration of ICAM-1 in study groups, Different letters mean there is a
significant difference; the similar letters mean no significant differences. A is mean high in
the significant differences as compared with B. p ≤ 0.05 mean significantly different. p ≥
58
According to Figure 18, the 1st group showed increased significant differences
(64.85±4.10) ng/ml in IFN-γ levels as compared with the 2nd (14.12±2.10) ng/ml,
the 3rd group (30.21±2.33) ng/ml, and the 4th group (30.37±2.85) ng/ml, while the
3rd and the 4th group were showed increased significant differences as compared
with the 2nd group. The first group showed positive significant differences as
compared with the other groups at (P≥0.05)
Figure 18: Concentration of IFN-γ in study groups, Different letters mean is a significant
difference; the similar letters mean no significant differences. A is mean high in the
IL-6, TGF-β, CCL-2/MCP-1, CCL-5, VEGF-A, ICAM-1, and IFN-γ

concentrations decreased in the 2nd group (treated group by MSC) compared with
the 1st group, and there are no significant differences between the 3rd group and
4th group based on our findings.
Nowadays, MSC is considered therapy for SLE to improve the clinical signs of
the SLE by inhibiting the activity of Th1, Th17, and B cells and increasing the
activity of Th2 and Treg cells. Treatment by MSC has benefits for enhancing the
immunosuppression of MSCs in SLE. Although MSC therapy is reported
ineffective in some studies, some patients with SLE do not respond to the therapy
due to MSC activity or patient-derived factors (Li et al., 2021).
MSC plays a role in regulating SLE immunity (Yang et al., 2021). MSCs have
immunosuppressive effects on immune activities. Administration of MSCs IV will
ameliorate the clinical signs of SLE. Allogeneic MSCs suppress autoimmunity in
mice and humans (Li et al., 2021). Treatment by MSC for animals with SLE
59
decreased autoimmune bodies and pro-inflammatory cytokines such as ds-DNA,

ANA, Scr, proteinuria, and BUN (Zhou et al., 2020). MSCs treat drug-resistant
cases (Dandan et al., 2019). The meta-analysis studies assessing MSCs showed
that MSCs are a new treatment for SLE without side effects (Tianbiao et al., 2020)
MSCs secrete immunomodulatory factors that restore immune balance and

produce good results in treating SLE; MSCs do not express major
histocompatibility complex II. Therefore, it is less rejected after MSC
transplantation. MSCs have no immunomodulatory effects, but they have great
ability in regenerative medicine (Hulya et al., 2021).
The third group does not have significant differences compared with the control
group. We added the third group to confirm that it does not cause a cross-
immunological reaction due to histological and immunological mismatching. This
will support the idea that MSC only has an essential role in SLE and has no role in
healthy animals.
1.3. The molecular examination (RT-PCR):
The IL-10 gene expression in G1 was lower than in the control. No significant
differences exist among other groups in IL-10 gene expression, as listed in Table 6
and Figure 19.
Table 6: The fold change values of the IL-10 gene
Group Fold change

G1 0.223 ± 0.03 B
G2 0.905 ± 0.012 A
G3 0.998 ± 0.021 A
G4 1.000 ± 0.0 A
The identical letters mean no differences; the not similar letters mean significant
differences. p ≤ 0.05 mean significantly different. p ≥ 0.05 indicates no significantly
different.
60
Figure 19: The chart presents the fold change values of the IL-10 gene
Lupus is usually treated with several drugs, such as Methotrexate,

Mycophenolate mofetil, Azathioprine, Cyclophosphamide, and Voclosporin
(Schiefer, 1980). In the last decade, many researchers found that body tissues
derived-Mesenchymal stem cells are important in treating lupus. Mesenchymal
stem cells reduce the pro-inflammatory cytokines and increase anti-inflammatory
cytokines by producing several factors such as exosomes, microvesicles, apoptotic
bodies, proteins, and lipids. These factors regulate immune responses by
controlling gene expression (McKeon et al., 2020).
The current study showed that the IL-6 encoding gene expression was increased
in G1 than in the control. At the same time, there were no statistical differences
between the other groups, as shown in Table 7 and Figure 20.
Table 7: Values of the fold change of IL-6 encoding gene
Group Fold change

G1 1.885 ± 0.12 A
G2 1.051 ± 0.09 B
G3 0.997 ± 0.08 B
G4 1.000 ± 0.0 B
different.
61
Figure 20: The chart illustrates the fold change values of the IL-6 gene
The findings showed that the TGF-β1 expression gene was reduced in G1 than in
the control. No marked differences among other groups in the TGF-β1 expression
gene exist, as listed in Table 8 and Figure 21.
Table 8: The fold change values of the TGF-β1 gene
Group Fold change

G1 0.365 ± 0.05 A
G2 0.996 ± 0.006 B
G3 0.997 ± 0.003 B
G4 1.000 ± 0.0 B
different.
62
Figure 21: The chart presents the fold change values of the TGF-β1 gene
The gene expression of the CCL-2/MCP-1 gene was increased in G1 more than
in the control group. There are no marked differences among other groups in gene
expression of the CCL-2/MCP-1-encoding gene, as listed in Table 9 and Figure 22.
Table 9: The fold change values of the CCL-2/MCP-1 gene
Group Fold change

G1 3.299 ± 0.012 A
G2 1.054 ± 0.009 B
G3 0.973 ± 0.019B
G4 1.000 ± 0.0 B
different.
63
Figure 22: The chart illustrates the fold change values of the CCL-2/MCP-1
gene
The current study showed that the gene expression of the CCL-5/RANTES-
encoding gene was increased in G1 than in control. There are no marked
differences among other groups in gene expression of the CCL-5/RANTES-
encoding gene, as listed in Table 10 and Figure 23.
Table 10: Values of the fold change of CCL-5/RANTES encoding gene
Group Fold change

G1 5.486 ± 0.27A
G2 0.968 ± 0.012B
G3 1.009 ± 0.003B
G4 1.000 ± 0.0 B
different.
64
Figure 23: The chart illustrates the fold change values of the CCL-5 gene
The gene expression of the VEGF-A encoding gene was increased in G1 more
than in the control group. There are no marked differences among other groups in
gene expression of the VEGF-A-encoding gene, as shown in Table 11 and Figure
24.
Table 11: Values of the fold change of the VEGF-A encoding gene
Group Fold change

G1 4.304 ± 0.34A
G2 1.134 ± 0.018B
G3 0.990 ± 0.004B
G4 1.000 ± 0.0 B
different.
65
Figure 24: The chart presents the fold change values of the VEGF-A gene
The current study showed that ICAM-1 encoding gene expression was
increased in G1 than in control. There are no marked differences among other
groups in the ICAM-1-encoding gene expression, as shown in Table 12 and Figure
25.
Table 12: Values of the fold change of the ICAM-1 gene in study groups
Group Fold change

G1 1.345 ± 0.062 A
G2 1.007 ± 0.002 B
G3 1.000 ± 0.003 B
G4 1.000 ± 0.0 B
different.
66
Figure 25: The chart presents the fold changes values of ICAM-1 gene
The current study showed that gene expression of the IFN-γ-encoding gene was
increased in G1 than in the control, with no marked differences between the other
groups, as shown in Table 13 and Figure 26.
Table 13: Values of the fold change of IFN-γ-encoding gene in study groups
Group Fold change

G1 2.135 ± 0.052 A
G2 0.992 ± 0.007 B
G3 0.994 ± 0.007 B
G4 1.000 ± 0.0 B
different.
67
Figure 26: The chart illustrates the fold changes values of the IFN-γ gene
Our results included high gene expression of IL-6, CCL-5/RANTES, VEGF,

ICAM, CCL-2, and IFNγ-encoding genes and a decrease in IL-10 and TGFβ1 gene
expression in the first group. The second group showed low gene expression of IL-
6, CCL-5/RANTES, VEGF, ICAM, CCL-2/MCP-1, and IFNγ while showing
significantly high gene expression of IL-10 and TGFβ1 gene as compared with the
control group. MSCs treat autoimmune diseases by regulating cytokine-encoding
gene expression (Wang et al., 2017) (Zhu and Feng, 2018). The low expression of
TGF-β1 is associated with the common expression of IL-10 in lupus. Lupus
showed a deficit in Treg cells, which MSCs can treat. MSCs reregulate the
immunological response, increase Treg cell counts in lupus cases, and increase
expression of TGF-β1 and IL-10 to maintain immune activity (Chun et al., 2021).
TGF-β1 was decreased in the patients with SLE than in the control group (Siham et
al., 2015).
TGF-β1 and IL-10 expression was increased in lupus patients compared to the
control group. TGF-β1 and IL-10 are increased in lupus patients. IL-10 and TGF-
β1 inhibit the autoreactive immune cells in lupus patients (Abbasifard et al., 2020).
The protein and mRNA expression levels of IL‑6 and TNF‑α were decreased in
MSCs in Osteoarthritis cases than in the control group using RT-PCR.
Furthermore, IL‑4, IL‑10, and TGF‑β1 levels in MSCs increased in lupus than in
the control group, which showed agreement with our results (Yi et al., 2020).
MSCs produce many bioactive factors, such as cytokines and growth factors,
which provide microenvironment regeneration and inhibit local inflammation.
68
MSCs stimulate the anti-inflammatory cytokine by regulating the expression of the

cytokines encoding genes. MSCs cause increased TGF-β1 gene expression
compared to the control (Mingxia et al., 2007) (Almashat, 2015). IL-6 was down-
regulated in lupus patients after treatment by MSc. The impaired MSCs to secrete
the immune factors are attributed to the genetic disorder of lupus cases due to
weakened MSC. IL-6 decreased MSC, while TNF-α increased MSC activity by
stimulating IDO in MSCs (Wang et al., 2014) (Chen et al., 2015). Interferon-γ and
IL-6 expression were reduced in lupus with MSCs (Zheng et al., 2020). MSCs
were stimuli to the regulatory B cells in the mice. MSCs inhibit anti-dsDNA and
regulate imbalances among Treg/Th17/Th1 (Chun, 2921). MSCs regulate the gene
expression of the cytokines; therefore, they can treat arthritis by modulating the
expression of the cytokines (Mao et al., 2010).
MSCs have a potent immunosuppressive effect in vivo (Le et al., 2004). MSCs
decrease IL-10 levels in pulmonary vasculitis in lupus mice. MSCs are strong
immunomodulatory cells investigated in graft versus host disease, lupus, and
ulcerative colitis (Prabowo et al., 2021). MSCs have an immunosuppressive effect
on the immune system (Zanone et al., 2010). The mesenchymal stem cell has
distinct gene expression; MSc has an immunomodulatory role in autoimmune
disease (Jansen et al., 2010) (Tyndall et al., 2007). The genetic exchange between
resident and MSc by the microvesicles showed instrumental in MSc therapeutic
effects (Bruno et al., 2013). The cytokine MSc produces is essential in Lupus
(Stępień-Wyrobiec et al., 2008). MSCs can treat rheumatoid arthritis, lupus, and
type I DM (Rosa et al., 2007). MSc has expressed the surface markers and secreted
factors. Therefore, it is used to treat lupus (Altaner et al., 2013) (Estrela et al.,
2017). All the studies above agreed with our findings and directly supported our
results.
69
1.4. The histopathological examination:

1.4.1. Liver:
G1 showed that the liver has severe necrosis of hepatocytes, hydropic
degenerated hepatocytes, and dilated sinusoids, which were evident with some
viable cells. Severe hemorrhage and necrosis of hepatocytes, loss of normal
striation of hepatocytes, and atrophy of hepatocytes are detected with engorged
central vein, as shown in Figure (27-31).
Figure 27: Liver section with hepatocytes necrosis Figure 28: Liver section with sinusoids dilatation
(black arrow), hydropic degenerated hepatocytes (black arrows) and hepatocytes atrophy (G1).
(blue arrows), and dilated sinusoids (yellow arrows), H&E, 40X.
viable cells (red arrow) (G1). H&E, 100X
Figure 29: Severe hemorrhage, hepatocytes 70 Figure 30: Loss of normal striation of
necrosis, sinusoids dilatation (G1). H&E, 400X. hepatocytes, atrophy and necrosis of hepatocytes
and sinusoids dilatation (G1). H&E, 40X.
Figure 31: A- Engorged central vein (CV), loss of normal striation of the hepatocytes (black arrow),
hepatocyte necrosis (blue arrow), and sinusoid dilation (red arrow). H&E, 100X. B- Shows engorged central
vein (CV), loss of normal striation of hepatocytes, severe necrosis of hepatocytes (blue arrow), and dilation of
sinusoids (black arrow) (G1). H&E, 400X.
G2 showed that the liver has mostly normal hepatocytes but also a focal area of
necrosis as well as dilation of sinusoids. The liver shows normal hepatocytes with
prominent nuclei, deeply eosinophilic cytoplasm, and some necrotic hepatocytes,
as shown in Figure 32.
Figure 32: A- Normal liver architecture. H&E, 40X. B- Normal hepatocytes (black arrows), focal area of
necrosis (blue arrow). H&E, 100X. C- Shows regeneration of the nuclei inside the hepatocytes and deeply
eosinophilic cytoplasm; necrotic hepatocytes and sinusoids dilation (G2). H&E, 400X.
71
G3 showed normal liver tissue architecture, as shown in figure (33-34).
Figure 33: The liver section illustrates normal liver Figure 34: the liver section illustrates normal
architectures. H&E (G3), 40X. liver architectures (G3). H&E, 100X.
The fourth group (control group) showed that the liver has normal liver
architectures and hepatocytes, as shown in Figure 35.
Figure 35: The liver section shows normal hepatocytes. H&E, 400X (control group)
72
According to the findings, G1 showed that the liver has severe necrosis of
hepatocytes, hydropic degenerating hepatocytes, and dilated sinusoids. Moreover,
the liver shows severe hemorrhage, loss of normal striation of hepatocytes, atrophy
of hepatocytes, and engorged central vein.
SLE causes organ and tissue damage due to high titer of the autoantibodies and
immune complex, such as the liver. SLE causes liver pathology, such as hepatitis,
jaundice, and severe inflammation of the liver biopsy (Salem et al., 2019). SLE
causes severe liver damage, hepatic failure, elevation of liver enzymes, and
necrosis of hepatocytes (Guo & LÜ, 2018). The hepatic disorders in patients with
lupus are frequent. The immunoglobulin G (IgG) deposes in the liver and damages
liver tissue. The liver injury was associated with SLE in mice. The
histopathological changes in life include liver inflammation, killer cell
accumulation, and macrophages due to hepatic-deposited lupus IgG (Fang et al.,
2018).
Lupus causes liver function disorders, such as liver damage, hepatitis, cirrhosis,
hyperplasic parenchymal and vascular lesions, hepatotoxicity, and dilated sinusoid,
congestion (Bessone et al., 2014). SLE causes pathological changes in many
organs, such as the kidney, intestine, and liver. The histopathological examination
of the lupus liver includes hepatitis, Cholangitis, Cirrhosis, congestion, and liver
cell damage (Shahin et al., 2017). Lupus causes liver enzyme abnormalities and
histopathologic findings, which include hepatitis, fatty liver, portal inflammation,
hemangioma, congestion, and hepatocyte hyperplasia (Grover et al., 2014).
Enlarged liver cells are detected in infants with liver diseases but rarely in the
mature. SLE leads to abnormal liver function, aggregation of the giant cells in the
liver, low liver function, and increased liver enzymes (Cairns and McMahon,
1996). In a study, they included (238) patients with lupus, which found that 33
patients had liver abnormalities such as cirrhosis, chronic hepatitis, granulomatous
hepatitis, and steatosis. At the same time, nine patients demonstrated advanced
stages of lupus. Three patients died from liver failure (Bruce et al., 1980).
A study in Japan carried out on patients with lupus found several
histopathological changes in the liver, such as liver congestion, fatty liver,
inflammation of the blood vessels of the liver, hepatocyte hyperplasia, chronic
persistent hepatitis, cholangitis, nonspecific reactive hepatitis, hemangioma.
Moreover, the development of nodular regenerative hyperplasia occurs in the liver
with lupus (Toshiharu et al., 1992). A study used (47) patients with lupus with liver
73
function disorder and tissue abnormalities; hepatitis was most common in the
patients with active lupus, increasing the leucocytes and platelets count (Zheng et
al., 2013).
Based on our findings, the group with lupus treated by MSCs showed that the
liver has mostly normal hepatocytes but also a focal area of necrosis, with slight
dilation of sinusoids. The liver shows normal hepatocytes with prominent nuclei,
deeply eosinophilic cytoplasm, and some necrotic hepatocytes. MSCs used for
treating hepatitis in lupus, MScs, can differentiate into many cell types and have
immunomodulatory effects. MSCs repair liver damage and decrease autoimmune
inflammation. MSCs can promote tissue repair, reducing hepatitis and liver
regeneration (Zhang et al., 2020). MSCs have immunosuppressive properties and
can modulate the immune response by inhibiting the proliferation of immune cells,
such as T and B cells, and reducing the pro-inflammatory cytokine levels. MSCs
suppress the lupus inflammation of the liver. MScs have antifibrotic effects that
reduce liver fibrosis by inhibiting the stellate cells, which are responsible for
excessive collagen deposition (Song et al., 2020). MSCs secrete various factors
and molecules that can promote tissue repair and regeneration. These factors can
stimulate the growth and differentiation of endogenous liver cells, promote
angiogenesis, and modulate the inflammatory response (Han et al., 2022). MSCs
induce proliferation and apoptosis; furthermore, MSCs produce VEGF and CXCL-
12, which have a role in repairing damaged tissue (Dandan et al., 2017). MSCs can
differentiate into many cells, demonstrating a role in immunomodulation and
regenerative therapy. MSCs have a valuable application in lupus treatment. MSCs
can treat lupus, rheumatoid arthritis, multiple sclerosis, inflammatory bowel
disease, and Sjogren's syndrome (Jasim et al., 2022). MSCs have potential in
regenerative medicine, including treating liver damage in lupus. MSCs can
regulate the immune system's response (Shandil et al., 2022). In lupus, the immune
system attacks healthy tissues, including the liver. MSCs can suppress the immune
response, reducing inflammation and preventing liver damage (Huang et al., 2022).
MSCs release many anti-inflammatory molecules that lower the inflammatory
response in the liver. MSCs can secrete the cytokines that stimulate the
regeneration of damaged liver cells (Zuhair, 2022). The above showed data in the
literature that agreed with our results on hepatic histopathological changes due to
lupus; SLE was associated with increased liver diseases, including
histopathological changes, liver function abnormalities, and pathological signs.
74
MSCs can differentiate into hepatocyte-like cells and integrate into the existing
liver tissue, enhancing the regenerative process (Wu et al., 2020). In liver damage,
fibrosis may be occurring, affecting liver function. MSCs can reduce fibrosis and
stimulate the extracellular matrix, facilitating tissue repair (Eom et al., 2020).
1.4.2. Kidney:
G1 showed atrophy of glomeruli in the kidney, with severe necrosis of renal
tubules of the kidney, vascular dilatation, obliteration of some renal tubules, and
fibrosis of interstitial tissue between renal tubules; in addition to that, there is
hemorrhage and deposition of eosinophilic materials in the lumen of the renal
tubule, as shown in figure (36-37).
Figure 36: Kidney section with atrophy of glomeruli (black arrow); some glomeruli are normal (yellow
arrows) (G1), H&E, 4X and 400X.
75
Figure 37: Severe necrosis of renal tubules of the kidney (blue arrows), vascular dilatation (yellow arrow),
obliteration of some renal tubules (black arrow), fibrosis (pink arrow) of interstitial tissue between renal
tubules, hemorrhage (H), and deposition of eosinophilic materials (green arrow) in the lumen of the renal
tubule (G1) H&E, 400X.
G2 showed almost normal renal tubules of the kidney but slight sloughing of
the epithelial lining of a few renal tubules; in addition, there are normal renal
glomeruli of the kidney and few atrophied glomeruli, as shown in Figure (38-40).
Figure 38: Almost normal renal tubules of the kidney, but sloughing of the epithelial lining of a few renal
tubules (yellow arrows) was also seen (G2), H&E, 400X.
76
Figure 39: Normal renal glomeruli of the kidney (black arrows) and few atrophied glomeruli (blue arrow)
were also seen; almost normal renal tubules with slightly sloughed lining epithelium (yellow arrows) of renal
tubules were evident (G2). H&E, 40X and 400X.
Figure 40: Normal renal glomeruli of the kidney (black arrows) and renal tubules, but mild sloughing of
lining epithelium (red arrow) was also evident (G2). H&E, 40X, 100X, and 400X.
77
G3, as shown in Figure 41, wherever, G3 showed that kidney tissues have
normal glomeruli and normal proximal, distal, and convoluted tubules, as shown in
Figure 42.
Figure 41: Normal renal glomeruli of the kidney (black arrows) and renal tubules in (G3). H&E, 400X.
The fourth group showed that kidney tissues have normal glomeruli and normal
proximal, distal, and convoluted tubules, as shown in Figure 42.
Figure 42: Normal renal glomeruli and renal tubules of the kidney (G4) (control group), H&E, 100X and
400X
78
According to our results, the lupus group showed atrophy of glomeruli in the
kidney, severe necrosis of renal tubules of the kidney, vascular dilatation,
obliteration of some renal tubules, fibrosis of interstitial tissue of the renal tubules,
in addition to that, there are hemorrhage and deposition of eosinophilic materials in
the lumen of the renal tubule. The lupus group and treated by the MSCs group
showed normal renal tubules of the kidney but slight sloughing of the epithelial
lining of a few renal tubules; in addition, there are normal renal glomeruli of the
kidney and few atrophied glomeruli.
The LN categorization needs to include a list of prognosticators supported by

data. While the validation of a formal index is still pending, our research suggests
that explicit independent grading should be used for at least fibrinoid necrosis,
fibrous crescents, and IF/TA to determine the likelihood of developing renal failure
in combination with clinical symptoms (Rijnink et, al., 2017).
SLE may be caused by glomerular pathology, tubule-interstitial, or vascular

pathology. The renal lesions are developed into the glomerular scar and loss of
function. Lupus is associated with tubular atrophy, interstitial fibrosis, glomerular
inflammation, and tubular atrophy (Cimbaluk et al., 2023). There are morphologic
and microscopic changes in the kidney with lupus, such as renal inflammation
(nephritis). Glomeruli necrosis is most common in kidneys with SLE. The focal or
diffuse involvement of the glomerulus occurs due to the immune complex
deposition (Giannakakis et al., 2011).
Lupus renal has developed renal failure and renal damage over time. Lupus
nephritis occurs as glomerulonephritis, acute tubule-interstitial damage. Lupus
nephritis showed different degrees of renal failure, depending on the disease
period, disease degree, and glomerular lesions. The advanced stage of lupus
nephritis develops into chronic renal failure and renal damage (Davidson, 2016).
More than three hundred renal biopsies in patients with lupus showed diffuse
proliferative glomerulonephritis, severe renal lesions, nephritis, glomerular lesions,
tubular atrophy, sclerosis, and interstitial fibrosis (Dimitrijević et al. 2002).
The kidney with lupus showed that lesions formed and deposited the immune
complex in the renal glomeruli, tubulo-interstitium, and vessels (Isaac, 2021).
Lupus kidney demonstrated renal fibrinous necrosis, fibrous crescents, and
79
interstitial fibrosis/tubular atrophy compared to the healthy group (Rijnink et al.,

2017). Lupus causes different stages of renal failure due to the pathological
changes in the kidney, such as Nephritis (Gupta et al., 2021).
The study included (58) patients with kidney failure with lupus and (64)
patients who died. The histopathological changes include tubular atrophy,
tubulointerstitial inflammation, cellular crescents, and different stages of renal
failure (Liao et al., 2023)
Nephritis, renal injury, IgA nephropathy, glomerular injury, kidney necrosis,
low kidney function, etc., are the most common histopathological changes in the
renal tissues due to lupus diseases (Bajema et al., 2023). The lupus nephritis
showed pathological changes in three regions. The first, the glomerular Lesions in
SLE, included (Crescents, necrotizing glomerulonephritis, kidney biopsies, extra
capillary hypercellularity, acute kidney injury, immune complex deposition,
segmental lesions, podocyte injury, tubulointerstitial injury, and glomerulopathy).
The second the tubulointerstitial Lesions included (tubulointerstitial and vascular
lesions, interstitial inflammatory cell infiltration, tubular atrophy, interstitial
fibrosis, mild glomerular lesions, interstitial inflammation, tubular atrophy, and
interstitial fibrosis, and tubulitis). The third vascular Lesions included (arterial
sclerosis, non-inflammatory necrotizing vasculopathy, thrombotic
microangiopathy, renal vasculitis, renal vasculitis, and renal vascular lesions)
(Obrișcă et al., 2022).
For SLE patients with nephritis due to IgA deposition in the renal tissue, the
kidney biopsy showed deposition of IgA in the kidney tissues compared to the
healthy group. High IgA levels result in nephritis development in the lupus kidney
(Honggyan et al., 2013) (Cimbaluk et al., 2023).
MSCs have various therapeutic applications for autoimmune diseases such as
lupus (Cras et al., 2015). MSCs have the therapeutic role of renal histopathology in
lupus nephritis due to their immunosuppressive properties, inhibit the activation
and immune cell proliferation, anti-inflammatory effects, and Promotion of tissue
repair by MSCs can differentiate into different cell types for repairing damaged
renal tissue and the generation of new blood vessels, for improve the renal
histopathology, MSCs have antifibrotic effects decrease and prevent the fiber and
collagen production for of fibrotic markers, such as collagen. By modulating the
fibrotic process, MSCs may help mitigate renal histopathological changes
(Sarsenova et al., 2022) (Han et al., 2022).
80
The reviewed studies support and agree with our findings that the mesenchymal
stem cells can repair and restore the histopathological changes to the normal
architecture due to their ability to repair damaged tissues due to inflammation
caused by lupus erythematosus.
1.5. The correlation study:
According to our results, there is a positive correlation between IL-10 and IL-6
at a significant level (0.01) and between CCL2 and VEGF at a significant level (P≥
0.05), wherever R-value was (0.903) and (0.666) respectively in the first group.
However, there is a negative correlation between IL-6 and VEGF, also between
TGF- β1 and CCL2, and finally between CCL-5 RANTES and ICAM-1 at (P≥
0.05), wherever R values were (-0.738), (-0.691), and (-0.653) respectively in the
first group, as shown in Table 14.
Table 14: The correlation relationship between the cytokines and chemokines
used in the first group (G1) by using liner R Pearson tests
CCL-5
IL-10 IL-6 TGF- β1 CCL2 RANTES VEGF ICAM-1 IFN- γ
IL-10 1
IL-6 0.903** 1
TGF-B 0.301 0.325 1
CCL2 -0.503 -0.433 -0.691* 1
CCL-5 -0.425 -0.374 -0.102 -0.209 1
VEGF -0.569 -0.738* -0.445 0.666* 0.109 1
ICAM-1 0.126 0.022 0.267 0.084 -0.653* 0.043 1
IFN-Y 0.005 0.146 -0.014 0.301 0.055 0.191 -0.463 1
* Correlation is significant at the 0.05 level, ** Correlation is significant at the 0.01 level
Several studies have investigated the correlation between Interleukin-10 and

Interleukin-6 in lupus (Chun et al., 2007; Capper et al., 2004; Ruchakorn et al.,
2019). Another study reported a correlation between IL-10 and IL-6 serum levels
was found only in SLE. It also noted that the elevation of IL-10 serum levels in
SLE and the positive correlation between IL-10 and IL-6 in SLE may suggest that
IL-10 may play a central role in inflammatory connective tissue diseases, and that
supports our results (Lacki et al., 197). A study on serum IL-6, IL-10, and TNF-α
levels changes in SLE patients found a positive correlation between anti-dsDNA
81
antibodies and IL-6, IL-10, and TNF-α levels (Jin et al., 2021). A study designed to
establish the correlation between IL-6 and the severity of SLE found a direct
correlation between the level of IL-6 and the severity of SLE (Ali, 2023).
IL-6 is a pro-inflammatory cytokine that plays a crucial role in the immune

response and inflammation. VEGF is a growth factor that stimulates the growth of
blood vessels and has been implicated in the pathogenesis of various diseases,
including lupus. Although there is limited research on the correlation between IL-6
and VEGF in lupus, some studies have investigated the relationship between these
factors in different contexts. A study on the correlation between IL-6 and the
development of systemic lupus erythematosus (SLE) found a direct correlation
between IL-6 levels and the severity of SLE (Ding et al., 2020).
Another study on cytokine levels in SLE patients found that IL-6, IL-10, IL-12,
and IFN-gamma were significantly elevated in active SLE patients compared to
healthy controls (Chun et al., 2007). A study found that TGF-β1 levels were lower
in SLE patients with SLEDAI scores 1-10 and SDI > 3 and were correlated with
chemokine CCL2 (Becker-Merok et al., 2020). The chemokine CCL5, also known
as RANTES (Regulated upon Activation, Normal T cell Expressed, and Secreted),
has been studied in the context of systemic lupus erythematosus (SLE). Elevated
serum levels of circulating RANTES have been described in SLE patients, and it
has been found that the expression of RANTES mRNA in the urinary sediment is
elevated in patients with active lupus nephritis (LN). One study reported that
RANTES correlates with proteinuria and SLE Disease Activity Index (SLEDAI)
levels, but it is not a good predictor of renal flare and has no correlation with the
activity index, chronicity index, or any histopathological characteristics (Aragón et
al., 2020).
On the other hand, ICAM-1 is a cell surface glycoprotein ligand for the
leukocyte integrin LFA-1. Treatment with cyclosporine has been shown to inhibit
ICAM-1 expression. While information is available on the individual roles of
RANTES and ICAM-1 in SLE, the specific correlation between RANTES and
ICAM-1 in the context of lupus is not well-documented in the provided search
results. Further research may be needed to explore the potential correlation
between these two factors in SLE (Jacob et al., 2011).
82
The results of the current study showed no correlation relationship between any
of the parameters used in the second group, as shown in Table 15.
VEGF-
IL-10 IL-6 TGF- β1 CCL-2 CCL-5 A ICAM-1 INF - γ
IL-10 1
IL-6 -0.419 1
TGF β1 -0.179 0.112 1
CCL-2 0.145 -0.479 0.372 1
CCL-5 -0.128 -0.151 -0.125 0.336 1
VEGF-
A 0.231 0.245 -0.132 -0.003 -0.333 1
ICAM-1 -0.441 0.502 0.008 -0.529 0.335 -0.437 1
INF - γ 0.433 -0.663 0.302 0.344 -0.012 -0.338 -0.225 1
Based on the results, the results demonstrated that negative correlation between
IL-6 and INF- γ, also between TGF β1 and CCL-2 at a significant level (P≥0.05),
wherever R values were (-0.736) and (-0.782), respectively in the third group, as
shown in Table 16.
IL-10 IL-6 TGF β1 CCL-2 CCL-5 VEGF ICAM-1 INF- γ
IL-10 1
IL-6 -0.024 1
TGF β1 0.378 -0.036 1
CCL-2 -0.442 -0.136 -0.782* 1
CCL-5 0.137 -0.262 -0.578 0.321 1
VEGF -0.522 -0.105 -0.008 0.138 -0.432 1
ICAM-1 0.110 -0.406 0.517 -0.267 -0.275 0.024 1
INF- γ 0.039 -0.736* -0.203 0.298 0.359 0.081 0.584
* Correlation is significant at the 0.05 level
According to the search results, the interplay between IFN-γ and IL-6 regulates
inflammation and gene expression. IFN-γ controls PMN infiltration and modulates
IL-6 signaling through its soluble receptor to promote their apoptosis and clearance
(McLoughlin et al., 2003). Both IFN-γ and IL-6 are required for increased
83
expression of IRF-1, which regulates IFN-stimulated genes and is required for

mHgIA (Cauvi et al., 2017) (David et al., 2017).
IRF-1 is also involved in the IFN-γ regulated expression of IL-6 with TNF-α
activated p65-NF-κB or via co-activation of TLR3 and TLR7 pathways. IFN-γ
may also drive IL-6 production in combination with IL-1β. Previous studies have
indicated that IFN-γ and IL-6 have opposing roles in cell proliferation, apoptotic
death, and inflammation, regulated by a complex crosstalk mechanism (Zhang et
al., 2022) (Qi et al., 2013). The search results did not provide direct information
about the correlation between TGF-β1 and CCL-2. However, they discussed the
role of the CLC-2 chloride channel in TGF-β1-induced processes and signaling
pathways (Sun et al., 2020) (Wang & Wang, 2013). The results indicated that
TGF-β1 can influence the expression of CLC-2 and CLC-3 chloride channels and
their association with various cellular processes and signaling pathways. While the
search results did not directly address the correlation between TGF-β1 and CCL-2,
they highlighted the involvement of TGF-β1 in cellular processes that may be
related to CCL-2 expression and function. Further research on the relationship
between TGF-β1 and CCL-2 would be needed to determine their direct correlation
(Cheng et al., 2007) (Sun et al., 2016).
The current results reveal a negative correlation between TGF β1 and VEGF,
also between CCL-5 and INF- γ at significant levels (P≥0.05), wherever R values
were (-0.513) and (0.530) respectively in the fourth group, as shown in Table 17.
IL-10 IL-6 TGF β1 CCL-2 CCL-5 VEGF ICAM-1 INF - γ
IL-10 1
IL-6 0.102 1
TGF β1 -0.213 0.398 1
CCL-2 0.489 -0.009 0.042 1
CCL-5 -0.297 -0.335 -0.347 -0.379 1
VEGF -0.275 -0.213 -0.513* -0.493 0.067 1
ICAM-1 -0.502 0.110 0.278 -0.491 0.088 0.045 1
INF- γ -0.392 -0.269 0.095 -0.126 0.530* -0.182 0.223 1
* Correlation is significant at the 0.05 level
84
TGF-β1 has been shown to induce VEGF expression in human granulosa-lutein

cells, which could potentially contribute to the pathogenesis of ovarian
hyperstimulation syndrome. Treatment with 5 ng/mL or 10 ng/mL TGF-β1 induced
a comparable increase in VEGF mRNA levels, and TGF-β1 significantly
stimulated the secretion of VEGF protein (Fang et al., 2020).
TGF-β1 is known to induce angiogenesis in vitro and in vivo, and it has been
proposed that TGF-β1 induces angiogenesis through an indirect mechanism by
inducing the expression of VEGF and/or other angiogenic factors in epithelial or
other cell types. TGF-β1 induces vascular endothelial cell expression of VEGF,
which mediates the apoptotic activity of TGF-β1 through activation of VEGFR2.
VEGF and TGF-β1 are often co-expressed in tissues where angiogenesis occurs,
notably in various tumors. However, the interactions between these two growth
factors at the level of endothelial cells are not yet fully understood (Ferrari et al.,
2009). In a study on patients with advanced non-small cell lung cancer, serum
VEGF-A, TGF-1β, and IL-1β levels were found to be associated with clinical
outcomes (Kim et al., 2013).
A study on women with endometriosis found that TGF-β1 regulated peritoneal

VEGF-A expression through an ID1 pathway (Young et al., 2015). TGF-β1 has
also been reported to induce neoangiogenesis with peritoneal fibrosis in patients
undergoing peritoneal dialysis, and the TGF-β1-VEGF-A pathway is involved in
this process (Kariya et al., 2018).
In the end, Through the above study and the results reached and discussed in this
chapter, it may be clear to everyone how important this study is in supporting
research projects in treating and diagnosing lupus. Eight important cytokines were
studied, and previous research indicated their importance and close relationship
with lupus disease. For the first time, the determination of the gene expression of
the genes encoding the studied cytokines was addressed. The results showed gene
expression consistent with and supportive of what was stated in the first serological
part. We confirm that studying the relationship of gene expression to cytokines in
Lupus disease was reported for the first time.
The third and final part of the study included a study of the histopathological
changes in kidney and liver tissue. The results supported what was stated in the
85
first two chapters, the first chapter (serological) and the second chapter
(molecular). The third chapter represents the final part of the story concerning the
experimental aspect, and the results came in a dramatic way that supports and
reinforces the results of the first and second chapters.
We hope this study will be part of the scientific studies of the scientific
community interested in studying lupus disease as a diagnosis and treatment.
86
Conclusion and
Perspectives
Conclusion and Perspective
1. The Conclusion and Perspective
1.1. The conclusion:
1- Lupus causes an increase in levels of IL-6, CCL-5/RANTES, VEGF, ICAM,

CCL-2/MCP-1, and IFNγ (pro-inflammatory cytokines) in the first group
(lupus-induced mice).
2- Lupus decreases in levels of IL-10 and TGFβ1 (anti-inflammatory
cytokines) in the lupus-induced mice.
3- Lupus causes an increase in the gene expression of the IL-6, CCL-
5/RANTES, VEGF, ICAM, CCL-2/MCP-1, and IFNγ mRNA in the first
group (lupus-induced mice).
4- Lupus decreases in the IL-10 and TGFβ1 mRNA's gene expression (anti-
inflammatory cytokines) in the lupus-induced mice.
5- Bone marrow derived-MSCs cause decreasing IL-6, CCL-5/RANTES,
VEGF, ICAM, CCL-2/MCP-1, and IFNγ (pro-inflammatory cytokines) in
the treated group (the second group).
6- Bone marrow derived-MSCs cause an increase in IL-10 and TGFβ1 (anti-
inflammatory cytokines) in the treated mice.
7- BM-MSCs cause a decrease in the gene expression of the IL-6, CCL-
5/RANTES, VEGF, ICAM, and CCL-2/MCP-1 genes in the treated mice.
8- BM-MSCs cause an increase in IFNγ IL-10 and TGFβ1 gene expression in
the treated mice.
9- Lupus causes negative histopathological changes in the liver and kidney; it
includes severe necrosis of hepatocytes, hydropic degenerated hepatocytes,
and dilated sinusoids, which were evident with some viable cells. Severe
hemorrhage and necrosis of hepatocytes, loss of normal striation of
hepatocytes, and atrophy of hepatocytes are detected with engorged central
veins.
10- Lupus causes negative histopathological changes in the kidney that include
atrophy of glomeruli in the kidney, with severe necrosis of renal tubules of
the kidney, vascular dilatation, obliteration of some renal tubules, and
fibrosis of interstitial tissue between renal tubules in addition to that, there is
hemorrhage and deposition of eosinophilic materials in the lumen of the
renal tubule.
87
11- BM-MSCs have ameliorated effects of the histopathological changes of the

liver in mice with lupus SLE.
12- BM-MSCs have ameliorated effects of the histopathological changes of the
kidney in mice with lupus SLE.
13- The correlation study showed a positive relation between (IL-10 and IL-6),
(CCL2, and VEGF) in the first group (lupus group).
14- There is a negative correlation between (IL-10 and CCL2), (IL-10 and
VEGF), (IL-6 and VEGF), (TGF- β1 and CCL2) in the first group (lupus
group).
15- There is no correlation between the used parameters in the second group
(treated group).
16- The third group has a negative correlation relationship between (TGF β1
and CCL-2), (IL-6 and INF- γ).
17- There is a correlation between CCL-5 and INF- γ (positive correlation) and
between TGF β1 and VEGF (negative correlation) in the fourth group
(control group).
18- The study suggests that CCL-2 is considered the fit biomarker tool or
indicator for diagnosing lupus in the first group.
88
1.2. The Perspective:
1- BM-MSCs could treat lupus erythematosus (SLE) in mice; BM-MSCs

significantly affect serological, molecular, and histological levels.
2- Make studies on using BM-MSCs to treat lupus erythematosus in other lab
animals, such as rats, rabbits, and guinea pigs.
3- Make studies related to the action mechanism, the effect of BM-MSCs on
immune cells, and the levels of specific and general biomolecules in the
serum.
4- Make studies including the effect of BM-MSCs on treating other
autoimmune diseases such as diabetes, rheumatoid arthritis (RA), and
vascular sclerosis.
5- We are conducting therapeutic studies using two types of stem cells to
determine the results.
6- They are experimenting with new and rapid methods of inducing lupus
disease in mice.
7- It conducts special reports and studies on the relationship between lupus and
some physiological and biochemical parameters.
8- They are conducting studies on the effect of lupus on other types of tissues,
such as the brain, vision, hearing, nervous activity, hair growth, spleen, and
general behavior.
9- We advise researchers reading this work to complete the aspects that are
appropriate for an integrated research project to support the scientific
process and the specialized scientific community with information and data
that is useful and supportive of other researchers.
10- It was conducting qualitative studies in cooperation with international
research teams to create an international or local working database for each
region that provides up-to-date information related to statistics related to
lupus disease.
11- They are adopting and presenting research projects on stem cells and their
ability to treat autoimmune diseases, especially lupus, to international
organizations that can make decisions regarding the permissibility of using
stem cells, such as the World Health Organization and the Food and Drug
Administration.
89
12- Supporting research teams and researchers in all universities around the
world morally, materially, and scientifically with the methods and
techniques used in developing the science related to stem cells in terms of
development, investment, applications, and marketing.
90
References
The references
The references:
Abbasifard, M., Kamiab, Z., Hasani, M. (2020). Assessing the expression of

immunosuppressive cytokines in the newly diagnosed systemic lupus
Erythematosus patients: a focus on B cells. BMC Immunol, 21, 58.
Abu-Dawud R, Graffmann N, Ferber S, Wruck W, Adjaye J. (2018).
Pluripotent stem cells: induction and self-renewal. Philos Trans R Soc
Lond B Biol Sci. 5;373(1750):20170213.
https://doi:10.1098/rstb.2017.0213.
Alberts B, Johnson A, Lewis J, et al. (2002). Molecular Biology of the Cell. 4th
edition. New York: Garland Science; Epidermis and Its Renewal by
Stem Cells. https://www.ncbi.nlm.nih.gov/books/NBK26865/
Ali, M. S. M. (2023). LSO-102 The correlation between interleukin-6 (IL-6)
and the development of systemic lupus erythematosus (SLE) in
universiti sains Malaysia (USM).
Alison MR, Vig P, Russo F, Bigger BW, Amofah E, Themis M, Forbes S.
(2004). Hepatic stem cells: from inside and outside the liver? Cell
Prolif.;37(1):1-21. https://doi:10.1111/j.1365-2184.2004.00297.x.
Almashat, R. A. (2015). Gene expression profiles of cytokines during
osteogenic differentiation of human gingiva derived mesenchymal stem
cells. Nova Southeastern University.
Altaner, C., Altanerova, V., Cihova, M., Hunakova, L., Kaiserova, K.,
Klepanec, A., ... & Madaric, J. (2013). Characterization of mesenchymal
stem cells of "no-options" patients with critical limb ischemia treated by
autologous bone marrow mononuclear cells. PLoS One, 8(9), e73722.
Aly RM. (2020). Current state of stem cell-based therapies: an overview. Stem
Cell Investig. 15;7:8. https://doi:10.21037/sci-2020-001.
Ameer MA, Chaudhry H, Mushtaq J, Khan OS, Babar M, et al. 2022). An
Overview of Systemic Lupus Erythematosus (SLE) Pathogenesis,
Classification, and Management. Cureus. 15;14(10):e30330.
https://doi:10.7759/cureus.30330.
Andersson-Rolf A, Zilbauer M, Koo BK, Clevers H. (2017). Stem Cells in
Repair of Gastrointestinal Epithelia. Physiology (Bethesda).
Jul;32(4):278-289. https://doi:10.1152/physiol.00005.2017.
Andrzejewska A, Lukomska B, Janowski M. (2019). Concise Review:
Mesenchymal Stem Cells: From Roots to Boost. Stem Cells.; 37(7):855-
864. https://doi:10.1002/stem.3016.
91
The references
Aragón CC, Tafúr RA, Suárez-Avellaneda A, et al. (2020). Urinary

biomarkers in lupus nephritis. J Transl Autoimmun. 13;3:100042.
https://doi:10.1016/j.jtauto.2020.100042.
Bae EH, Lim SY, Han K-D, (2020). Trend of prevalence and incidence of
systemic lupus erythematosus in South Korea, 2005 to 2015: a
nationwide population-based study. Korean J Intern Med;35:652–61.
Bai, Y, Tong, Y, Liu, Y, & Hu, H. (2018). Self-dsDNA in the pathogenesis of
systemic lupus erythematosus. Clin. Exp. Immunol.,; 191(1), 1–10.
https://doi.org/10.1111/cei.13041
Bajema, I. M., Balow, J. E., Haas, M., Jayne, D., et al. (2023). Update on
scoring and providing evidence basis for assessing pathology in lupus
nephritis. Kidney International, 103(5), 813-816.
Baker CL, Pera MF. (2018). Capturing Totipotent Stem Cells. Cell Stem Cell.
4;22(1):25-34. https://doi:10.1016/j.stem.2017.12.011.
Bakshi N, Munir T, Guma M, Chenitz KB. A (2023). Rare Case of
Antinuclear Antibody (ANA)-Negative Lupus Nephritis. Cureus.
6;15(7):e41480. https://doi:10.7759/cureus.41480.
Ballou SP, Khan MA, Kushner I. (1982). Clinical features of systemic lupus
erythematosus: differences related to race and age of onset. Arthritis
Rheum.;25(1):55-60. https://doi:10.1002/art.1780250109.
Barber, M.R.W., Drenkard, C., Falasinnu, T. (2021). Global epidemiology of
systemic lupus erythematosus. Nat Rev Rheumatol 17, 515–532.
https://doi.org/10.1038/s41584-021-00668-1
Batool S, Ahmad NM, Saeed MA, Farman S. (2016). Pattern of initial clinical
manifestations of systemic lupus erythematosus in a tertiary care
hospital. Pak J Med Sci.;32(5):1066-1070.
https://doi:10.12669/pjms.325.11480.
Becker Y, Marcoux G, Allaeys I, Julien AS, et al. (2019). Autoantibodies in
Systemic Lupus Erythematosus Target Mitochondrial RNA, Front.
Immunol.;10,1026.
Becker-Merok A, Eilertsen GØ, Nossent JC. (2010).Levels of transforming
growth factor-beta are low in systemic lupus erythematosus patients
with active disease. J. Rheumatol. ;37(10):2039-45.
https://doi:10.3899/jrheum.100180
Bertsias G, Karampli E, Sidiropoulos P, Gergianaki I, Drosos A, Sakkas L,
Boumpas D (2016). Clinical and financial burden of active lupus in
Greece: a nationwide study. Lupus 25(12):1385–1394
Bessone F, Poles N, Roma MG. (2014). Challenge of liver disease in systemic
lupus erythematosus: Clues for diagnosis and hints for pathogenesis.
World J Hepatol; 6(6): 394-409 https://DOI:10.4254/wjh.v6.i6.394
92
The references
Biehl JK, Russell B. (2009). Introduction to stem cell therapy. J Cardiovasc

Nurs. ;24(2):98-103; quiz 104-5.
https://doi:10.1097/JCN.0b013e318197a6a5.
Bishop, A.E., Buttery, L.D.K. and Polak, J.M. (2002), Embryonic stem cells. J.
Pathol., 197: 424-429. https://doi.org/10.1002/path.1154
Black SM, Walocko F, Li X, et al (2021). Development of systemic lupus in
patients with cutaneous lupus using the 2012 systemic lupus
international collaborating clinics (SLICC) classification criteria for
systemic lupus erythematosus. J Am Acad Dermatol;85:200–2.
https://doi:10.1016/j.jaad.2020.12.061
Blanpain C, Fuchs E. (2006). Epidermal stem cells of the skin. Annu Rev Cell
Dev Biol. ;22:339-73.
https://doi:10.1146/annurev.cellbio.22.010305.104357.
Bonner-Weir S, Sharma A. (2002). Pancreatic stem cells. J Pathol.
;197(4):519-26. https://doi:10.1002/path.1158.
Boroviak T., Nichols J. (2014). The birth of embryonic pluripotency.
Philosophical Transactions of the Royal Society B: Biological
Sciences.;369(1657):p. 20130541. https://doi:10.1098/rstb.2013.0541.
Bragança J, Lopes JA, Mendes-Silva L, Almeida Santos JM. (2019). Induced
pluripotent stem cells, a giant leap for mankind therapeutic
applications. World J Stem Cells. 26;11(7):421-430.
https://doi:10.4252/wjsc.v11.i7.421.
Brittan M, Wright NA. (2004). The gastrointestinal stem cell. Cell
Prolif.;37(1):35-53. https://doi:10.1111/j.1365-2184.2004.00299.x.
Bruce A. Runyon, Douglas R. LaBrecque, Sinn Anuras, (1980). The spectrum
of liver disease in systemic lupus erythematosus: Report of 33
histologically-proved cases and review of the literature, The American
Journal of Medicine, Volume 69, Issue 2, P:187-194,
https://doi.org/10.1016/0002-9343(80)90378-2.
Bruno, S., & Bussolati, B. (2013). Therapeutic effects of mesenchymal stem
cells on renal ischemia–reperfusion injury: a matter of genetic
transfer?. Stem Cell Research & Therapy, 4(5), 1-2.
Bryder D, Rossi DJ, Weissman IL. (2006). Hematopoietic stem cells: the
paradigmatic tissue-specific stem cell. Am J Pathol. ;169 (2):338-46.
https://doi:10.2353/ajpath.2006.060312.
Bukulmez H, Kumar G. (2021). Clinical Use of Mesenchymal Stem Cells in
Treatment of Systemic Lupus Erythematosus, Lupus-Need to Know, 22;
IntechOpen, https://doi:10.5772/intechopen.97261
93
The references
Bukulmez, Hulya, Iren Horkayne-Szakaly, et al. (2021). Intrarenal injection

of mesenchymal stem cell for treatment of lupus nephritis in mice–a
pilot study. Lupus 30, no. 1: 52-60.
Cai J, Chen H, Xie S, Hu Z, Bai Y. (2022). Research Progress of Totipotent
Stem Cells. Stem Cells Dev.; 31(13-14):335-345.
https://doi:10.1089/scd.2022.0061.
Cairns, A., and McMahon R. F.. (1996). Giant cell hepatitis associated with
systemic lupus erythematosus." Journal of clinical pathology 49, no. 2:
183-184.
Campbell R Jr, Cooper GS, Gilkeson GS (2008). Two aspects of the clinical
and humanistic burden of systemic lupus erythematosus: mortality risk
and quality of life early in the course of disease. Arthritis Care Res
59(4):458–464
Capper ER, Maskill JK, Gordon C, Blakemore AI. (2004). Interleukin (IL)-
10, IL-1ra and IL-12 profiles in active and quiescent systemic lupus
erythematosus: could longitudinal studies reveal patient subgroups of
differing pathology? Clin Exp Immunol.;138(2):348-56.
https://doi:10.1111/j.1365-2249.2004.02607.x.
Carp, Diana M., and Yun Liang. (2022). Universal or Personalized
Mesenchymal Stem Cell Therapies: Impact of Age, Sex, and Biological
Source. Cells 11, no. 13: 2077.
Carter EE, Barr SG, Clarke AE (2016) The global burden of SLE: prevalence,
health disparities and socioeconomic impact. Nat Rev Rheumatol
12(10):605–620
Cauvi DM, Cauvi G, Toomey CB, Jacquinet E, Pollard KM. (2017). From the
Cover: Interplay Between IFN-γ and IL-6 Impacts the Inflammatory
Response and Expression of Interferon-Regulated Genes in
Environmental-Induced Autoimmunity. Toxicol Sci. 1;158(1):227-239.
https://doi:10.1093/toxsci/kfx083.
Charitos IA, Ballini A, Cantore S, Boccellino M, Di Domenico M, et al. (2021).
Stem Cells: A Historical Review about Biological, Religious, and Ethical
Issues. Stem Cells Int. 29;2021:9978837.
https://doi:10.1155/2021/9978837.
Chela H, Romana BS, Madabattula M, Albarrak AA, et al. (2020). Stem cell
therapy: a potential for the perils of pancreatitis. Turk J
Gastroenterol.;31(6):415-424. https://doi:10.5152/tjg.2020.19143.
Chen H, Shi B, Feng X, Kong W, Chen W, et al. (2015). Leptin and
neutrophil-activating peptide 2 promote mesenchymal stem cell
senescence through activation of the phosphatidylinositol 3-kinase/Akt
94
The references
pathway in patients with systemic lupus erythematosus. Arthritis

Rheumatol.;67:2383–93.
Cheng T, Ding S, Liu S, Li Y, Sun L. (2021). Human umbilical cord-derived
mesenchymal stem cell therapy ameliorates lupus through increasing
CD4+ T cell senescence via MiR-199a-5p/Sirt1/p53 axis. Theranostics.
1;11(2):893-905. https://doi:10.7150/thno.48080
Cheng, G., Shao, Z., Chaudhari, B., & Agrawal, D. K. (2007). Involvement of
chloride channels in TGF-β1-induced apoptosis of human bronchial
epithelial cells. American Journal of Physiology-Lung Cellular and
Molecular Physiology, 293(5), L1339-L1347.
Choi, E. W., Shin, I.S., Park, S.Y., Park, J.H., Kim, J.S., Yoon, E.J., Kang,
S.K., Ra, J.C. and Hong, S.H. (2012), Reversal of serologic,
immunologic, and histologic dysfunction in mice with systemic lupus
erythematosus by long-term serial adipose tissue–derived mesenchymal
stem cell transplantation. Arthritis & Rheumatism, 64: 243-253.
https://doi.org/10.1002/art.33313
Choi, E., Lee, M., Song, J. et al. (2016).Mesenchymal stem cell transplantation
can restore lupus disease-associated miRNA expression and Th1/Th2
ratios in a murine model of SLE. Sci Rep 6, 38237.
https://doi.org/10.1038/srep38237
Chun HY, Chung JW, Kim HA, Yun JM, et al. (2007). Cytokine IL-6 and IL-
10 as biomarkers in systemic lupus erythematosus. J. Clin. Immunol.
2007 Sep;27 (5):461-6. https://doi:10.1007/s10875-007-9104-0
Chun, W., Tian, J. & Zhang, Y. (2021). Transplantation of mesenchymal stem
cells ameliorates systemic lupus erythematosus and upregulates B10
cells through TGF-β1. Stem Cell Res Ther, 12, 512.
Cimbaluk, David J., and Melvin M. Schwartz, (2013). Lupus nephritis:
Histopathology', in Dwomoa Adu, Paul Emery, and Michael Madaio
(eds), Rheumatology and the Kidney, 2 edn, Oxford Clinical Nephrology
Series https://doi.org/10.1093/med/9780199579655.003.0013
Cojocaru M, Cojocaru IM, Silosi I, Vrabie CD. (2011). Manifestations of
systemic lupus erythematosus. Maedica (Bucur). ;6(4):330-6.
Cook, H.C. ed., (1973). Histopathology: Selected Topics. Bailliere Tindall
Limited.
Cras A, Farge D, Carmoi T, Lataillade JJ, Wang DD, Sun L. (2015). Update
on mesenchymal stem cell-based therapy in lupus and scleroderma.
Arthritis Res Ther. 3;17:301. https://doi:10.1186/s13075-015-0819-7.
Danchenko N, Satia JA, Anthony MS (2006) Epidemiology of systemic lupus
erythematosus: a comparison of worldwide disease burden. Lupus
15(5):308–318
95
The references
Dandan W, Lingyun S, Xiao-Dong C. (2019). Chapter 7 - Systemic Lupus

Erythematosus, A Roadmap to Non-Hematopoietic Stem Cellbased
Ther., Academic Press, 143-172.
Dandan Wang et al. (2017). Serum IFN-γ Predicts the Therapeutic Effect of
Mesenchymal Stem Cells Transplantation in Systemic Lupus
Erythematosus Patients, Stem Cells Translational Medicine, Volume 6,
Issue 9, P:1777–1785, https://doi.org/10.1002/sctm.17-0002
Dave M, Rankin J, Pearce M, Foster HE (2020). Global prevalence estimates
of three chronic musculoskeletal conditions: club foot, juvenile
idiopathic arthritis and juvenile systemic lupus erythematosus. Pediatr
Rheumatol 18(1):1–7
David M. Cauvi, Gabrielle Cauvi, Christopher B. Toomey, et al. (2017). From
the Cover: Interplay Between IFN-γ and IL-6 Impacts the
Inflammatory Response and Expression of Interferon-Regulated Genes
in Environmental-Induced Autoimmunity, Toxicological Sciences,
Volume 158, Issue 1, P: 227–239, https://doi.org/10.1093/toxsci/kfx083
Davidson A. (2016). What is damaging the kidney in lupus nephritis? Nat Rev
Rheumatol. 12(3):143-53. https://doi:10.1038/nrrheum.2015.159.
Davies JE, Walker JT, Keating A. (2017). Concise Review: Wharton's Jelly:
The Rich, but Enigmatic, Source of Mesenchymal Stromal Cells. Stem
Cells Transl Med. ;6(7):1620-1630. https://doi:10.1002/sctm.16-0492
Davis, Laurie S., Jack Hutcheson, and Chandra Mohan. (2011). The role of
cytokines in the pathogenesis and treatment of systemic lupus
erythematosus. Journal of interferon & cytokine research 31, no. 10:
781-789.
Dazzi F, Krampera M. (2011).Mesenchymal stem cells and autoimmune
diseases. Best Pract Res Clin Haematol. ;24(1):49-57.
https://doi:10.1016/j.beha.2011.01.002
D'Cruz DP. (2006). Systemic lupus erythematosus. BMJ. 2006 Apr
15;332(7546):890-4. https://doi:10.1136/bmj.332.7546.890.
De Kretser D. (2007). Totipotent, pluripotent or unipotent stem cells: a
complex regulatory enigma and fascinating biology. J Law Med. 2007
Oct;15(2):212-8. Erratum in: J Law Med. ;15(3):320.
Dimitrijević J, Dukanović L, Kovacević Z, et al. (2002). Lupus nephritis:
histopathologic features, classification and histologic scoring in renal
biopsy. Vojnosanit Pregl.;59(6 Suppl):21-31.
Ding DC, Shyu WC, Lin SZ. (2011). Mesenchymal stem cells. Cell
Transplant.;20(1):5-14. https://doi:10.3727/096368910X.
Ding J, Su S, You T, Xia T, Lin X, Chen Z, Zhang L. (2020). Serum
interleukin-6 level is correlated with the disease activity of systemic
96
The references
lupus erythematosus: a meta-analysis. Clinics (Sao Paulo).

https://doi:10.6061/clinics/2020/e1801.
Dulak J, Szade K, Szade A, Nowak W, Józkowicz A. (2015). Adult stem cells:
hopes and hypes of regenerative medicine. Acta Biochim Pol.;62(3):329-
37. https://doi:10.18388/abp.2015_1023.
Dupont G, Yilmaz E, Loukas M, Macchi V, De Caro R, Tubbs RS. (2019).
Human embryonic stem cells: Distinct molecular personalities and
applications in regenerative medicine. Clin Anat.;32(3):354-360.
https://doi:10.1002/ca.23318.
Duran C, Talley PJ, Walsh J, Pigott C, et al. (2001). Hybrids of pluripotent
and nullipotent human embryonal carcinoma cells: partial retention of
a pluripotent phenotype. Int J Cancer. 1;93(3):324-32.
https://doi:10.1002/ijc.1355.
Eaves CJ. (2015). Hematopoietic stem cells: concepts, definitions, and the new
reality. Blood. 23;125(17):2605-13. https://doi:10.1182/blood-2014-12-
570200.
Ebrahimi A, Ahmadi H, Pourfraidon Z, Tanide N, Shahriarirad R, Erfani A,
et al. (2021). Therapeutic effects of stem cells in different body systems,
a novel method that is yet to gain trust: A comprehensive review. Bosn J
Basic Med Sci. 1;21(6):672-701. https://doi:10.17305/bjbms.2021.5508.
El-Demerdash, R.F., Hammad, L.N., Kamal, M.M. and El Mesallamy, H.O.,
(2015). A comparison of Wharton's jelly and cord blood as a source of
mesenchymal stem cells for diabetes cell therapy. Regenerative
Medicine, 10(7), pp.841-855.
Elena, Elstner. AJ Friedenstein, (2009). founder of the mesenchymal stem cell
concept." Cellular Therapy and Transplantation 1, no. 3: 35-38.
Eom YW, Kang SH, Kim MY, Lee JI, Baik SK. (2020). Mesenchymal stem
cells to treat liver diseases. Ann Transl Med.;8(8):563.
https://doi:10.21037/atm.2020.02.163.
Essouma M, Nkeck JR, Endomba FT, Bigna JJ, Ralandison S (2020)
Epidemiology of rheumatoid arthritis in sub-Saharan Africa: a
systematic review and meta-analysis protocol. Syst Rev 9(1):1–4
Estrela, C., Silva, B. S. F., Silva, J. A., et al. (2017). Stem cell marker
expression in persistent apical periodontitis. Journal of Endodontics,
43(1), 63-68.
Fang, L., Li, Y., Wang, S. et al. (2020). TGF-β1 induces VEGF expression in
human granulosa-lutein cells: a potential mechanism for the
pathogenesis of ovarian hyperstimulation syndrome. Exp Mol Med 52,
450–460. https://doi.org/10.1038/s12276-020-0396-y
97
The references
Fang, Xiang, Muhammad Haidar Zaman, Xuanxuan Guo, et al. (2018). Role
of hepatic deposited immunoglobulin G in the pathogenesis of liver
damage in systemic lupus erythematosus. Fron. in Imm.9: 1457.
Fathollahi A, Gabalou NB, Aslani S. (2018). Mesenchymal stem cell
transplantation in systemic lupus erythematous, a mesenchymal stem
cell disorder. Lupus.;27(7):1053-1064.
https://doi:10.1177/0961203318768889
Fatoye, F., Gebrye, T., & Mbada, C. (2022). Global and regional prevalence
and incidence of systemic lupus erythematosus in low-and-middle
income countries: a systematic review and meta-analysis. Rheumatology
International, 42(12), 2097-2107.
Fava A, Petri M. (2019). Systemic lupus erythematosus: Diagnosis and clinical
management. J. Autoimmun.;96:1-13.
https://doi:10.1016/j.jaut.2018.11.001.
Fayyaz A, Igoe A, Kurien BT, Danda D, James JA, Stafford HA, Scofield RH.
(2015). Haematological manifestations of lupus. Lupus Sci Med. 3;2(1):
https://doi:10.1136/lupus-2014-000078.
Fei Gu, Ivan Molano, Philip Ruiz, Lingyun Sun, Gary S. Gilkeson, (2012).
Differential effect of allogeneic versus syngeneic mesenchymal stem cell
transplantation in MRL/lpr and (NZB/NZW)F1 mice, Clinical
Immunology, Volume 145, Issue 2, P:142-152,
https://doi.org/10.1016/j.clim.2012.08.012.
Fernandez D, Kirou KA. (2016). What Causes Lupus Flares? Curr Rheumatol
Rep.;18(3):14. https://doi:10.1007/s11926-016-0562-3.
Ferrari G, Cook BD, Terushkin V, Pintucci G, Mignatti P. (2009).
Transforming growth factor-beta 1 (TGF-beta1) induces angiogenesis
through vascular endothelial growth factor (VEGF)-mediated
apoptosis. J Cell Physiol. ;219(2):449-58. https://doi:10.1002/jcp.21706.
Ferucci ED, Johnston JM, Gaddy JR, Sumner L, Posever JO, Choromanski
TL, Helmick CG (2014) Prevalence and incidence of systemic lupus
erythematosus in a population-based registry of American Indian and
Alaska Native people, 2007–2009. Arthritis Rheumatol 66(9):2494–2502
Fessel WJ (1974) Systemic lupus erythematosus in the community: incidence,
prevalence, outcome, and first symptoms; the high prevalence in black
women. Arch Intern Med 134(6):1027–1035
Flor M, Weiß M, Selhorst T, et al. (2020). Comparison of Bayesian and
frequentist methods for prevalence estimation under misclassification.
BMC Public Health;20:1135.
98
The references
Fontes PA, Thomson AW. (1999). Stem cell technology. Interview by Abi
Berger. BMJ. 13;319(7220):1308.
https://doi:10.1136/bmj.319.7220.1308.
Forbes S, Vig P, Poulsom R, et al. (2012). Hepatic stem cells. J Pathol.
;197(4):510-8. Erratum in: J Pathol.;226(3):e1.
https://doi:10.1002/path.1163.
Forraz N, McGuckin CP. (2011). The umbilical cord: a rich and ethical stem
cell source to advance regenerative medicine. Cell Prolif. ;44 Suppl
1(Suppl 1):60-9. https://doi:10.1111/j.1365-2184.2010.00729.x.
Gallo PM, Gallucci S. (2013). The dendritic cell response to classic, emerging,
and homeostatic danger signals. Implications for autoimmunity. Front
Immunol. 10;4:138. https://doi:10.3389/fimmu.2013.00138.
García-Carrasco M, Mendoza Pinto C, Solís Poblano JC,. (2013). Systemic
lupus erythematosus. In: Anaya JM, Shoenfeld Y, Rojas-Villarraga A,
et al., editors. Autoimmunity: From Bench to Bedside [Internet]. Bogota
(Colombia): El Rosario University Press; 18. Chapter 25. Available
from: https://www.ncbi.nlm.nih.gov/books/NBK459474/
Geneva-Popova MG, Popova-Belova SD, Gardzheva PN, Kraev KI. A Study
of IFN-α-Induced Chemokines CCL2, CXCL10 and CCL19 in Patients
with Systemic Lupus Erythematosu. Life (Basel). 2022 Feb 8;12(2):251.
doi: 10.3390/life12020251.
Ghazimoradi MH, Khalafizadeh A, Babashah S. (2022). A critical review on
induced totipotent stem cells: Types and methods. Stem Cell Res.
;63:102857. https://doi:10.1016/j.scr.2022.102857.
Giannakakis, K., Faraggiana, T. (2011). Histopathology of Lupus Nephritis.
Clinic Rev Allerg Immunol 40, 170–180. https://doi.org/10.1007/s12016-
010-8207-1
Godsell, J, Rudloff, I, Kandane-Rathnayake, R, et al. (2016).Clinical
associations of IL-10 and IL-37 in systemic lupus erythematosus. Sci.
Rep., 6, 34604. https://doi.org/10.1038/srep34604
Golchin A, Chatziparasidou A, Ranjbarvan P, Niknam Z, Ardeshirylajimi A.
(2021). Embryonic Stem Cells in Clinical Trials: Current Overview of
Developments and Challenges. Adv Exp Med Biol.;1312:19-37.
https://doi:10.1007/5584_2020_592.
Gómez-Bernal F, Quevedo-Abeledo JC, García-González M, Fernández-
Cladera Y, González-Rivero AF, de Vera-González A, Martín-González
C, González-Gay MÁ, Ferraz-Amaro I. Serum Levels of Transforming
Growth Factor Beta 1 in Systemic Lupus Erythematosus Patients.
Biomolecules. 2022 Dec 29;13(1):73. doi: 10.3390/biom13010073.
99
The references
González LA, Toloza SMA, McGwin G Jr, Alarcón GS (2013) Ethnicity in

systemic lupus erythematosus (SLE): its influence on susceptibility and
outcomes. Lupus 22(12):1214–1224
Granot N., Storb R. (2020). History of hematopoietic cell transplantation:
challenges and progress. Haematologica ;105(12):2716–2729.
https://doi:10.3324/haematol.2019.245688.
Grover S, Rastogi A, Singh J, Rajbongshi A, Bihari C. (2014). Spectrum of
Histomorphologic Findings in Liver in Patients with SLE: A Review.
Hepat Res Treat.;2014:562979. https://doi:10.1155/2014/562979.
Gu Z, Akiyama K, Ma X, (2010). Transplantation of umbilical cord
mesenchymal stem cells alleviates lupus nephritis in MRL/lpr mice.
Lupus.;19(13):1502-1514. https://doi:10.1177/0961203310373782
Guo, R., & LÜ, L. (2018). Accurate Understanding of Pathological Profile in
Systemic Lupus Erythematosus with Liver Damage. Chinese Journal of
Gastroenterology, 293-295.
Gupta AO, Wagner JE. (2020).Umbilical Cord Blood Transplants: Current
Status and Evolving Therapies. Front Pediatr. 2;8:570282.
https://doi:10.3389/fped.2020.570282.
Gupta, A., Reddy, A., Jawahar, C. V., & Vinod, P. K. (2021). Classification of
histopathology images using ConvNets to detect Lupus Nephritis. arXiv
preprint.
Habeeb MA, Vishwakarma SK, Bardia A, Khan AA. (2015). Hepatic stem
cells: A viable approach for the treatment of liver cirrhosis. World J
Stem Cells. 26;7(5):859-65. https://doi:10.4252/wjsc.v7.i5.859.
Habener JF. (2004). A perspective on pancreatic stem/progenitor cells.
Pediatr Diabetes.;5 Suppl 2:29-37. https://doi:10.1111/j.1399-
543X.2004.00077.x.
Han, Y., Yang, J., Fang, J. (2022). The secretion profile of mesenchymal stem
cells and potential applications in treating human diseases. Sig
Transduct Target Ther 7, 92. https://doi.org/10.1038/s41392-022-00932-
0
Hawley RG, Ramezani A, Hawley TS. (2006). Hematopoietic stem cells.
Methods Enzymol.;419:149-79. https://doi:10.1016/S0076-
6879(06)19007-2.
Hoang DM, Pham PT, Bach TQ, Ngo ATL, et al. (2022). Stem cell-based
therapy for human diseases. Signal Transduct Target Ther. 6;7(1):272.
https://doi:10.1038/s41392-022-01134-4.
Hochberg MC. (1997). Updating the American College of rheumatology
revised criteria for the classification of systemic lupus erythematosus.
Arthritis Rheum;40:1725.
100
The references
Hongyan, L., Yi, Z., Bao, D., Yuewu, L., & Juan, M. (2013). A study on
clinical and pathologic features in lupus nephritis with mainly IgA
deposits and a literature review. Clinical and Developmental
Immunology.
Huang, Y.; Wu, Q.; Tam, P.K.H. (2022). Immunomodulatory Mechanisms of
Mesenchymal Stem Cells and Their Potential Clinical Applications. Int.
J. Mol. Sci. 23, 10023. https://doi.org/10.3390/ijms231710023
Hulya Bukulmez and Gurinder Kumar (2021). Clinical Use of Mesenchymal
Stem Cells in Treatment of Systemic Lupus Erythematosus, book,
IntechOpen, https://doi:10.5772/intechopen.97261
Idborg, H, & Oke, V. (2021). Cytokines as Biomarkers in Systemic Lupus
Erythematosus: Value for Diagnosis and Drug Therapy. Int. J. Mol.
Sci.; 22(21), 11327. https://doi.org/10.3390/ijms222111327
Imran S, Thabah MM, Azharudeen M, et al. (2021). Liver Abnormalities in
Systemic Lupus Erythematosus: A Prospective Observational Study.
Cureus. 16;13(6):e15691. https://doi:10.7759/cureus.15691.
Isaac Ely Stillman, Chapter 43 - The pathology of lupus nephritis, Editor(s):
George C. Tsokos, Systemic Lupus Erythematosus (Second Edition),
Academic Press, 2021, P:389-413, https://doi.org/10.1016/B978-0-12-
814551-7.00043-X.
Ishii T, Eto K. (2014). Fetal stem cell transplantation: Past, present, and
future. World J Stem Cells. 26;6(4):404-20.
https://doi:10.4252/wjsc.v6.i4.404.
Jacob, N., Stohl, W. (2011). Cytokine disturbances in systemic lupus
erythematosus. Arthritis Res Ther 13, 228.
https://doi.org/10.1186/ar3349
Jansen, B. J., Gilissen, C., Roelofs, H., et al. (2010). Functional differences
between mesenchymal stem cell populations are reflected by their
transcriptome. Stem cells and development, 19(4), 481-490.
Jasim, S.A., Yumashev, A.V., Abdelbasset, W.K. et al. (2022). Shining the
light on clinical application of mesenchymal stem cell therapy in
autoimmune diseases. Stem Cell Res Ther 13, 101.
https://doi.org/10.1186/s13287-022-02782-7
Jatwani S, Hearth Holmes MP. (2023). Subacute Cutaneous Lupus
Erythematosus. [Updated 2023 Jul 31]. In: StatPearls [Internet].
Treasure Island (FL): StatPearls Publishing;.
https://www.ncbi.nlm.nih.gov/books/NBK554554/
Ji S, Guo Q, Han Y, Tan G, Luo Y, Zeng F: (2012).Mesenchymal Stem Cell
Transplantation Inhibits Abnormal Activation of Akt/GSK3β Signaling
101
The references
Pathway in T Cells from Systemic Lupus Erythematosus Mice. Cell

Physiol Biochem ;29:705-712. https://doi:10.1159/000178590
Jiang FX, Morahan G. (2014). Pancreatic stem cells remain unresolved. Stem
Cells Dev. 1;23(23):2803-12. https://doi:10.1089/scd.2014.0214.
Jin S, Yu C, Yu B. (2021). Changes of serum IL-6, IL-10 and TNF-α levels in
patients with systemic lupus erythematosus and their clinical value. Am
J Transl Res. 15;13(4):2867-2874.
Jones, K., Klein, O. (2013). Oral epithelial stem cells in tissue maintenance
and disease: the first steps in a long journey. Int J Oral Sci 5, 121–129.
https://doi.org/10.1038/ijos.2013.46
Jung J, Chang Y, Jin G, Deng Q, Lian XL, Bao X. (2023). Chemically defined
generation of human definitive hematopoietic stem and progenitor cells.
STAR Protoc. 17;4(1):101953. https://doi:10.1016/j.xpro.2022.101953.
2022, 16.
Justiz Vaillant AA, Goyal A, Varacallo M. (2023). Systemic Lupus
Erythematosus. (2023). In: StatPearls [Internet]. Treasure Island (FL):
StatPearls, https://www.ncbi.nlm.nih.gov/books/NBK535405/
Kariya, T., Nishimura, H., Mizuno, M., Suzuki, Y., et al. (2018). TGF-β1-
VEGF-A pathway induces neoangiogenesis with peritoneal fibrosis in
patients undergoing peritoneal dialysis. American Journal of
Physiology-Renal Physiology, 314(2), F167-F180.
Karrar S, Cunninghame Graham DS. (2018). Abnormal B Cell Development
in Systemic Lupus Erythematosus: What the Genetics Tell Us. Arthritis
Rheumatol.;70(4):496-507. https://doi:10.1002/art.40396.
Kennea NL, Mehmet H. (2002). Neural stem cells. J Pathol.;197(4):536-50.
https://doi:10.1002/path.1189.
Kerr CL, Gearhart JD, Elliott AM, Donovan PJ. (2006). Embryonic germ
cells: when germ cells become stem cells. Semin Reprod Med.;24(5):304-
13. https://doi:10.1055/s-2006-952152.
Khaddour K, Hana CK, Mewawalla P. (2023). Hematopoietic Stem Cell
Transplantation. [Updated 2022 Jun 27]. In: StatPearls [Internet].
Treasure Island (FL): StatPearls Publishing;
Khanlarkhani N, Baazm M, Mohammadzadeh F, et al. (2016). Multipotent
Stem Cell and Reproduction. J Stem Cells.;11(4):219-229.
Kim JW, Koh Y, Kim DW, Ahn YO, Kim TM, et al. (2013). Clinical
Implications of VEGF, TGF-β1, and IL-1β in Patients with Advanced
Non-small Cell Lung Cancer. Cancer Res Treat.;45(4):325-33.
https://doi:10.4143/crt.2013.45.4.325, 2013, 31.
102
The references
Kordes C, Häussinger D. (2-13). Hepatic stem cell niches. J Clin Invest.

;123(5):1874-80. https://doi:10.1172/JCI66027.
Kuhn A, Bonsmann G, Anders HJ, Herzer P, Tenbrock K, Schneider M.
(2015). The Diagnosis and Treatment of Systemic Lupus
Erythematosus. Dtsch Arztebl Int. 19;112(25):423-32.
https://doi:10.3238/arztebl.2015.0423.
Kumar D, Talluri TR, Anand T, Kues WA. (2015). Induced pluripotent stem
cells: Mechanisms, achievements and perspectives in farm animals.
World J Stem Cells. 26;7(2):315-28. https://doi:10.4252/wjsc.v7.i2.315.
Kuryliszyn-Moskal A, Klimiuk PA, Sierakowski S, Ciołkiewicz M. Vascular
endothelial growth factor in systemic lupus erythematosus: relationship
to disease activity, systemic organ manifestation, and nailfold
capillaroscopic abnormalities. Arch Immunol Ther Exp (Warsz). 2007
May-Jun;55(3):179-85. doi: 10.1007/s00005-007-0017-7. Epub 2007 Jun
8. PMID: 17557150; PMCID: PMC2765643.
Kyogoku C, Dijstelbloem HM, Tsuchiya N, Hatta Y, Kato H, Yamaguchi A, et
al. (2002).Fcgamma receptor gene polymorphisms in Japanese patients
with systemic lupus erythematosus: contribution of FCGR2B to genetic
susceptibility. Arthritis Rheum.;46:1242–1254.
Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE, et al.
(2004). Genetic association of the R620W polymorphism of protein
tyrosine phosphatase PTPN22 with human SLE. Am J Hum
Genet.;75:504–507.
Lacki, J.K., Samborski, W. & Mackiewicz, S.H. (1997). Interleukin-10 and
interleukin-6 in lupus erythematosus and rheumatoid arthritis,
correlations with acute phase proteins. Clin Rheumatol 16, 275–278.
https://doi.org/10.1007/BF02238963
Lapouge G, Blanpain C. (2008). Medical applications of epidermal stem cells.
2008 Nov 15. In: StemBook [Internet]. Cambridge (MA): Harvard Stem
Cell Institute. https://doi:10.3824/stembook.1.27.1
Le Blanc, K., Rasmusson, I., Sundberg, B., et al. (2004). Treatment of severe
acute graft-versus-host disease with third party haploidentical
mesenchymal stem cells. The Lancet, 363(9419), 1439-1441.
Lee JE, Lee DR. (2011). Human embryonic stem cells: derivation,
maintenance and cryopreservation. Int J Stem Cells.;4(1):9-17.
https://doi:10.15283/ijsc.2011.4.1.9.
Lee JY, Hong SH. (2020). Hematopoietic Stem Cells and Their Roles in Tissue
Regeneration. Int J Stem Cells. 30;13(1):1-12.
https://doi:10.15283/ijsc19127.
103
The references
Lee, Hong Kyung, Hyung Sook Kim, et al. (2017). CCL2 deficient
mesenchymal stem cells fail to establish long-lasting contact with T cells
and no longer ameliorate lupus symptoms. Scien. Reports 7, no. 1: 1-12.
Lenkiewicz AM. (2019). Epidermal Stem Cells. Adv Exp Med Biol.;1201:239-
259. https://doi:10.1007/978-3-030-31206-0_12.
Leong P-Y, Huang J-Y, Chiou J-Y, et al. (2021). The prevalence and incidence
of systemic lupus erythematosus in Taiwan: a nationwide population-
based study. Sci Rep;11:5631.
Lerang K, Gilboe I, Garen T, Thelle DS, Gran JT (2012). High incidence and
prevalence of systemic lupus erythematosus in Norway. Lupus
21(12):1362–1369
Lewandowski LB, Schanberg LE, Thielman N, Phuti A, Kalla AA, Okpechi I,
Scott C (2017). Severe disease presentation and poor outcomes among
pediatric systemic lupus erythematosus patients in South Africa. Lupus
26(2):186–194
Li A, Guo F, Pan Q, Chen S, Chen J, Liu HF, Pan Q. (2021).Mesenchymal
Stem Cell Therapy: Hope for Patients With Systemic Lupus
Erythematosus. Front Immunol. 30;12:728190.
https://doi:10.3389/fimmu.2021.728190.
Li H, Jasper H. (2016). Gastrointestinal stem cells in health and disease: from
flies to humans. Dis Model Mech. 1;9(5):487-99.
https://doi:10.1242/dmm.024232.
Li Z, Hu X, Zhong JF. (2019). Mesenchymal Stem Cells: Characteristics,
Function, and Application. Stem Cells Int.,6;2019:8106818.
https://doi:10.1155/2019/8106818.
Li, W, Chen, W, Sun, L. (2021). An update for mesenchymal stem cell therapy
in lupus nephritis. Kidney Dis.,;7(2), 79-89.
https://doi:10.1159/000513741
Liang, Jun, Huayong Zhang, Bingzhu Hua, et al. (2010). Allogenic
mesenchymal stem cells transplantation in refractory systemic lupus
erythematosus: a pilot clinical study. Annals of the rheumatic diseases
69, no. 8: 1423-1429.
Liao, Y. W., Chen, Y. M., Hsieh, T. Y., Hung, W. T., Hsu, C. Y., Wen, M. C.,
... & Huang, W. N. (2023). Renal Histopathology Associated With
Kidney Failure and Mortality in Patients With Lupus Nephritis: A
Long-Term Real-World Data Study. The Journal of rheumatology,
jrheum-220345.
Liau LL, Ruszymah BHI, Ng MH, Law JX. (2020). Characteristics and
clinical applications of Wharton's jelly-derived mesenchymal stromal
104
The references
cells. Curr Res Transl Med. ;68(1):5-16.

https://doi:10.1016/j.retram.2019.09.001.
Lin W, Xu L, Lin S, Shi L, Wang B, et al. (2019). Characterisation of
multipotent stem cells from human peripheral blood using an improved
protocol. J Orthop Translat. 7;19:18-28.
https://doi:10.1016/j.jot.2019.02.003.
Lingyun Sun, Kentaro Akiyama, Huayong Zhang, et al. (2009). Mesenchymal
Stem Cell Transplantation Reverses Multiorgan Dysfunction in
Systemic Lupus Erythematosus Mice and Humans, Stem Cells, Volume
27, Issue 6, P:1421–1432, https://doi.org/10.1002/stem.68
Liu G, David BT, Trawczynski M, Fessler RG. (2020). Advances in
Pluripotent Stem Cells: History, Mechanisms, Technologies, and
Applications. Stem Cell Rev Rep. ;16(1):3-32.
https://doi:10.1007/s12015-019-09935-x.
Liu W, Zhang S, Wang J. IFN-γ, should not be ignored in SLE. Front
Immunol. 2022 Aug 10;13:954706. doi: 10.3389/fimmu.2022.954706.
Lourenço, EV, & La Cava, A. (2009). Cytokines in systemic lupus
erythematosus. Curr. Mol. Med., 9(3), 242–254.
https://doi.org/10.2174/156652409787847263
Lu R, Munroe ME, Guthridge JM, Bean KM, Fife DA, Chen H, Slight-Webb
SR, Keith MP, Harley JB, James JA. (2016). Dysregulation of innate
and adaptive serum mediators precedes systemic lupus erythematosus
classification and improves prognostic accuracy of autoantibodies. J
Autoimmun. ;74:182-193. https://doi:10.1016/j.jaut.2016.06.001
Ma, Xiaolei, Nan Che, Zhifeng Gu, Jing Huang, Dandan Wang, Jun Liang,
Yayi Hou, Gary Gilkeson, et al. (2013). Allogenic mesenchymal stem cell
transplantation ameliorates nephritis in lupus mice via inhibition of B-
cell activation. Cell transplantation 22, no. 12: 2279-2290.
Mahla RS. (2016). Stem Cells Applications in Regenerative Medicine and
Disease Therapeutics. Int J Cell Biol.;2016:6940283.
https://doi:10.1155/2016/6940283.
Maidhof W, Hilas O. (2012). Lupus: an overview of the disease and
management options. P T. ;37(4):240-9.
Majo F, Rochat A, Nicolas M, Jaoudé GA, Barrandon Y. (2008). Oligopotent
stem cells are distributed throughout the mammalian ocular surface.
Nature. 13;456(7219):250-4. https://doi:10.1038/nature07406.
Malik V, Wang J. (2022). Pursuing totipotency: authentic totipotent stem cells
in culture. Trends Genet.;38(7):632-636.
https://doi:10.1016/j.tig.2022.03.012.
105
The references
Mao, F., Xu, W. R., Qian, H., Zhu, W., et al. (2010). Immunosuppressive
effects of mesenchymal stem cells in collagen induced mouse arthritis.
Inflammation Research, 59, 219-225.
Marino L, Castaldi MA, Rosamilio R, et al. (2019). Mesenchymal Stem Cells
from the Wharton's Jelly of the Human Umbilical Cord: Biological
Properties and Therapeutic Potential. Int J Stem Cells. 31;12(2):218-
226. https://doi:10.15283/ijsc18034.
McKeon KP, Jiang SH. (2020). Treatment of systemic lupus erythematosus.
Aust Prescr. ;43(3):85-90. https://doi:10.18773/austprescr.2020.022.
McLoughlin RM, Witowski J, Robson RL,et al. (2003). Interplay between
IFN-gamma and IL-6 signaling governs neutrophil trafficking and
apoptosis during acute inflammation. J Clin Invest.;112(4):598-607.
https://doi:10.1172/JCI17129
Memon B, Abdelalim EM. (2020). Stem Cell Therapy for Diabetes: Beta Cells
versus Pancreatic Progenitors. Cells., 23;9(2):283.
https://doi:10.3390/cells9020283.
Metry AM, Al Salmi I, Al Balushi F, et al. (2019). Systemic Lupus
Erythematosus: Symptoms and Signs at Initial Presentations.
Antiinflamm Antiallergy Agents Med Chem.;18(2):142-150.
https://doi:10.2174/1871523018666181128161828.
Mingxia Shi, Jing Li, Lianming Liao, Bin Chen, et l. (2007). Regulation of
CXCR4 expression in human mesenchymal stem cells by cytokine
treatment: role in homing efficiency in NOD/SCID mice.
Haematologica; 92(7):897-904;
Mirzaei H, Sahebkar A, Sichani LS, et al. (2018). Therapeutic application of
multipotent stem cells. J Cell Physiol.;233(4):2815-2823.
https://doi:10.1002/jcp.25990.
Mitalipov S, Wolf D. (2009). Totipotency, pluripotency and nuclear
reprogramming. Adv Biochem Eng Biotechnol.;114:185-99.
https://doi:10.1007/10_2008_45.
Mohamed AAA, Hammam N, El Zohri MH, Gheita TA. (2019). Cardiac
Manifestations in Systemic Lupus Erythematosus: Clinical Correlates
of Subclinical Echocardiographic Features. Biomed Res Int.
10;2019:2437105. https://doi:10.1155/2019/2437105.
Mok CC, Lau CS. (2003). Pathogenesis of systemic lupus erythematosus. J
Clin Pathol.;56(7):481-90. https://doi:10.1136/jcp.56.7.481.
Morasso MI, Tomic-Canic M. (2005). Epidermal stem cells: the cradle of
epidermal determination, differentiation and wound healing. Biol
Cell.;97(3):173-83. https://doi:10.1042/BC20040098
106
The references
Morgani SM, Canham MA, Nichols J, Sharov AA, Migueles RP, Ko MS,
Brickman JM. (2013). Totipotent embryonic stem cells arise in ground-
state culture conditions. Cell Rep. 27;3(6):1945-57.
https://doi:10.1016/j.celrep.2013.04.034.
Morrison SJ, Uchida N, Weissman IL. (1995). The biology of hematopoietic
stem cells. Annu Rev Cell Dev Biol.;11:35-71.
https://doi:10.1146/annurev.cb.11.110195.000343.
Mosaad YM. (2014). Hematopoietic stem cells: an overview. Transfus Apher
Sci.;51(3):68-82. https://doi:10.1016/j.transci.2014.10.016.
Mousaei Ghasroldasht M, Seok J, Park HS, et al. (2022). Stem Cell Therapy:
From Idea to Clinical Practice. Int J Mol Sci. 5;23(5):2850.
https://doi:10.3390/ijms23052850
Murtaugh LC, Kopinke D. Pancreatic stem cells. (2008). In: StemBook
[Internet]. Cambridge (MA): Harvard Stem Cell Institute;
https://doi:10.3824/stembook.1.3.1
Musial C, Gorska-Ponikowska M. (2012). Medical progress: Stem cells as a
new therapeutic strategy for COVID-19. Stem Cell Res. ;52:102239.
https://doi:10.1016/j.scr.2021.102239.
Nadig RR. (2009). Stem cell therapy - Hype or hope? A review. J Conserv
Dent.;12(4):131-8. https://doi:10.4103/0972-0707.58329
Nan Che, Xia Li, Lu Zhang, Rui Liu, Haifeng Chen, Xiang Gao, Songtao Shi,
Wanjun Chen, Lingyun Sun; (2014). Impaired B Cell Inhibition by
Lupus Bone Marrow Mesenchymal Stem Cells Is Caused by Reduced
CCL2 Expression. J Immunol; 193 (10): 5306–5314.
https://doi.org/10.4049/jimmunol.1400036
National Research Council (US) and Institute of Medicine (US) (2002).
Committee on the Biological and Biomedical Applications of Stem Cell
Research. Stem Cells and the Future of Regenerative Medicine.
Washington (DC): National Academies Press (US); CHAPTER THREE,
Embryonic Stem Cells.
Ng AP, Alexander WS. (2017). Haematopoietic stem cells: past, present and
future. Cell Death Discov. 6;3:17002.
https://doi:10.1038/cddiscovery.2017.2.
Nyman E, Vaughan T, Desta B, Wang X, Barut V, Emmas C. (2020).
Characteristics and Symptom Severity of Patients Reporting Systemic
Lupus Erythematosus in the PatientsLikeMe Online Health
Community: A Retrospective Observational Study. Rheumatol
Ther.;7(1):201-213. https://doi:10.1007/s40744-020-00195-7.
107
The references
Obrișcă, B., Vornicu, A., Procop, A., et al. (2022). A histology-guided

approach to the management of patients with lupus nephritis: are we
there yet?. Biomedicines, 10(6), 1409.
O'Donoghue K, Fisk NM. (2004). Fetal stem cells. Best Pract Res Clin Obstet
Gynaecol.;18(6):853-75. https://doi:10.1016/j.bpobgyn.2004.06.010.
Ohl K, Tenbrock K. (2011). Inflammatory cytokines in systemic lupus
erythematosus. J Biomed Biotechnol.;432595.
https://doi:10.1155/2011/432595
Okon LG, Werth VP. (2013). Cutaneous lupus erythematosus: diagnosis and
treatment. Best Pract Res Clin Rheumatol.;27(3):391-404.
https://doi:10.1016/j.berh.2013.07.008.
Pan Y, Sawalha AH. (2009). Epigenetic regulation and the pathogenesis of
systemic lupus erythematosus. Transl Res.;153:4–10.
Park, Min-Jung, Seung-Ki Kwok, et al. (2015). Adipose tissue-derived
mesenchymal stem cells induce expansion of interleukin-10-producing
regulatory B cells and ameliorate autoimmunity in a murine model of
systemic lupus erythematosus. Cell Transplantation 24, no. 11: 2367-
2377.
Pei YA, Pei M. (2022). Hypoxia Modulates Regenerative Potential of Fetal
Stem Cells. Appl Sci (Basel).;12(1):363.
https://doi:10.3390/app12010363.
Pelosi E, Forabosco A, Schlessinger D. (2011). Germ cell formation from
embryonic stem cells and the use of somatic cell nuclei in oocytes. Ann N
Y Acad Sci.;1221 (1):18-26. https://doi:10.1111/j.1749-
6632.2011.05982.x.
Pera MF, Reubinoff B, Trounson A. (2000). Human embryonic stem cells. J
Cell Sci.;113 ( Pt 1):5-10. https://doi:10.1242/jcs.113.1.5.
Perez-Hernandez, J., Redon, J., & Cortes, R. (2017). Extracellular Vesicles as
Therapeutic Agents in Systemic Lupus Erythematosus. International
journal of molecular sciences, 18(4), 717.
Piga M, Arnaud L. The Main Challenges in Systemic Lupus Erythematosus:
Where Do We Stand? J Clin Med. 2021 Jan 11;10(2):243. doi:
10.3390/jcm10020243. PMID: 33440874; PMCID: PMC7827672.
Pisetsky, DS, Lipsky, PE. (2020). New insights into the role of antinuclear
antibodies in systemic lupus erythematosus. Nat. Rev. Rheumatol. 16,
565–579. https://doi.org/10.1038/s41584-020-0480-7
Pons-Estel GJ, Alarcón GS, Scofield L, (2010). Understanding the
epidemiology and progression of systemic lupus erythematosus. Semin
Arthritis Rheum.;39(4):257-68.
https://doi:10.1016/j.semarthrit.2008.10.007
108
The references
Poole, BD, Niewold, TB, Tsokos, GC, & Via, CS. (2010). Cytokines in systemic
lupus erythematosus. J. biotechnol. biomed., 735169.
https://doi.org/10.1155/2010/735169
Potten CS. (1998). Stem cells in gastrointestinal epithelium: numbers,
characteristics and death. Philos Trans R Soc Lond B Biol Sci.
29;353(1370):821-30. https://doi:10.1098/rstb.1998.0246
Prabowo, N. A., Adnan, Z. A., et al. (2021). Mesenchymal stem cell
conditioned medium as good as methyl prednisolone in decreasing levels
of interleukin 10 and the degree of pulmonary vasculitis in lupus mice.
Bangladesh Journal of Medical Science, 20(2), 426-430.
Ptacek T, Li X, Kelley JM, Edberg JC. (2008). Copy number variants in
genetic susceptibility and severity of systemic lupus erythematosus.
Cytogenet Genome Res. ;123:142–147.
Qi, Yf., Huang, Yx., Wang, Hy. et al. (2013). Elucidating the crosstalk
mechanism between IFN-gamma and IL-6 via mathematical modelling.
BMC Bioinformatics 14, 41. https://doi.org/10.1186/1471-2105-14-41
Qiao B, Wu J, Chu YW, Wang Y, et al. (2005). Induction of systemic lupus
erythematosus-like syndrome in syngeneic mice by immunization with
activated lymphocyte-derived DNA. Rheumatology. Sup; 44(9):1108-14.
https://doi:10.1093/rheumatology/keh656
Qiaoli Yi, Zhijie Xu, Abhimanyu Thakur, Kui Zhang, Qiuju Liang, Yuanhong
Liu, Yuanliang Yan. (2023). Current understanding of plant-derived
exosome-like nanoparticles in regulating the inflammatory response and
immune system microenvironment. Pharmacological Research 190,
pages 106733.
Qinjun Zhao, Hongying Ren, Zhongchao Han, (2016). Mesenchymal stem
cells: Immunomodulatory capability and clinical potential in immune
diseases, Journal of Cellular Immunotherapy, V:2, Issue 1, P:3-20,
https://doi.org/10.1016/j.jocit.2014.12.001
Quante M, Wang TC. (2009). Stem cells in gastroenterology and hepatology.
Nat Rev Gastroenterol Hepatol.;6(12):724-37.
https://doi:10.1038/nrgastro.2009.195.
Quintero-Del-Rio AI, Kelly JA, Kilpatrick J, et al. (2002). The genetics of
systemic lupus erythematosus stratified by renal disease: linkage at
10q22.3 (SLEN1), 2q34-35 (SLEN2), and 11p15.6 (SLEN3) Genes
Immun.;3 1:S57–S62.
Ramos PS, Brown EE, Kimberly RP, Langefeld CD. (2010). Genetic factors
predisposing to systemic lupus erythematosus and lupus nephritis.
Semin Nephrol.;30(2):164-76.
https://doi:10.1016/j.semnephrol.2010.01.007.
109
The references
Ramos PS, Brown EE, Kimberly RP, Langefeld CD. Genetic factors
predisposing to systemic lupus erythematosus and lupus nephritis.
Semin Nephrol. 2010 Mar;30(2):164-76. doi:
10.1016/j.semnephrol.2010.01.007. PMID: 20347645; PMCID:
PMC2847514.
Rashad NM, El-Shabrawy RM, Said D, El-Shabrawy SM, Emad G. (2019).
Serum Levels of Transforming Growth Factor Beta -1 (TGF-β1) as An
Early No Invasive Marker for Diagnosis of Lupus Nephritis in Systemic
Lupus Erythematosus Patients. Egypt J Immunol.; 26(1):31-42.
Rees F, Doherty M, Grainge MJ, Lanyon P, Zhang W (2017) The worldwide
incidence and prevalence of systemic lupus erythematosus: a systematic
review of epidemiological studies. Rheumatology 56(11):1945–1961
Rekik R, Khanfir MS, Larbi T, Zamali I, et al. (2018). Impaired TGF-β
signaling in patients with active systemic lupus erythematosus is
associated with an overexpression of IL-22. Cytokine. 108:182-189.
http://doi:10.1016/j.cyto.2018.04.011
Rijnink, E. C., Teng, Y. O., Wilhelmus, S., et al. (2017). Clinical and
histopathologic characteristics associated with renal outcomes in lupus
nephritis. Clinical Journal of the American Society of Nephrology,
12(5), 734-743.
Rippon HJ, Bishop AE. (2004). Embryonic stem cells. Cell Prolif. ;37(1):23-34.
https://doi:10.1111/j.1365-2184.2004.00298.x
Rodrigues R. S., Lourenço D. M., Paulo S. L. (2019). Cannabinoid actions on
neural stem cells: implications for pathophysiology. Molecules.;24(7):p.
1350. https://doi:10.3390/molecules24071350
Romito A, Cobellis G. (2016). Pluripotent Stem Cells: Current Understanding
and Future Directions. Stem Cells Int.;2016:9451492.
https://doi:10.1155/2016/9451492
Rosa, S. B., Voltarelli, J. C., Chies, J. A. B., & Pranke, P. (2007). The use of
stem cells for the treatment of autoimmune diseases. Brazilian Journal
of Medical and Biological Research, 40, 1579-1597.
Ruchakorn N, Ngamjanyaporn P, et al. (2019). Performance of cytokine
models in predicting SLE activity. Arthritis Res Ther.,16;21(1):287.
https://doi:10.1186/s13075-019-2029-1
Ruhil S, Kumar V, Rathee P. (2009). Umbilical cord stem cell: an overview.
Curr Pharm Biotechnol. 10(3):327-34.
https://doi:10.2174/138920109787847529
Sabry A, Sheashaa H, El-Husseini A, El-Dahshan K, Abdel-Rahim M,
Elbasyouni SR. Intercellular adhesion molecules in systemic lupus
erythematosus patients with lupus nephritis. Clin Rheumatol. 2007
110
The references
Nov;26(11):1819-23. doi: 10.1007/s10067-007-0580-7. Epub 2007 Mar 6.

PMID: 17340048.
Salem, C., E. Makhoul, and T. E. I. Murr. (2019). Case Report and Review of
Literature: An Overlap Syn-drome of Autoimmune Hepatitis and
Systemic Lupus Erythematous. Clin Med Rev Case Rep 5: 249.
Sarsenova M, Kim Y, Raziyeva K, Kazybay B, Ogay V, Saparov A. (2022).
Recent advances to enhance the immunomodulatory potential of
mesenchymal stem cells. Front Immunol. 23;13:1010399.
https://doi:10.3389/fimmu.2022.1010399
Schena, F., Gambini, C., Gregorio, A., et al. (2010), Interferon-γ–dependent
inhibition of B cell activation by bone marrow–derived mesenchymal
stem cells in a murine model of systemic lupus erythematosus. Arthritis
& Rheumatism, 62: 2776-2786. https://doi.org/10.1002/art.27560
Schiefer, W.C. (1980). Statistics for the biological sciences. 2nd ed. Addison.
Wesley pub comp, California, London.
Sennerstam R, Strömberg JO. (1984). A comparative study of the cell cycles of
nullipotent and multipotent embryonal carcinoma cell lines during
exponential growth. Dev Biol.;103(1):221-9. https://doi:10.1016/0012-
1606(84)90023-x.
Shahin, A. A., Alazkalany, G. S., Hasaballah, M. S., & Ewiela, A. S. A. (2017).
Liver Involvement in Systemic Lupus Erythematosus Patients. Suez
Canal University Medical Journal, 20(2), 161-167.
Shaikh MF, Jordan N, D'Cruz DP. (2017). Systemic lupus erythematosus. Clin
Med (Lond).;17(1):78-83. https://doi:10.7861/clinmedicine.17-1-78.
Shandil RK, Dhup S, Narayanan S. (2022). Evaluation of the Therapeutic
Potential of Mesenchymal Stem Cells (MSCs) in Preclinical Models of
Autoimmune Diseases. Stem Cells Int. 28;2022:6379161.
https://doi:10.1155/2022/6379161.
Shi Y, Inoue H, Wu JC, Yamanaka S. (2017). Induced pluripotent stem cell
technology: a decade of progress. Nat Rev Drug Discov.16(2):115-130.
https://doi:10.1038/nrd.2016.245.
Siham Aly Metawie, Rasha M. ElRefai, et al. (2015). Transforming growth
factor-β1 in systemic lupus erythematosus patients and its relation to
organ damage and disease activity, The Egyptian Rheumatologist,
37(4)S, 49-54
Skulimowska I, Sosniak J, Gonka M, et al. (2022). The biology of
hematopoietic stem cells and its clinical implications. FEBS J.
;289(24):7740-7759. https://doi:10.1111/febs.16192.
Sobhani A, Khanlarkhani N, Baazm M, et al. (2017). Multipotent Stem Cell
and Current Application. Acta Med Iran.;55(1):6-23.
111
The references
Sohrabian, A., Parodis, I., Carlströmer-Berthén, N., et al. (2019). Increased

levels of anti-dsDNA antibodies in immune complexes before treatment
with belimumab are associated with clinical response in patients with
systemic lupus erythematosus. Arthritis research & therapy,21(1), 259.
https://doi.org/10.1186/s13075-019-2056-y
Song N, Scholtemeijer M, Shah K. (2020). Mesenchymal Stem Cell
Immunomodulation: Mechanisms and Therapeutic Potential. Trends
Pharmacol Sci.;41(9):653-664. https://doi:10.1016/j.tips.2020.06.009.
Stępień-Wyrobiec, O., Hrycek, A., & Wyrobiec, G. (2008). Transforming
growth factor beta (TGF-beta): its structure, function, and role in the
pathogenesis of systemic lupus erythematosus. Advances in Hygiene and
Experimental Medicine, 62.
Sudoł-Szopińska I, Żelnio E, Olesińska M, (2022). Update on Current Imaging
of Systemic Lupus Erythematous in Adults and Juveniles. J Clin Med.
2022, 3;11(17):5212. https://doi:10.3390/jcm11175212.
Sun L, Dong Y, Zhao J, Yin Y, Zheng Y. (2016).The CLC-2 Chloride Channel
Modulates ECM Synthesis, Differentiation, and Migration of Human
Conjunctival Fibroblasts via the PI3K/Akt Signaling Pathway. Int J
Mol Sci. 9;17(6):910. https://doi:10.3390/ijms17060910
Sun, Lingyun, Kentaro Akiyama, Huayong Zhang, et al. (2009). Mesenchymal
stem cell transplantation reverses multiorgan dysfunction in systemic
lupus erythematosus mice and humans. Stem cells 27, no. 6: 1421-1432.
Sun, Lixia & chui, Renzhe & Huan, Meng et al. (2020). Role of the ClC-2
Chloride Channel in TGF-β1-induced Proliferation, Collagen Synthesis,
and Collagen Gel Contraction Mediated by Human Conjunctival
Fibroblasts. https://doi:10.21203/rs.2.20695/v1
Suvarna, K.S. and Layton, J.D., (2013). Bancroft Bancroft’s Theory and
Practice of Histological Techniques. Canada.
Thorburn CM, Prokunina-Olsson L, Sterba KA, Lum RF, Seldin MF,
Alarcon-Riquelme ME, et al. (2007). Association of PDCD1 genetic
variation with risk and clinical manifestations of systemic lupus
erythematosus in a multiethnic cohort. Genes Immun. ;8:279–287.
Tianbiao Zhou, Hong-Yan Li, Chunling Liao, Wenshan Lin, Shujun Lin,
(2020). Clinical Efficacy and Safety of Mesenchymal Stem Cells for
Systemic Lupus Erythematosus", Stem Cells International, vol. pages
11, https://doi.org/10.1155/2020/6518508
Tikly M, Navarra SV (2008). Lupus in the developing world–is it any
different? Best Pract Res Clin Rheumatol 22(4):643–655
112
The references
Tishkowski K, Gupta V. Erythrocyte Sedimentation Rate. [Updated 2023 Apr

23]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls
Publishing; 2023, https://www.ncbi.nlm.nih.gov/books/NBK557485/
Toshiharu Matsumoto, Tugio Yoshimine, et al. (1992). The liver in systemic
lupus erythematosus: pathologic analysis of 52 cases and review of
Japanese autopsy registry data, Human Pathology, V: 23, Issue 10, ,
P:1151-1158, https://doi.org/10.1016/0046-8177(92)90033-Y.
Tsao BP, Wu H. (2007). The genetics of human lupus. In: Wallace DJ, Hahn
BH, editors. Dubois' lupus erythematosus. 7th. 6. Philadelphia:
Lippincott Williams & Wilkins;. pp. 54–81.
Tsuchiya A, Lu WY. (2019). Liver stem cells: Plasticity of the liver
epithelium. World J Gastroenterol., 7;25(9):1037-1049.
https://doi:10.3748/wjg.v25.i9.1037.
Tuazon JP, Castelli V, Lee JY, et al. (2019). Neural Stem Cells. Adv Exp Med
Biol. 1201:79-91. https://doi:10.1007/978-3-030-31206-0_4.
Tyndall, A., & Furst, D. E. (2007).Adult stem cell treatment of scleroderma.
Current opinion in rheumatology, 19(6), 604-610.
Ullah I, Subbarao RB, Rho GJ. (2015). Human mesenchymal stem cells -
current trends and future prospective. Biosci Rep. 28;35(2):e00191.
https://doi:10.1042/BSR20150025.
Umar S. (2010). Intestinal stem cells. Curr Gastroenterol Rep.;12(5):340-8.
https://doi:10.1007/s11894-010-0130-3.
Varaa N, Azandeh S, Khodabandeh Z, Gharravi AM. (2019). Wharton's Jelly
Mesenchymal Stem Cell: Various Protocols for Isolation and
Differentiation of Hepatocyte-Like Cells; Narrative Review. Iran J Med
Sci.;44(6):437-448. https://doi:10.30476/ijms.2019.44952.
Vazin T, Freed WJ. (2010).Human embryonic stem cells: derivation, culture,
and differentiation: a review. Restor Neurol Neurosci.;28(4):589-603.
https://doi:10.3233/RNN-2010-0543.
Vyshkina T, Sylvester A, Sadiq S, Bonilla E, Perl A, Kalman B. CCL genes in
multiple sclerosis and systemic lupus erythematosus. J Neuroimmunol.
2008 Aug 30;200(1-2):145-52. doi: 10.1016/j.jneuroim.2008.05.016. Epub
2008 Jul 3. PMID: 18602166; PMCID: PMC5301077.
Wallace, D.J., & Hahn, B.H. (2013). Dubois' lupus erythematosus and related
syndromes. (8th ed.) Philadelphia, PA: Elsevier Saunders.
Wang D, Feng X, Lu L, Konkel JE, Zhang H, Chen Z, Li X, Gao X, Lu L, Shi
S, Chen W, Sun L. (2014). A CD8 T cell/indoleamine 2,3- dioxygenase
axis is required for mesenchymal stem cell suppression of human
systemic lupus erythematosus. Arthritis Rheumatol. 66:2234–45.
113
The references
Wang, D., Huang, S., Yuan, X. (2017).The regulation of the Treg/Th17

balance by mesenchymal stem cells in human systemic lupus
erythematosus. Cell Mol Immunol, 14, 423–431.
Wang, Dandan, Huayong Zhang, et al. (2013). Allogeneic mesenchymal stem
cell transplantation in severe and refractory systemic lupus
erythematosus: 4 years of experience. Cell transplantation 22, no. 12:
2267-2277.
Wang, Dandan, Huayong Zhang, Jun Liang, Hong Wang, Bingzhu Hua,
Xuebing Feng, et al. (2018). A long-term follow-up study of allogeneic
mesenchymal stem/stromal cell transplantation in patients with drug-
resistant systemic lupus erythematosus. Stem cell reports 10, no. 3: 933-
941.
Wang, H.W., & Wang, H.W. (2013). Effect of CLC-2 on the cytoskeleton in
human trabecular meshwork cells. Molecular Medicine Reports, 8,
1099-1105. https://doi.org/10.3892/mmr.2013.1619
Wang, JH, Liu, XL, Sun, JM, et al. (2020). Role of mesenchymal stem cell-
derived extracellular vesicles in autoimmunity: A systematic review.
World J Stem Cells,; 12(8), 879–896.
https://doi.org/10.4252/wjsc.v12.i8.879
Waterman, R. S., Morgenweck, J., Nossaman, B. D., Scandurro, A. E.,
Scandurro, S. A., & Betancourt, A. M. (2012). Antiinflammatory
mesenchymal stem cells (MSC2) attenuate symptoms of painful diabetic
peripheral neuropathy. Stem cells translational medicine, 1(7), 557–565.
https://doi.org/10.5966/sctm.2012-0025
Watt FM, Driskell RR. (2010). The therapeutic potential of stem cells. Philos
Trans R Soc Lond B Biol Sci. 12;365(1537):155-63.
https://doi:10.1098/rstb.2009.0149.
Wei Deng, Weiwei Chen, Zhuoya Zhang, Saisai Huang, et al. (2015).
Mesenchymal stem cells promote CD206 expression and phagocytic
activity of macrophages through IL-6 in systemic lupus erythematosus,
Clinical Immunology, Volume 161, Issue 2, P:209-216,
https://doi.org/10.1016/j.clim.2015.07.011.
Weiss ML, Troyer DL. (2006). Stem cells in the umbilical cord. Stem Cell
Rev.;2(2):155-62. https://doi:10.1007/s12015-006-0022-y.
Wikipedia, (2017). https://www.wikidoc.org/index.php/File:Lupus2.jpg
Witt R, MacKenzie TC, Peranteau WH. (2017). Fetal stem cell and gene
therapy. Semin Fetal Neonatal Med. 22(6):410-414.
https://doi:10.1016/j.siny.2017.05.003.
114
The references
Worku MG. (2021). Pluripotent and Multipotent Stem Cells and Current
Therapeutic Applications: Review. Stem Cells Cloning. 12;14:3-7.
https://doi:10.2147/SCCAA.S304887.
Wszoła M, Nitarska D, Cywoniuk P, Gomółka M, Klak M. (2021). Stem Cells
as a Source of Pancreatic Cells for Production of 3D Bioprinted Bionic
Pancreas in the Treatment of Type 1 Diabetes. Cells. 18;10(6):1544.
https://doi:10.3390/cells10061544.
Wu, X., Jiang, J., Gu, Z. et al. (2020). Mesenchymal stromal cell therapies:
immunomodulatory properties and clinical progress. Stem Cell Res
Ther 11, 345. https://doi.org/10.1186/s13287-020-01855-9
Xie, Min, Cuifang Li, Zhou She, Feifeng Wu, et al. (2022). Human umbilical
cord mesenchymal stem cells derived extracellular vesicles regulate
acquired immune response of lupus mouse in vitro. Scientific Reports
12, no. 1: 13101.
Xu, Jianyong; Chen, Jieting; Li, Wenlei; et al. (2020). Additive Therapeutic
Effects of Mesenchymal Stem Cells and IL-37 for Systemic Lupus
Erythematosus. JASN 31(1):p 54-65,
https://DOI:10.1681/ASN.2019050545
Xu, T., Li, X., Guo, Y., Uhlin, E., Holmberg, L., Mitra, S., ... & Sundström, E.
(2022). Multiple therapeutic effects of human neural stem cells derived
from induced pluripotent stem cells in a rat model of post-traumatic
syringomyelia. EBioMedicine, 77.
Yang C, Sun J, Tian Y, et al. (2021). Immunomodulatory Effect of MSCs and
MSCs- Derived Extracellular Vesicles in Systemic Lupus
Erythematosus, Front. Immunol., 12:3652,
https://DOI=10.3389/fimmu.2021.714832
Yang Q, Liu Y, Chen G, et al. (2021). An Overview of the Safety, Efficiency,
and Signal Pathways of Stem Cell Therapy for Systemic Lupus
Erythematosus. Stem Cells Int. 13;2021:2168595.
https://doi:10.1155/2021/2168595
Yang X, Yang J, Li X, Ma W, Zou H. (2018). Bone marrow-derived
mesenchymal stem cells inhibit T follicular helper cell in lupus-prone
mice. Lupus.;27(1):49-59. https://doi:10.1177/0961203317711013
Ye L, Swingen C, Zhang J. (2013). Induced pluripotent stem cells and their
potential for basic and clinical sciences. Curr Cardiol Rev. 1;9(1):63-72.
https://doi:10.2174/157340313805076278
Yi, P., Xu, X., Qiu, B., & Li, H. (2020). Impact of chitosan membrane culture
on the expression of pro‑and anti‑inflammatory cytokines in
mesenchymal stem cells. Experimental and Therapeutic Medicine,
20(4), 3695-3702.
115
The references
Youd M, Blickarz C, Woodworth L, et al. (2010). Allogeneic mesenchymal

stem cells do not protect NZB × NZW F1 mice from developing lupus
disease, Clinical and Experimental Immunology, Volume 161, Issue 1, ,
Pages 176–186, https://doi.org/10.1111/j.1365-2249.2010.04158.x
Young RA. (2011). Control of the embryonic stem cell state. Cell.
18;144(6):940-54. https://doi:10.1016/j.cell.2011.01.032
Young, V., Ahmad, S., Brown, J. et al. (2015).Peritoneal VEGF-A expression
is regulated by TGF-β1 through an ID1 pathway in women with
endometriosis. Sci Rep 5, 16859. https://doi.org/10.1038/srep16859
Yuan, W., DiMartino, SJ, Redecha, PB, Ivashkiv, LB, & Salmon, JE. (2011).
Systemic lupus erythematosus monocytes are less responsive to
interleukin-10 in the presence of immune complexes. Arthritis and
rheumatism,; 63(1), 212–218. https://doi.org/10.1002/art.30083
Zakrzewski W, Dobrzyński M, Szymonowicz M, Rybak Z.(2019). Stem cells:
past, present, and future. Stem Cell Res Ther. 26;10(1):68.
https://doi:10.1186/s13287-019-1165-5
Zanone, M. M., Favaro, E., Miceli, I., Grassi, G., Camussi, E., Caorsi, C., &
Camussi, G. (2010). Human mesenchymal stem cells modulate cellular
immune response to islet antigen glutamic acid decarboxylase in type 1
diabetes. The Journal of Clinical Endocrinology & Metabolism, 95(8),
3788-3797.
Zhang S, Yang Y, Fan L, Zhang F, Li L. (2020).The clinical application of
mesenchymal stem cells in liver disease: the current situation and
potential future. Ann Transl Med.; 8(8):565.
https://doi:10.21037/atm.2020.03.218
Zhang Y, Bai XF, Huang CX. (2003).Hepatic stem cells: existence and origin.
World J Gastroenterol. ;9(2):201-4. https://doi:10.3748/wjg.v9.i2.201
Zhang, Xu, Xingyu Lu, Yixuan Yu, Kexin Tan, and Huijuan Cui. (2022).
Changes of IL-6 And IFN-γ before and after the adverse events related
to immune checkpoint inhibitors: A retrospective study. Medicine 101,
no. 46.
Zhao L, Liu JW, Shi HY, Ma YM. (2021). Neural stem cell therapy for brain
disease. World J Stem Cells. 26;13(9):1278-1292.
https://doi:10.4252/wjsc.v13.i9.1278
Zhao Q, Ren H, Han Z. (2016). Mesenchymal stem cells: Immunomodulatory
capability and clinical potential in immune diseases, J. Cell.
Immunother., 2 (1), 3-20, https://doi.org/10.1016/j.jocit.2014.12.001
Zheng B, Zhang P, Yuan L, Chhetri RK, Guo Y, Deng D. (2020). Effects of
human umbilical cord mesenchymal stem cells on inflammatory factors
116
The references
and miR-181a in T lymphocytes from patients with systemic lupus

erythematosus. Lupus.; 29(2):126- 135.
Zheng, Ru-hua, Jin-hui Wang, et al. (2013). Clinical and immunopathological
features of patients with lupus hepatitis. Chinese Medical Journal 126,
no. 02: 260-266.
Zhou T, Li HY, Liao C, Lin W, Lin S, (2020).Clinical Efficacy and Safety of
Mesenchymal Stem Cells for Systemic Lupus Erythematosus, Stem
Cells Int., ; (11): https://doi.org/10.1155/2020/6518508
Zhou, K., Zhang, H., Jin, O. et al. (2008). Transplantation of Human Bone
Marrow Mesenchymal Stem Cell Ameliorates the Autoimmune
Pathogenesis in MRL/lpr Mice. Cell Mol Immunol 5, 417–424.
https://doi.org/10.1038/cmi.2008.52
Zhou, T, Liao, C, Li, HY. (2020). Efficacy of mesenchymal stem cells in
animal models of lupus nephritis: a meta-analysis. Stem Cell Res. Ther.;
11(1) 1-10. https://doi.org/10.1186/s13287-019-1538-9
Zhu Y, Feng X. (2018). Genetic contribution to mesenchymal stem cell
dysfunction in systemic lupus erythematosus. Stem Cell Res Ther.,
24;9(1):149.
Zhu Z, Huangfu D. (2013). Human pluripotent stem cells: an emerging model
in developmental biology. Development.;140(4):705-17.
https://doi:10.1242/dev.086165
Zhuoya Zhang, Lingying Niu, Xiaojun Tang, et al. (2019). Mesenchymal stem
cells prevent podocyte injury in lupus-prone B6.MRL-Faslpr mice via
polarizing macrophage into an anti-inflammatory phenotype,
Nephrology Dialysis Transplantation, V:34, Issue 4, P: 597–605,
https://doi.org/10.1093/ndt/gfy195
Zuhair M. Mohammedsaleh, (2022). The use of patient-specific stem cells in
different autoimmune diseases, Saudi Journal of Biological Sciences,
Volume 29, Issue 5, P:3338-3346,
https://doi.org/10.1016/j.sjbs.2022.02.009.
117
Annexes
Appendix
(Annexes 1)
BALB/c Mouse Bone Marrow Mesenchymal Stem Cells (BCBMMSCs)
Product Description:
BALB/c Mouse Bone Marrow Mesenchymal Stem Cells are derived from the
tibias of pathogen-free laboratory adult mice. Cells are grown in tissue culture
plates with Cell Biologics’ Culture Medium for 7-15 days. Cultures are then
expanded. Prior to shipping, cells at passage 1 are detached and cryopreserved in
vials. Each vial contains 1x106 cells per ml and is delivered frozen. Cells are
negative for bacteria, yeast, fungi, and mycoplasma. Cells can be expanded for 2 or
3 passages at a split ratio of 1:2 under the cell culture conditions specified by Cell
Biologics. Repeated freezing and thawing of cells is not recommended.
MBMMSCs are tested for expression of markers using antibodies, CD44, Sca-1
and CD29 by flow cytometry.
Laboratory Applications:
MBMMSCs can be used in standard biochemical procedures include PCR,
Western blotting, immunoprecipitation, or cell derivatives for desired research
applications.
Authorized Uses of Cell Biologics Products:
MBMMSCs from Cell Biologics are distributed for internal research purposes
only. Our products are not authorized for human use, for in vitro diagnostic
procedures, or for therapeutic procedures. Transfer or resale of any Cell Biologics’
cells or products from the purchaser to other markets, organizations or individuals
is prohibited by Cell Biologics, without the company’s written consent. Cell
Biologics’ Terms and Conditions must be accepted before submitting an order.
Medium
Review the information provided on the Cell Biologics website about
appropriate culture media. Use pre-warmed (37°C) cell culture media (30-50 ML)
to recover cryo-preserved cells and when changing media or splitting cells.
Handling of Arriving Live Cells:
When you receive the live cells in a T25 or T75 flask, remove the sticker from
the filter cap, and keep the flask with 6-20 ml existing medium in 37°C CO2
incubator for 1 hour before replacing the desired CellBiologics' medium. Either
split the 95-100% confluent cells from a T25 flask to a T75 flask after 1 hour or let
the cells grow in the T25 flask with the desired Medium for 12-48 hours before
subculturing cells. The recommended split ratio for primary cells is 1:2.
Cell Recovery from Cryovial:
• Quickly thaw cells in cryo-vial by incubating them in a 37°C water bath for <1
min until there is just a small bit of ice left in the vial.
• Promptly remove the vial and wipe it down with 70% ethanol.
118
Appendix
• Transfer cells from the vial to a sterile centrifuge tube. Add 8-10 ml of Cell
Biologics’ Medium.
• Flush the vial with an additional 0.5-1 ml of medium to ensure complete transfer
of cells to the centrifuge tube.
• Centrifuge cells at 120 g for 5 minutes.
• Aspirate the supernatant and suspend the cell pellet in 6 ml of Culture Medium.
• Add suspended cells into a flask or plate.
• Place the T25 flask in a humidified, 5% CO2 incubator at 37°C.
• Change culture media the following day to remove non-adherent cells and
replenish nutrients.
• Change cell culture medium every day when cells are >70% confluent.
• Cells should be checked daily under a microscope to verify appropriate cell
morphology.
Expansion of Cultured Primary Cells:
• Remove and discard the cell culture media from the flask.
• Flush the adherent layer 1 time using a 5 ml sterile pipette with sterile PBS (1X)
without calcium and magnesium to dislodge loosely attached cells and remove
fraction.
• Remove and discard the wash solution from the flask.
• Incubate cells with warm (37°C) 0.25% Trypsin-EDTA solution for 2-5 minutes.
Use 3.0 ml of Trypsin-EDTA solution when collecting cells in a T75 flask, and 2
ml when using a T25 flask. As soon as cells have detached (the flask may require a
few firm gentle taps), add 8-10 ml of Cell Culture Medium supplemented with 5-
10 % FBS to a T25 or T75 flask.
• Plate cells in fresh flasks or plates precoated with Gelatin-Based Coating Solution
in a humidified, 5%-CO2 incubator at 37°C.
• Change culture media the following day to remove non-adherent cells and
replenish nutrients.
• Cells should be checked daily under a microscopy to verify appropriate cell
morphology.
• Change culture medium every 24-48 hours. Please note that the medium should
be changed every day when cells are >70% confluent to remove non-adherent cells
and replenish nutrients, pre-wash cells with 1X PBS 1-2 times whenever replacing
the medium.
119
Appendix
(Annexes 2)
Mouse Anti-nuclear antibody (ANA) ELISA Kit

This product is suitable for the in vitro quantitative detection of ANA
concentration using Mouse serum, plasma, or cell culture supernatant. For
detection of other special sample types please contact our technical support. The
kit is for research-use-only. Please read the instructions carefully before using and
confirm all kit components are included. This kit employs the “Double Antigen
Sandwich” technique. The principle of Double Antigen Sandwich is based on the
characteristics of the target antibody which contains two available paratopes which
can be identified by both the pre-coated capture antigen and the detection antigen
simultaneously. The process is as follows:
1. Pre-coat antigens to the plate, and then, via washing, remove all other antigens
and impurities that did not bind to the plate. The remaining sites on the plate are
blocked with irrelevant proteins.
2. Once remaining plate sites have been blocked, sample containing the target
analyte can be added, which will result in the target analyte becoming immobilized
by the capture antigens, forming an antigen-antibody complex. The wells are then
washed to remove all unbound particles and impurities.
3. A biotinylated antigen is then added to the wells that will then bind to the
remaining antibody’s paratope, resulting in an antibody-antigen-antibody complex.
The plate is again washed to remove unbound antigens and impurities.
4. Next, horseradish peroxidase + avidin is added to the wells and binds with the
biotinylated antigen. The quantity of reporter enzyme is now positively correlated
to the quantity of target antibody in the sample. The wells are then washed again to
remove any impurities.
5. Finally, substrates for the HRP reaction are added, and the sample
concentrations can then be computed/calculated from the resulting coloration
changes.
Procedure:
As mentioned above, this kit utilizes the Double Antigen Sandwich ELISA
technique. The pre-coated antigen is a related-Mouse ANA antigen, while the
detection antigen is another antigen. Samples are added into ELISA plate wells and
washed out with PBS or TBS after their respective additions to the wells. Then
Avidin-peroxidase conjugates are added to the wells in after. TMB substrate is
used for coloration after the enzyme conjugate has already been thoroughly washed
out of the wells by PBS or TBS. TMB reacts to form a blue product from the
peroxidase activity, and finally turns to yellow after addition of the stop solution.
The color intensity and quantity of target analyte in the sample are positively
correlated.
120
Appendix
Sample Preparation:
1. Serum: Place collected whole blood in refrigerator at 4℃ overnight. Then
centrifuge for 10min at 1000-3000rpm. Take supernatant and either test
immediately or place samples at -20℃/-80℃ (1-3 months) for storage.
2. Plasma: Take EDTA, sodium citrate, or heparin as anticoagulant, and add to
plasma. Mix well. Centrifuge mixture for 10min at 1000-3000rpm. Take
supernatant and test immediately or place samples at -20℃ /-80℃ (1-3 months) for
storage.
3. Tissue homogenate: Take tissue slices and wash them in 0.01M PBS; Add a
tissue protein extraction reagent according to proportion of 1g to 5-10mL and mix
on ice bath. After sufficient homogenization, please then centrifuge for 10min at
5000-10000rpm. Take supernatant for immediate testing, or place samples at -
20℃/-80℃ (1-3 months) for storage.
4. Cell culture: Centrifuge for 10min at 1000-3000rpm. Take supernatant for
immediate testing, or place samples at -20℃/-80℃ (1-3 months) for storage.
5. For urine, ascites, cerebrospinal fluid, etc: Centrifuge for 10min at 1000-3000
rpm. Take supernatant for immediate testing, or place samples at -20℃/-80℃ (1-3
months) for storage.
Test preparation:
121
Appendix
1. Please remove ELISA Kit from refrigerator 20 minutes in advance, and begin
test once it has been brought to room temperature.
2. Dilute the concentrated washing buffer with double distilled water (1:25).
Return unused quantity back to the box.
3. Standard: Add 1.0ml Standard Diluent to lyophilized standard vial and allow
sitting for 30 min. After the standard has completely dissolved, mix it slightly and
mark with a label on the tube. It is recommended to use the following
concentration values for the standard curve: 20, 10, 5, 2.5, 1.25, 0.625,
0.312ng/mL. Note: Make absolutely sure the lyophilized standard completely
dissolved and well mixed.
4. Legend of standard sample dilution method: Take 7 clean tubes and label them
with their expected concentrations (10, 5, 2.5, 1.25, 0.625, 0.312, 0ng/mL). Add
300μL Standard Diluent into each tube. Pipette out 300μl diluent from the
reconstituted standard and add to the tube labeled 10ng/mL and mix well. Further
Pipette out 300μl diluent from the 10ng/mL tube, and add to the 5ng/mL, and mix
well. Repeat these steps through the 0.312ng/mL standard. Standard Diluent in the
0ng/mL tube is the negative control.
Washing method:
1. Automatic plate-washing: The required amount of wash buffer is 350μl, and the
injection and extraction intervals should be ~20－30secs. Please be well aware of
the operation before putting the machine into practice.
2. Manual plate-washing: add 350μl wash buffer to each well and let stand for
30sec. Shake plate to remove as much liquid as possible, and dab the plate with
absorbent paper if necessary. During the plate-washing process, please pay close
attention to the wash buffer-adding steps to avoid contamination and well-jumping.
Step Summary of operating procedures:
1 -Prepare reagents, samples and the standards.
2 -Add the prepared samples and standard & incubate at 37 ℃ for 90 minutes.
3 -Wash 2x, add antigen solution & incubate at 37 ℃ for 60 minutes.
4 -Wash 3x, then add the Enzyme working solution & incubate at 37 ℃ for 30
minutes.
122
Appendix
5 -Wash 5x, then add the Color Reagent solution & incubate at 37 ℃ up to 30
minutes.
6 -Add the Color Reagent C.
7 -Use microplate readers to measure OD within 10 minutes of adding Color
Reagent C.
8 -Calculate the content of samples being tested
123
Appendix
(Annexes 3)
Mouse anti -double –stranded DNA (anti -ds DNA) ELISA Kit
This product is suitable for in vitro quantitative detection of Mouse serum,
plasma or cell culture supernatant and organizations in the natural and recombinant
anti -ds DNA concentration. Detection of other special sample please contacts our
technical support. The kit is for research use only. Please read the instructions
carefully before using and check the kit components. This kit employs Double
Antigen Sandwich Technique. The principle of Double Antigen Sandwich is based
on characteristics of the tested antigen with more than two valances which can
identify coated antigen and detection antigen at same time.
Procedure:
This experiment use double-sandwich Elisa technique and the ELISA Kit
provided is typical. The pre-coated antigen is Mouse anti -ds DNA antigen.
Samples and antigen are added into ELISA plate wells and washed out with PBS
or TBS. Then Avidin-peroxidase conjugates are added to ELISA wells in order;
Use TMB substrate for coloring after reactant thoroughly washed out by PBS or
TBS. TMB turns into blue in peroxidase catalytic and finally turns into yellow
under the action of acid. The color depth and the testing factors in samples are
positively correlated. Schematic diagram of the Mouse anti -ds DNA ELISA kits
the first step The second step
124
Appendix
Necessary for testing their own testing supplies and reagents】

1. Centrifuge tube (capacity of 1.5ml, 5ml, and so on).
2. Disposable tip (range of 0.5-10μl-20μl, 20-200μl, 200-1000μl).
3. Pure water or distilled water.
4. Coordinate paper.
5. Absorbent paper.
6. EDTA, sodium citrate, heparin
Sample collection Note:
1. The tube for blood collection should be free of pyrogen and endotoxin
2. Hemolysis and hyperlipidemia specimens cannot be used to extracted serum and
plasma.
3. The samples should appear clear and transparent. And all the suspension should
be removed through centrifugation.
4. If collected samples are not timely detected, they should be divided according to
single usage amount and frozen reserved in refrigerator at -20-80℃, avoiding the
repeated freeze-thaw.
5. According to the actual situation of the samples, make proper multiple dilutions
6. Collect specimens and try to gain double dosage to avoid specimens shortage for
repeated assays in case that failure in one-assay delays experimental process.
7. Do protective measures when collecting specimens (e.g. wearing gloves,
respirator, respirator, etc.), aware of the potential risk in all specimens.
8. Specimen processing should be inside the biological safety cabinet. Ensure
proper use of the biological safety cabinet.
Measures for the samples:
Serum: Put the collected whole blood in refrigerator at 4℃ for the night. Then
centrifuge it for 10min at 1000-3000rpm. Take supernatant tested immediately or
put samples at -20℃ (for 1-3 months) or -80℃ (for 1-3 months) for storage.
Test preparation:
1. Please get the Elisa Kit out of refrigerator 20 minutes in advance and take test
when it balances to room temperature.
2. Dilute the concentrated washing solution with double distilled water (1:25). Put
the unused back.
3. Mouse anti -ds DNA standard sample: Add Standard diluent 1.0ml into Mouse
anti – ds DNA lyophilized standard sample and keep it still for 30 min. After the
sample completely dissolved, mix it slightly and mark label on the tube ①，then
take dilution as needed. (It is recommended to using following concentration value
to standard curve: 20,10, 5, 2.5, 1.25, 0.625, 0.312ng/ml). Note: Make sure the
lyophilized standard completely dissolved and well mixed.
125
Appendix
4. Legend of standard sample dilution method: Take 7 clean tubes and label them
with ②, ③, ④, ⑤, ⑥, ⑦, ⑧ respectively. Add 300μl standard sample diluent
into each tube. Pipette out 300μl diluent from tube ① to tube ② and mix well.
Further Pipette out 300μl diluent from tube ② to tube ③, and mix well. Repeat
steps above up to tube ⑦. Standard sample dilution in tube⑧is negative control.
5. Mouse anti -ds DNA antigen liquid: Referring to needed amount, employ
antigen diluent to dilute the concentrated antigen (1:100) to form antigen liquid.
The preparation should be done 30 min in advance. And it’s only for use on that
day
6. Enzyme-conjugate liquid: Referring to needed amount, dilute the concentrated
enzyme-conjugate by enzyme-conjugate diluent (1:100) to form enzyme-conjugate
liquid. The preparation should be done 30 min in advance. And it’s only for use on
that day.
7. Color Reagent liquid: Prepare Color Reagent liquid 30 min in advance with
Color Reagent A and Color Reagent B by the proportion of 9:1.
Washing method:
1. Automatic plate-washing machine: The required amount of lotion is 350μl and
the injection and extraction interval should be 20－30secs. Be well aware of the
operation instruction before putting the machine into practice.
2. Manual plate-washing machine: add 350μl lotion to each well and keep it still
for 30secs. Shake individual wells as dry as you can and clean them with absorbent
paper. During the plate-washing process, pay attention to the lotion-adding step to
avoid contamination and well-jumping.
Steps:
1.Take out needed strips from zip lock bag which balances to room temperature.
The unused strips and desiccant should be put back into the sealed aluminum foil
bag at 2-8℃ for storage.
2. Set aside blank wells.
3. Add samples or different concentration of Mouse anti -ds DNA standard
samples to corresponding wells (100μl for each well), 0ng/ml well should be filled
with standard diluent. Seal the reaction wells with adhesive tapes, hatching in
incubator at 37℃ for 90 min.
4. Prepare Mouse anti -ds DNA antigen liquid 30min in advance.
5. Wash the Elisa plate 2 times
6. Add the Mouse anti -ds DNA antigen liquid to each well (100μl for each). Seal
reaction wells with adhesive tapes, hatching in incubator at 37℃ for 60 min.
7. Prepare enzyme-conjugate liquid 30min in advance.
8. Wash the Elisa plate 3 times
126
Appendix
9. Add enzyme-conjugate liquid to each well except blank wells (100μl for each).
Seal the reaction wells with adhesive tapes, hatching in incubator at 37℃ for 30
min.
10. Wash the Elisa plate 5 times.
11. Add 100μl Colour Reagent liquid to individual well, hatching in dark incubator
at 37℃. When color for high concentration of standard curve become darker and
color gradient appears, the hatching can be stopped. The chromogenic reaction
should be controlled within 30 min.
12. Add 100μl Colour Reagent C to individual well. Mix well. Read OD（450nm
）within 10 min.
Result determination:
1. OD value of each sample and specimen should minus that of blank well.
2. Draw standard curve manually. Take concentration value of samples as abscissa
and OD readings as vertical coordinate. Use smooth line to connect each
coordinate point of standard sample. The concentration of samples can be found by
checking sample OD reading. It is recommended to employ the professional curve
software to analyze and compute the result.
3. If the sample OD is higher than the upper limit of standard curve, the sample
should be re-diluted and the experiment rerun. Multiply the result by dilution factor
when calculating the unknown.
Reference curve
127
Appendix
(Annexes 4)
BALB/C model mice:
Also Known As:C, BALBc, BALB, BALB/c BALB/cJ is a commonly used
inbred. Key traits include a susceptibility to developing the demyelinating disease
upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ
substrain is susceptible to Listeria, all species of Leishmania, and several species
of Trypanosoma, but is resistant to experimental allergic orchitis.
Genetic Background RESEARCH APPLICATIONS:
Immunology, Inflammation and Autoimmunity Research, Cardiovascular
Research, Cancer Research, Neurobiology Research, Hematological Research,
Mouse/Human Gene Homologs.
Detailed Description
BALB/c mice are particularly well known for the production of plasmacytomas
following injection with mineral oil forming the basis for the production of
monoclonal antibodies. Although not all BALB/c substrains have been examined
for plasmacytoma induction, substrains derived from the Andervont (An) lineage
(which includes BALB/cByJ) typically are susceptible, while those descended
from BALB/cJ are resistant.
BALB/c mice immunized with PLP180-199 develop an atypical form of
experimental autoimmune encephalomyelitis in which susceptibility is determined
by location. BALB/c mice are predisposed to dystrophic cardiac calcinosis. Using
BALB/cByJ and BALB/cJ mice obtained from Jackson Laboratory.
Development
This is a substrain of BALB (Bagg’s albino) derived initially from the BALB
strain maintained by MacDowell at Cold Spring Harbor, eventually sent to G.D.
Snell at the University of Texas and brought by Snell to the Jackson Laboratory in
1932 at generation F26. Three branches from Snell’s BALB/c were separated
during the period 1937-1939, Andervont (BALB/cAn), Scott (BALB/cSc), and
Green (BALB/cGn). The lineage from BALB/cSc eventually became BALB/cJ in
1941 at generation F41.
This mouse can be used to support research in many areas including:
Cardiovascular Research, Diet-Induced Atherosclerosis, Cancer Research,
Increased Tumor Incidence, Mammary Gland Tumors, Research Tools,
Monoclonal antibodies, Myeloma, infectious Disease, Neurodevelopmental
Defects, Inflammation, Autoimmunity, Allergic encephalomyelitis (EAE),
Hematological Research, Hemoglobin Defects, and Thalassemia, beta.
128
Appendix
(Annexes 5)
Mouse CCL2 (MCP-1) ELISA:

Enzyme-linked immunosorbent assay for quantitative detection of mouse CCL2
(MCP-1) Catalog Number 88-7391, This Mouse CCL2 (MCP-1) Uncoated ELISA
contains the necessary reagents, standards, buffers and diluents for performing
quantitative ELISA. This ELISA set is specifically engineered for accurate and
precise measurement of mouse CCL2 protein levels from samples including serum,
plasma, and supernatants from cell cultures.
Stability:
This kit is guaranteed to perform as defined if stored and handled as instructed
according to this datasheet and the Certificate of Analysis, which is included with
the reagents. Expiration date is indicated on the box label.
Reagent preparation
• Coating Buffer (1X): Make a 1:10 dilution of PBS (10X) in deionized water.
• Capture Antibody: Dilute capture antibody (250X) 1:250 in Coating Buffer (1X).
• 5X ELISA/ELISPOT Diluent: Dilute Diluent Concentrate (5X) 1:5 in deionized
water.
• Standard: Reconstitute mouse CCL2 standard by addition of distilled water.
Reconstitution volume is stated on the label of the standard vial. Allow the
standard to reconstitute for 10– 30 minutes. Swirl or mix gently to ensure complete
and homogeneous solubilization (concentration of reconstituted standard = 2000
pg/mL).
Mix well prior to making dilutions. The standard has to be used immediately after
reconstitution and cannot be stored.
• Detection Antibody: Dilute detection antibody (250X) 1:250 in ELISA/ELISPOT
Diluent (1X).
129
Appendix
• Enzyme: Dilute HRP Concentrate (250X) 1:250 in ELISA/ELISPOT Diluent

(1X).
Experimental procedure:
1. Coat Corning™ Costar™ 9018 ELISA plate with 100 μL/well of capture
antibody in Coating Buffer, seal the plate and incubate overnight at 4°C.
2. Aspirate wells and wash 3 times with >250 μL/well Wash Buffer. Allowing time
for soaking during each wash step increases the effectiveness of the washes. Blot
plate on absorbent paper to remove any residual buffer.
3. Block wells with 200 μL of ELISA/ELISPOT Diluent (1X). Incubate at room
temperature for 1 hour.
4. Prepare Standard.
5. Aspirate and wash at least once with Wash Buffer.
6. Perform 2-fold serial dilutions of the top standards to make the standard curve
for a total of 8 points. For that add 100 μL of ELISA/ELISPOT Diluent to the
wells leaving the first wells empty. Add 200 μL/well of top standard concentration
to the first empty wells A1/A2. Transfer 100 μL of top standard from wells A1/A2
to wells B1/B2. Mix the contents of the wells B1 and B2 by repeated aspiration
and ejection and transfer 100 μL to wells C1/C2. Take care not to scratch surface
of the microwells. Continue this procedure 5 times.
7. Add 100 μL/well of samples to the appropriate wells, Add 100 μL of
ELISA/ELISPOT Diluent to the blank well, Seal the plate and incubate at room
temperature for 2 hours.
8. Prepare the Detection Antibody.
9. Aspirate and wash as in Step 2. Repeat for a total of 3-5 washes. Allowing time
for soaking (~1 minute) during each wash step increases the effectiveness of the
washes. Blot plate on absorbent paper to remove any residual buffer.
10. Add 100 μL/well diluted Detection Antibody to all wells.
11. Seal the plate and incubate at room temperature for 1 hour.
12. Prepare the Avidin-HRP.
13. Aspirate and wash as in Step 2. Repeat for a total of 3-5 washes. Allowing time
for soaking during each wash step increases the effectiveness of the washes. Blot
plate on absorbent paper to remove any residual buffer.
14. Add 100 μL/well of diluted Avidin-HRP.
15. Seal the plate and incubate at room temperature for 30 minutes.
16. Aspirate and wash as in Step 2, making sure to allow time for soaking for 1 to
2 minutes prior to aspiration. Repeat for a total of 5-7 washes.
17. Add 100 μL/well of 1X TMB Solution.
18. Incubate at room temperature for 15 minutes.
19. Add 100 μL/well of Stop Solution.
20. Read plate at 450 nm.
130
Appendix
(Annexes 6)
Mouse RANTES ELISA Kit (CCL5):

Product name Mouse RANTES ELISA Kit (CCL5), Detection method
Colorimetric Sample type Cell culture supernatant, Serum, Plasma Assay type
Sandwich. Assay duration multiple steps standard assay
Species reactivity Reacts with:
Mouse Product overview Abcam’s RANTES Mouse ELISA kit is an in vitro
enzyme-linked immunosorbent assay for the quantitative measurement of mouse
RANTES in serum, plasma and cell culture supernatants. This assay employs an
antibody specific for mouse RANTES coated on a 96-well plate. Standards and
samples are pipetted into the wells and RANTES present in a sample is bound to
the wells by the immobilized antibody. The wells are washed and biotinylated anti-
mouse RANTES antibody is added. After washing away unbound biotinylated
antibody, HRP-conjugated streptavidin is pipetted to the wells. The wells are again
washed, a TMB substrate solution is added to the wells and color develops in
proportion to the amount of RANTES bound. The Stop Solution changes the color
from blue to yellow, and the intensity of the color is measured at 450 Function
Chemoattractant for blood monocytes, memory T-helper cells and eosinophils.
Causes the release of histamine from basophils and activates eosinophils. One of
the major HIV-suppressive factors produced by CD8+ T-cells. Recombinant
RANTES protein induces a dose-dependent inhibition of different strains of HIV-
1, HIV-2, and simian immunodeficiency virus. The processed form RANTES acts
as a natural chemotaxis inhibitor and is a more potent inhibitor of HIV-1-infection.
The second processed form RANTES exhibits reduced chemotactic and HIV-
suppressive activity compared with RANTES and RANTES and is generated by an
unidentified enzyme associated with monocytes and neutrophils. Tissue specificity
T-cell and macrophage specific. Sequence similarities Belongs to the intercrine
beta (chemokine CC) family. Post-translational modifications N-terminal
processed form RANTES is produced by proteolytic cleavage, probably by DPP4,
after secretion from peripheral blood leukocytes and cultured sarcoma cells.
131
Appendix
(Annexes 7)
Mouse ICAM-1 ELISA Kit:
The Mouse ICAM-1 ELISA Kit is a solid-phase sandwich Enzyme-Linked
Immunosorbent Assay (ELISA) designed to detect and quantify the level of mouse
ICAM-1 in serum, plasma, and cell culture media.
Procedural guidelines:
Review the Procedural guidelines and Plate washing directions in the ELISA
Technical Guide at thermofisher.com for details prior to starting the procedure.
Reagents are lot-specific. Do not mix or interchange different reagent lots from
various kit lots.
Prepare 1X Wash Buffer:
1. Allow Wash Buffer Concentrate (20X) to reach room temperature and mix to
dissolve any precipitated salts.
2. Dilute 20 mL of the Wash Buffer Concentrate into 380 mL of deionized or
buffer within one month.
Prepare diluent:
Assay Diluent D and Assay Diluent B should be diluted 5-fold with deionized or
distilled water before use.
Prepare biotin conjugate:
1. Briefly spin down the biotin conjugate before use.
2. Add 100 μL of 1X Assay Diluent B into the vial to prepare a biotin conjugate
concentrates.
3. Pipette up and down to mix gently (the concentrate can be stored at 4°C for 5
days).
4. The biotin conjugate concentrate should be diluted 80-fold with 1X Assay
Diluent B and used in step 2 of ELISA procedure.
Sample preparation guidelines:
Collect samples in pyrogen/endotoxin-free tubes. Freeze samples after collection
if samples will not be tested immediately. Avoid multiple freeze-thaw cycles of
frozen samples. Thaw completely and mix well prior to analysis. Avoid the use of
hemolyzed or lipemic sera. If large amounts of particulate matter are present in the
sample, centrifuge or filter sample prior to analysis.
Pre-dilute samples:
1X Assay Diluent D should be used for dilution of serum, plasma, and cell
culture supernatant samples. Dilute serum and plasma 50 - 500-fold. Because
conditions may vary, it is recommended that each investigator determine the
optimal dilution to be used for each application.
Dilute standards:
132
Appendix
1. Briefly spin down a vial of lyophilized standard.

2. Add 400 μL 1X Assay Diluent D into the lyophilized standard vial to prepare a
50 ng/mL standard solution. Dissolve the powder thoroughly by gentle mixing.
Add 60 μL ICAM-1 standards from the vial of reconstituted standard, into a tube
with 440 μL 1X Assay Diluent D to prepare a 6,000 pg/mL standard solution.
Pipette 400 μL 1X Assay Diluent D into each tube. Use the 6,000 pg/mL standard
solution to produce a dilution series. Mix each tube thoroughly before the next
transfer. 1X Assay Diluent D serves as the zero standards (0 pg/mL).
Prepare 1X Streptavidin-HRP solution:

1. Briefly spin the Streptavidin-HRP and pipette up and down to mix gently before
use, as precipitates may form during storage.
2. Dilute Streptavidin-HRP 400-fold with 1X Assay Diluent B.
3. Do not store diluted solution for future use.
133
Appendix
Determine the number of 8-well strips required for the assay. Insert the strips in
the frames for use. Re-bag any unused strips and frames, and store at 2 to 8°C for
future use.
1- Bind antigen a. For the standard curve, add 100 μL of standards to the
appropriate wells. For samples, add 100 μL of diluted samples to the wells.
b. Cover wells and incubate for 2.5 hours at room temperature or overnight at 4°C
with gentle shaking.
c. Discard the solution and wash 4 times with 1X Wash Buffer. Wash by filling
each well with Wash Buffer (300 μL) using a multi-channel Pipette or autowasher.
Complete removal of liquid at each step is essential for good performance. After
the last wash, remove any remaining Wash Buffer by aspirating or decanting.
Invert the plate and blot it against clean paper towels.
2- Add biotin conjugate a. Add 100 μL of prepared biotin conjugate to each well.
b. Incubate for 1 hour at room temperature with gentle shaking.
c. Discard the solution. Repeat the wash as in step 3.
3- Add Streptavidin-HRP a. Add 100 μL of prepared Streptavidin-HRP solution to
each well.
b. Incubate for 45 minutes at room temperature with gentle shaking.
c. Discard the solution. Repeat the wash as in step 3.
4- Add TMB substrate
a. Add 100 μL of TMB Substrate to each well. The substrate will begin to turn
blue.
b. Incubate for 30 minutes at room temperature in the dark with gentle shaking.
5- Add stop solution Add 50 μL of Stop Solution to each well. Tap the side of the
plate gently to mix. The solution in the well changes from blue to yellow.
Reading of the standard curve:
1. Read the absorbance at 450 nm. Read the plate within 30 minutes after adding
the Stop Solution.
2. Use curve-fitting software to generate the standard curve. A four parameter
algorithm provides the best standard curve fit. Optimally, the background
absorbance may be subtracted from all data points, including standards, unknowns
and controls, prior to plotting.
3. Read the concentrations for unknown samples and control from the standard
curve. Multiple value(s) obtained for sample(s) by the appropriate factor to correct
for the sample dilution.
Performance characteristics:
Standard curve: These standard curves are for demonstration only. A standard
curve must be run with each assay.
134
Appendix
Linearity of dilution:
The serum, plasma, and cell culture media samples were spiked with
recombinant mouse ICAM-1, serially diluted in sample diluent and evaluated.
Observed values were compared to expected values to calculate percent recovery
and demonstrate the dilution linearity of the assay.
135
Appendix
(Annexes 8)
Mouse IL-6 ELISA Kit
The Invitrogen™ Mouse IL-6 ELISA Kit is a solid-phase sandwich Enzyme-
Linked Immunosorbent Assay. This assay is designed to detect and quantify the
level of mouse IL-6 in mouse serum, plasma, buffered solution, or cell culture
medium. The assay recognizes both natural and recombinant mouse IL-6. IL-6 is a
21–28 kDa glycoprotein composed of 184 amino acids produced by lymphocytes,
monocytes, fibroblasts, keratinocytes, endothelial cells, mesangial cells, astrocytes,
bone marrow stroma, and tumor cell lines. At the protein level, mouse IL-6 shows
42% homology to human IL-6, while mouse and rat are 93% identical. IL-6 plays a
major role in the regulation of cell growth, hematopoiesis, and inflammation. IL-6
induces maturation of B-cells into antibody-secreting plasma cells and it co-
stimulates T-cell growth and cytotoxic T-cell differentiation. IL-6 increases IL-2
receptor production in T-cells and induces production of IL-2. IL-6 is the major
inducer of acute phase reactions in response to inflammation or tissue injury, and
with IL-1b and TNF-a, IL-6 induces synthesis of acute phase proteins by
hepatocytes.
Before you begin:
Do not mix or interchange different reagent lots from various kit lots.
• Review the Procedural guidelines and Plate washing directions in the ELISA
Technical Guide available at thermofisher.com.
• Allow reagents to reach room temperature before use. Mix to dissolve any
precipitated salts. Prepare 1X Wash Buffer
1. Dilute 16 mL of Wash Buffer Concentrate (25X) with 384 mL of deionized or
buffer within 14 days.
Sample preparation guidelines:
• Refer to the ELISA Technical Guide at thermofisher.com for detailed sample
preparation procedures.
• Collect samples in pyrogen/endotoxin-free tubes.
• Freeze samples after collection if samples will not be tested immediately. Avoid
multiple freeze-thaw cycles of frozen samples. Thaw completely and mix well (do
not vortex) prior to analysis.
• Avoid the use of hemolyzed or lipemic sera. If large amounts of particulate
matter are present in the sample, centrifuge or filter sample prior to analysis.
Pre-dilute samples:
Because conditions may vary, we recommend that each investigator determine
the optimal dilution for each application.
• Perform sample dilutions with Standard Diluent Buffer.
136
Appendix
• For this assay, serum and plasma samples are diluted 1:2 in Standard Diluent
Buffer when added to wells (see "Perform ELISA" step 1a).
1. Reconstitute Ms IL-6 Standard to 10,000 pg/mL with Standard Diluent Buffer.
Refer to the standard vial label for instructions. Swirl or mix gently and allow the
contents to sit for 10 minutes to ensure complete reconstitution. Use the standard
within 1 hour of reconstitution.
2. Add 50 μL Reconstituted Standard to one tube containing 950 μL Standard
Diluent Buffer and mix. Label as 500 pg/mL mouse IL-6.
3. Add 300 μL Standard Diluent Buffer to each of 7 tubes labeled as follows: 250,
125, 62.5, 31.2, 15.6, 7.8, and 0 pg/mL mouse IL-6.
4. Make serial dilutions of the standard as described below in the dilution diagram.
Mix thoroughly between steps.
5. Remaining reconstituted standard should be discarded or frozen in aliquots at –
80°C for further use. Standard can be frozen and thawed one time only without loss
of immunoreactivity.
Prepare 1X Streptavidin‑HRP solution:

Prepare 1X Streptavidin-HRP within 15 minutes of usage. The Streptavidin-
HRP (100X) is in 50% glycerol, which is viscous. To ensure accurate dilution:
1. For each 8-well strip used in the assay, pipet 10 μL Streptavidin-HRP (100X)
solution, wipe the pipette tip with clean absorbent paper to remove any excess
solution, and dispense the solution into a tube containing 1 mL of Streptavidin-
HRP Diluent. Mix thoroughly.
2. Return the unused Streptavidin-HRP (100X) solution to the refrigerator.
Perform ELISA:
• Allow all components to reach room temperature before use. Mix all liquid
reagents prior to use.
• Determine the number of 8-well strips required for the assay. Insert the strips in
the frames for use. Re-bag any unused strips and frames, and store at 2°C to 8°C
for future use.
137
Appendix
a. Add 100 μL of standards, controls, or cell culture media samples to the

appropriate wells. For serum and plasma samples, add 50 μL of Standard Diluent
Buffer followed by 50 μL of sample to the appropriate wells. Leave the wells for
chromogen blanks empty.
b. Tap the side of the plate to mix. Cover the plate with a plate cover and incubate
for 2 hours at room temperature.
c. Thoroughly aspirate the solution and wash wells 4 times with 1X Wash Buffer.
a. Add 100 μL Ms IL-6 Biotin Conjugate solutions into each well except the
chromogen blanks.
b. Cover the plate and incubate for 30 minutes at room temperature.
c. Thoroughly aspirate the solution and wash wells 4 times with 1X Wash Buffer.
2- Add Biotin Conjugate
a. Add 100 μL 1X Streptavidin-HRP solution into each well except the chromogen
blanks.
b. Cover the plate and incubate for 30 minutes at room temperature.
c. Thoroughly aspirate the solution from the wells and wash wells 4 times with 1X
Wash Buffer.
3- Add Streptavidin‑HRP
a. Add 100 μL Stabilized Chromogen to each well. The solution begins to turn
blue.
b. Incubate for 30 minutes at room temperature in the dark.
4- Add Stabilized Chromogen: Add 100 μL Stop Solution to each well. Tap the
side of the plate to mix. The solution in the wells changes from blue to yellow.
138
Appendix
5- Add Stop Solution

Determination of the standard curve:
1. Read the absorbance at 450 nm. Read the plate within 2 hours after adding the
Stop Solution.
2. Use curve-fitting software to generate the standard curve. A 4 parameter
algorithm provides the best standard curve fit. Optimally, the Background
absorbance may be subtracted from all data points, including standards, unknowns
and controls, prior to plotting.
3. Read the concentrations for unknown samples and controls from the standard
curve. Multiply value(s) obtained for sample(s) by the appropriate factor to correct
for the sample dilution.
139
Appendix
(Annexes 9)
Mouse IL-10 ELISA Kit:
Product name Mouse IL-10 ELISA Kit, Detection method Colorimetric, Sample
type Cell culture supernatant, Serum, Plasma, Assay type Sandwich (quantitative).
Assay duration multiple steps standard assay:
Species reactivity Reacts with: Mouse Product overview Abcam’s Mouse IL-10
ELISA kit is an in vitro enzyme linked immunosorbent assay for the quantitative
measurement of IL-10 in serum, plasma and cell culture supernatants. This assay
employs an antibody specific for mouse IL-10 coated on a 96-well plate. Standards
and samples are pipetted into the wells and IL-10 present in a sample is bound to
the wells by the immobilized antibody. The wells are washed and biotinylated anti-
mouse IL-10 antibody is added. After washing away unbound biotinylated
antibody, HRP conjugated streptavidin is pipetted to the wells. The wells are again
washed, a TMB substrate solution is added to the wells and color develops in
proportion to the amount of IL-10 bound. The Stop Solution changes the color
from blue to yellow, and the intensity of the color is measured at 450 nm.
Platform Microplate:
Function Inhibits the synthesis of a number of cytokines, including IFN-gamma,
IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper
T-cells. Tissue specificity produced by a variety of cell lines, including T-cells,
macrophages, mast cells and other cell types. Sequence similarities Belongs to the
IL-10 family. Cellular localization Secreted. Quality guaranteed and expert
technical support Replacement or refund for products not performing as stated on
the datasheet Valid for 12 months from date of delivery Response to your inquiry
within 24 hours.
140
Appendix
(Annexes 10)
Mouse Interferon gamma ELISA Kit:
Sample type Milk, Serum, Assay type Sandwich (quantitative), Assay time 3h
45m, Assay duration Multiple steps standard assay Species reactivity Reacts with:
Mouse Product overview Mouse interferon gamma ELISA kit (IFN Gamma) is
designed for the quantitative measurement of IFN gamma in mouse serum,
buffered solutions and cell culture medium. A monoclonal antibody specific for
IFN gamma has been coated onto the wells of the microtiter strips provided.
Samples, including standards of known IFN gamma concentrations, control
specimens or unknowns are pipetted into these wells. During the first incubation,
the standards or samples and a biotinylated monoclonal antibody specific for IFN
gamma are simultaneously incubated. After washing, the enzyme Streptavidin-
HRP, that binds the biotinylated antibody is added, incubated and washed. A TMB
substrate solution is added which acts on the bound enzyme to induce a colored
reaction product. The intensity of this colored product is directly proportional to
the concentration of IFN gamma present in the samples. This kit will recognize
both endogenous and recombinant mouse IFN gamma. Get results in 90 minutes
with Human IFN gamma ELISA Kit from our SimpleStep ELISA range. Platform
Microplate Function Produced by lymphocytes activated by specific antigens or
mitogens. IFN-gamma, in addition to having antiviral activity, has important
immunoregulatory functions. It is a potent activator of macrophages, it has
antiproliferative effects on transformed cells and it can potentiate the antiviral and
antitumor effects of the type I interferons. Tissue specificity Released primarily
from activated T lymphocytes. Involvement in disease In Caucasians, genetic
variation in IFNG is associated with the risk of aplastic anemia (AA). AA is a rare
disease in which the reduction of the circulating blood cells results from damage to
the stem cell pool in bone marrow. In most patients, the stem cell lesion is caused
by an autoimmune attack. T-lymphocytes, activated by an endogenous or
exogenous, and most often unknown antigenic stimulus, secrete cytokines,
including IFN-gamma, which would in turn be able to suppress hematopoiesis.
141
Appendix
(Annexes 11)
Mouse TGF beta 1 ELISA Kit:
Enzyme-linked Immunosorbent Assay for quantitative detection of mouse TGF
beta 1. The mouse TGF beta 1 ELISA is an enzyme-linked immunosorbent assay
for the quantitative detection of mouse TGF beta 1. Transforming growth factor
beta (TGF beta) is a pleiotropic cytokine that exhibits a broad spectrum of
biological and regulatory effects on the cellular and organism level. It plays a
critical role in cellular growth, development, differentiation, proliferation,
extracellular matrix synthesis and degradation, control of mesenchymalepithelial
interactions during embryogenesis, immune modulation, apoptosis, cell cycle
progression, angiogenesis, adhesion and migration and leukocyte chemotaxis. It
has both tumor suppressive and tumor promoting activities and is highly regulated
at all levels.
TGF beta is the first recognized protein of at least 40 of the TGF beta
superfamily of structurally related cytokines. Three isoforms (TGF beta 1-3) have
been described in mammals. (Each isoform is encoded by a unique gene on
different chromosomes. All bind to the same receptors.) They are synthesized by
most cell types and tissues. Cells of the immune system mainly express TGF beta
1. The initially sequestered, inactive LTGF beta (latent TGF beta) requires
activation (cleavage and dissociation of its LAP (latency associated peptide)
region) before it can exert biological activity. LTGF beta can also be bound to LTB
(latent TGF beta binding protein) to form a large latent complex (LLC). TGF beta
forms homodimers, and its subunits of 12.5 kDa each are bound via disulphide
bridges. TGF beta signal transduction is mediated via the TGF beta receptors Type
II and I, phosphorylation and conformational changes.
Sample collection and storage instructions:
Cell culture supernatant, serum and plasma (EDTA, citrate) were tested with this
assay. Other biological samples might be suitable for use in the assay. Remove
serum or plasma from the clot or cells as soon as possible after clotting and
separation.
Preparation of reagents:
Buffer Concentrates should be brought to room temperature and should be
diluted before starting the test procedure. If crystals have formed in the Buffer
Concentrates, warm them gently until they have completely dissolved. Wash buffer
(1x) Pour entire contents (50 mL) of the Wash Buffer Concentrate (20x) into a
clean 1000 mL graduated cylinder. Bring to final volume of 1000 mL with glass-
distilled or deionized water. Mix gently to avoid foaming. Transfer to a clean wash
bottle and store at 2° to 25℃. Please note that Wash Buffer (1x) is stable for 30
days. Wash Buffer (1x) may also be prepared as needed Pour the entire contents (5
mL) of the Assay Buffer Concentrate (20x) into a clean 100 mL graduated
142
Appendix
cylinder. Bring to final volume of 100 mL with distilled water. Mix gently to avoid
foaming. Store at 2° to 8℃. Please note that the Assay Buffer (1x) is stable for 30
days. Assay Buffer (1x) may also be prepared as needed according to the following
table
Mouse TGF beta 1 standard:
1. Reconstitute mouse TGF beta 1 standard by addition of distilled water.
Reconstitution volume is stated on the label of the standard vial. Swirl or mix
gently to insure complete and homogeneous solubilization (concentration of
reconstituted standard = 4 ng/mL). Allow the standard to reconstitute for 10-30
minutes.
2. Mix well prior to making dilutions.
3. After usage remaining standard cannot be stored and has to be discarded.
4. Standard dilutions can be prepared directly on the microwell plate or
alternatively in tubes.
External standard dilution:
1. Label 7 tubes, one for each standard point: S1, S2, S3, S4, S5, S6, S7.
2. Prepare 1:2 serial dilutions for the standard curve as follows: Pipette 225 μL of
Assay Buffer (1x) into each tube.
3. Pipette 225 μL of diluted standard (concentration of standard = 4000 pg/mL)
into the first tube, labelled S1, and mix (concentration of standard 1 = 2 ng/mL).
4. Pipette 225 μL of this dilution into the second tube, labelled S2, and mix
thoroughly before the next transfer.
5. Repeat serial dilutions 5 more times thus creating the points of the standard
curve. Assay Buffer (1x) serves as blank.
Test protocol:
1. Prepare your serum and plasma samples before starting the test procedure.
Dilute serum and plasma samples with Assay Buffer (1x) according to the
following scheme: 20 μL sample + 920 μL Assay Buffer (1x) Add 30 μL 1N HCI
(see “Materials required but not provided“ on page 2) to 940 μL prediluted sample,
mix and incubate for 1 hour at room temperature. Neutralize by addition of 30 μL
1N NaOH
2). Vortex! Prepare your cell culture supernatant samples before starting the test
procedure. Dilute cell culture supernatant samples with Assay Buffer (1x)
according to the following scheme: 20 μL sample + 180 μL Assay Buffer (1x) Add
20 μL 1N HCI to 200 μL prediluted sample, mix and incubate for 1 hour at room
temperature. Neutralize by addition of 20 μL 1N NaOH.
2. Determine the number of microwell strips required to test the desired number of
samples plus appropriate number of wells needed for running blanks and standards.
Each sample, standard, blank and optional control sample should be assayed in
143
Appendix
duplicate. Remove extra microwell strips from holder and store in foil bag with the
desiccant provided at 2°-8℃ sealed tightly.
3. Wash the microwell strips twice with approximately 400 μL Wash Buffer per
well with thorough aspiration of microwell contents between washes. Allow the
Wash Buffer to sit in the wells for about 10 – 15 seconds before aspiration. Take
care not to scratch the surface of the microwells. After the last wash step, empty
wells and tap microwell strips on absorbent pad or paper towel to remove excess
Wash Buffer. Use the microwell strips immediately after washing. Alternatively
microwell strips can be placed upside down on a wet absorbent paper for not
longer than 15 minutes. Do not allow wells to dry.
4. Standard dilution on the microwell plate, Add 100 μL of Assay Buffer (1x) in
duplicate to all standard wells. Pipette 100 μL of prepared standard. Mix the
contents of wells A1 and A2 by repeated aspiration and ejection (concentration of
standard 1, S1 = 2000.0 pg/mL), and transfer 100 μL to wells B1 and B2,
respectively. Take care not to scratch the inner surface of the microwells. Continue
this procedure 5 times, creating two rows of mouse TGF beta 1 standard dilutions
ranging from 2000.0 to 31.3 pg/mL. Discard 100 μL of the contents from the last
microwells (G1, G2) used. In case of an external standard dilution, pipette 100 μL
of these standard dilutions (S1 - S7).
5. Add 100 μL of Assay Buffer (1x) in duplicate to the blank wells.
6. For serum and plasma samples add 80 μL of Assay Buffer (1x) to the sample
wells. For cell culture supernatant samples add 60 μL of Assay Buffer (1x) to the
sample wells. (It is absolutely necessary to vortex the samples!)
7. For serum and plasma samples add 20 μL of each pretreated sample in duplicate
to the sample wells. For cell culture supernatant samples add 40 μL of each
pretreated sample in duplicate to the sample wells. (It is absolutely necessary to
vortex the samples!)
8. Cover with an adhesive film and incubate at room temperature (18 to 25℃) for 2
hours, on a microplate shaker. (Shaking is absolutely necessary for an optimal test
performance.)
9. Prepare Biotin-Conjugate.
10. Remove adhesive film and empty wells. Wash microwell strips 5 times
according to 3 of the test protocol. Proceed immediately to the next step.
12. Cover with an adhesive film and incubate at room temperature (18 to 25℃) for
1 hour, on a microplate shaker. (Shaking is necessary for the test performance.)
13. Prepare Streptavidin-HRP (refer to Preparation of Streptavidin- HRP
“Streptavidin-HRP“ on page 3).
according to 3. of the test protocol. Proceed immediately to the next step.
15. Add 100 μL of diluted Streptavidin-HRP to all wells, including the blank wells.
144
Appendix
16. Cover with an adhesive film and incubate at room temperature (18° to 25℃)
for 30 minutes, on a microplate shaker. (Shaking is absolutely necessary for an
optimal test performance.)
according to 3 of the test protocol. Proceed immediately to the next step.
18. Pipette 100 μL of TMB Substrate Solution to all wells.
19. Incubate the microwell strips at room temperature (18° to 25℃) for about 30
min. Avoid direct exposure to intense light. The color development on the plate
should be monitored and the substrate reaction stopped before positive wells are no
longer properly recordable. Determination of the ideal time period for color
development has to be done individually for each assay. Adding the stop solution
when the highest standard has developed a dark blue color. Alternatively the color
development can be monitored by the ELISA reader at 620 nm. The substrate
reaction should be stopped as soon as Standard 1 has reached an OD of 0.9 – 0.95.
20. Stop the enzyme reaction by quickly pipetting 100 μL of Stop Solution into
each well. It is important that the Stop Solution is spread quickly and uniformly
throughout the microwells to completely inactivate the enzyme. Results must be
read immediately after the Stop Solution is added or within one hour if the
microwell strips are stored at 2 - 8℃ in the dark.
21. Read absorbance of each microwell on a spectrophotometer using 450 nm as
the primary wave length (optionally 620 nm as the reference wave length; 610 nm
to 650 nm is acceptable). Blank the plate reader according to the manufacturer's
instructions by using the blank wells. Determine the absorbance of both the
samples and the standards.
Calculation of results:
• Calculate the average absorbance values for each set of duplicate standards and
samples. Duplicates should be within 20 percent of the mean value.
• Create a standard curve by plotting the mean absorbance for each standard
concentration on the ordinate against the mouse TGF beta 1 concentration on the
abscissa. Draw a best fit curve through the points of the graph (a 5-parameter curve
fit is recommended).
• To determine the concentration of circulating mouse TGF beta 1 for each sample,
first find the mean absorbance value on the ordinate and extend a horizontal line to
the standard curve. At the point of intersection, extend a vertical line to the
abscissa and read the corresponding mouse TGF beta 1 concentration.
• If instructions in this protocol have been followed, serum and plasma samples
have been diluted 1:250 (20 μL sample + 920 μL Assay Buffer (1x) ( = 1:50) +
30μL 1N HCl + 30μL 1N NaOH and 20 μL pretreated sample + 80 μL Assay
Buffer (1x) ( = 1:5)) and cell culture supernatant samples have been diluted 1:30
(20 μL sample + 180 μL Assay Buffer (1x) + 20μL 1N HCl + 20μL 1N NaOH ( =
145
Appendix
1:12) and 40 μL pretreated sample + 60 μL Assay Buffer (1x) ( = 1:2.5)) and the
concentration read from the standard curve must be multiplied by the dilution
factor (x 250 or 30, respectively).
• Calculation of samples with a concentration exceeding standard 1 may result in
incorrect, low mouse TGF beta 1 levels. Such samples require further external
predilution according to expected mouse TGF beta 1 values with Assay Buffer (1x)
in order to precisely quantitate the actual mouse TGF beta 1 level.
• It is suggested that each testing facility establishes a control sample of known
mouse TGF beta 1 concentration and runs this additional control with each assay.
If the values obtained are not within the expected range of the control, the assay
results may be invalid.
• The curve cannot be used to derive test results. Each laboratory must prepare a
standard curve for each group of microwell strips assayed. Do not use this
standard curve to derive test results. A standard curve must be run for each group
of microwell strips assayed.
Mouse TGF beta 1 standard:

Reconstitute lyophilized mouse TGF beta 1 standard with distilled water.
(Reconstitution volume is stated on the label of the standard vial.).
Test protocol:
1. Pretreatement for serum and plasma samples: 20 μL sample + 920 μL Assay
Buffer (1x), add 30 μL 1N HCI to 940 μL prediluted sample, mix and incubate for
1 hour at room temperature, add 30 μL 1N NaOH; Vortex! Pretreatement for cell
culture supernatant samples: 20 μL sample + 180 μL Assay Buffer (1x), add 20 μL
1N HCI to 200 μL prediluted sample, mix and incubate for 1 hour at room
temperature, add 20 μL 1N NaOH; Vortex!
2. Determine the number of microwell strips required.
3. Wash microwell strips twice with Wash Buffer.
4. Standard dilution on the microwell plate: Add 100 μL Assay Buffer (1x), in
duplicate, to all standard wells. Pipette 100 μL prepared standard into the first
wells and create standard dilutions by transferring 100 μL from well to well.
Discard 100 μL from the last wells. Alternatively external standard dilution in
tubes, Pipette 100 μL of these standard dilutions in the microwell strips.
5. Add 100 μL Assay Buffer (1x), in duplicate, to the blank wells.
6. Add 80 μL (serum and plasma samples) or 60 μL (cell culture supernatant
samples) Assay Buffer (1x) to sample wells
7. Add 20 μL (serum or plasma sample) or 40 μL (cell culture supernatant sample)
in duplicate, to designated sample wells.
8. Cover microwell strips and incubate 2 hours at room temperature (Shaking is
necessary for an optimal test performance.)
146
Appendix
9. Prepare Biotin-Conjugate.
10. Empty and wash microwell strips 5 times with Wash Buffer.
11. Add 100 μL Biotin-Conjugate to all wells.
12. Cover microwell strips and incubate 1 hours at room temperature. (Shaking is
necessary for an optimal test performance.)
13. Prepare Streptavidin-HRP.
15. Add 100 μL diluted Streptavidin-HRP to all wells.
16. Cover microwell strips and incubate 30 minutes at room temperature. (Shaking
is necessary for an optimal test performance.)
18. Add 100 μL of TMB Substrate Solution to all wells.
19. Incubate the microwell strips for about 30 minutes at room temperature
20. Add 100 μL Stop Solution to all wells.
21. Blank microwell reader and measure color intensity at 450 nm.
147
Appendix
(Annexes 12)
Mouse VEGF Immunoassay:
Quantikine™ ELISA, This package insert must be read in its entirety before
using this product for research use only. Not for use in diagnostic procedures, for
the quantitative determination of mouse VEGF concentrations in cell culture
supernates, tissue homogenates, serum, and plasma. Vascular endothelial growth
factor is a potent mediator of both angiogenesis and vasculogenesis in the fetus and
in adults. It is a member of the PDGF family that is characterized by the presence
of eight conserved cysteine residues in a cysteine knot structure and the formation
of anti-parallel disulfide-linked dimers. Alternately spliced isoforms of 120, 164
and 188 amino acids have been found in mice, while 121, 145, 165, 183, 189, and
206 aa isoforms have been identified in humans. In humans, VEGF165 appears to
be the most abundant and potent isoform, followed by VEGF121 and VEGF189.
The same pattern may exist in mice. Isoforms other than VEGF120 and VEGF121
contain basic heparin-binding regions and are not freely diffusible. Mouse
VEGF164 shares 97% aa sequence identity with corresponding regions of rat
VEGF. It also shares 89% aa sequence identity with human and porcine VEGF,
88% with bovine VEGF, and 90% with feline, equine, and canine VEGF. VEGF is
expressed in multiple cells and tissues including skeletal and cardiac muscle,
hepatocytes, osteoblasts, neutrophils, macrophages, keratinocytes, brown adipose
tissue, CD34+ stem cells, endothelial cells, fibroblasts, and vascular smooth
muscle cells. Circulating VEGF levels correlate with disease activity in
autoimmune diseases such as rheumatoid arthritis, multiple sclerosis, and systemic
lupus erythematosus. The Quantikine™ Mouse VEGF Immunoassay is a 4.5 hour
solid phase ELISA designed to measure mouse VEGF in cell culture supernates,
tissue homogenates, mouse serum, and plasma. It contains Sf 21-expressed mouse
VEGF and antibodies raised against the recombinant factor. This immunoassay has
been shown to quantitate the recombinant mouse VEGF accurately. Results
obtained using natural mouse VEGF showed dose-response curves that were
parallel to the standard curves obtained using the recombinant Quantikine kit
standards. These results indicate that this kit can be used to determine relative mass
values for natural mouse VEGF.
PRINCIPLE OF THE ASSAY:
This assay employs the quantitative sandwich enzyme immunoassay technique.
A polyclonal antibody specific for mouse VEGF has been pre-coated onto a
microplate. Standards, control, and samples are pipetted into the wells and any
VEGF present is bound by the immobilized antibody. After washing away any
unbound substances, an enzyme-linked polyclonal antibody specific for mouse
VEGF is added to the wells. Following a wash to remove any unbound antibody-
enzyme reagent, a substrate solution is added to the wells. The enzyme reaction
148
Appendix
yields a blue product that turns yellow when the Stop Solution is added. The
intensity of the color measured is in proportion to the amount of VEGF bound in
the initial step. The sample values are then read off the standard curve.
PHARMPAK CONTENTS:
Each PharmPak contains reagents sufficient for the assay of 50 microplates (96
wells/plate). The package inserts supplied are the same as those supplied in the
single kit packs and because of this, a few minor differences related to the number
of reagents and their container sizes should be noted.
• Sufficient material is supplied to perform at least 50 standard curves; reuse of
each vial may be required. The number of vials, and the number of standard curves
obtained per vial will vary with the analyte.
• Wash Buffer 25X Concentrate is bulk packed in 125 mL bottles containing 100
mL.
SAMPLE COLLECTION:
The sample collection and storage conditions listed below are intended as
general guidelines. Sample stability has not been evaluated. Cell Culture
Supernates - Remove particulates by centrifugation and assay immediately or
aliquot and store samples at ≤ -20 °C. Avoid repeated freeze-thaw cycles. Tissue
Homogenates - The preparation of tissue homogenates will vary depending upon
the tissue type. For this assay, heart, kidney, and spleen tissue from three mice and
lung tissue from eight mice were rinsed with 1X PBS to remove excess blood,
homogenized in 20 mL of 1X PBS, and stored overnight at ≤ -20 °C. After two
freeze-thaw cycles were performed to break the cell membranes, the homogenates
were centrifuged for 5 minutes at 5000 x g. Samples can be assayed immediately
or stored at ≤ -20 °C. Avoid repeated freeze-thaw cycles.
Serum - Allow blood samples to clot for 2 hours at room temperature before
centrifuging for 20 minutes at 2000 x g. Remove serum and assay immediately or
aliquot and store samples at ≤ -20 °C. Avoid repeated freeze-thaw cycles.
Plasma - Collect plasma using EDTA or heparin as an anticoagulant. Centrifuge
for 20 minutes at 2000 x g within 30 minutes of collection, assay immediately or
aliquot and store samples at ≤ -20 °C. Avoid repeated freeze-thaw cycles.
SAMPLE PREPARATION:
Use polypropylene tubes. Serum and plasma samples require a 5-fold dilution
into Calibrator Diluent RD5T. A suggested 5-fold dilution is 50 μL of sample +
200 μL of Calibrator Diluent RD5T. Cell culture supernates and tissue
homogenates may require dilution. The dilution factor is dependent upon sample
values.
REAGENT PREPARATION:
Bring all reagents to room temperature before use. Mouse VEGF Control -
Reconstitute the control with 1.0 mL deionized or distilled water. Mix thoroughly.
149
Appendix
Assay the control undiluted. Wash Buffer - If crystals have formed in the
concentrate, warm to room temperature and mix gently until the crystals have
completely dissolved. To prepare enough Wash Buffer for one plate, add 20 mL of
Wash Buffer Concentrate to (480) mL of deionized or distilled water to prepare
500 mL of Wash Buffer. Substrate Solution - Color Reagents A and B should be
mixed together in equal volumes within 15 minutes of use. Protect from light. 100
μL of the resultant mixture is required per well.
Mouse VEGF Standard - Refer to the vial label for reconstitution volume.
Reconstitute the Mouse VEGF Standard with Calibrator Diluent RD5T. Do not
substitute other diluents. This reconstitution produces a stock solution of (500)
pg/mL. Allow the stock solution to sit for a minimum of 5 minutes with gentle
mixing prior to making dilutions. Use polypropylene tubes. Pipette 200 μL of
Calibrator Diluent RD5T into each tube. Use the stock solution to produce a
dilution series (below). Mix each tube thoroughly before the next transfer. The
undiluted Mouse VEGF Standard (500 pg/mL) serves as the high standard.
Calibrator Diluent RD5T serves as the zero standards (0 pg/mL).
ASSAY PROCEDURE:
Bring all reagents and samples to room temperature before use. It is
recommended that all standards, control, and samples be assayed in duplicate.
1. Prepare all reagents, working standards, control, and samples as directed in the
previous sections.
2. Remove excess microplate strips from the plate frame, return them to the foil
pouch containing the desiccant pack, and reseal.
3. Add 50 μL of Assay Diluent RD1N to each well.
4. Add 50 μL of standard, control, or sample to each well. Mix by gently tapping
the plate frame for 1 minute. Cover with the adhesive strip provided. Incubate for 2
hours at room temperature. A plate layout is provided to record standards and
samples assayed.
150
Appendix
5. Aspirate each well and wash, repeating the process four times for a total of five
washes. Wash by filling each well with Wash Buffer (400 μL) using a squirt bottle,
manifold dispenser, or auto washer. Complete removal of liquid at each step is
essential to good performance. After the last wash, remove any remaining Wash
Buffer by aspirating or decanting. Invert the plate and blot it against clean paper
towels.
6. Add 100 μL of Mouse VEGF Conjugate to each well. Cover with a new
adhesive strip. Incubate for 2 hours at room temperature.
7. Repeat the aspiration/wash as in step 5.
8. Add 100 μL of Substrate Solution to each well. Incubate for 30 minutes at room
temperature. Protect from light.
9. Add 100 μL of Stop Solution to each well. Gently tap the plate to ensure
thorough mixing.
10. Determine the optical density of each well within 30 minutes, using a
microplate reader set to 450 nm. If wavelength correction is available, set to 540
nm or 570 nm. If wavelength correction is not available, subtract readings at 540
nm or 570 nm from the readings at 450 nm. This subtraction will correct for optical
imperfections in the plate. Readings made directly at 450 nm without correction
may be higher and less accurate.
CALCULATION OF RESULTS:
Average the duplicate readings for each standard, control, and sample and
subtract the average zero standard optical density (O.D.). Create a standard curve
by reducing the data using computer software capable of generating a four
parameter logistic (4-PL) curve-fit. As an alternative, construct a standard curve by
plotting the mean absorbance for each standard on the y-axis against the
concentration on the x-axis and draw a best fit curve through the points on the
graph. The data may be linearized by plotting the log of the mouse VEGF
concentrations versus the log of the O.D. and the best fit line can be determined by
regression analysis. This procedure will produce an adequate but less precise fit of
the data. If samples have been diluted the concentration must be read from the
standard curve multiplied by the dilution factor.
This standard curve is provided for demonstration only. A standard curve
should be generated for each set of samples assayed.
151
Appendix
SENSITIVITY:
The minimum detectable dose (MDD) of mouse VEGF is typically less than
(3.0) pg/mL. The MDD was determined by adding two standard deviations to the
mean O.D. value of twenty-zero standard replicates and calculating the
corresponding concentration.
LINEARITY:
To assess the linearity of the assay, samples containing and/or spiked with
various concentrations of mouse VEGF in each matrix were diluted with calibrator
diluent and then assayed.
SAMPLE VALUES:
Serum/Plasma - Forty individual mouse serum samples and nine individual
mouse plasma samples were evaluated for detectable levels of mouse VEGF in this
assay. All samples measured less than the lowest mouse VEGF standard, (7.8)
pg/mL. Tissue Homogenates - Tissue homogenates from mouse heart, lung,
kidney, and spleen tissue were assayed for mouse VEGF and measured (111)
pg/mL, 3680 pg/mL, 157 pg/mL, and 30 pg/mL, respectively.
Cell Culture Supernates:
152
Appendix
P388D1 mouse lymphoma cells (1 x 105) cells/mL were cultured for four days
in RPMI supplemented with 5% fetal bovine serum. The cell culture supernate was
assayed for mouse VEGF and measured 7600 pg/mL. Mouse lung conditioned
media (1 lung, 1-2 mm pieces in 10 mL of RPMI supplemented with 10% fetal
bovine serum) was collected after culturing for 5 days. The cell culture supernate
was assayed for mouse VEGF and measured 4660 pg/mL. Mouse heart
conditioned media (1 heart, 1-2 mm pieces in 10 mL of RPMI supplemented with
10% fetal bovine serum) was collected after culturing for 5 days. The cell culture
supernate was assayed for mouse VEGF and measured (378) pg/mL.
SPECIFICITY:
This assay recognizes both the 164 and 120 amino acid residue forms of mouse
VEGF. The factors listed below were prepared at 50 ng/mL in calibrator diluent
and assayed for cross-reactivity. Preparations of the following factors prepared at
50 ng/mL in a mid-range mouse VEGF control were assayed for interference. No
significant cross-reactivity or interference was observed.
153
The published
Papers
Cellular and Molecular Biology
E-ISSN : 1165-158X / P-ISSN : 0145-5680
www.cellmolbiol.org
Immunomodulatory effects of bone marrow-derived Mesenchymal stem cells in a BALB/c
mouse model on induced Systemic lupus erythematosus (SLE)
Ghassan Khudhair Esmael1,2*, Tarek Rebai3, Khalil Gazar Chelab Al-Nailey4
1
Department of Life Sciences, Faculty of Sciences-Sfax, University of Sfax, Tunisia
2
University of Al-Qadisiyah, veterinary medicine college – Iraq
3
Laboratory Histo-embryology and Cytogenetics, Faculty of Medicine of Sfax, University of Sfax, Tunisia
4
University of Al-Qadisiyah, veterinary medicine college – Iraq
ARTICLE INFO ABSTRACT

Original paper Systemic lupus erythematosus (SLE) is an autoimmune inflammatory disease that causes acute inflamma-
tion in most body tissues. The current study aims to determine levels of some cytokines and chemokines in
Article history: BALB/c mice with SLE and treatment by using BALB/c Mesenchymal stem cells (BM-MSCs). Forty BALB/c
Received: November 12, 2022 male mice were divided into four groups equally. The first and second groups received activated lymphocyte-
Accepted: January 12, 2023 derived DNA (ALD DNA) for induction of SLE. The second group received BM-MSCs/IV after the appea-
Published: January 31, 2023 rance of SLE clinical signs. The third group received BM-MSCs only, while the fourth group (control group)
received PBS. All the study groups examine levels of IL-10, IL-6, TGFβ1, VEGF, CCL-2, CCL-5/RANTES,
Keywords: IFNγ, and ICAM -1 by ELISA kits. The cytokines levels are determined in all the study groups. There was a
significant increase in ANA and anti-dsDNA levels in the first group, while there was a decrease in the second
SLE, BM-MSCs, BALB/c mice, group (treatment by BM-MSCs). There is no significant difference between the third and control groups in
cytokines ANA and anti-dsDNA levels. The first group showed a significant increase in IL-6, CCL-5/RANTES, VEGF,
ICAM, CCL-2, and IFNγ levels and a decrease in IL-10 and TGFβ1. The second group showed low levels
of IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2/MCP-1, and IFNγ but a high level of IL-10 and TGFβ1 as
compared with the control group. The third group has no significant differences from the control group in all
the tested parameters. BM-MSCs have an essential therapeutic role in the functional regulation of cytokines
and chemokines in mice with SLE.
Doi: http://dx.doi.org/10.14715/cmb/2022.69.1.4 Copyright: © 2023 by the C.M.B. Association. All rights reserved.
Introduction phenotypic markers and differentiate into several kinds of

cells. Also, MSCs have immunomodulatory functions; by
Lupus is a long-term autoimmune disease; its causes secreting some of the bio compounds based on cell-to-cell
are unknown. Humans and animals could be affected. contacts, the secretion of cytokines is the main function
Lupus occurs if the immune response is hyperactive and of MSCs (5). The data about the relationship between the
attacks the tissues (lungs, brain, heart, skin, joints, blood secreted cytokines and MSCs in lupus is minor and should
cells, and kidneys) and the antibodies (1). The conven- focus on level changes of cytokines after treatment by
tional treatment of SLE is included immunosuppressive MSC (6). The action mechanisms of MSCs are unknown,
drugs, which inhibit the immune system activity, such as but they influence directly and indirectly on immune cells.
antimalarial drugs (Hydroxychloroquine), corticosteroids SLE is autoimmune and shows a disorder in immunologi-
(prednisone), Immunosuppressant (azathioprine), and cal response. Therefore, there is an urgent need for a new
Biologics (belimumab) (2). These drugs have some disad- treatment method to induce immunosuppression without
vantages, particularly when used for a long time, such as adverse side effects (7) (8). The present review focuses on
stomach bleeding, kidney problems, damage to the eye the essential cytokines levels that changed after treatment
retina, decreased weight, diabetes, high blood pressure, by MSCs and their effect on autoimmune bodies in the
thinning bones, infection, cancer, hepatic tissue damage, mice serum.
and infertility. Furthermore, some cases do not respond to
the therapy, and others show allergic clinical signs (3). If Materials and Methods
it becomes feasible to find an alternative, modern and safe
way to treat SLE, especially in light of the spread of this The experimental animals
disease worldwide, in humans and animals alike. Some Forty BALB/c albino males mice at 6 weeks old with
studies have used alternative methods to treat this disease 20-30 grams were provided by (Jackson Laboratory, USA)
in newer ways, including using Mesenchymal stem cells. and housed together under the same conditions. BALB/c
Mesenchymal stem cells are undifferentiated cells (4). mice are used in immunological experiments (9).
When cultured in specific inducing media, it could express
* Corresponding author. Email: ghassan.khudhair@qu.edu.iq

Cellular and Molecular Biology, 2023, 69(1): 19-24
19
Ghassan Khudhair Esmael et al. / Effects of bone marrow-derived Mesenchymal stem cells, 2023, 69(1): 19-24
The study design Source, USA) and ELISA kit anti-double strand DNA
forty BALB/c mice; divided into four groups, each (Anti-dsDNA) (MyBioSource, USA) is used for the detec-
group consisting of ten mice; the first group is adminis- tion of antibodies levels in animals in all the study groups,
trated (ALD DNA) (50 μg/mouse/SC) in three doses at (0, before and after treatment by BM-MSCs and PBS, accor-
14, 28) days to induce SLE in BALB/c mice. The second ding to company directions.
group is administrated (ALD-DNA) (50 μg/mouse/SC),
three doses at (0, 14, 28) days for inducing SLE; after The BALB/c BM-MSCs preparation
onset, the clinical signs of lupus (after 28 days), also, BALB/c- BMMSCs are provided by (Cell biologics
ANA, and anti-dsDNA are examined for final diagnosis Company, USA) from the bone marrow of pathogen-free.
of SLE. Positive lupus in the second group is treated by BALB/c-MSCs could be used in immunosuppressive
BALB/c-MSCs (CellBiologics company, USA) (0.1×106) trials. The cells are thawing water bath (37°C) for (60) se-
cells/for 10g/IV. The third group is administrated BALB/ conds until the disappearance of the ice bit. The provided
c-MSCs (0.1×106) cells/for 10g/IV. The fourth group cells were put in a centrifuge tube with a culture Medium
(control group) administrated BPs only. (8-10) ml for five minutes at 120 rpm. Remove the super-
natant layer then put the cell in a culture Medium (6) ml.
Induction of SLE Add suspended cells into a flask, place the T25 flask in a
After receiving the shipped mice, some of the shipped humidified CO2 (5%), then incubate at (37°C). The media
mice out of the experimental animals (five mice) were are changed daily (for four days) to remove non-adherent
used for the preparation of activated lymphocyte DNA cells and spread the nutrient elements.
(ALD DNA) for induction lupus in mice according to (10),
as following steps: Administration of BALB/c- BM- MSCs
-Preparation of splenocyte The 2nd and 3rd group received BALB/c- BM-MSCs at
removing the BALB/c mice spleens and kept in RPMI- dose (0.1×106) Cells (IV) through the tail vein to decrease
1640 (Gibco, Ireland), then passing the cells several times and prevent the trapping in the lung.
on nylon mesh, then washing by RPMI-1640 then, Add
fetal bovine serum (Gibco, Ireland) (10%) with Mgluta- The used ELISA kits
mine 2m (Sigma, USA), penicillin G and streptomycin The tested cytokines in the study are IL-10, IL-6, CCL-
(100) mg/ml each one to prevent the contamination. Then, 2, TGFβ1, IFNγ, CCL-5, ICAM, and VEGF using ELISA
splenocytes were diluted to (2×106) cells/ml with concana- kits to the company directions as shown in table (1).
valin A (5 ug/ml) for 48 hours (ConA can stimulate mouse
T-cells for giving rise to many folds (11) (12). Statistical Analysis
-DNA extraction: gDNA extracted activated spleno- The results were analyzed by a one-way ANOVA
cytes were treated with proteinase K (Sigma, USA) and and two-way ANOVA tests using SPSS, V27; the USA).
S1 nuclease (TaKaRa, Japan) and then purified by kit (Ge- LSD test was used to determine the significant difference
netech, China). The nanodrop (Thermo Fisher Scientific, between the groups at the significant level (P≥0.05) (13).
USA) is used at (260) nm for determining DNA concen-
trations. Results
-The immunization: the mice were classified into four
groups. Each one consists of ten mice (G1, G2, G3, G4). 1st ANA and Anti dsDNA levels
and 2nd groups were only immunized with activated ALD Our findings showed that the Anti-dsDNA levels be-
DNA (0.2) ml/ SC with PBS and (CFA) (Sigma, USA), fore treatment were (16.98±0.83) ng/ml, (17.29±0.77) ng/
at three doses of ALD DNA, the period between one and ml, (3.10±3.10) ng/ml, and (3.06±5.01) ng/ml. In contrast,
another was two weeks, at (0, 14, 28) day. Before the third Anti-dsDNA levels after treatment were (16.8±0.90) ng/
dose, the animals showed clinical signs of SLE syndrome ml, (2.45±0.52) ng/ml, (3.00±0.30) ng/ml, and (2.98±0.28)
(nose bleeding). ng/ml in the study groups respectively, wherever does not
show significant differences except for the 2nd group which
ANA and anti-dsDNA Examination showed significant differences between before and after
ELISA kit antinuclear antibodies (ANA) (MyBio- treatment by BM-MSCs at (P<0.05).
Table 1. The used ELISA kits in the study.

The ELISA kit The company Origen
Interleukin-10 (IL-10) Abcam™ UK
Interleukin-6 (IL-6) Invitrogen™ USA
Transforming growth factor β (TGFβ1) Invitrogen™ USA
chemokine ligand Monocyte chemotactic protein-1 (CCL-2/MCP-1) Invitrogen™ USA
C-C motif ligand 5 (CCL-5/RANTES) Abcam™ UK
Vascular endothelial growth factor (VEGF) Quantikine™ USA
Intercellular adhesion molecule -1 (ICAM -1) Invitrogen™ USA
Interferon gamma (IFNγ) abcamTM USA
Mouse Anti-nuclear antibody (ANA) MyBioSourceTM USA
Anti -double-stranded DNA (anti -dsDNA) MyBioSourceTM USA
20
Table 2. level of ANA and Anti dsDNA in serum before and after treatment by BM-MSCs.
Anti dsDNA ng/ml ANA ng/ml
Before treatment by After treatment by Before treatment by After treatment by
BM-MSCs BM-MSCs BM-MSCs BM-MSCs
G1 16.98 ±0.83Aa 16.8±0.90Aa 18.15±1.45Aa 18.07±1.09Aa
G2 17.29 ±0.77Aa 2.45 ±0.52Bb 17.55±0.83Aa 2.71±0.61Bb
G3 3.10±3.10Ba 3.00±0.30Bb 3.70±4.1Ba 3.22±0.64Bb
G4 3.06±5.01Ba
2.98±0.28Bb 3.63±4.87 Ba
3.30±0.75Bb
0.584 0.861
Our findings showed that ANA levels before treat-

ment were (18.15±1.45) ng/ml, (17.55±0.83) ng/ml,
(3.70±4.1) ng/ml, and (3.63±4.87) ng/ml in the first, se-
cond, third, fourth group. The ANA levels after treatment
were (18.07±1.09) ng/ml, (2.71±0.61) ng/ml, (3.22±0.64)
ng/ml, and (3.3±0.75) ng/ml in the first, second, third, and
fourth group respectively. It does not show significant
differences except for the 2nd group, which showed signi-
ficant differences between before and after treatment by
BM-MSCs at (P<0.05), as a table (2). Figure 2. Concentration of IL-6 in study groups.
The cytokine levels

According to figure (1), the first group showed de-
crease significant differences in IL-10 levels (7.18±0.47)
ng/ml as compared with the second group (29.1±1.1) ng/
ml, the third group (32.09±2.89), and the fourth group
(32.14±3.54) ng/ml. In contrast, the fourth group showed
a higher level of IL-10 as compared with the study groups.
According to figure (2), the first group showed an in-
crease significant (360.89±4.48) ng/ml of IL-6 levels as
compared with the second group (201.14±5.55) ng/ml, Figure 3. Concentration of TGF-β1 in study groups.
the third group (190.89±3.7c) ng/ml, and the fourth group
(191.37±3.26).
According to figure (3), levels of TGF-β1 were
(2354.2±341.7 ng/ml, (8222.54±570.3) ng/ml,
(8225.6±390.1) ng/ml, and (8250.8±384.8) ng/ml in the
first, second, third, and fourth group respectively. The
first group showed a decrease significant in TGF-β1 le-
vels compared with the second, third, and fourth groups.
However, there are no significant differences between the
second, third, and fourth groups in the TGF-β1 level.
According to figure (4), the first group showed an in- Figure 4. Concentration of CCL-2/MCP-1 in study groups.
crease in significant differences (162.98±11.48) ng/ml of
CCL-2/MCP-1 levels as compared with the second group
(52.09±6.15) ng/ml, the third group (48.1±10.2) ng/ml,
and the fourth group (49.4±9.75) ng/ml. There are no si-
gnificant differences between the second, third, and fourth
groups.
The 1st group showed an increase in significant dif-
ferences in CCL-5/RANTES level (41.74±4.9) ng/ml as
compared with the 2nd group (7.37±1.45) ng/ml, the 3rd
Figure 5. Concentration of CCL-5 in study groups.
(7.68±1.47) ng/ml, and the 4th group (7.61±1.51) ng/ml.

There are no significant differences among the 2nd, 3rd, and
4th groups, as shown in figure (5).
According to figure (6), the 1st group showed increasing
significant differences (41.84±2.89) ng/ml of VEGF-A le-
vels as compared with the 2nd group (11.03±3.30) ng/ml,
the 3rd group (9.63±2.97) ng/ml, the 4th group (9.72±3.46)
Figure 1. Concentration of IL-10 in study groups. ng/ml. At the same time, there are no significant diffe-
21
Figure 6. Concentration of VEGF-A in study groups.

Figure 7. Concentration of ICAM-1 in study groups.
rences among all the study groups.

According to figure (7), the 1st group showed increased
significant differences (302.9±28.31) ng/ml of ICAM-1
level as compared with the 2nd group (226.8±11.69) ng/
ml, the 3rd group (225.3±6.26) ng/ml, and the 4th group
(225.1±8.33) ng/ml, while there are no significant diffe-
rences among the 2nd, the 3rd, the 4th group.
According to figure (8), the 1st group showed increased
significant differences (64.85±4.10) ng/ml in IFN-γ levels
Figure 8. Concentration of IFN-γ in study groups.
as compared with the 2nd (14.12±2.10) ng/ml, the 3rd group
(30.21±2.33) ng/ml, and the 4th group (30.37±2.85) ng/
ml, while the 3rd and the 4th group were showed increased MSC could produce and help to secret the exosomes, the
significant differences as compared with the 2nd group. cytokines, and the chemokines that directly regulate and
control the immune response; furthermore, MSC can be
Discussion balanced between th17 cells and Treg cells (25).
Our results showed that TGF-β1 levels were decreased
Lupus is an immune and inflammatory disorder in most in the first group (induced lupus) compared to the control
body tissues due to disorders in the levels and function group, but they come back to their normal level after treat-
of the cytokines (14). High expression of th17 cells and ment by MSC (the second group).
down-regulation of Treg cells occur in patients with lupus TGF-β1 is a cytokine that has a vital play in the pa-
due to high levels of autoantibodies, which leads to com- thogenesis of lupus diseases. The patients with lupus
plications and death (15). The autoantibodies are causing a showed a significantly lower level of TGF-β1 compared
dramatic series of clinical findings of SLE (16). to the control group. The lowest levels of TGFβ1 attribu-
MSCs are used in treating autoimmune diseases be- ted to low activity and low numbers of Treg cells in lu-
cause they regulate immunological responses (17). Moreo- pus cases. A low level of TGFβ1 is associated with lupus
ver, MSCs have immunomudualry effects (18). Lupus is nephritis in humans and animals. As lupus nephritis shows
included immune disorder and the absence of immune a lower level of TGFβ1, it will indicate more kidney tissue
regulation (19). damage (26).
Our findings showed that anti-dsDNA levels decreased The reports demonstrated that TGF-β1 has anti-inflam-
after administration of BM-MSCs in the second group and matory effects and showed low concentration in lupus due
showed significant negative differences compared with to less activity of Treg cells that secreted it, which reveals
other groups after treatment. The second group showed agreement with our findings (27).
significant positive differences in ANA levels before the IL-6, CCL-2/MCP-1, CCL-5/RANTES, VEGF-A,
BM-MSCs administration as compared to after treatment ICAM-1, and IFN-γ levels showed a significant increase in
by MSCs. The second group showed normal values of the first group (lupus group) compared with other groups
ANA after the administration of BM-MSCs close to the based on our study. All mentioned cytokines are pro-in-
values in the control group. flammatory cytokines produced by th17 cells. Undoub-
The anti-dsDNA and ANA are antibodies produced by tedly, SLE is an acute autoimmune condition that includes
the lymphocytes against self-DNA due to poor identifica- high pro-inflammatory cytokines and autoantibodies (28).
tion of the exact antigenic components (20). Anti-dsDNA SLE is an autoimmune disease that includes cytokine
and ANA antibodies are increased in lupus, according to imbalances, triggers inflammation, immune cell dysfunc-
many reports (21), as found and agree with our results. tion, and cytokine storm. The primer cytokine of the SLE
Our findings showed that the IL-10 level decreased in pathogenesis is interferon-alpha, which is stimuli by im-
the first group compared with the control group. IL-10 le- mune compounds that increase some inflammatory pro-
vel was a comeback to the normal level in the second (after teins (29) (30).
treatment), with slightly significant differences between SLE is a disease that includes dysregulation of the cy-
both groups. tokine and chemokines levels with its receptors expressed
IL-10 has anti-inflammatory effects, produced at low against the target antigens and organs. Interferons play the
levels in lupus cases compared with healthy individuals main role in SLE and can activate rest cytokines. Inter-
(22), suppressed by many immunobiological factors secre- ferons are keys to controlling and treating lupus, such as
ted in lupus involvement (23). The treated group by MSC TNF-α used for rheumatoid arthritis (31). Absent coordi-
(the second group) showed an increase in IL-10 cytokine nation between the cytokine is important to development
levels as compared with the first group due to MSC effects of the active lupus. IL-17 is produced by th17 cells, which
that are unknown yet (24). Some reports indicated that act as pro-inflammatory cytokines that play a role in lupus
22
development and loss of tolerance (32). 615–635. https://doi.org/10.1016/j.molmed.2017.05.006

IL-6, CCL-2/MCP-1, CCL-5/RANTES, VEGF-A, 2. Ruiz-Irastorza, G, & Bertsias, G. Treating systemic lupus erythe-
ICAM-1, and IFN-γ levels decreased in the 2nd group matosus in the 21st century: new drugs and new perspectives on
(treated group by MSC) compared with the first group, and old drugs. Rheumatology, 2020 Dec; 59 (Supplment5), v69–v81.
there are no significant differences between the third group https://doi.org/10.1093/rheumatology/keaa403
and fourth group based on our findings. 3. Al-Saadoon M. Adverse Effects of Medicines: Is the Omani popu-
Nowadays, MSC is considered therapy for SLE to im- lation safe?. Sultan Qaboos Univ. Med. J., 2015 May; 15(2), e149–
prove the clinical signs of the SLE by inhibiting the acti- e151. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4450774/
vity of Th1, Th17, and B cells and increasing the activity 4. Pittenger, MF, Discher, DE, Péault, BM, Phinney, DG, Hare, JM,
of Th2 and Treg cells. Treatment by MSC has benefits & Caplan, AI Mesenchymal stem cell perspective: cell biology to
for enhancing the immunosuppression in lupus, although clinical progress. NPJ Regen. med., 2019 Dec; 4, 22. https://doi.
MSC therapy is reported ineffective in some studies, and org/10.1038/s41536-019-0083-6
that attributed to some patients with lupus do not respond 5. Kyurkchiev, D, Bochev, I, Ivanova-Todorova, E, Mourdjeva, M,
to the therapy due to strange sources of MSC or patient-re- Oreshkova, T, Belemezova, K, & Kyurkchiev, S. Secretion of
lated factors or patients haven't able to respond to cellular immunoregulatory cytokines by mesenchymal stem cells. World
immunological stimulation by treatment by MSC (33). J. Stem Cells, 2014 Nov; 6(5), 552–570. https://doi.org/10.4252/
MSC plays a role in regulating SLE immunity (34). wjsc.v6.i5.552
MSCs have immunosuppressive effects on the hyperactivi- 6. Park, CW, Kim, KS, Bae, S, Son, HK, Myung, PK, Hong, HJ, &
ties of immunological reactions. Administration of MSCs Kim, H. Cytokine secretion profiling of human mesenchymal stem
IV will ameliorate the clinical signs of lupus. Allogeneic cells by antibody array. Int. J. Stem Cells, 2009 May; 2(1), 59–68.
MSCs suppress autoimmunity in mice and humans (35). https://doi.org/10.15283/ijsc.2009.2.1.59
Treatment by MSC for animals with SLE decreased au- 7. De Miguel MP, Fuentes-Julián S, Blázquez-Martínez A, Pas-
toimmune bodies such as ds-DNA and ANA (36). MSCs cual CY, Aller MA, Arias J, Arnalich-Montiel F. Immunosup-
used to treat lupus in drug-resistant cases, such as corti- pressive properties of mesenchymal stem cells: advances and
sone and corticosteroid drugs used normally to treat lupus applications. Curr. Mol. Med. 2012 Jun; 12(5):574-91. https://
(37). The meta-analysis studies assessing MSCs showed doi:10.2174/156652412800619950
that MSCs are a new treatment for SLE without side ef- 8. Liu, S, Liu, F, Zhou, Y, Jin, B, Sun, Q, & Guo, S. Immunosup-
fects in humans and lab animals (38). pressive Property of MSCs Mediated by Cell Surface Receptors.
MSC secrete immunomodulatory factors that restore Front. Immunol., 2020 Jul; 11, 1076. https://doi.org/10.3389/fim-
immune balance and produce good results in treating SLE. mu.2020.01076
MSCs do not express major histocompatibility complex II 9. Jax Mice Data Sheet BALB/cByJ. Jax Mice Data Sheet. Jackson
(MHC II). Therefore, it is less rejected after MSC trans- Laboratory. Archived from the original. 2006; https://www.jax.
plantation. MSCs have no immunomodulatory effects org/strain/000651
only, but they have great ability in regenerative medicine 10. Qiao B, Wu J, Chu YW, Wang Y, Wang DP, Wu HS, Xiong SD.
due to their ability to differentiate into several types of Induction of systemic lupus erythematosus-like syndrome in
cells (39). syngeneic mice by immunization with activated lymphocyte-de-
The third group does not have significant differences rived DNA. Rheumatology. 2005 Sup; 44(9):1108-14. https://
compared with the control group. We establish the third doi:10.1093/rheumatology/keh656
group to confirm that MSCs do not cause a cross-immu- 11. Dwyer JM, Johnson C. The use of concanavalin A to study the
nological reaction such as histological and immunological immunoregulation of human T cells. Clin. Exp. Immunol. 1981
mismatching. It supports that MSC only has an essential Nov; 46 (2): 237–49. https://www.ncbi.nlm.nih.gov/pmc/articles/
role in lupus cases and has no role in healthy animals. PMC1536405
In the end, we can conclude that BM-MSCs can regu- 12. Schiefer HG, Krauss H, Brunner H, Gerhardt U. Ultrastructural
late and maintenance of cytokines and chemokines in mice visualization of surface carbohydrate structures on mycoplasma
with lupus. BM-MSCs could use for the treatment of lupus membranes by concanavalin A. J. Bacteriol. 1975 Dec; 124 (3):
in mice. 1598–600. http://doi:10.1128/JB.124.3.1598-1600.1975
13. Schiefer, W.C. Statistics for the biological sciences; 2nd ed. Addi-
Funding Sources son. Wesley pub comp, California, London, 1980.
there is no fund 14. Lourenço, EV, & La Cava, A. Cytokines in systemic lupus erythe-
matosus. Curr. Mol. Med., 2009 Apr; 9(3), 242–254. https://doi.
Competing interests org/10.2174/156652409787847263
The authors have declared that no competing interests 15. Pisetsky, DS, Lipsky, PE. New insights into the role of antinuclear
exist. antibodies in systemic lupus erythematosus. Nat. Rev. Rheumatol.
2020 Oct; 16, 565–579. https://doi.org/10.1038/s41584-020-0480-
Authors' contribution 7
Ghassan: experiments design, data analysis, study valida- 16. Becker Y, Marcoux G, Allaeys I, Julien AS, Loignon RC, Benk-
tion, writing. Tarek and Khalil: supervision, provision of Fortin H, Rollet-Labelle E, Rauch J, Fortin PR, Boilard E. Autoan-
study materials. tibodies in Systemic Lupus Erythematosus Target Mitochondrial
RNA, Front. Immunol., 2019 May; 10, 1026, https://www.fron-
References tiersin.org/article/10.3389/fimmu.2019.01026
17. Dazzi F, Krampera M. Mesenchymal stem cells and autoimmune
1. Moulton, VR, Suarez-Fueyo, A., Meidan, E., Li, H, Mizui, M, & diseases. Best Pract, Res, Clin, Haematol. 2011 Mar;24(1):49-57.
Tsokos, G. C. Pathogenesis of Human Systemic Lupus Erythema- https://doi:10.1016/j.beha.2011.01.002
tosus: A Cellular Perspective. Trends in mol. Med. 2017 Jul; 23(7), 18. Zhao Q, Ren H, Han Z. Mesenchymal stem cells: Immunomo-
23
dulatory capability and clinical potential in immune diseases, J. overexpression of IL-22. Cytokine. 2018 Aug; 108:182-189.
Cell. Immunother., 2016; 2 (1), 3-20, https://doi.org/10.1016/j. http://doi:10.1016/j.cyto.2018.04.011
jocit.2014.12.001 28. Davis LS, Hutcheson J, and Mohan C. The role of cytokines in the
19. Lu R, Munroe ME, Guthridge JM, Bean KM, Fife DA, Chen H, pathogenesis and treatment of systemic lupus erythematosus. J.
Slight-Webb SR, Keith MP, Harley JB, James JA. Dysregulation Interferon Cytokine Res. 2011 Oct; 31(10): 781-789.
of innate and adaptive serum mediators precedes systemic lupus 29. Ohl K, Tenbrock K. Inflammatory cytokines in systemic lupus
erythematosus classification and improves prognostic accuracy erythematosus. J Biomed Biotechnol. 2011 Oct; 16:2011:432595.
of autoantibodies. J. Autoimmun. 2016 Nov; 74:182-193. https:// https://doi:10.1155/2011/432595
doi:10.1016/j.jaut.2016.06.001 30. Ruchakorn, N, Ngamjanyaporn, P, Suangtamai, T, Kafaksom T,
20. Bai, Y, Tong, Y, Liu, Y, & Hu, H. Self-dsDNA in the pathogenesis Polpanumas C, Petpisit V, Pisitkun T, Pisitkun P. Performance of
of systemic lupus erythematosus. Clin. Exp. Immunol., 2018 Jan; cytokine models in predicting SLE activity. Arthritis Res. Ther.
191(1), 1–10. https://doi.org/10.1111/cei.13041 2019 Dec; 21, 1-1. https://doi.org/10.1186/s13075-019-2029-1
21. Sohrabian, A., Parodis, I, Carlströmer-Berthén, N, Frodlund, M, 31. Idborg, H, & Oke, V. Cytokines as Biomarkers in Systemic Lu-
Jönsen, A, Zickert, A, Sjöwall, C, Bengtsson, A, Gunnarsson, I, & pus Erythematosus: Value for Diagnosis and Drug Therapy. Int.
Rönnelid, J. Increased levels of anti-dsDNA antibodies in immune J. Mol. Sci. 2021 Jan; 22(21), 11327. https://doi.org/10.3390/
complexes before treatment with belimumab are associated with ijms222111327
clinical response in patients with systemic lupus erythematosus. 32. Poole, BD, Niewold, TB, Tsokos, GC, & Via, CS. Cytokines in
Arthritis Res. Ther., 2019 Dec; 21(1), 259. https://doi.org/10.1186/ systemic lupus erythematosus. J. biotechnol. biomed., 2010 Oct,
s13075-019-2056-y 735169. https://doi.org/10.1155/2010/735169
22. Godsell, J, Rudloff, I, Kandane-Rathnayake, R, Hoi, A, Nold, MF, 33. Li A, Guo F, Pan Q, Chen S, Chen J, Liu HF, Pan Q. Mesenchy-
Morand, EF, & Harris, J. Clinical associations of IL-10 and IL-37 mal Stem Cell Therapy: Hope for Patients With Systemic Lupus
in systemic lupus erythematosus. Sci. Rep., 2016 Oct; 6, 34604. Erythematosus, Front. Immunol., 2021 Sep, 12: 4062, https://
https://doi.org/10.1038/srep34604 DOI=10.3389/fimmu.2021.728190
23. Yuan, W., DiMartino, SJ, Redecha, PB, Ivashkiv, LB, & Sal- 34. Yang C, Sun J, Tian Y, Li H, Zhang L, Yang J, Wang J, Zhang
mon, JE. Systemic lupus erythematosus monocytes are less res- J, Yan S, Xu D. Immunomodulatory Effect of MSCs and MSCs-
ponsive to interleukin-10 in the presence of immune complexes. Derived Extracellular Vesicles in Systemic Lupus Erythemato-
Arthritis and rheumatism, 2011 Jan; 63(1), 212–218. https://doi. sus, Front. Immunol., 2021; 12:3652, https://DOI=10.3389/
org/10.1002/art.30083 fimmu.2021.714832
24. Waterman, RS, Morgenweck, J, Nossaman, BD, Scandurro, AE, 35. Li, W, Chen, W, Sun, L. An update for mesenchymal stem cell
Scandurro, SA, & Betancourt, AM. Antiinflammatory mesenchy- therapy in lupus nephritis. Kidney Dis., 2021;7(2), 79-89. https://
mal stem cells (MSC2) attenuate symptoms of painful diabetic doi:10.1159/000513741
peripheral neuropathy. Stem Cells Transl. Med., 2012 Jan; 1(7), 36. Zhou, T, Liao, C, Li, HY. Efficacy of mesenchymal stem cells in
557–565. https://doi.org/10.5966/sctm.2012-0025 animal models of lupus nephritis: a meta-analysis. Stem Cell Res.
25. Wang, JH, Liu, XL, Sun, JM, Yang, JH, Xu, DH, & Yan, SS. Role Ther. 2020 Dec; 11(1) 1-10. https://doi.org/10.1186/s13287-019-
of mesenchymal stem cell-derived extracellular vesicles in au- 1538-9
toimmunity: A systematic review. World J Stem Cells, 2020 Aug; 37. Dandan W, Lingyun S, Xiao-Dong C. Chapter 7 - Systemic Lupus
12(8), 879–896. https://doi.org/10.4252/wjsc.v12.i8.879 Erythematosus, A Roadmap to Non-Hematopoietic Stem Cell-
26. Rashad NM, El-Shabrawy RM, Said D, El-Shabrawy SM, Emad based Ther., Academic Press, 2019; 143-172.
G. Serum Levels of Transforming Growth Factor Beta -1 (TGF-β1) 38. Zhou T, Li HY, Liao C, Lin W, Lin S, Clinical Efficacy and
as An Early No Invasive Marker for Diagnosis of Lupus Nephri- Safety of Mesenchymal Stem Cells for Systemic Lupus Erythe-
tis in Systemic Lupus Erythematosus Patients. Egypt J Immunol.; matosus", Stem Cells Int., 2020 Oct; (11): 2020. https://doi.
2019 Jan; 26(1):31-42. PMID: 31332994. org/10.1155/2020/6518508
27. Rekik R, Khanfir MS, Larbi T, Zamali I, Beldi-Ferchiou A, Kam- 39. Bukulmez H, Kumar G. Clinical Use of Mesenchymal Stem Cells
moun O, Marzouki S, Hamzaoui S, Mrad S, Barbouche MR, Hou- in Treatment of Systemic Lupus Erythematosus, Lupus-Need
man MH, Ben Ahmed M. Impaired TGF-β signaling in patients to Know, 2021 May 22; IntechOpen, https://doi:10.5772/inte-
with active systemic lupus erythematosus is associated with an chopen.97261
24
Volume 21 | June 2023 ISSN: 2795-7624
Molecular effects of bone marrow

derived-Mesenchymal stem cells
(BM-MSCs) on some the cytokines
encoding-genes in BALB/c mice with
systemic lupus erythematosus (SLE)
Ghassan Khudhair Esmael1,2*, 1Department of Life Sciences, Faculty of Sciences-Sfax, University of

Sfax, Tunisia
2University of Al-Qadisiyah, veterinary medicine college – Iraq
*Corresponding author: Esmael ghassan.khudhair@qu.edu.iq

Tarek Rebai3 3 Laboratory Histo-embryology and Cytogenetics, Faculty of
Medicine of Sfax, University of Sfax, Tunisia

Lupus is a chronic autoimmune disease that occurs due to immune disturbance and
poor regulation of the immune response, such as dysfunction of antibodies, immune cell,
and cytokines. The study investigates the gene expression of some encoding chemokines
and cytokines gene in BALB/c model mice with lupus. Forty male BALB/c mice are
divided into four groups; each one consists of ten BALB/c mice. The first groups are
injected activated lymphocytes Derivative DNA S/C for induction lupus. The second
group was administrated activated lymphocytes Derivative DNA S/C for induction lupus
then, treated with bone marrow derived-Mesenchymal stem cells (BM-MSCs); the third
group was administered BM-MSCs intravenously only. The control group administrated
ABSTRACT
PBS. After finishing the induction and treatment time, all the animals activated for take
the serum for estimation the gene expression of the some of the cytokines and
chemokines genes by using RT-PCR techniques in all the study groups. The findings are
included that the first group showed significant high expression of IL-6, CCL-5/RANTES,
VEGF, ICAM, CCL-2, and IFNγ-encoding genes; and low expression of IL-10 and TGFβ1-
encoding gene as compared with the control group. The second group showed a
significant low expression of IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2/MCP-1, and IFNγ-
encoding genes while showing significant high expression of IL-10 and TGFβ1-encoding
gene as compared with the control group. The third group doesn't show any changes in
the studied cytokines and chemokines gene expression compared to the control group.
BM-MSCs can effect on the gene expression of many cytokines and chemokine encoding
genes, which treats induced lupus in mice.
Keywords:
Mesenchymal stem cells, gene expression, cytokines genes,
BALB/c mice, lupus
Introduction: lupus is a chronic immune MSCs can regulate the immunological
disorder that affects humans and animals. response in vivo and in vitro in humans and
Mesenchymal stem cells (MSCs) are adult stem mice by two mechanisms: forming of the
cells; they can differentiate into several cell soluble factors (IL-10, PGE2, and TGF-β1); and
type lineages (1). MSCs have by cellular communication (3) (4). T helper
immunomodulatory impacts because they cells are regulating the immune responses by
inhibit Th17 cells and stimuli Treg cells in producing cytokines (5). MSCs have an
autoimmune diseases (2).
Eurasian Medical Research Periodical www.geniusjournals.org

Page | 31
Volume 21 | June 2023 ISSN: 2795-7624
immunosuppressive effect; therefore, it used to preparation) in three doses between one and
treat lupus in the murine (6). another two weeks (0, 14, 28) days for
Treg cells have an important role in inducing SLE in BALB/c mice. The second
maintaining tolerance. Treg cells inhibit group is also administered (ALD-DNA) (50
immune response, which has benefits for the μg/mouse), three doses at (0, 14, 28) days for
treatment of lupus (7). MSCs showed that they inducing SLE; after the onset of the clinical
are important in cases of Treg cells deficiency signs, ANA and anti-dsDNA are examined for
(8). MSCs improve the generation of Treg cells final diagnosis of SLE. The positive cases of SLE
(9); therefore, it could be MSC to treat in the second group are treated by BALB/c-
autoimmune diseases (10). MSCs (CellBiologics company, USA) (0.1×106)
TGF-β1 is stimuli Treg cells (11). IL-10 and cells/for 10g/IV. The third group is
TGF-β1 increase the gene expression of FoxP3 administrated BALB/c-MSCs only (0.1×106)
in Treg cells. Differentiation of the Th cell cells/for 10g/IV. The fourth group (control
inhibits differentiation of the Th17 cell, which group) administrated BPs only.
regulate by IDO and PGE2 (12). TGF-β1 SLE induction: After receiving the shipped
suppresses Th1 and Th2 cells, also Treg and animals, some of the exported animals out of
Th17 cell induction (13-15). Th cells affect the the experimental animals were used for the
regulation of cytokines and encoding genes preparation of activated lymphocyte DNA (ALD
(16). DNA) according to (21), as three steps:
TGF-β1 can inhibit Th1 and Th2 cells in Preparation of splenocytes from BALB/c mice
autoimmune diseases such as lupus (17-19). spleens (22) (23), DNA extraction extracted
TGF-β1 acts as an anti-inflammatory cytokine from activated splenocytes. The animal was
that has been used for the treatment of immunized with activated ALD DNA in three
autoimmune disease (20). The current study doses. The clinical signs appear after the third
investigates the effects of BM-MSCs on the gene dose. Eliza kits did ANA and anti-dsDNA
expression of some chemokines-encoding Examination.
genes and cytokines–encoding genes in The BALB/c BM-MSCs: The cells are provided
BALB/C model mice with lupus. by (Cell biologics Company, USA). It was
administrated for the second and third groups
Materials and methods: at a dose (0.1×106) Cells (IV) for 10 g
The experimental animals: Forty BALB/c intravenous.
model mice provided at (6) weeks old with The used primers for gene expression: The
(20-30) grams purchased from (Jackson tested genes are IL-10, IL-6, CCL-2, TGFβ1,
Laboratory, USA). It was housed in a pathogen- IFNγ, CCL-5, ICAM, and VEGF genes in mice by
free animal house and under the same using designed primers (depending on the
conditions. genes database of NCBI
The study design: Forty BALB/c mice are (https://www.ncbi.nlm.nih.gov), and the
categories to (4) groups; each group consists of primers are designed by primers 3 plus
ten mice; the first group is administrated (ALD (https://www.primer3plus.com) in RT-PCR as
DNA) (50 μg/mouse) (ALD DNA was previous shown in table (1)
Table (1): showed the used primers in the study
Gene Product size Direction Seq.
IL-10 242 bp L TCAGAGCTCCTGGAACTGGT
R TGCTAGAGCCCGGAGTTAAA
IL-6 185 bp L TTTCTCCACGCAGGAGACTT
R TCCACGATTTCCCAGAGAAC
TGF-β1 160 bp L ATTTTAGGGTGGCCCATTTC
R GAACTGACCCTGCTTCTTGC

Page | 32
Volume 21 | June 2023 ISSN: 2795-7624
CCL-2/MCP-1 200 bp L CCCAATGAGTAGGCTGGAGA
R GAACTGCCTTTGCCTTCTTG
CCL-5/RANTES 197 bp L GTGCCCACGTCAAGGAGTAT
R CTGGAGACGAGGAGCCATAG
VEGF-A 199 bp L ACCCGTGACTGAGGTTTGAC
R TTTCTTGCGCTTTCGTTTTT
ICAM-1 160 bp L AGCACCTCCCCACCTACTTT
R AGCTTGCACGACCCTTCTAA
IFN-γ 181 bp L ACTTTGCTTCTGCCTTTCCA
R ACAAGGTCACCCACAGGAAG
Total RNA Extraction and Reverse The fold change are calculated as
Transcriptase: 2-ΔΔCTΔΔCT =ΔCT
RNA was extracted from animals serum ΔCT-ΔCT =CT gene-CT House Keeping gene.
directly by using RNA Extraction Kit Statistical Analysis: The results were
(Addbio/Korea), 3). Extracted RNA was analyzed by an ANOVA test (SPSS, V20; USA).
converted to cDNA by SYBR Green Master Using of LSD test to determine the difference
(Quantabio/Germany). The final volume 25 μl among the groups at P= 0.05 (24).
that consist of (SYBR Green Master Mix 12.5 μl,
F primer and R primer 1 μl, DNA free water 6.5 Results:
μl, RNA template 3 μl and qScript One- Step The gene expression of the IL-10 gene in G1
RT3 1 μl). The total reaction mixture was was low than in control. No significant
incubated into the thermocycler. cDNA differences exist among other groups in gene
synthesis (49) ºC for (10) minutes., Taq expression of the IL-10 gene, as shown in table
activation 95ºC for (2) minutes., PCR cycling (2) and figure (1).
(38 cycles, 95 ºC for (4) seconds, and 59 ºC for
(40) seconds)
Table (2): Values of the fold change of the IL-10 gene
Group Fold change
G1 0.223 B
G2 0.905 A
G3 0.998 A
G4 1A
The same letters haven't significant differences; the different letters have significant
differences
Fold change
1
0.8 G1
0.6 G2
0.4 G3
0.2 G4
0
G1 G2 G3 G4
Figure (1): the chart shows the fold changes of the IL-10 gene

Page | 33
Volume 21 | June 2023 ISSN: 2795-7624
The current study showed that the IL-6 encoding gene expression was increased in G1 than in the
control. There are no significant differences among the other groups in gene expression of the IL-6
gene, as shown in table (3) and figure (2).
Table (3): Values of the fold change of IL-6 encoding gene
Group Fold change
G1 1.885 A
G2 1.051 B
G3 0.997 B
G4 1B
differences
Fold change
2
G1
1.5
G2
1
G3
0.5 G4
0
G1 G2 G3 G4
Figure (2): chart shows the fold changes of the IL-6 gene
The findings showed that the TGF-β1 expression gene was reduced in G1 than in the control. There
are no marked differences among other groups in the TGF-β1 expression gene, as shown in table (4)
and figure (3).
Table (4): The fold change values of the TGF-β1 gene
Group Fold change
G1 0.365 A
G2 0.996 B
G3 0.997 B
G4 1B
differences
Fold change
1
0.8 G1
0.6 G2
0.4 G3
0.2 G4
0
G1 G2 G3 G4
Figure (3): chart shows the fold changes of the TGF-β1 gene

Page | 34
Volume 21 | June 2023 ISSN: 2795-7624
The current study showed that the gene expression of the CCL-2/MCP-1 encoding gene was
increased in G1 than in the control. There are no marked differences among other groups in gene
expression of the CCL-2/MCP-1-encoding gene, as shown in table (5) and figure (4).
Table (5): The fold change values of the CCL-2/MCP-1 gene
Group Fold change
G1 3.299 A
G2 1.0544 B
G3 0.97368 B
G4 1B
differences
Fold change
4 G1
3 G2
2
G3
1
G4
0
G1 G2 G3 G4
Figure (4): chart shows the fold changes of the CCL-2/MCP-1 gene
The current study showed that the gene expression of the CCL-5/RANTES-encoding gene was
increased in G1 than in the control. There are no marked differences among other groups in gene
expression of the CCL-5/RANTES-encoding gene, as shown in table (6) and figure (5).
Table (6): Values of the fold change of CCL-5/RANTES encoding gene
Group Fold change
G1 5.48684 A
G2 0.96846 B
G3 1.00919 B
G4 1B
differences
Fold change
6 G1
4 G2
2 G3
G4
0
G1 G2 G3 G4
Figure (5): chart shows the fold changes of the CCL-5 gene
The gene expression of the VEGF-A encoding gene was increased in G1 than in the control. There are
no marked differences among other groups in gene expression of the VEGF-A-encoding gene, as
shown in table (7) and figure (6).

Page | 35
Volume 21 | June 2023 ISSN: 2795-7624
Table (7): Values of the fold change of the VEGF-A encoding gene
Group Fold change
G1 4.30452 A
G2 1.134773 B
G3 0.990740 B
G4 1B
differences
Fold change
5
G1
4
3 G2
2 G3
1 G4
0
G1 G2 G3 G4
Figure (6): chart shows the fold changes of the VEGF-A gene
The current study showed that the ICAM-1 encoding gene expression was increased in G1 than in the
control. There are no marked differences among other groups in gene expression of the ICAM-1-
encoding gene, as shown in table (8) and figure (7).
Table (8): Values of the fold change of the ICAM-1 gene in study groups
Group Fold change
G1 1.34562 A
G2 1.00755 B
G3 1.000888 B
G4 1B
differences
Fold change
1.5
G1
1
G2
G3
0.5
G4
0
G1 G2 G3 G4
Figure (7): chart shows the fold changes of ICAM-1 gene in study groups
The current study showed that gene expression of the IFN-γ-encoding gene was increased in G1
than in the control. There are no marked differences among other groups in gene expression of the
IFN-γ encoding gene, as shown in table (9) and figure (8).

Page | 36
Volume 21 | June 2023 ISSN: 2795-7624
Table (9): Values of the fold change of IFN-γ-encoding gene in study groups
Group Fold change
G1 2.135330 A
G2 0.992939 C
G3 0.994731 B
G4 1B
differences
Fold change
2.5
G1
2
1.5 G2
1 G3
0.5 G4
0
G1 G2 G3 G4
Figure (8): chart showed the fold changes of the IFN-γ gene in study groups
Discussion: of TGF-β1 is associated with the common

Lupus is a complex autoimmune disease; expression of IL-10 in lupus. Lupus showed a
several medicine drugs could be used to treat deficit in Treg cells which can treat by MSCs.
lupus, such as Methotrexate, Mycophenolate MSCs reregulate the immunological response,
mofetil, Azathioprine, Cyclophosphamide, and increase Treg cell counts in lupus cases, and
Voclosporin (24). In the last decade, many increase expression of TGF-β1 and IL-10 to
researchers found that body tissues derived- maintain immune activity (29). TGF-β1 was
Mesenchymal stem cells are important in decreased in the patients with SLE than in the
treating lupus. Mesenchymal stem cells reduce control group (30).
the pro-inflammatory cytokines and increase TGF-β1 and IL-10 expression was increased
anti-inflammatory cytokines by producing in lupus patients compared to the control
several factors such as exosomes, group. TGF-β1 and IL-10 are increased in lupus
microvesicles, apoptotic bodies, proteins, and patients. IL-10 and TGF-β1 inhibit the
lipids. These factors play a crucial role in autoreactive immune cells in lupus patients
regulating immune responses by control on (31). mRNA expression of IL‑6 and TNF‑α were
gene expression (25) (26). decreased in MSCs in Osteoarthritis cases than
Our findings included high gene expression in the control group using RT-PCR.
of IL-6, CCL-5/RANTES, VEGF, ICAM, CCL-2, Furthermore, the mRNA concentration of IL‑10,
and IFNγ-encoding genes; and a decrease in IL‑4, and TGF‑β1 in MSCs was increased than in
gene expression of IL-10 and TGFβ1 gene in the the control group, which showed agreement
first group. The second group showed low gene with our results (32).
expression of IL-6, CCL-5/RANTES, VEGF, Treatment by MSCs was used in
ICAM, CCL-2/MCP-1, and IFNγ while showing regeneration medicine and autoimmune
significantly high gene expression of IL-10 and diseases. MSCs can migrate to injured sites for
TGFβ1 gene than in the control group. MSCs differentiation to produce many bioactive
are used to treat autoimmune diseases by factors, such as cytokines and growth factors,
regulating the gene expression of cytokine- which provide microenvironment regeneration
encoding genes (27) (28). The low expression and inhibit local inflammation. The

Page | 37
Volume 21 | June 2023 ISSN: 2795-7624
differentiation of MSCs is associated with secreted factors. MSc genes play an important
cytokines and proteins. MSCs stimulate the role in therapeutic outcomes (47). MSc
anti-inflammatory cytokine by regulating the contributes to the immunosuppressive in
expression of the cytokines encoding genes. persistent apical periodontitis (48). All the
TGF-β1 gene expression was increased than above and mentioned studies agreed with our
the control group. MSCs could regulate the study findings and directly supported our
gene expression of the cytokines genes (33). results.
Gene expression of the cytokines was changed
during the MSCs differentiation (34). Conclusion: BM-MSCs can effect on the gene
IL-6 was down-regulated in lupus patients expression of some cytokines genes in BALB/C
after treatment by MSc. The impaired MSCs to mice with lupus.
secrete the immune factors are attributed to
the genetic disorder of lupus cases due to References:
weakened MSC. IL-6 decreased MSC, while 1. Corcione A, Benvenuto F, Ferretti E,
TNF-α increased MSC activity by stimulating Giunti D, Cappiello V, Cazzanti F, Human
IDO in MSCs (35) (36). Interferon-γ and IL-6 mesenchymal stem cells modulate B-cell
expression were reduced in T lymphocytes of functions. Blood 2006; 1:367–72.
lupus patients with MSCs (37). MSCs were 2. Phinney DG, Hill K, Michelson C, DuTreil
stimuli to the regulatory B cells in the mice M, Hughes C, Humphries S. Biological
with the autoimmune disease. MSCs inhibit activities encoded by the murine
anti-dsDNA and regulate imbalances among mesenchymal stem cell transcriptome
Treg/Th17/Th1 (29). Many reports found a provides a basis for their developmental
relationship between the effects of t MSCs on potential and broad therapeutic efficacy.
the gene expression of the cytokines wherever; Stem Cells 2006; 1:186–98.
MSCs can treat collagen-induced arthritis 3. Meirelles Lda S, Fontes AM, Covas DT,
through the modulation of the expression of Caplan AI. Mechanisms involved in the
the cytokines (38). therapeutic properties of mesenchymal
MSCs have a potent immunosuppressive stem cells. Cytokine Growth Factor Rev
effect in vivo (39). MSCs can decrease 2009; 5–6:419–27.
interleukin 10 concentration in pulmonary 4. Pillai S, Cariappa A. The bone marrow
vasculitis in lupus mice. MSCs are strong perisinusoidal niche for recirculating B
immunomodulatory cells investigated in graft cells and the positive selection of bone
versus host disease, SLE, Crohn's disease, and marrow-derived B lymphocytes. Immunol
ulcerative colitis (40). MSCs have an Cell Biol 2009; 1:16–9.
immunosuppressive effect on the immune 5. Weaver CT, Hatton RD, Mangan PR,
system (41). MSCs have distinct gene Harrington LE. IL-17 family cytokines and
expression (42). MSc has an the expanding diversity of effector T cell
immunomodulatory role in autoimmune lineages. Annu Rev Immunol. 2007:821–
disease (43). The genetic exchange between 52.
resident and MSCs by the microvesicles 6. Chang JW, Hung SP, Wu HH, Wu WM,
showed instrumental in MSc therapeutic effects Yang AH, Tsai HL, Therapeutic effects of
(44). The cytokine produced by MSc has an umbilical cord blood-derived
important role in autoimmunological disorders mesenchymal stem cell transplantation in
such as SLE (45). experimental lupus nephritis. Cell
MSc transplantation has important Transplant 2011; 2:245–57.
therapeutic effects on treating rheumatoid 7. Joffre O, Santolaria T, Calise D, Al Saati T,
arthritis, SLE, Crohn's disease, juvenile Hudrisier D, Romagnoli P. Prevention of
idiopathic arthritis, systemic sclerosis, multiple acute and chronic allograft rejection with
sclerosis, and type I diabetes mellitus (46). MSc CD4+CD25+Foxp3+ regulatory T
has expressed the surface markers and lymphocytes. Nat Med 2008; 1:88–92.

Page | 38
Volume 21 | June 2023 ISSN: 2795-7624
8. Crispin JC, Tsokos GC. Interleukin-17- 18. Harrington LE, Hatton RD, Mangan PR,
producing T cells in lupus. Curr Opin Turner H, Murphy TL, Murphy KM,
Rheumatol 2010; 5:499–503. Interleukin 17-producing CD4+ effector T
9. Gonzalez-Rey E, Gonzalez MA, Varela N, cells develop via a lineage distinct from
O'Valle F, Hernandez-Cortes P, Rico L, the T helper type 1 and 2 lineages. Nat
Human adipose-derived mesenchymal Immunol 2005; 11:1123–32.
stem cells reduce inflammatory and T cell 19. Hwang ES, Szabo SJ, Schwartzberg PL,
responses and induce regulatory T cells in Glimcher LH. T helper cell fate specified
vitro in rheumatoid arthritis. Ann. Rheum. by kinase-mediated interaction of T-bet
Dis. 2010; 1:241–8. with GATA-3. Science 2005; 5708:430–3.
10. Sun L, Wang D, Liang J, Zhang H, Feng X, 20. Wilson NJ, Boniface K, Chan JR, McKenzie
Wang H. Umbilical cordmesenchymal BS, Blumenschein WM, Mattson JD.
stem cell transplantation in severe and Development, cytokine profile and
refractory systemic lupus erythematosus. function of human interleukin 17-
Arthritis Rheum 2010; 8:2467–75. producing helper T cells. Nat Immunol
11. Fu S, Zhang N, Yopp AC, Chen D, MaoM, 2007; 9:950–7.
Zhang H. TGF-beta induces Foxp3+ T- 21. Qiao B, Wu J, Chu YW, Wang Y, Wang DP,
regulatory cells from CD4+CD25− Wu HS, Xiong SD. Induction of systemic
precursors. Am J Transplant 2004; lupus erythematosus-like syndrome in
10:1614–27. syngeneic mice by immunization with
12. Tatara R, Ozaki K, Kikuchi Y, Hatanaka K, activated lymphocyte-derived DNA.
Oh I, Meguro A. Mesenchymal stromal Rheumatology. 2005; 44(9):1108-14.
cells inhibit Th17 but not regulatory T- 22. Dwyer JM, Johnson C. The use of
cell differentiation. Cytotherapy concanavalin A to study the
2011;6:686–94. immunoregulation of human T cells.
13. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Clinical and Experimental Immunology.
Marinos N. Conversion of peripheral 1981, 46 (2): 237–49.
CD4+CD25− naive T cells to CD4+CD25+ 23. Schiefer HG, Krauss H, Brunner H,
regulatory T cells by TGF-beta induction Gerhardt U. Ultrastructural visualization
of transcription factor Foxp3. J Exp Med of surface carbohydrate structures on
2003; 12:1875–86. mycoplasma membranes by concanavalin
14. Zheng SG, Wang JH, Gray JD, Soucier H, A. Journal of Bacteriology. 1975, 124 (3):
Horwitz DA. Natural and induced 1598–600.
CD4+CD25+ cells educate CD4+CD25− 24. Schiefer, W.C. Statistics for the biological
cells to develop suppressive activity: the sciences. 2nd ed. Addison. Wesley pub
role of IL-2, TGF-beta, and IL-10. J comp, California, London, 1980.
Immunol 2004; 9:5213–21. 25. McKeon KP, Jiang SH. Treatment of
15. Zhou L, Ivanov II, Spolski R, Min R, systemic lupus erythematosus. Aust
Shenderov K, Egawa T. IL-6 programsT Prescr. 2020; 43 (3):85-90.
(H)-17 cell differentiation by promoting 26. Perez-Hernandez, J., Redon, J., & Cortes, R.
sequential engagement of the IL-21 and Extracellular Vesicles as Therapeutic
IL-23 pathways. Nat Immunol 2007; Agents in Systemic Lupus Erythematosus.
9:967–74. International journal of molecular
16. Paul WE, Seder RA. Lymphocyte sciences, 2017, 18(4), 717.
responses and cytokines. Cell 1994; 27. Wang, D., Huang, S., Yuan, X. The
2:241–51. regulation of the Treg/Th17 balance by
17. Gorelik L, Fields PE, Flavell RA. Cutting mesenchymal stem cells in human
edge: TGF-beta inhibits Th type 2 systemic lupus erythematosus. Cell Mol
development through inhibition of GATA- Immunol 2017, 14, 423–431.
3 expression. J Immunol 2000; 9:4773–7.

Page | 39
Volume 21 | June 2023 ISSN: 2795-7624
28. Zhu Y, Feng X. Genetic contribution to 36- Chen H, Shi B, Feng X, Kong W, Chen W,
mesenchymal stem cell dysfunction in Geng L, Chen J, Liu R, Li X, Chen W, Gao X,
systemic lupus erythematosus. Stem Cell Sun L. Leptin and neutrophil-activating
Res Ther. 2018, 24;9(1):149. peptide 2 promote mesenchymal stem cell
29- Chun, W., Tian, J. & Zhang, Y. senescence through activation of the
Transplantation of mesenchymal stem phosphatidylinositol 3-kinase/Akt
cells ameliorates systemic lupus pathway in patients with systemic lupus
erythematosus and upregulates B10 cells erythematosus. Arthritis Rheumatol.
through TGF-β1. Stem Cell Res Ther 2021, 2015;67:2383–93.
12, 512. 37- Zheng B, Zhang P, Yuan L, Chhetri RK, Guo
30- Siham Aly Metawie, Rasha M. ElRefai, Suzan Y, Deng D. Effects of human umbilical cord
Sadek ElAdle, Rasha Mohamad Hosny mesenchymal stem cells on inflammatory
Shahin, Transforming growth factor-β1 in factors and miR-181a in T lymphocytes
systemic lupus erythematosus patients from patients with systemic lupus
and its relation to organ damage and erythematosus. Lupus. 2020; 29(2):126-
disease activity, The Egyptian 135.
Rheumatologist, 2015, 37(4)S, 49-54 38- Mao, F., Xu, W. R., Qian, H., Zhu, W., Yan, Y.
31- Abbasifard, M., Kamiab, Z., Hasani, M. M., Shao, Q. X., & Xu, H. X.
Assessing the expression of Immunosuppressive effects of
immunosuppressive cytokines in the mesenchymal stem cells in collagen-
newly diagnosed systemic lupus induced mouse arthritis. Inflammation
Erythematosus patients: a focus on B Research, 2010, 59, 219-225.
cells. BMC Immunol, 2020, 21, 58. 39- Le Blanc, K., Rasmusson, I., Sundberg, B.,
32- Yi, P., Xu, X., Qiu, B., & Li, H. Impact of Götherström, C., Hassan, M., Uzunel, M., &
chitosan membrane culture on the Ringdén, O. Treatment of severe acute
expression of pro‑and anti‑inflammatory graft-versus-host disease with third party
cytokines in mesenchymal stem cells. haploidentical mesenchymal stem cells.
Experimental and Therapeutic Medicine, The Lancet, 2004, 363(9419), 1439-1441.
2020, 20(4), 3695-3702. 40- Prabowo, N. A., Adnan, Z. A., Nurudhin, A.,
33- Mingxia Shi, Jing Li, Lianming Liao, Bin Werdiningsih, Y., & Prasetyo, K.
Chen, Bingzong Li, Lei Chen, Hairong Jia, Mesenchymal stem cell conditioned
Robert Chunhua Zhao. Regulation of medium as good as methyl prednisolone
CXCR4 expression in human in decreasing levels of interleukin 10 and
mesenchymal stem cells by cytokine the degree of pulmonary vasculitis in
treatment: role in homing efficiency in lupus mice. Bangladesh Journal of Medical
NOD/SCID mice. Haematologica 2007; Science, 2021, 20(2), 426-430.
92(7):897-904; 41- Zanone, M. M., Favaro, E., Miceli, I., Grassi,
34- Almashat, R. A. Gene expression profiles of G., Camussi, E., Caorsi, C., & Camussi, G.
cytokines during osteogenic Human mesenchymal stem cells modulate
differentiation of human gingiva derived cellular immune response to islet antigen
mesenchymal stem cells. Nova glutamic acid decarboxylase in type 1
Southeastern University, 2015. diabetes. The Journal of Clinical
35- Wang D, Feng X, Lu L, Konkel JE, Zhang H, Endocrinology & Metabolism, 2010,
Chen Z, Li X, Gao X, Lu L, Shi S, Chen W, 95(8), 3788-3797.
Sun L. A CD8 T cell/indoleamine 2,3- 42- Jansen, B. J., Gilissen, C., Roelofs, H., Schaap-
dioxygenase axis is required for Oziemlak, A., Veltman, J. A., Raymakers, R.
mesenchymal stem cell suppression of A., ... & Adema, G. J. Functional differences
human systemic lupus erythematosus. between mesenchymal stem cell
Arthritis Rheumatol. 2014; 66:2234–45. populations are reflected by their

Page | 40
Volume 21 | June 2023 ISSN: 2795-7624
transcriptome. Stem cells and
development, 2010, 19(4), 481-490.
43- Tyndall, A., & Furst, D. E. Adult stem cell
treatment of scleroderma. Current
opinion in rheumatology, 2007, 19(6),
604-610.
44- Bruno, S., & Bussolati, B. Therapeutic
effects of mesenchymal stem cells on
renal ischemia–reperfusion injury: a
matter of genetic transfer?. Stem Cell
Research & Therapy, 2013, 4(5), 1-2.
45- Stępień-Wyrobiec, O., Hrycek, A., &
Wyrobiec, G. Transforming growth factor
beta (TGF-beta): its structure, function,
and role in the pathogenesis of systemic
lupus erythematosus. Advances in
Hygiene and Experimental Medicine,
2008, 62.
46- Rosa, S. B., Voltarelli, J. C., Chies, J. A. B., &
Pranke, P. The use of stem cells for the
treatment of autoimmune diseases.
Brazilian Journal of Medical and Biological
Research, 2007, 40, 1579-1597.
47- Altaner, C., Altanerova, V., Cihova, M.,
Hunakova, L., Kaiserova, K., Klepanec, A.,
... & Madaric, J. Characterization of
mesenchymal stem cells of "no-options"
patients with critical limb ischemia
treated by autologous bone marrow
mononuclear cells. PLoS One, 2013, 8(9),
e73722.
48- Estrela, C., Silva, B. S. F., Silva, J. A.,
Yamamoto-Silva, F. P., dos Santos Pinto-
Júnior, D., & Gomez, R. S. Stem cell marker
expression in persistent apical
periodontitis. Journal of Endodontics,
2017, 43(1), 63-68.

Page | 41

Final Thesis (1) - Merged - Compressed

Uploaded by

Copyright:

Available Formats

Final Thesis (1) - Merged - Compressed

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Final Thesis (1) - Merged - Compressed

Uploaded by

Copyright:

Available Formats

LIST OF PUBLICATIONS

1-Immunomodulatory effects of bone marrow-derived Mesenchymal stem

Ghassan Khudhair Esmael1, Tarek Rebai2, Khalil Gazar Chelab Al-Nailey3

Cellular and Molecular Biology E-ISSN: 1165-158X / P-ISSN: 0145-5680

Ghassan Khudhair Esmael et al. / Effects of bone marrow-derived

2- Molecular Effects of bone marrow derived-Mesenchymal stem cells (BM-

Ghassan Khudhair Esmael 1, and Tarek Rebai2

Eurasian Medical Research Periodical, ISSN: 2795-7624, (published) Volume 21 |

To the cradle of the first letter

The first word

The first history

To my parents, my father and my mother,

To My wife, for her support,

To All members of my Family

My brothers and sisters

Table N. Title Page N.

Figure N. Title Page N.

Abbreviations The details

Le lupus érythémateux disséminé (LED) provoque des réactions

high blood sugar, osteoporosis, mood changes, insomnia, gastrointestinal Issues,

Mesenchymal stem cells treat patients with autoimmune diseases and

Aims of the study:

1- Determination of some of the cytokines and chemokines levels in BALB/C

1.1. The stem cell history:

The majority of dedifferentiation-independent events that occur throughout the

gasoline to the ongoing controversy, embryonic stem cell research is linked to

1.2. Classification of the stem cells

Figure 1: Immunostaining for alkaline phosphatase, GM-CSF-R, RANK-L,

2-Embryonic Germ Stem Cells:

3- Fetal stem cells:

B-Infant stem cells:

2- Wharton's jelly stem cells:

WJ-MSCs may exert immunomodulatory effects. In patients with Graft-versus-

Figure 2: Whartons Jelly Human Mesenchymal Stem Cells, wherever, A:

A- Adult stem cells

loss of MSCs that occurs as a result of their transformation into adipocytes.

Figure 3: Human Mesenchymal Stem Cells-Bone Marrow (HMSC-bm)

2-Hematopoietic stem cells:

Figure 4: Characterization of hPSC and hPSC-derived endothelial progenitor

3-Neural Stem Cells:

Figure 5: Phenotypes of NESCs at different differentiation stages in vitro.

4-Gastrointestinal stem cells:

5-Epidermal stem cells:

6-Hepatic stem cells:

7- Pancreatic stem cells:

II- Types of stem cells according to the differentiation:

zygotic genome is demethylated by enzymatic modification of 5-methylcytosine.

2-Pluripotent stem cells:

3-Multipotent stem cells:

4-Unipotent stem cells:

5-Oligopotent stem cells:

6- Nullipotent stem cells:

Neural Stem NSC CNS (brian

1.3. Therapeutic uses of the stem cells:

1.4. Lupus disease:

The severity of the condition will determine how it is treated. It has to be

1.4.1. Lupus Epidemiology:

these countries are under-represented in epidemiological data on SLE. A study

disease start in childhood; this is due to increased renal, neuropsychiatric, and