MIT Biology Department

7.012: Introductory Biology - Fall 2004

Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel

NAME_____________________________________________________________TA__________________ SEC____
7.012 Problem Set 4 FRIDAY October 15, 2004
Answers to this problem set must be inserted into the box outside

Problem sets will NOT be accepted late. Solutions will be posted on the web.

Question 1

NASA astronauts found a mysterious gene from the H zone of outer space. They needed
your help to know more about the gene, so they cloned it into a plasmid vector and told
you they would send you the plasmid, that they named pSET (plasmid “Sequence Extra-
Terrestrial”). When the package arrived, however, you found two unlabeled tubes.

Not sure of what they sent you, you decide to make restriction maps of what’s in each
tube, assuming that there is plasmid DNA in each.

You perform digestions with the restriction enzymes BglII (B), NotI (N) and SalI (S)
either alone or in combination and obtain the following gel-electrophoresis data.

Base
pairs
a) Draw the restriction maps of the plasmids in the space provided below. Write the
distances between the restriction sites. Also write down the total sizes of the plasmids
in the boxes below, in kilobases.

Plasmid #1 Plasmid #2

kb kb

b) Confused, you call NASA and ask them what’s going on and why they sent you two
tubes. They do not know why you got two tubes, but they know that the gene of interest
had been cloned into the NotI and SalI restriction sites of the vector. Which of the
plasmids has the gene? Circle your answer.

Plasmid #1 Plasmid #2

c) What is the length of the cloned gene in bases?

d) NASA also told you that the plasmid they used is a bacterial expression vector. Which
one of the following elements should be in the vector? Circle all that apply.

centromere multiple cloning sites nuclear localization signal

telomere inducible terminator bacterial origin of replication
selectable marker nucloid insertion sites cytosolic targeting sequences
inducible promoter topoisomerase gene gene encoding restriction enzyme

2
Question 2

You rename the gene GOSH for “gene from the outer space H.” For some reason, NASA
wants you to study the effect of expressing GOSH in amphibians. To express GOSH in
amphibian cells, you have to clone it into an amphibian expression plasmid (pEA) with an
amphibian promoter. Below is the map of pEA.

5’GGATCC 3’ BamHI recognition sequence

5’CTCGAG 3’ XhoI recognition sequence

5’GCGGCCGC 3’ NotI recognition sequence

5’GTCGAC 3’ SalI recognition sequence

a) Since pEA does not contain NotI and SalI sites, you decide to PCR-amplify GOSH with
primers that will replace the SalI and NotI sites with BamHI and XhoI sites. You know
the sequences of the 5’ and 3’ ends of GOSH as they are in the bacterial plasmid:
Start Stop
5’GTCGACatggtcgccatgcga………………………..tgctcgatatcgtaaGCGGCCGC3’

SalI NotI

Which of the following primer pairs would you use to successfully amplify the gosh gene
with the desired restriction sites at either end? All primer sequences are written in the
5’  3’ direction. Circle all that apply.

Pair1: GTCGACATGGTCGCCATGCGA and GCGGCCGCTTACGATATCGAG

Pair2: TCGCATGGCGACCATGTCGAC and GGATCACTACGAGATCGAGCA

Pair3: GGATCCATGGTCGCCATGCGA and CTCGAGTTACGATATCGAGCA

Pair4: TCGCATGGCGACCATCTCGAG and TGCTCGATATCGTAAGGATCC

Pair5: CTCGAGATGGTCGCCATGCGA and GGATCCTTACGATATCGAGCA

3
Now you try to express the new construct (pEA-GOSH) in frog (Xenopus) embryos.
Hmm… Something seems wrong and the expected peptide is not expressed. Since PCR can
introduce errors, you sequence pEA-GOSH from its 5’ end and obtain the following
sequencing gel:

b) What is the sequence in the gel? (in 5’  3’ direction)

c) Based on the sequence data, why is GOSH not expressed? Circle all that apply.

i) Restriction enzyme recognition site is lost, resulting in an immature, nonfunctional peptide.

ii) A nonsense mutation is introduced, introducing an early stop codon.

iii) The promoter in the plasmid is lost, so GOSH cannot be expressed.

iv) A frameshift mutation is introduced, so the encoded protein has a different primary
structure from Gosh.

4
Question 3

After fixing the mutation, you express pEA-GOSH in frog embryos. The transformed
frogs show abnormal eye-tongue coordination. You call this phenotype Helpless. (See an
artist’s depiction below.)

frogs transformed with pEA vector only:

frogs transformed with the pEA-GOSH construct:

How to keep GOSH-expressing frogs alive in the laboratory.

Place image like so. (Otherwise they would starve to death.)

Figure by MIT OCW.

To better understand the function of Gosh, you construct two more plasmids. The first
one is pEA-GFP, which will express the green fluorescent protein in amphibians. The
second one is pEA-GOSH-GFP, which will express a fusion protein of Gosh and GFP. You
examine the impact of expressing these plasmids in frogs.

5
 frogs transformed with pEA-GFP:

frogs transformed with pEA-GOSH-GFP:

Figure by MIT OCW.

a) According to the result above, does the presence of GFP affect the function of Gosh? Briefly
explain your answer.

b) Under a microscope, you compare the green fluorescence signals in frog neuronal cells that
express either GFP alone, or the Gosh-GFP fusion protein. (If your P-set is printed black and
white, please look at this colored figure in the PDF file on a computer screen.)

Legend:
GFP-fluorescence DAPI-fluorescence
A and B are two independent microscopy
pictures of the same neuronal cell that
pEA-GFP

expresses GFP.

In A, the green signal comes from GFP

A B molecules. In B, the blue signal comes from
DAPI molecules. DAPI is a blue dye that
pEA-GOSH-GFP

binds (and therefore stains) DNA.

Likewise, C and D are two pictures of

another neuronal cell, which expresses the
Gosh-GFP. Green signal comes from GFP
C D
molecules and blue signal comes from
Figure by MIT OCW. DAPI molecules.

c) What do these images suggest? Circle all that apply.

i) GOSH contains an NLS.
ii) GFP contains an NLS.
iii) GOSH-GFP is transported into the central vacuole.
iv) GOSH-GFP is synthesized by ribosomes on rough ER.
v) GOSH-GFP is a part of the nuclear pore complex.

d) You intend to find out which part of the Gosh protein causes the phenomenon seen in part B.
How would you do it? (Please keep your answer within 20 words. Do NOT go into technical details.
Just write down the principle of your experiment briefly.)
6
Question 4:

A human geneticist next door comes to you to discuss a hyperactive human mutant, who
in his bone marrow can convert a small amount of adenosine into caffeine. After doing
some research, you find out that this person grew up in a region where Coffea mirus (a
coffee tree) was abundant. At age 10, he had a viral infection during a viral epidemic in
Coffea mirus.

a) You want to find out if a known enzyme that makes caffeine in Coffea mirus is
expressed in the human mutant’s bone marrow. Which of the following methods would
you use?

i) Create a cDNA library from the mutant’s bone marrow. Then probe for the cDNA encoding
the enzyme in the library.

ii) Create a genomic DNA library from the mutant’s bone marrow. Then probe for the gene
encoding the enzyme in the library.

iii) Create a genomic DNA library from the Coffea mirus tree. Then probe for the gene encoding
the enzyme in the library.

iv) Create an rDNA library from the mutant’s bone marrow. Then probe for the rDNA of the
enzyme in the library.

v) Create an rRNA library from the mutant’s bone marrow. Then probe for the rRNA of the
enzyme in the library.

b) Suppose you do find the coffee-tree enzyme expressed in the mutant’s bone marrow.
What is a likely vehicle that transferred the gene from the coffee tree to the human
mutant? [Give a very short yet concise answer, please.]

We hope you liked this p-set. Please remember to hand it in by 4:40pm on Oct 21.