GENES, CHROMOSOMES & CANCER 32:302–310 (2001)

Fusion of the BCR and the Fibroblast Growth Factor

Receptor-1 (FGFR1) Genes as a Result of
t(8;22)(p11;q11) in a Myeloproliferative Disorder:
The First Fusion Gene Involving BCR But Not ABL
Thoas Fioretos,1* Ioannis Panagopoulos,1 Carin Lassen,1 Agneta Swedin,2 Rolf Billström,3 Margareth Isaksson,1
Bodil Strömbeck,1 Tor Olofsson,4 Felix Mitelman,1 and Bertil Johansson1
1
Department of Clinical Genetics, Lund University Hospital, Sweden
2
Department of Internal Medicine, Simrishamn Hospital, Sweden
3
Department of Internal Medicine, Section of Hematology, Lund University Hospital, Sweden
4
Department of Hematology, Lund University Hospital, Sweden

Constitutive activation of tyrosine kinases as a consequence of chromosomal translocations, forming fusion genes, plays an
important role in the development of hematologic malignancies, in particular, myeloproliferative syndromes (MPSs). In this
respect, the t(9;22)(q34;q11) that results in the BCR/ABL fusion gene in chronic myeloid leukemia is one of the best-studied
examples. The fibroblast growth factor receptor 1 (FGFR1) gene at 8p11 encodes a transmembrane receptor tyrosine kinase
and is similarly activated by chromosomal translocations, in which three alternative genes—ZNF198 at 13q12, CEP110 at 9q34,
and FOP at 6q27— become fused to the tyrosine kinase domain of FGFR1. These 8p11-translocations are associated with
characteristic morphologic and clinical features, referred to as “8p11 MPS.” In this study, we report the isolation and
characterization of a novel fusion gene in a hematologic malignancy with a t(8;22)(p11;q11) and features suggestive of 8p11
MPS. We show that the breakpoints in the t(8;22) occur within introns 4 and 8 of the BCR and FGFR1 genes, respectively. On
the mRNA level, the t(8;22) results in the fusion of BCR exons 1– 4 in-frame with the tyrosine kinase domain of FGFR1 as well
as in the expression of a reciprocal FGFR1/BCR chimeric transcript. By analogy with data obtained from previously charac-
terized fusion genes involving FGFR1 and BCR/ABL, it is likely that the oligomerization domain contributed by BCR is critical
and that its dimerizing properties lead to aberrant FGFR1 signaling and neoplastic transformation. © 2001 Wiley-Liss, Inc.

INTRODUCTION example of how chromosomal translocations result

To date, more than 500 recurrent chromosomal in fusion genes. This abnormality is found in more
translocations have been identified in hematologic than 90% of chronic myeloid leukemias (CMLs), in
malignancies (Mitelman et al., 2001). Many of 15–20% cases of adult acute lymphoblastic leuke-
these aberrations have been shown to result in mia (ALL), and occasionally in acute myeloid leu-
fusion genes (Look, 1998; Mitelman et al., 2001) kemia (AML) (Heim and Mitelman, 1995; Saw-
that, in principle, may be dichotomized into two yers, 1999). Through the 9;22-translocation, the
functionally different types: one that fuses genes tyrosine kinase gene ABL on chromosome 9 is
involved in the regulation of transcription and one fused to the BCR gene on chromosome 22. De-
that involves genes encoding proteins with tyrosine pending on the breakpoint position within BCR,
kinase activity. Although some genes have only this fusion results in at least three different BCR/
one known partner gene, several genes, e.g., MLL ABL proteins, designated P190, P210, and P230
and ETV6, are quite promiscuous, having a large BCR/ABL (Groffen and Heisterkamp, 1997; Saw-
number of various partners in different disease yers, 1999). That P190 and P210 BCR/ABL are
entities (Mitelman et al., 2001). During the last few leukemogenic is strongly supported by the devel-
years it has also become increasingly apparent that opment of hematologic malignancies in retroviral
the type of chromosomal aberration and/or specific
fusion gene present often is correlated with char-
Supported by: Swedish Cancer Society, the Swedish Child Cancer
acteristic clinicomorphologic features (Heim and Fund, and the Lund University Medical Faculty.
Mitelman, 1995; Look, 1998). *Correspondence to: Thoas Fioretos, MD, PhD, Department of
The Philadelphia chromosome (Ph), which in Clinical Genetics, University Hospital, SE-221 85 Lund, Sweden.
E-mail: Thoas.Fioretos@klingen.lu.se
the majority of the cases is generated by the recip- Received 14 March 2001; Accepted 21 May 2001
rocal t(9;22)(q34;q11), remains the paradigmatic

© 2001 Wiley-Liss, Inc.

 FUSION OF THE BCR AND FGFR1 GENES 303
and transgenic animal models (Daley et al., 1990; appearing cells, and a trephine bone marrow biopsy
Heisterkamp et al., 1990; Kelliher et al., 1990; showed fibrosis. An immunophenotypic analysis of
Honda et al., 1998; Sawyers, 1999). peripheral blood revealed an increase of small poly-
The fibroblast growth factor receptor-1 (FGFR1) clonal B lymphocytes and larger immature myeloid
gene at 8p11 has recently been shown to be fused cells that were positive for HLA-DR, CD34,
with three structurally unrelated genes, i.e., CD117, CD13, and CD33. The blasts stained neg-
ZNF198 at 13q12, CEP110 at 9q34, and FOP at atively for Sudan Black B, myeloperoxidase, and
6q27, as the result of the translocations t(8;13)(p11; alpha naphtyl butyrate esterase. A diagnosis of un-
q12), t(8;9)(p11;q34), and t(6;8)(q27;p11), respec- classified MPS with transformation to AML was
tively (Popovici et al., 1998, 1999; Reiter et al., made, and treatment with cytarabine infusions and
1998; Smedley et al., 1998; Xiao et al., 1998; Gu- hydroxyurea was initiated. Apart from fatigue and a
asch et al., 2000). These variant 8p11 translocations slight splenomegaly, the patient is presently well,
are associated with quite characteristic morphologic with almost normal leukocyte and platelet counts.
and clinical features, collectively referred to as the
“8p11 myeloproliferative syndrome” (8p11 MPS), Cytogenetic and FISH Analyses
which includes a CML-like myeloid hyperplasia, Peripheral blood cells were investigated cytogenet-
marked eosinophilia, a high incidence of T-cell ically with standard procedures, and metaphase fluo-
non-Hodgkin’s lymphoma (NHL), and a propen- rescence in situ hybridization (FISH) analysis, probe
sity to rapid progression into AML (Inhorn et al., preparation, and labeling were performed as previ-
1995; Macdonald et al., 1995). ously described (Fioretos et al., 1999). The following
We here report that the BCR gene is involved in probes were used: a commercially available probe set
a variant fusion gene, generated by a t(8;22)(p11; (LSI™ bcr/abl dual-color translocation probe; Vysis,
q11), which fuses BCR in-frame with the FGFR1 Downers Grove, IL) that includes a BCR probe ex-
gene. tending approximately 300 kb from exons 13 and 14
(M-bcr exons 2 and 3) toward the centromere (hence,
MATERIALS AND METHODS also covering the m-bcr breakpoint in ALL), and an
ABL probe that begins between exons 4 and 5 and
Case History extends about 200 kb toward the telomere of chro-
A 75-year-old man was examined because of a mosome 9; a yeast artificial chromosome (YAC) clone
short history of slightly elevated liver enzymes. He (yWPR415/D107F9, obtained from the Center for
was previously healthy, apart from a myocardial Genetics in Medicine, Washington University School
infarction 2 years earlier. The peripheral blood of Medicine, St. Louis, MO) containing the entire
count revealed a leukocytosis of 19 ⫻ 109/l, with BCR gene (Lengauer et al., 1992); and a YAC clone
52% neutrophils, 7% eosinophils, 1% basophils, (899e2, obtained from CEPH, Paris, France) covering
24% lymphocytes, 6% monocytes, 3% myelocytes, the FGFR1 gene (Reiter et al., 1998; Smedley et al.,
and 7% blasts, a hemoglobin level of 123 g/l, and a 1998). In addition, commercially available whole-
normal platelet count with some giant platelets. chromosome painting (wcp) probes for chromosomes
The bone marrow smears were hypercellular and 8, 9, 21, and 22, as well as subtelomeric 9q and 22q
contained relatively few megakaryocytes. Eosino- probes, were used.
philia (6%) and basophilia (3%) were noted. Blasts
were increased to 20% and had the appearance of Southern Blot Analysis
myeloblasts, but with a fraction resembling High-molecular-weight DNA was isolated from
megakaryoblasts with dense homogenous chroma- peripheral blood cells according to standard proce-
tin and cytoplasmic blebs. No dysplastic changes dures. Ten micrograms of DNA were digested with
were seen and no Auer rods were found. Small BglII, BamHI, EcoRI, and HindIII, and electropho-
lymphocytes constituted 37% of nucleated bone resed through 0.8% agarose gels. The DNA was
marrow cells. A few weeks later, the white blood subsequently transferred onto nylon membrane fil-
cell count had increased to 37 ⫻ 109/l and the ters (GeneScreen Plus; NEN Life Science Prod-
platelets had decreased to 85 ⫻ 109/l. The differ- ucts, Boston, MA), and hybridized with probes la-
ential count was essentially unchanged except for a beled with [␣-32P]dCTP using a random labeling
somewhat larger proportion of blast cells (9%) and system (Amersham Pharmacia Biotech UK Lim-
for the presence of a few erythroblasts. At this time, ited; Amersham Place, UK). To detect a possible
the bone marrow smears displayed maximal cellu- rearrangement within M-bcr, where the great ma-
larity with 30% blasts and 35% small lymphoid- jority of the breakpoints in CML occur (Groffen
304 FIORETOS ET AL.

TABLE 1. Primers Used for PCR and Sequencing

Primer Primer
set designation Sequence (5⬘ 3 3⬘) Direction Localization

1 3029U21 GGGCCAAGGAGACCAGTGAGT F BCR (intron 4)

3561L21 AACAGCCAGCCTGAGGTAGGG R BCR (intron 4)
2 5837U21 CCAAGGCTGGGAGGCACTCAG F BCR (intron 4)
6329L21 ATCTCTGGGCCCCACAACACC R BCR (intron 4)
3 FGFR1U22 ACATCGAGGTGAATGGGAGCAA F FGFR1 (exons 5–6)
FGFR1L21 TTGGAGGAGAGCTGCTCCTCT R FGFR1 (exon 12)
4a 1449U20 CCCCGGAGTTTTGAGGATTG F BCR (exon 1)
3534L21 TGGCGTGATGTAGTTGCTTGG R ABL (exon 3)
4b 1611U19 CAGAACTCGCAACAGTCCT F BCR (exon 1)
3478L21 ACCATTCCCCATTGTGATTAT R ABL (exon 3)
5a 3046U20 CTGACTATGAGCGTGCAGAGT F BCR (exon 12)
3695L21 TACACCCTCCCTTCGTATCTC R ABL (exon 3)
5b 3180U21 ATTCCGCTGACCATCAATAAG F BCR (exon 12)
3541L21 TGTTGACTGGCGTGATGTAGT R ABL (exon 3)
6a 1449U20 CCCCGGAGTTTTGAGGATTG F BCR (exon 1)
3496L19 CGGTTGGGTTTGTCCTTGT R FGFR1 (exon 9)
6b 1611U19 CAGAACTCGCAACAGTCCT F BCR (exon 1)
3373L21 CGGGAAGCTCATACTCAGAGA R FGFR1 (exon 9)
7a 3046U20 CTGACTATGAGCGTGCAGAGT F BCR (exon 12)
3496L19 CGGTTGGGTTTGTCCTTGT R FGFR1 (exon 9)
7b 3180U21 ATTCCGCTGACCATCAATAAG F BCR (exon 12)
3373L21 CGGGAAGCTCATACTCAGAGA R FGFR1 (exon 9)
8a 747U21 GTATACGTGCTTGGCGGGTAA F FGFR1 (exon 7)
1329L21 GGGGTGTGATCTCCTCATTGA R BCR (exon 8)
8b 902U21 TGGTGGGGTCGGTCATCGTCT F FGFR1 (exon 8)
1212L21 CCAGCGTGCTCCTCGTCACAC R BCR (exon 7)
9a 2558U21 TTGTTGTGGGCACTTCTCACC F BCR (intron 4)
7081L21 GAACCAGAAGAACCCCAGAGT R FGFR1 (exon 9)
9b 3029U21 GGGCCAAGGAGACCAGTGAGT F BCR (intron 4)
8000L21 CAAGCTGGCCTTTCTGGACTT R FGFR1 (intron 8)
F, forward primer; R, reverse primer.

and Heisterkamp, 1997) a 1.2 kb HindIII/BglII and allel, was performed for the following possible fu-
a 2 kb BglII/HindIII probe were used. Additional sion gene variants (the primer designation and their
probes were generated by PCR of genomic DNA or positions are given in parentheses): P190 BCR/ABL
cDNA (see below) using different primer sets (Ta- (primer set 4a and b; BCR exon 1/ABL exon 3),
ble 1) and included a 331 bp probe from the 5⬘ part P210 BCR/ABL (primer set 5a and b; BCR exon
of BCR intron 4 (primer set 1), a 513 bp probe from 12/ABL exon 3), BCR/FGFR1 (primer set 6a and b;
the 3⬘ part of BCR intron 4 (primer set 2), and a BCR exon 1/FGFR1 exon 9), BCR/FGFR1 (primer
cDNA probe from FGFR1 including exons 7–11 set 7a and b; BCR exon 12/FGFR1 exon 9), and
(primer set 3). Hybridization and washing were FGFR1/BCR (primer set 8a and b; FGFR1 exon 7
performed as previously described (Fioretos et al., and 8/BCR exon 8 and 7).
1993). To identify the BCR/FGFR1 breakpoint at the
genomic level, several 5⬘ primers located within
RT-PCR, Genomic PCR, and Sequence Analyses BCR exon 4 or intron 4, and 3⬘ primers placed
Total RNA was extracted from peripheral blood within FGFR1 intron 8 or exon 9, were constructed.
using the Trizol reagent according to the manufac- The sequences of the primer set (9a and b) that
turer’s instructions (GibcoBRL, Life Technolo- successfully amplified the breakpoint at the
gies, Stockholm, Sweden). Five micrograms of total genomic level are given in Table 1.
RNA were reversely transcribed in a 20 ␮l reaction Genomic PCR and RT-PCR reactions were per-
volume using random hexamers as described pre- formed in 50 ␮l reaction mixtures containing 20
viously (Fioretos et al., 1993). The different primer mM Tris-HCl pH 8.0, 1.25 mM MgCl2, 0.2 mM of
sets used for RT-PCR are listed in Table 1. Single- each dNTP, 1 unit PlatinumTaq DNA polymerase
step PCR, using two different primer pairs in par- (GibcoBRL), 0.5 ␮M of each primer, and 1 ␮l
 FUSION OF THE BCR AND FGFR1 GENES 305
cDNA or 200 ng DNA as template. The reactions
were run in a thermal cycler (PTC-200; MJ Re-
search, Cambridge, MA) and initiated with a pri-
mary denaturation step at 95°C for 5 min, followed
by a reaction profile of 35 cycles of 95°C for 30 sec,
60°C for 30 sec, 72°C for 1 min, and a final exten-
sion for 10 min at 72°C. Fifteen microliters of the
PCR products were analyzed by electrophoresis
through 1–2% agarose gels, stained with ethidium
bromide, and photographed.
For sequence analysis, the obtained PCR frag-
ments were excised from the gels and purified using
the QIAquick gel extraction kit protocol (Qiagen,
Hilden, Germany), according to the manufacturer’s
instructions. Direct sequencing of the purified DNA
was performed with the Big Dye sequencing kit (PE Figure 1. Partial karyotype and FISH analysis of the t(8;22). FISH
Applied Biosystems, Warrington, UK) in an ABI analysis with probes specific for BCR (red), ABL (green), and FGFR1
(YAC 899e2, yellow) revealed colocalization of the BCR and FGFR1
PRISM 377 DNA sequencer (PE Applied Biosys- signals (white arrows) at both derivative chromosomes 8 and 22,
tems). Computer analyses of the obtained sequences whereas the ABL signals remained intact at 9q34. A partial karyotype of
the normal and derivative chromosomes 8 and 22 is inserted at the
were performed using BLAST and ORF finder soft- bottom to the left.
ware (http://www.ncbi.nlm.nih.gov/). For the detec-
tion of repeat elements and recombinogenic se-
quence motifs, the RepeatMasker (http://ftp.genome.
washington.edu/cgi-bin/RepeatMasker) and FindPat- Identification of BCR/FGFR1 and FGFR1/BCR Fusion
terns (Genetics Computer Group, Madison, WI) pro- Transcripts
grams were used. The previously reported three chimeric genes
involving FGFR1 all lead to a fusion of the 5⬘
RESULTS partner gene in-frame to exons 9 –16 of FGFR1
encoding the split tyrosine kinase domain (Popo-
Involvement of the BCR and the FGFR1 Genes in vici et al., 1998, 1999; Reiter et al., 1998; Smedley
the t(8;22) et al., 1998; Xiao et al., 1998; Guasch et al., 2000),
The cytogenetic analysis revealed the karyotype whereas fusion of BCR exon 1 (m-bcr) or 13/14
46,XY,t(8;22)(p11;q11),?dup(9)(q34q34). Further (M-bcr) to ABL exon 2 results in the P190 and P210
characterization of the suspected duplication at BCR/ABL fusion genes in Ph-positive leukemias
9q34, using subtelomeric 9q and wcp 21 probes, (Groffen and Heisterkamp, 1997; Sawyers, 1999).
revealed a reciprocal t(9;21)(q34;q22), with a break- Using RT-PCR with two paired primer sets located
point distal to the ABL locus (not shown). The in BCR exon 1 and FGFR1 exon 9, two fragments
reciprocal translocation t(8;22) was confirmed by of 1,050 and 750 bp, respectively, were obtained
FISH with wcp 8 and 22 (not shown). Using the (Fig. 2). The sizes of the obtained PCR products
BCR/ABL probe set, the BCR probe displayed a suggested that additional sequences apart from
split signal, with signals at both the derivative (der) BCR exon 1 were included in the fusion transcript.
chromosomes 8 and 22, whereas the ABL probe Indeed, sequence analysis revealed that BCR exon
remained intact at 9q34 (not shown). Given the 4 was fused in-frame with FGFR1 exon 9 (Fig. 3).
known localization of the FGFR1 gene at 8p11, the No fragments were amplified when using BCR
fact that it encodes a protein with tyrosine kinase exon 12 primers together with FGFR1 exon 9 prim-
activity, and its known involvement in 8p11 MPS, ers or primer sets designed to detect the 190 BCR/
a YAC clone (899e2) containing the FGFR1 gene ABL (primer set 4a and b) or P210 BCR/ABL (prim-
was hybridized together with the BCR/ABL probe er set 5a and b) associated with Ph-positive
set. Colocalization of BCR and FGFR1 signals at leukemias (not shown).
both der(8) and der(22) was found (Fig. 1), suggest- To investigate whether the reciprocal FGFR1/
ing a fusion of these two genes. The same result BCR fusion transcript was also expressed, RT-PCR
was obtained when using a YAC clone containing was performed using forward primers in FGFR1
BCR (yWPR415/D107F9) together with the exons 7 and 8 together with reverse primers in BCR
FGFR1 YAC clone 899e2 (not shown). exons 8 and 7 (primer set 8a and b). As shown in
306 FIORETOS ET AL.

Figure 2. RT-PCR analysis showing the expression of a BCR/FGFR1 Figure 4. RT-PCR analysis showing the expression of a reciprocal
fusion transcript. PCR of t(8;22) cDNA with two different primer sets FGFR1/BCR fusion transcript. PCR of t(8;22) cDNA using two different
located in BCR exon 1 and FGFR1 exon 9 (primer set 6a and 6b, Table primer pairs located in FGFR1 exon 7 and BCR exon 8 (primer set 8a,
1) resulted in fragments of approximately 1,050 (lane 1) and 750 bp Table 1) or in FGFR1 exon 8 and BCR exon 7 (primer set 8b) resulted
(lane 2), respectively. No fragments were obtained with two different in fragments of approximately 600 (lane 1) and 350 bp (lane 2), respec-
primer sets (primer sets 7a and 7b) located in BCR exon 12 and FGFR1 tively. No fragments were obtained using a negative control (K562)
exon 9 (lanes 3 and 4). Lane 5, blank water control; M, 100 bp DNA cDNA with the same primer combinations (lanes 3 and 4). Lane 5, blank
ladder. water control; M, 100 bp DNA ladder.

Figure 5. Sequence analysis of the FGFR1/BCR fusion transcript. A

partial sequence chromatogram of the FGFR1/BCR junction is shown at
the top. At the bottom, the nucleotide sequence of the amplified
fragment as determined by sequence analysis is depicted (EMBL Acc.
No. AJ298917). The arrows indicate the in-frame fusion junction of
FGFR1 exon 8 with BCR exon 5. Vertical lines in the lower sequence
indicate exon boundaries. The primers 902U21 and 1212L21 (primer
set 8b, Table 1) are underlined.

Figure 3. Sequence analysis of the BCR/FGFR1 fusion transcript. A

partial sequence chromatogram of the BCR/FGFR1 junction is shown at
the top. At the bottom, the nucleotide sequence of the amplified with BCR exon 5. Direct sequencing of the smaller
fragment as determined by direct sequencing is depicted (EMBL Acc. fragment confirmed the in-frame fusion (Fig. 5).
No. AJ298916). The arrows indicate the in-frame fusion junction of BCR
exon 4 with FGFR1 exon 9. Vertical lines in the lower sequence indicate
exon boundaries. The primers 1611U19 and 3373L21 (primer set 6b, Genomic Breakpoint Characterization
Table 1) are underlined.
The fusion points of the BCR/FGFR1 and the
reciprocal FGFR1/BCR cDNAs suggested that the
Figure 4, the two primer sets weakly amplified genomic breakpoints had occurred in the 6,868 bp
fragments of approximately 600 and 350 bp, re- large intron 4 of BCR (GenBank Acc. No. U07000;
spectively, suggesting a fusion of FGFR1 exon 8 nt 95.619-102.485) and in the 1,160 bp large intron
 FUSION OF THE BCR AND FGFR1 GENES 307

Figure 6. Autoradiogram showing rearrangement of the FGFR1

gene. Southern blot analysis using the FGFR1 cDNA probe revealed Figure 7. Genomic PCR of the BCR/FGFR1 fusion gene. Genomic
rearranged fragments (indicated by arrows) in BamHI, BglII, and EcoRI PCR using primers located in BCR intron 4 and FGFR1 exon 9 (primer
digested DNA obtained from the leukemic peripheral blood cells (lane set 9a, Table 1) resulted in a fragment of approximately 1,800 bp in
1), but not in two normal control DNAs (lanes 2 and 3). Size marker, DNA obtained from the leukemic peripheral blood cells (lane 1), but
HindIII-digested lambda DNA. not in two normal control DNAs (lanes 2 and 3). M, 1 kb DNA ladder.

8 of FGFR1 (Acc. No. AJ007697), respectively. To

detect these rearrangements, Southern blot analy-
ses were performed using two BCR intron 4-de-
rived probes and an FGFR1 cDNA probe. Because
of repetitive sequences contained within the BCR
probes (see below), no conclusive results were ob-
tained as regards the presence of a BCR intron 4
rearrangement, whereas the FGFR1 cDNA probe Figure 8. Sequence analysis of the BCR/FGFR1 fusion gene. A partial
clearly revealed rearranged fragments in BamHI, sequence chromatogram of the genomic BCR/FGFR1 junction sequence
BglII, and EcoRI digestions (Fig. 6). As expected, is shown at the top. The arrow indicates the junction between the two
genes. At the bottom, parts of normal BCR intron 4 (top), BCR/FGFR1
no rearrangement was detected within the M-bcr of (middle), and normal FGFR1 sequences (bottom) have been aligned. The
BCR (not shown). partial BCR/FGFR1 sequence has been assigned EMBL Acc. No.
AJ298918.
Using genomic PCR with forward primers lo-
cated within BCR intron 4 and reverse primers in
FGFR1 intron 8 or exon 9, fragments with size Database searches (RepeatMasker) revealed that
differences consistent with breakpoints within at least nine repeat elements were present in BCR
these introns were obtained. The most distinctly intron 4, among them three AluSx elements lo-
amplified fragment was approximately 1,800 bp cated at nt 21–191, 4,541– 4,847, and 4,848 –5,140.
(Fig. 7). Partial sequence analysis of this fragment One repeat element, THE1B, was identified at nt
(Fig. 8) showed that nt 3,064 of BCR intron 4 (nt 348 – 686 of FGFR1 intron 8. However, neither of
98,683 of GenBank Acc. No. U07000) was joined to the two breakpoints occurred within these repeat
nt 26 of FGFR1 intron 8 (nt 26 of GenBank Acc. elements. Searches (FindPatterns) for putative re-
No. AJ007697). combinogenic sequence motifs were also per-
308 FIORETOS ET AL.

formed using sequences 100 bp up- and down- in a significant fraction (30 –50%) of Ph-positive
stream of the breakpoints. The motifs included the ALL (Groffen and Heisterkamp, 1997; Faderl et
heptamer-nonamer recombination signal (Tycko al., 1999; Sawyers, 1999). A third, rare variant—
and Sklar, 1990), the DNA topoisomerase II bind- P230 BCR/ABL—fuses exons 1–19 of BCR with
ing and cleavage site (Spitzner and Muller, 1988; ABL and has been identified mainly in patients
Negrini et al., 1993), chi-like sequences (Krowc- with chronic neutrophilic leukemia (Faderl et al.,
zynska et al., 1990; Wyatt et al., 1992), the translin 1999; Sawyers, 1999).
binding consensus sequence (Aoki et al., 1995), FGFR1 is a transmembrane receptor tyrosine
alternating polypurine-polypyrimidine stretches kinase and a member of a family that includes at
(Boehm et al., 1989), and guanine-rich elements least four FGFRs (FGFR1-4) (Johnson and Wil-
(Knapp et al., 1994). One guanine-rich element liams, 1993). FGFR1 encodes a protein with an
(GGNNGG), starting at nt ⫹53 relative to the extracellular ligand-binding domain that contains
breakpoint, was present in BCR intron 4. In the three immunoglobulin-like domains, a single trans-
FGFR1 gene, three chi-like elements (CC- membrane domain, and a cytoplasmic tyrosine ki-
WSYVK), at -88, -51, and ⫹10 relative to the break- nase domain. Ligand binding leads to receptor
point and one guanine-rich element (⫹34 bp) were dimerization and subsequent tyrosine autophos-
identified. None of the other recombinogenic se- phorylation and phosphorylation of target proteins,
quence motifs were found. thereby triggering multiple signaling pathways
(Mason, 1994; Goldfarb, 1996; Kouhara et al., 1997;
DISCUSSION Klint and Claesson-Welsh, 1999). Signaling
We here report the first fusion gene involving through FGFR1 has been shown to affect cellular
BCR, but not its common partner gene ABL, in a proliferation, differentiation, and migration in a va-
hematologic malignancy cytogenetically character- riety of cellular systems (Berardi et al., 1995; Rata-
ized by t(8;22)(p11;q11). On the molecular level, jczak, 1997; Klint and Claesson-Welsh, 1999; Fa-
this translocation leads to the expression of both loon et al., 2000).
BCR/FGFR1 and the reciprocal FGFR1/BCR fusion Involvement of FGFR1 in leukemogenesis is
gene. The morphologic and clinical features ob- suggested by the recent identification of leukemia-
served were very similar to what has been de- specific fusion genes, in which three genes have
scribed in other 8p11 MPSs (Inhorn et al., 1995; been reported to be fused in-frame with the ty-
Macdonald et al., 1995). The patient presented rosine kinase domain of FGFR1. The genes—
with myeloid hyperplasia characterized by slight ZNF198, CEP110, and FOP—were all identified as
eosinophilia and, a few weeks later, the disorder 5⬘ partner genes of FGFR1 upon characterization of
progressed toward AML. Apart from an unex- variant 8p11-translocations (Popovici et al., 1998,
plained polyclonal B-cell expansion, there were no 1999; Reiter et al., 1998; Smedley et al., 1998; Xiao
signs of lymphoid involvement such as lymphade- et al., 1998; Guasch et al., 2000). Although these
nopathy or T-cell NHL, features that are frequent genes are unrelated and have different subcellular
(60%) during the course of 8p11 MPS (Inhorn et localizations, a significant feature shared by the
al., 1995). proteins is the presence of homodimerization mo-
The BCR gene was originally isolated as the tifs, which include a proline-rich region in ZNF198
translocation partner to ABL, and the resulting (Xiao et al., 2000), a leucine-rich region in FOP
BCR/ABL fusion was the first hybrid gene de- (Popovici et al., 1999), and leucine zippers in
scribed in neoplasia (Heisterkamp et al., 1985; CEP110 (Guasch et al., 2000). Thus, as also sug-
Shtivelman et al., 1985; Grosveld et al., 1986; Mes- gested by functional studies of ZNF198/FGFR1
Masson et al., 1986). Two main types of BCR/ABL (Ollendorff et al., 1999; Xiao et al., 2000) and
chimeras have been identified: in P190 BCR/ABL CEP110/FGFR1 (Guasch et al., 2000), the dimer-
the first BCR exon is fused to exons 2–11 of ABL, ization mediated by the different 5⬘ partner genes
and in P210 BCR/ABL exons 1–13/14 are fused to is most likely the mechanism underlying the con-
the same ABL exons. The resulting fusion proteins stitutive activation of the FGFR1 tyrosine kinase
show deregulated tyrosine kinase activity and acti- activity.
vate multiple signal transduction pathways (Grof- In the present case, BCR exons 1– 4 were fused
fen and Heisterkamp, 1997; Faderl et al., 1999; in-frame to FGFR1 exon 9. The 160 kDa BCR
Sawyers, 1999). Whereas P190 BCR/ABL almost protein contains several distinct domains, including
exclusively is associated with Ph-positive ALL, an oligomerization domain, an ABL SH2-binding
P210 is seen in the vast majority of CML and also domain, and a region displaying serine/threonine
 FUSION OF THE BCR AND FGFR1 GENES 309
kinase activity (Maru and Witte, 1991; Pendergast of BCR are of importance for the transforming
et al., 1991; McWhirter et al., 1993). All of these, activity BCR/FGFR1 must await further studies.
which are encoded by BCR exon 1, are included in In conclusion, we describe a novel chimeric gene
the chimeric BCR/FGFR1 protein. In addition, a that fuses BCR exon 4 in-frame with the cytoplas-
segment (approximately 80 amino acids) of the mic tyrosine kinase domain of FGFR1. Altogether,
DBL proto-oncogene homology (DH-) domain four chimeric genes (BCR/FGFR1, ZNF198/
(Ron et al., 1991) (Swiss-Prot Acc. No. P11274; aa FGFR1, CEP110/FGFR1, and FOP/FGFR1) in-
505– 696) is retained. Previous studies have shown volving FGFR1 have now been identified in hema-
that activation of ABL in P210 and P190 BCR/ABL tologic malignancies characterized by similar
is mediated by the N-terminal oligomerization do- morphologic and clinical features. A constitutive
main (aa 1– 64), and that a deletion of this segment activation of the FGFR1 tyrosine kinase activity,
reduces BCR/ABL tyrosine kinase activity and mediated by dimerization/oligomerization motifs
transforming capability. Hence, by analogy with provided by the different 5⬘ fusion partners, and an
data obtained from previously characterized altered subcellular localization most likely lead to
FGFR1 fusion genes (Ollendorff et al., 1999; Gu- aberrant FGFR1 signaling and neoplastic transfor-
asch et al., 2000; Xiao et al., 2000), we believe that mation. Further identification and characterization
the oligomerization domain contributed by BCR is of similar fusion genes will undoubtedly provide
critical and that its dimerizing properties lead to a important insights into normal and leukemic hema-
constitutive activation of FGFR1. topoiesis. In addition, their detection at diagnosis
The reciprocal FGFR1/BCR transcript was also may become increasingly important, given the re-
found, although at a lower level (Fig. 4). This cent promising development of tyrosine kinase in-
putative chimeric protein includes the extracellular hibitory drugs (Druker and Lydon, 2000).
and transmembrane regions of FGFR1 fused to the
REFERENCES
remaining part of the DH domain, the pleckstrin
Aoki K, Suzuki K, Sugano T, Tasaka T, Nakahara K, Kuge O, Omori
homology domain, as well as the C-terminal part of A, Kasai M. 1995. A novel gene, Translin, encodes a recombina-
BCR, which encodes a GTPase-activating protein tion hotspot binding protein associated with chromosomal trans-
locations. Nat Genet 10:167–174.
(GAP) that is active on members of the RHO Berardi AC, Wang A, Abraham J, Scadden DT. 1995. Basic fibroblast
protein family (Diekmann et al., 1991). However, growth factor mediates its effects on committed myeloid progen-
itors by direct action and has no effect on hematopoietic stem
we deem it unlikely that this reciprocal fusion cells. Blood 86:2123–2129.
protein is of pathogenetic significance, although Boehm T, Mengle-Gaw L, Kees UR, Spurr N, Lavenir I, Forster A,
Rabbitts TH. 1989. Alternating purine-pyrimidine tracts may pro-
additional functional studies are needed to clarify mote chromosomal translocations seen in a variety of human
this issue. lymphoid tumours. EMBO J 8:2621–2631.
Daley GQ, Van Etten RA, Baltimore D. 1990. Induction of chronic
Using PCR, we were able to characterize the myelogenous leukemia in mice by the P210bcr/abl gene of the
breakpoints within BCR and FGFR1 at the Philadelphia chromosome. Science 247:824 – 830.
Diekmann D, Brill S, Garrett MD, Totty N, Hsuan J, Monfries C,
genomic level. Sequence analysis showed that in- Hall C, Lim L, Hall A. 1991. Bcr encodes a GTPase-activating
tron 4 of BCR was fused with intron 8 of FGFR1. A protein for p21rac. Nature 351:400 – 402.
Druker BJ, Lydon NB. 2000. Lessons learned from the develop-
breakpoint in BCR intron 4 has never been re- ment of an abl tyrosine kinase inhibitor for chronic myelogenous
ported in Ph-positive leukemias, whereas intron 8 leukemia. J Clin Invest 105:3–7.
Faderl S, Talpaz M, Estrov Z, Kantarjian HM. 1999. Chronic my-
breaks in FGFR1 are consistently detected in 8p11 elogenous leukemia: biology and therapy. Ann Intern Med 131:
MPS (Kulkarni et al., 1999). Apart from two gua- 207–219.
Faloon P, Arentson E, Kazarov A, Deng CX, Porcher C, Orkin S,
nine-rich elements, localized approximately 30 –50 Choi K. 2000. Basic fibroblast growth factor positively regulates
nucleotides 3⬘ of the two breakpoints, no repeat hematopoietic development. Development 127:1931–1941.
Fioretos T, Nilsson PG, Aman P, Heim S, Kristoffersson U, Malm C,
elements or other recombinogenic sequence motifs Simonsson B, Turesson I, Mitelman F. 1993. Clinical impact of
were identified adjacent to the breakpoints. Thus, breakpoint position within M-bcr in chronic myeloid leukemia.
Leukemia 7:1225–1231.
the observed breakpoints most likely reflect a se- Fioretos T, Strömbeck B, Sandberg T, Johansson B, Billström R,
lection of cells carrying this particular rearrange- Borg A, Nilsson PG, Van Den Berghe H, Hagemeijer A, Mitelman
F, Höglund M. 1999. Isochromosome 17q in blast crisis of chronic
ment, because it results in an in-frame fusion pro- myeloid leukemia and in other hematologic malignancies is the
tein with leukemogenic properties. As discussed result of clustered breakpoints in 17p11 and is not associated with
coding TP53 mutations. Blood 94:225–232.
above, the critical part contributed by BCR is prob- Goldfarb M. 1996. Functions of fibroblast growth factors in verte-
ably the oligomerization domain encoded by exon brate development. Cytokine Growth Factor Rev 7:311–325.
Groffen J, Heisterkamp N. 1997. The chimeric BCR-ABL gene.
1. This exon is, however, out-of-frame with FGFR1 Baillieres Clin Haematol 10:187–201.
exon 9, which may be a reason why additional BCR Grosveld G, Verwoerd T, van Agthoven T, de Klein A, Ramachan-
dran KL, Heisterkamp N, Stam K, Groffen J. 1986. The chronic
exons are included in the fusion gene. Whether myelocytic cell line K562 contains a breakpoint in bcr and pro-
sequences apart from the oligomerization domain duces a chimeric bcr/c-abl transcript. Mol Cell Biol 6:607– 616.
310 FIORETOS ET AL.

Guasch G, Mack GJ, Popovici C, Dastugue N, Birnbaum D, Rattner Mitelman F, Johansson B, Mertens F. 2001. Mitelman database of
JB, Pebusque MJ. 2000. FGFR1 is fused to the centrosome- chromosome aberrations in cancer. http://cgap.nci.nih.gov/Chro-
associated protein CEP110 in the 8p12 stem cell myeloprolifera- mosomes/Mitelman
tive disorder with t(8;9)(p12;q33). Blood 95:1788 –1796. Negrini M, Felix CA, Martin C, Lange BJ, Nakamura T, Canaani E,
Heim S, Mitelman F. 1995. Cancer cytogenetics, 2 ed. New York: Croce CM. 1993. Potential topoisomerase II DNA-binding sites at
Wiley-Liss. the breakpoints of a t(9;11) chromosome translocation in acute
Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G. 1985. myeloid leukemia. Cancer Res 53:4489 – 4492.
Structural organization of the bcr gene and its role in the Ph1 Ollendorff V, Guasch G, Isnardon D, Galindo R, Birnbaum D,
translocation. Nature 315:758 –761. Pebusque MJ. 1999. Characterization of FIM-FGFR1, the fusion
Heisterkamp N, Jenster G, ten Hoeve J, Zovich D, Pattengale PK, product of the myeloproliferative disorder-associated t(8;13) trans-
Groffen J. 1990. Acute leukaemia in bcr/abl transgenic mice. location. J Biol Chem 274:26922–26930.
Nature 344:251–253. Pendergast AM, Muller AJ, Havlik MH, Maru Y, Witte ON. 1991.
Honda H, Oda H, Suzuki T, Takahashi T, Witte ON, Ozawa K, BCR sequences essential for transformation by the BCR-ABL
Ishikawa T, Yazaki Y, Hirai H. 1998. Development of acute oncogene bind to the ABL SH2 regulatory domain in a non-
lymphoblastic leukemia and myeloproliferative disorder in trans- phosphotyrosine-dependent manner. Cell 66:161–171.
genic mice expressing p210bcr/abl: a novel transgenic model for
Popovici C, Adelaide J, Ollendorff V, Chaffanet M, Guasch G, Jacrot
human Ph1-positive leukemias. Blood 91:2067–2075.
M, Leroux D, Birnbaum D, Pebusque MJ. 1998. Fibroblast
Inhorn RC, Aster JC, Roach SA, Slapak CA, Soiffer R, Tantravahi R,
Stone RM. 1995. A syndrome of lymphoblastic lymphoma, eosin- growth factor receptor 1 is fused to FIM in stem-cell myelopro-
ophilia, and myeloid hyperplasia/malignancy associated with t(8; liferative disorder with t(8;13). Proc Natl Acad Sci USA 95:5712–
13)(p11;q11): description of a distinctive clinicopathologic entity. 5717.
Blood 85:1881–1887. Popovici C, Zhang B, Gregoire MJ, Jonveaux P, Lafage-Pochitaloff
Johnson DE, Williams LT. 1993. Structural and functional diversity M, Birnbaum D, Pebusque MJ. 1999. The t(6;8)(q27;p11) trans-
in the FGF receptor multigene family. Adv Cancer Res 60:1– 41. location in a stem cell myeloproliferative disorder fuses a novel
Kelliher MA, McLaughlin J, Witte ON, Rosenberg N. 1990. Induc- gene, FOP, to fibroblast growth factor receptor 1. Blood 93:1381–
tion of a chronic myelogenous leukemia-like syndrome in mice 1389.
with v-abl and BCR/ABL. Proc Natl Acad Sci USA 87:6649 – 6653. Ratajczak MZ. 1997. Fibroblast growth factors and early hemopoi-
Klint P, Claesson-Welsh L. 1999. Signal transduction by fibroblast etic cell development. Leuk Lymphoma 27:221–229.
growth factor receptors. Front Biosci 4:165–177. Reiter A, Sohal J, Kulkarni S, Chase A, Macdonald DH, Aguiar RC,
Knapp S, Delle Karth G, Friedl J, Purtscher B, Mitterbauer G, Goncalves C, Hernandez JM, Jennings BA, Goldman JM, Cross
Domer PH, Jaeger U. 1994. Guanine-rich (GGNNGG) elements NC. 1998. Consistent fusion of ZNF198 to the fibroblast growth
at chromosomal breakpoints interact with a loop-forming, single- factor receptor-1 in the t(8;13)(p11;q12) myeloproliferative syn-
stranded DNA-binding protein. Oncogene 9:1501–1505. drome. Blood 92:1735–1742.
Kouhara H, Hadari YR, Spivak-Kroizman T, Schilling J, Bar-Sagi D, Ron D, Zannini M, Lewis M, Wickner RB, Hunt LT, Graziani G,
Lax I, Schlessinger J. 1997. A lipid-anchored Grb2-binding pro- Tronick SR, Aaronson SA, Eva A. 1991. A region of proto-dbl
tein that links FGF-receptor activation to the Ras/MAPK signal- essential for its transforming activity shows sequence similarity to
ing pathway. Cell 89:693–702. a yeast cell cycle gene, CDC24, and the human breakpoint cluster
Krowczynska AM, Rudders RA, Krontiris TG. 1990. The human gene, bcr. New Biol 3:372–379.
minisatellite consensus at breakpoints of oncogene translocations. Sawyers CL. 1999. Chronic myeloid leukemia. N Engl J Med 340:
Nucleic Acids Res 18:1121–1127. 1330 –1340.
Kulkarni S, Reiter A, Smedley D, Goldman JM, Cross NC. 1999. Shtivelman E, Lifshitz B, Gale RP, Canaani E. 1985. Fused tran-
The genomic structure of ZNF198 and location of breakpoints in script of abl and bcr genes in chronic myelogenous leukaemia.
the t(8;13) myeloproliferative syndrome. Genomics 55:118 –121. Nature 315:550 –554.
Lengauer C, Riethman HC, Speicher MR, Taniwaki M, Konecki D, Smedley D, Hamoudi R, Clark J, Warren W, Abdul-Rauf M, Somers
Green ED, Becher R, Olson MV, Cremer T. 1992. Metaphase and G, Venter D, Fagan K, Cooper C, Shipley J. 1998. The t(8;
interphase cytogenetics with Alu-PCR-amplified yeast artificial 13)(p11;q11-12) rearrangement associated with an atypical myelo-
chromosome clones containing the BCR gene and the protoonco- proliferative disorder fuses the fibroblast growth factor receptor 1
genes c-raf-1, c-fms, and c-erbB-2. Cancer Res 52:2590 –2596.
gene to a novel gene RAMP. Hum Mol Genet 7:637– 642.
Look AT. 1998. The genetic basis of human cancer. Kinzler K,
Spitzner JR, Muller MT. 1988. A consensus sequence for cleavage
Vogelstein B, editors. New York: McGraw-Hill. p 109 –141.
Macdonald D, Aguiar RC, Mason PJ, Goldman JM, Cross NC. 1995. by vertebrate DNA topoisomerase II. Nucleic Acids Res 16:5533–
A new myeloproliferative disorder associated with chromosomal 5556.
translocations involving 8p11: a review. Leukemia 9:1628 –1630. Tycko B, Sklar J. 1990. Chromosomal translocations in lymphoid
Maru Y, Witte ON. 1991. The BCR gene encodes a novel serine/ neoplasia: a reappraisal of the recombinase model. Cancer Cells
threonine kinase activity within a single exon. Cell 67:459 – 468. 2:1– 8.
Mason IJ. 1994. The ins and outs of fibroblast growth factors. Cell Wyatt RT, Rudders RA, Zelenetz A, Delellis RA, Krontiris TG.
78:547–552. 1992. BCL2 oncogene translocation is mediated by a chi-like
McWhirter JR, Galasso DL, Wang JY. 1993. A coiled-coil oligomer- consensus. J Exp Med 175:1575–1588.
ization domain of Bcr is essential for the transforming function of Xiao S, Nalabolu SR, Aster JC, Ma J, Abruzzo L, Jaffe ES, Stone R,
Bcr-Abl oncoproteins. Mol Cell Biol 13:7587–7595. Weissman SM, Hudson TJ, Fletcher JA. 1998. FGFR1 is fused
Mes-Masson AM, McLaughlin J, Daley GQ, Paskind M, Witte ON. with a novel zinc-finger gene, ZNF198, in the t(8;13) leukaemia/
1986. Overlapping cDNA clones define the complete coding re- lymphoma syndrome. Nat Genet 18:84 – 87.
gion for the P210c-abl gene product associated with chronic my- Xiao S, McCarthy JG, Aster JC, Fletcher JA. 2000. ZNF198-FGFR1
elogenous leukemia cells containing the Philadelphia chromo- transforming activity depends on a novel proline-rich ZNF198
some. Proc Natl Acad Sci USA 83:9768 –9772. oligomerization domain. Blood 96:699 –704.