Questions
Questions
Questions
Compare the backbone of the sugar-phosphate arrangement in the side chains of all three figures. Are there any differences? The arrangement is identical for all three samples. 2. In the above figure, do all three samples contain the same bases? Describe your observations. All samples contain same bases; A, T, G and C. 3. Are the base paired in an identical manner in all three samples? Describe the pattern of the base pairing bonding. The A is always bonded with T and the C is always bonded with G. 4. In your attempt to analyze DNA samples from three different individuals, what conclusions can you make about the similarities and differences of the DNA samples? The sugar phosphate arrangement is the same for all samples and so are the kind of bases; what is different is the arrangement of bases among three samples.
5. What will you need to compare between these DNA samples to determine if they are identical or non-identical? The sequence of base pairs in each individual samples.
Lesson 1 Restriction digestion of DNA samples. Consideration how can we detect differences in base sequences? (pg. 25, 26) 1. How many pieces of DNA would result from this cut? 2
2. Write the base sequence of the DNA fragments on both the left and right side of the cut. Left: ATG TACTTA 3. What differences are there in the two pieces? - Each fragment is a different size. - One fragment is short and one is long. - Some bases are unpaired. 4. DNA fragment size can be expressed as the number of base pairs in the fragment indicate the size of the fragments [mention any discrepancy you may detect] a) The smaller fragment is 3 base pairs (bp) b) What is the length of the longer fragment? 11 Right: AATTCTCAATTACCT GAGTTAATGGA
5. Consider the two samples of DNA shown below-single strand are shown for simplicity: Sample #1 CAGTGATCTCGAATTCGCTAGTAACGTT Sample #2 TCATGAATTCCTGGAATCAGCAAATGCA If both samples are treated with the restriction enzyme EcoRI [recognition sequence GAATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA. Sample #1 #of fragments: 2 Sample #2 #of fragments: 2
List fragment size in order: largest to smallest Sample #1 117 bp fragment 11 bp fragment Sample #2 23 bp fragment 5 bp fragment
Lesson 1 Restriction digestion of DNA samples (pg. 28) Observations 1. Describe the samples of DNA (physical properties). DNA samples are clear, colourless liquid samples. 2. Is there any observable difference between samples of DNA? No. All samples appear similar. 3. Describe the appearance of the restriction endonuclease mix. The restriction enzyme appears to be clear, colourless liquid.
Lesson 1 Restriction digestion of DNA samples (pg. 30) Review questions 1. Before you incubated your samples, describe any visible signs of change in the contents of the tubes containing the DNA after it was combined with the restriction enzymes. DNA + EcoRI/PstI enzyme mix. No visible change appeared in the tubes. 2. Can you see any evidence to indicate that your samples of DNA were fragmented or altered in any way by the addition of EcoRI/PstI? No. No visible change appears in the tubes. 3. In the absence of any visible evidence of change, is it still possible that the DNA samples were fragmented? Explain your reasoning. Yes. They may be chemically changed but the changes may not be visible. Enzymes may have cut the DNA. 4. After a 24 hour incubation period, are there any visible clues that the restriction enzymes may have in some way changed the DNA in any of the tubes? Explain your reasoning. No. No visible change apparent in the tubes but the enzymes may have cut the DNA. The reactions are at the molecular level and too small to be seen.
Lesson 2 Agarose gel electrophoresis (pg. 34) Review questions 1. The electrophoresis apparatus creates an electrical field with positive and negative poles at the ends of the gel. DNA molecules are negatively charged. To which electrode pole of the electrophoresis field would you expect DNA to migrate? (+ or -)? Explain. Positive 2. What colour represents the negative pole? Negative pole (cathode) is black. Positive pole (anode) is red. 3. After DNA samples are loaded into the sample wells, they are forced to move through the gel matrix. What size fragments (large vs. small) would you expect to move toward the opposite end of the gel most quickly? Explain. Smaller. There is less resistance to their movement through the gel matrix. 4. Which fragments (large vs. small) are expected to travel the shortest distance from the well? Explain. Larger. There is more resistance to their movement through the gel matrix.