From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014.

For
personal use only.

2005 106: 3747-3754

doi:10.1182/blood-2005-05-2168 originally published online
August 18, 2005

Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML):

association with other gene abnormalities and previously established
gene expression signatures and their favorable prognostic significance
Roel G. W. Verhaak, Chantal S. Goudswaard, Wim van Putten, Maarten A. Bijl, Mathijs A. Sanders,
Wendy Hugens, André G. Uitterlinden, Claudia A. J. Erpelinck, Ruud Delwel, Bob Löwenberg and
Peter J. M. Valk

Updated information and services can be found at:

http://bloodjournal.hematologylibrary.org/content/106/12/3747.full.html
Articles on similar topics can be found in the following Blood collections
Clinical Trials and Observations (3829 articles)
Neoplasia (4212 articles)
Oncogenes and Tumor Suppressors (795 articles)

Information about reproducing this article in parts or in its entirety may be found online at:
http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

Information about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

Information about subscriptions and ASH membership may be found online at:
http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
CLINICAL TRIALS AND OBSERVATIONS

Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML):

association with other gene abnormalities and previously established gene
expression signatures and their favorable prognostic significance
Roel G. W. Verhaak, Chantal S. Goudswaard, Wim van Putten, Maarten A. Bijl, Mathijs A. Sanders, Wendy Hugens, André G. Uitterlinden,
Claudia A. J. Erpelinck, Ruud Delwel, Bob Löwenberg, and Peter J. M. Valk

Mutations in nucleophosmin NPM1 are the rosine kinase-3 gene (FLT3) internal tandem netic risk AML without FLT3 ITD mutations
most frequent acquired molecular abnor- duplication (ITD) mutations. NPM1 muta- but with NPM1 mutations have a signifi-
malities in acute myeloid leukemia (AML). tions associate inversely with the occur- cantly better overall survival (OS) and event-
We determined the NPM1 mutation status in rence of CCAAT/enhancer-binding protein-! free survival (EFS) than those without NPM1
a clinically and molecularly well-character- (CEBPA) and NRAS mutations. With respect mutations. Finally, in multivariable analysis
ized patient cohort of 275 patients with newly to gene expression profiling, we show that NPM1 mutations express independent favor-
diagnosed AML by denaturing high-perfor- AML cases with an NPM1 mutation cluster able prognostic value with regard to OS,
mance liquid chromatography (dHPLC). We in specific subtypes of AML with previously EFS, and disease-free survival (DFS). (Blood.
show that NPM1 mutations are significantly established gene expression signatures, are 2005;106:3747-3754)
underrepresented in patients younger than highly associated with a homeobox gene–
35 years. NPM1 mutations positively corre- specific expression signature, and can be
late with AML with high white blood cell predicted with high accuracy. We demon-
counts, normal karyotypes, and fms-like ty- strate that patients with intermediate cytoge- © 2005 by The American Society of Hematology

Introduction
Acute myeloid leukemia (AML) is a heterogeneous disease with of ribosomal proteins through the nuclear membrane.14-16 Disruption of
diverse genetic abnormalities and variable responsiveness to therapy. NPM1, either by chromosomal translocation or by mutation, results in
Cytogenetic analyses and molecular analyses are currently used to the cytoplasmic dislocation of NPM1. The high frequency of NPM1
risk-stratify AML. For instance, the translocations inv(16), t(8;21), mutations in AML with normal karyotypes and the observation that
and t(15;17) herald a favorable prognosis, whereas certain other cytoplasmic NPM1 cannot exert its normal functions as binding partner
cytogenetic aberrations indicate leukemia with intermediate or high and transporter protein lead to the notion that NPM1 mutation may be an
risk of relapse.1-5 Nevertheless, the classification of AML on the early event in leukemogenesis.
basis of karyotyping is still far from satisfactory. In recent years An important role for NPM1 in leukemias and lymphomas has
extended molecular analyses have yielded novel molecular markers been proposed previously. NPM1 has been found to be part of
important for proper diagnostics of AML. The internal tandem several fusion proteins that are formed as a result of chromosomal
duplication (ITD) in the fms-like tyrosine kinase-3 gene (FLT3),6,7 translocation and in which only the NPM1 N-terminal region is
partial tandem duplication (PTD)8,9 of the mixed lineage leukemia conserved. A t(2;5)(p23;q35) chromosomal translocation occurs in
gene (MLL), and increased expression of the transcription factor approximately 8% of non-Hodgkin lymphomas in children and
ecotropic virus integration site 1 (EVI1)10 are indicative of poor young adults and results in the chimeric fusion of NPM1 to ALK.17
prognosis. In contrast, mutations in the transcription factor CCAAT/ In rare cases of acute promyelocytic leukemia (APL), characterized
enhancer-binding protein-! (CEBPA) have been associated with a by chromosomal translocations that disrupt the gene encoding the
favorable response to therapy.11,12 A recent study showed mutations retinoic acid receptor (RARA), fusion of NPM1 to RARA was
in exon 12 of the gene encoding nucleophosmin NPM1 in shown.18 A t(3;5)(q25.1;q34) chromosomal translocation, infre-
approximately 35% of cases of de novo AML.13 Mutations in quently seen in myelodysplastic syndrome and AML, gives rise to a
NPM1 were found to be mutually exclusive with certain common fusion transcript of NPM1 and MLF1.19
recurrent chromosomal aberrations and are predominantly seen in Gene expression profiling is a powerful way to comprehen-
AML with normal karyotypes and FLT3 ITD mutations. sively classify individuals with AML and to further resolve the
NPM1 is predominantly localized in the nucleolus and is thought to heterogeneous nature of AML.20 Using this technique, new prognos-
function as a molecular chaperone of proteins, facilitating the transport tically relevant AML subtypes have been identified, while the

From the Departments of Hematology, Statistics, and Internal Medicine, An Inside Blood analysis of this article appears in the front of this issue.
Erasmus University Medical Center, Rotterdam, The Netherlands.
Reprints: Peter J. M. Valk, Erasmus University Medical Center Rotterdam,
Submitted June 1, 2005; accepted July 19, 2005. Prepublished online as Blood Department of Hematology, Ee1391a, Dr Molewaterplein 50, 3015 GE
First Edition Paper, August 18, 2005; DOI 10.1182/blood-2005-05-2168. Rotterdam Z-H, The Netherlands; e-mail: p.valk@erasmusmc.nl.
The publication costs of this article were defrayed in part by page charge
Supported by grants from the Dutch Cancer Society (Koningin Wilhelmina payment. Therefore, and solely to indicate this fact, this article is hereby
Fonds) and the Erasmus University Medical Center (Revolving Fund). marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
The online version of the article contains a data supplement. © 2005 by The American Society of Hematology

BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12 3747

 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
3748 VERHAAK et al BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12

presence of recurrent chromosomal abnormalities such as inv(16), ing with NPM1-REV using an ABI-PRISM3100 genetic analyzer (Applied
t(15;17), and t(8;21) as well as other molecular aberrations (eg, C- Biosystems, Foster City, CA).
and N-terminal mutations in CEBPA) could be predicted with high Sequence analyses for mutations in FLT3 (ITD and tyrosine kinase
accuracy by unique expression patterns.21-23 In a recent study, novel domain [TKD] mutation), N-RAS, K-RAS, and CEBPA were performed as
described previously.12,30,31
subtypes of AML have also been defined based on gene expression
profiling; however, the common molecular abnormalities in these
Gene expression profiling and unsupervised cluster analyses
AML subtypes are largely unknown.21 Because NPM1 is mutated
in approximately one third of AML patients, this molecular A total of 285 AML cases were analyzed using Affymetrix HGU133A
abnormality may drive the clustering of these AML subtypes. The GeneChips (Affymetrix, Santa Clara, CA).21 Unsupervised cluster analysis
effect of mutant NPM1 has been studied using gene expression on the basis of the gene expression profiles of the 285 cases of AML was
performed using the correlation view tool (version 3.6) of OmniViz
profiling and revealed a distinctive signature for NPM1 mutations.24
(Maynard, MA).21 The Pearson correlation values calculated in OmniViz
Among players in this signature were several homeodomain-containing
were subsequently imported into the MicroArray Data Explorer (MADEx),
family members of homeobox (HOX) transcription factors and CD34, which was developed in our laboratory. MADEx was used to visualize the
both observations being indicative of hematopoietic development.24 relations between the OmniViz unsupervised clustering results and other
However, it is currently not known whether NPM1 mutations are parameters, such as clinical and molecular characteristics of the AML
predictable on the basis of a gene expression signature. patients (Figure 1). MADEx is a database system that stores, mines, and
Cytoplasmic NPM1 has been positively associated with remis- visualizes microarray data in a secure and scalable manner.
sion rate13; however, the relation of mutant NPM1 with survival
outcome parameters remains to be elucidated. Significance analysis of microarrays (SAM)
We have studied a well-characterized cohort of 275 cases of de All supervised analyses were performed using significance analysis of
novo AML for the presence of a NPM1 mutations to (1) validate microarrays (SAM; version 1.21).32 A threshold was set for a minimum
denaturing high-performance liquid chromatography (dHPLC) as a change in expression of at least 1.5-fold. A false discovery rate (FDR) of
rapid approach to determine NPM1 mutations; (2) investigate the 0.01 was used to select the differentially expressed genes.
relation of NPM1 mutations with regard to clinical parameters,
cytogenetics, and various molecular abnormalities; (3) determine Prediction analysis of microarrays (PAM)
the relation of NPM1 mutations in subtypes of AML, recently All supervised class prediction analyses were performed by applying
identified by gene expression profiling21; (4) derive NPM1 mutation– prediction analysis of microarrays (PAM; version 2.0).33 The gene signature
specific and predictive gene expression signatures; and (5) deter- was selected based on the smallest prediction error in the training set and
mine the prognostic value of mutated NPM1. was subsequently tested using the test set. The positive predictive value was
calculated as follows: true positives/(true positives $ false positives).

Statistical analyses of survival

Patients, materials, and methods
Cytogenetic abnormalities were categorized in 3 cytogenetic groups for
Patients and cell samples statistical analyses. Patients with inv(16)/t(16;16), t(8;21), and t(15;17)
abnormalities were considered as being in the favorable-risk category. The
Patients had a diagnosis of primary AML confirmed by cytologic examina- unfavorable-risk category was defined by the presence of %5/del(5q),
tion of blood and bone marrow (median age, 44 years; range, 15-78 years); %7del(7q), t(6;9), t(9;22), 3q26 abnormality, or complex karyotype (more
median bone marrow blast count, 65% (range, 0% [for APL] to 98%); than 3 abnormalities). All other patients were classified as intermediate risk.
median white blood cell (WBC) count, 32 " 109/L (range, 0.3 " 109/L to Statistical analyses were performed with Stata Statistical Software, Re-
263 " 109/L). All patients had been treated according to the Dutch-Belgian lease 7.0 (Stata, College Station, TX). Actuarial probabilities of overall
Hemato-Oncology Cooperative Group (HOVON) protocols.25-27 After survival (OS) (with failure defined as death due to any cause) and event-free
informed consent, bone marrow aspirates or peripheral blood samples were survival (EFS) (with failure defined as not achieving complete remission
taken at diagnosis. Blasts and mononuclear cells were purified by Ficoll- [set at day 1], relapse, or death in first complete remission) were estimated
Hypaque (Nygaard, Oslo, Norway) centrifugation and cryopreserved. The by the method of Kaplan and Meier. The Cox proportional hazards model
AML samples contained 80% to 100% blast cells after thawing, regardless was applied to determine the association of NPM1 mutation with OS, EFS,
of the blast count at diagnosis. and disease-free survival (DFS) without and with adjustment for other
factors such as cytogenetic risk, age, WBC count, and FLT3 ITD. All tests
PCR, WAVE, and sequence analyses were 2-sided, and a P of less than .05 was considered statistically
significant.
RNA isolation and cDNA synthesis were performed as described.21,28
Complementary DNA prepared from 50 ng RNA was used for all
polymerase chain reaction (PCR) amplifications. NPM1 mutations in exon
12 were determined by cDNA amplification using the primers NPM1-FOR
Results
5#-CTTCCGGATGACTGACCAAGAG-3# and primer NPM1-REV 5#- Different NPM1 variant mutations in AML
CCTGGACAACATTTATCAAACACG-3# (25 mM deoxyribonucleoside
triphosphate [dNTP], 15 pmol primers, 2 mM MgCl2, Taq polymerase, and The presence of NPM1 mutations in 275 cases of primary AML
10 " buffer [Invitrogen Life Technologies, Breda, The Netherlands]). was rapidly and reliably detected by dHPLC WAVE. Nucleotide
Cycling conditions for NPM1 mutation detection were as follows: 1 cycle, 5 sequencing was performed on those cases with an abnormal
minutes at 94°C; 30 cycles, 1 minute at 94°C, 1 minute at 58°C, and 1
dHPLC profile (Table 1). Each NPM1 mutation variant reveals a
minute at 72°C; and 1 cycle, 7 minutes at 72°C. PCR products were
subsequently subjected to dHPLC using a Transgenomics (Omaha, NE)
specific dHPLC WAVE profile. Thus, each type of NPM1 mutation
WAVE dHPLC system.29 Samples were run at 56°C and 58°C. The exact could be predicted on the basis of a specific dHPLC WAVE profile.
NPM1 mutant sequence was confirmed for all samples showing an In addition, 3 novel NPM1 mutant variants were identified
abnormal dHPLC profile. PCR products were purified using the Multiscreen- (NPM1 mutants I to K [Table 1]). These rare variants have
PCR 96-well system (Millipore, Bedford, MA) followed by direct sequenc- comparable 4 bp insertions, like NPM1 variant mutations A to D,13
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12 NPM1 MUTATIONS IN AML 3749

Table 1. NPM1 mutation frequencies in 275 cases of de novo AML

NPM1 variant Nucleotide sequence* Protein sequence† No. of NPM1 mutants (%)

WT GATCTCTG GCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLWQWRKSL NA

Mutant A GATCTCTGTCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCLAVEEVSLRK 72 (26)
Mutant B GATCTCTGCATGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCMAVEEVSLRK 12 (4)
Mutant D GATCTCTGCCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCLAVEEVSLRK 4 (1)
Mutant I‡ GATCTCTGCAGAGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCRAVEEVSLRK 1 (& 1)
Mutant J‡ GATCTCTGCTTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCLAVEEVSLRK 1 (& 1)
Mutant K‡ GATCTCTGTATGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG -DLCMAVEEVSLRK 1 (& 1)

Number of NPM1 mutants with undetermined variants, 4 (1%); total number of NPM1 mutants, 95 (35%).
*Inserted nucleotides are underlined and italicized.
†The C-terminal tryptophane residues (W) are underlined for wild-type (WT) NPM1.
‡NPM1 mutants I, J, and K are novel variants identified in addition to the 6 known NPM1 variants.13

resulting in a frame shift and replacement of the 7 C-terminal (nos. 4 and 15) all lack NPM1 mutations. The subset of AML
amino acids of the NPM1 protein by 11 different residues (Table 1). patients in cluster no. 10, with adverse prognosis and an expres-
sion profile comparable to CD34$ cells,21 did not present with
NPM1 mutations in relation to clinical and molecular
NPM1 mutations.
features in AML
Falini and colleagues13 had shown a negative correlation
The NPM1 mutation frequencies of the 275 cases of primary AML between the presence of NPM1 mutations and CD34 expression
with regard to clinical parameters, morphology, cytogenetics, and levels. In fact, by plotting the CD34 mRNA expression levels of the
molecular characteristics are shown in Table 2. NPM1 mutations 285 AML cases, as determined by the GeneChip analyses, along
are significantly less frequently present in patients of younger age with the NPM1 mutation status (Figure 1), a distinguishable association
(less than 35 years, P & .001). The mean age of patients with AML of CD34 mRNA expression and NPM1 mutation is apparent (ie, CD34
and NPM1 mutations is 47.3 years ('10.7 years), whereas the mRNA expression is low or absent in cases of AML with NPM1
mean age of patients with AML and wild-type NPM1 is 39.7 years mutations, while CD34 mRNA levels are high in AML cases without
('13.3 years). NPM1 mutations are seen in AML French-American- NPM1 mutations).
British (FAB) subtypes M1 to M6 but are absent in AML FAB M0. HOX gene–specific gene expression signature of NPM1
The mutations are relatively frequently found in AML FAB M5 as mutant cases
well as in all 3 cases of AML FAB M6. In AML with recurrent
translocations (ie, t(8;21), inv(16), and t(15;17)) no NPM1 muta- To identify genes with significant differential expression between
tions were demonstrated. In cases with various other cytogenetic primary AML samples with NPM1 mutations (n ( 95) and samples
abnormalities, mutations in NPM1 were also rare. As a result, there without NPM1 mutations (n ( 180) the SAM algorithm was
appears to be a positive correlation between NPM1 mutations and used.32 A fold change threshold of 1.5 for up-regulation of gene
AML with normal karyotypes (P & .001). The analysis of NPM1 expression and 0.667 for down-regulation of gene expression was
mutations reveals interesting relationships with particular common applied. With an FDR of 0.01, 569 probe sets representing 440
molecular abnormalities. The presence of NPM1 mutations signifi- unique genes were identified as being significantly differentially
cantly correlates with the presence of FLT3 ITD mutations expressed (Figure S1 and Table S1, available on the Blood website;
(P & .001). A correlation between NPM1 mutations and FLT3 see the Supplemental Materials link at the top of the online article).
TKD mutations is not apparent. AML with NRAS mutations The identity of the top 50 genes, in some cases represented by
showed a significantly lower percentage of NPM1 mutations multiple probe sets, is depicted in Table 3.
(P ( .024). Among 5 of 8 cases of AML with NPM1 mutations, A dominant homeobox (HOX) gene–specific signature is strongly
KRAS mutations were found. No mutations in NPM1 were found in associated with AML carrying an NPM1 mutation. Moreover, the
cases of AML with CEBPA mutations (P ( .001). expression of members of the HOXA and HOXB gene families, but
also the HOX gene–related three–amino acid loop extension
NPM1 mutations occur within specific AML subtypes defined
(TALE) genes, PBX3 and MEIS1, is increased. In contrast, the
by gene expression profiling
CD34 gene is the strongest significantly down-regulated gene with
Of the cohort of 285 cases of primary AML that had previously regard to NPM1 mutation in the AML patient cohort.
been profiled using the Affymetrix HGU133A GeneChip21 and for NPM1 mutant cases are predicted with high accuracy based
which 16 distinct expression signatures had been defined following on their gene expression signature
unsupervised cluster analyses, we have now examined 275 cases
for the presence of NPM1 mutations. Among these pre-established NPM1 mutation prediction analyses were performed using the
signatures, the AML cases with NPM1 mutations aggregate within PAM algorithm.33 All 275 primary AML samples were randomly
particular clusters (Figure 1). Most AML cases in cluster nos. 2, 3, assigned to a training set, consisting of 122 samples without NPM1
5, and 7 carry NPM1 mutations. In fact, all cases of AML of cluster mutations and 62 samples with NPM1 mutations, and a validation
nos. 6 (100% FLT3 ITD) and 11 (78% normal karyotypes) carried series, consisting of 58 samples lacking the NPM1 mutation and 33
mutations in NPM1. Although cluster nos. 7 and 8 have comparable samples with mutations in NPM1. Cross-validation to predict the
expression profiles (Figure 1), 13 of the 18 AML cases in cluster mutation status of NPM1 on the training set resulted in 100%
no. 7 (72%) and only 1 of 12 cases of cluster no. 8 (8%) reveal correct predictions of presence of mutation (sensitivity) and 80.3%
NPM1 mutations. The clusters merely consisting of AML with correct predictions of absence of mutation (specificity) (Table 4).
inv(16) (no. 9), t(15;17) (no. 12), or t(8;21) (no. 13) as well as the Prediction of an independent validation set also resulted in 100%
clusters predominantly containing cases with CEBPA mutations correct prediction of presence of mutation and 82.7% correct
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
3750 VERHAAK et al BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12

Table 2. NPM1 mutation frequencies in relation to clinical NPM1 mutation is an independent favorable prognostic marker
parameters, morphology, cytogenetics, and molecular
characteristics of the 275 patients with de novo AML To investigate the prognostic value of NPM1 mutation, 252 AML
No. of NPM1 patients with long-term follow-up following therapy completion
No. mutants (%) P were included for survival analysis. The EFS, OS, and probability
Sex .100 of relapse at 60 months for the AML patients with or without NPM1
Male 135 40 (30) mutations were similar (Figure 3A-B). Likewise, among the
Female 140 55 (39) subgroup with cytogenetics of intermediate prognostic risk, EFS,
Age, y & .001
OS, and probability of relapse at 60 months were not different
Younger than 35 74 11 (15)
(Figures 3C-D), although there appears a trend for more favorable
35 to 60 169 69 (41)
60 and older 32 15 (47)
outcome for patients with AML with NPM1 mutations. Because
WBC count, " 109/L & .001 NPM1 mutations are significantly associated with both normal
20 or below 113 28 (25) karyotype and presence of a FLT3 ITD (Table 2), we investigated
Above 20 157 66 (42) the prognostic value of NPM1 mutations within the intermediate
ND 5 1 (20) cytogenetic risk group in relation to FLT3 ITD status. Patients in
FAB the intermediate cytogenetic risk group without FLT3 ITD muta-
M0 6 0 (0) ND
tions but with NPM1 mutations have a significantly better OS and
M1 62 21 (34) ) .999
EFS than those without NPM1 mutations (P ( .05) (Figure 4A-C).
M2 63 18 (29) .296
M3 17 1 (6) .008 In intermediate cytogenetic risk AML with FLT3 ITD muta-
M4 49 15 (31) 062 tions, NPM1 mutations do not significantly distinguish prognosis
M5 65 32 (49) .007 (Figure 4B,D).
M6 3 3 (100) ND NPM1 mutations are asynchronously associated with particular
ND 10 5 (50) karyotypes and molecular abnormalities that might express addi-
Cytogenic abnormalities* tional positive or negative prognostic value and therefore might
t(15;17) 16 0 (0) .002
obscure the prognostic significance of NPM1 mutations (Table 2;
t(8;21) 21 0 (0) & .001
inv(16)/t(16;16) 17 0 (0) .001
Figure 1). Therefore we investigated the prognostic value of NPM1
$8 24 5 (21) ND mutations in both univariable and multivariable analyses. Univari-
$11 5 0 (0) ND able and multivariable Cox regression analyses were applied to
$21 1 1 (100) ND assess the prognostic significance of NPM1 mutation, cytogenetic
%5 2 0 (0) ND risk class, WBC count below or above 20 " 109/L, age, and FLT3
%5(q) 1 0 (0) ND
%7 13 0 (0) .005
%7(q) 7 0 (0) ND
3q 5 1 (20) ND
t(6;9) 4 0 (0) ND
t(9;22) 2 1 (50) ND
t(11q23) 16 1 (6) 014
Complex; more than 3 abnormalities 11 0 (0) .018
Other 55 10 (18) .004
Normal 116 74 (64) & .001
ND 10 6 (60)
Molecular abnormalities
FLT3 ITD 78 47 (60) & .001
FLT3 TKD 32 14 (44) .243
NRAS 25 3 (12) .024
KRAS 8 5 (63) .130
CEBPA 17 0 (0) .001

P values were calculated using the Fisher exact test (2-tailed; ND indicates not
determined).
*All patients with a specific abnormality were considered irrespective of the
presence of additional abnormalities. Figure 1. OmniViz correlation view of 285 AML patients. The correlation view
displays pairwise correlations between AML patients. The cells in the visualization are
colored by Pearson correlation coefficient values, with deeper colors indicating
higher positive (red) or negative (blue) correlations. The scale bar indicates maximum
prediction of absence of mutation. The positive predictive value in positive correlation (red) toward maximum negative correlation (blue). The 16
this cohort is 72% in the training set and 74% overall. As expected, clusters identified in the cohort of 285 AML patients using 2856 probe sets on the
basis of the correlation view are indicated (1 to 16).21 Clinical and molecular data are
the genes included in the PAM gene signature were among the most depicted in the columns along the original diagonal of the correlation view.21 FAB
significant differentially expressed genes as determined by SAM, classification and karyotype based on cytogenetics are depicted in the first 2 columns
thereby validating both algorithms. Of note, NPM1 mRNA expres- (FAB M0, red; M1, green; M2, purple; M3, orange; M4, yellow; M5, blue; M6 gray; and
karyotype: normal, green; inv(16), yellow; t(8;21), purple; t(15;17), orange; 11q23
sion did not correlate with mutation status (Figure 2). The NPM1
abnormalities, blue; 7(q) abnormalities, red; $8, pink; complex, black; other, gray).
mutant AML cases have a distinct signature with regard to the 18 FLT3 ITD and NPM1 mutations are depicted in the same set of columns (red bar,
selected genes (Figure 2) and are therefore predicted with high positive; green bar, negative). The expression levels of CD34 (probe set: 209543_s_at)
accuracy (Table 4). However, these 18 genes seem to be expressed in the 285 AML patients are plotted in the last column (bars are proportional to the
level of expression). The percentages of the most common (more than 40%)
at comparable levels in a subset of AML cases with wild-type abnormalities, NPM1 mutations, as well as normal karyotypes (NN) for each cluster
NPM1 (Figure 2). are indicated.
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12 NPM1 MUTATIONS IN AML 3751

Table 3. NPM1 mutation-associated gene expression in 275 patients Table 4. NPM1 mutation prediction by using PAM
with de novo AML Predicted genotype
Probe set ID Gene symbol Fold change
10-fold CV error* Error validation set*
Up-regulated in AML with mutant NPM1 Genotype WT Mutant WT Mutant
213844_at HOXA5 4.2
WT NPM1 98 24 48 10
205366_s_at HOXB6 2.6
Mutant NPM1 0 62 0 33
208414_s_at HOXB3 1.8
204082_at PBX3 2.8 Most optimal result for NPM1 mutation prediction using a cohort of 275 cases of
205600_x_at HOXB5 2.1 AML divided in a training and test set.21 The number of probe sets used in this
206289_at HOXA4 2.1 prediction was 22, which represents 18 unique genes. For the 10-fold CV error set,
205453_at HOXB2 2.1 n ( 184; for the error validation set, n ( 91.
*Ten-fold cross-validation (CV) prediction error on training set (n ( 184); predic-
213150_at HOXA10 2.6
tion error on validation set (n ( 91). In 10-fold cross-validation, the model is fitted on
204069_at MEIS1 2.6 90% of the samples and the class of the remaining 10% is predicted. This procedure
209905_at HOXA9 2.8 is repeated 10 times, with each part playing the role of the test samples and the error
201664_at SMC4L1 2.1 of all 10 parts added together to compute the overall error. The error within the
209439_s_at PHKA2 1.6 validation set reflects the number of samples wrongfully predicted in this set.
206847_s_at HOXA7 1.5
63825_at ABHD2 1.6
219304_s_at PDGFD 1.9 independent prognostic marker in addition to cytogenetic risk, age,
212820_at RC3 2.4 and FLT3 ITD mutations.
213110_s_at COL4A5 2.9
207111_at EMR1 2.1
208557_at HOXA6 1.6 Discussion
203471_s_at PLEK 1.6
203680_at PRKAR2B 2.3 Recently, we established a comprehensive classification of AML
202729_s_at LTBP1 3.6
based on gene expression profiling.21 In this classification several
210145_at PLA2G4A 1.6
clusters of AML signatures correlated with distinct (cyto)genetic
220162_s_at CARD9 1.5
206298_at ARHGAP22 2.0
abnormalities, such as t(8;21), t(15;17), inv(16), and C- and
219602_s_at FAM38B 1.9 N-terminal mutations in CEBPA. However, the common underly-
Down-regulated in AML with mutant NPM1 ing molecular abnormality for the other subtypes of AML was
209543_s_at CD34 %5.4 unknown. In the present study we show that 2 clusters consist
206896_s_at GNG7 %1.7 entirely of AML cases with NPM1 mutations (ie, cluster nos. 6 and
209583_s_at MOX2 %3.1 11), whereas cluster nos. 2, 3, 5, and 7 predominantly include
200953_s_at CCND2 %2.1 patients with NPM1 mutations. Thus, we identify mutant NPM1 as
221004_s_at ITM2C %3.0 a common molecular abnormality in these subtypes of AML.
205330_at MN1 %4.3
Falini and colleagues13 have shown that mutations in NPM1 are
200602_at APP %2.6
present in 35% of patients with AML. In this study, we confirm that
200665_s_at SPARC %3.8
201015_s_at JUP %3.1
218899_s_at BAALC %4.3
209679_s_at LOC57228 %1.9
219694_at FLJ11127 %2.1
206042_x_at SNRPN %2.5
211535_s_at FGFR1 %2.6
214582_at PDE3B %1.8
221523_s_at RRAGD %1.8
213618_at CENTD1 %1.7
218589_at P2RY5 %3.3
202016_at MEST %2.9
208116_s_at MAN1A1 %3.1
205240_at GPSM2 %1.9
202747_s_at ITM2A %4.1
206622_at TRH %9.1
206726_at PGDS %4.7

The top 50 unique most discriminating genes and fold change in expression with
regard to NPM1 mutation as determined by SAM (up-regulated: increased expres-
sion in NPM1 mutant cases; down-regulated: decreased expression in NPM1 mutant
cases).

ITD mutation for OS, DFS, and EFS (Table 5). In univariable
analyses NPM1 mutation showed no statistical significance with
respect to the end points. However, in multivariable analyses Figure 2. The most predictive molecular signature with regard to NPM1
mutated NPM1 was significantly associated with a much lower mutation in AML assessed with 22 probe sets representing 18 unique genes.
The levels of expression of the probe sets in the 275 cases of AML are depicted (scale
hazards ratio (HR), which was statistically significant for all end
bar indicates an increase [red] or a decrease [green] in the level of expression of at
points (EFS: HR ( 0.59, P ( .005; DFS: HR ( 0.52, P ( .003; least 4 relative to the geometric mean).21 The 3 probe sets representing the NPM1
and OS: HR ( 0.49, P & .001). Mutant NPM1 appeared as an gene are also depicted.
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
3752 VERHAAK et al BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12

The sharp distinction between CD34 positivity and NPM1

mutations in AML cases based on the HOX gene signature is
notable because 22 of the 39 HOX genes are expressed in human
CD34$ cells, whereas during normal differentiation HOX gene
expression declines.38 Extensive studies have demonstrated for a
number of HOX genes that sustained overexpression in murine
bone marrow results in perturbations in the stem cell pools, and
coexpression of certain HOX gene family members with their
protein binding partner, such as MEIS1, results in leukemia.38
Thus, in AML with NPM1 mutations the hematopoietic progenitor
cells may have arrested at a differentiation stage with endogenous
coexpression of the HOX genes (ie, HOXA5, -A9, -A10, -B2, -B3,
-B5, and -B6) and their TALE partner genes (ie, MEIS1 and PBX3)
or as a result of the increased expression of these genes.
SAM and PAM analyses were highly concordant for the genes
identified with differential expression between AML with mutant
and AML with wild-type NPM1, where, in both cases, CD34 was
Figure 3. Survival analyses of AML patients with and without NPM1 mutations. the most discriminating gene, down-regulated in NPM1 mutants.
Kaplan-Meier estimates of OS (A) and EFS (B) among patients with AML and OS (C) Patients harboring an NPM1 mutation can be predicted with high
and EFS (D) among patients with AML with intermediate-risk karyotypes.
accuracy; however, a subset of patients with wild-type NPM1 is
wrongly predicted. Interestingly, within this subgroup the percent-
NPM1 mutations are frequently present in AML (ie, in 35% of all age of patients with 11q23 abnormalities is significantly increased.
cases). NPM1 mutant is less frequently represented in patients with In fact, this may not be surprising because MLL has been
AML of age younger than 35 years. This seems consistent with the implicated as a HOX gene regulator39 and selective expression of
tendency of the NPM1 mutation to be more frequently present in HOX genes in ALL cases with mutant MLL has been shown.40
older children with AML.34 Furthermore, NPM1 mutations are By univariate analyses we show that there is a tendency that the
significantly associated with AML with high WBC count. presence of an NPM1 mutation, and concomitant low CD34 mRNA
We detected the various mutation variants of NPM1 at similar expression, is a favorable marker for clinical outcome (Figure 3). This is
frequencies as was described recently13 and also identified 3 novel in agreement with CD34 expression as an indicator for poor response to
mutant variants. These novel variants carry, like the other NPM1 induction therapy.41-43 In addition, we demonstrate by multivariate
mutant variants in our study, an insertion of 4 bp, resulting in a analyses that NPM1 mutations are a strong independent favorable
protein with an altered C-terminus (Table 1). Falini and col- predictive marker for EFS, DFS, and OS in AML. The finding that the
leagues13 suggested that the disruption of 1 of the 2 C-terminal effect of NPM1 mutation is much more pronounced in multivariable
tryptophan residues and the last 5 residues (ie, VSLRK) are than in univariable analyses can be explained by the strong correlation
important for NPM1 mutant function. Our study suggests that the between NPM1 and FLT3 ITD mutations and additionally by the
final 9 amino acids (ie, AVEEVSLRK) may in general be required association with high WBC count and age. NPM1 mutations are more
for mutant NPM1 function. frequently present in AML patients with FLT3 ITD, high WBC count,
NPM1 mutations often coincide with mutations in FLT3, and older age. These factors are unfavorable determinants of progno-
particularly with the ITD-type mutations. Our data may suggest an sis,44 while NPM1 mutation seems to express a favorable prognostic
association of mutations in KRAS and NPM1, but the study has
limited power because of the small number of mutant KRAS AMLs.
In contrast, mutations in NRAS were not associated with mutant
NPM1, because NRAS mutations are found in AML with inv(16),21,30
a subclass of AML that lacks NPM1 mutations. In addition, we did
not find NPM1 mutations in clusters of AML patients, previously
identified by gene expression profiling,21 characterized by C- and
N-terminal mutations in CEBPA. These observations might per-
haps suggest that constitutive active FLT3 or K-RAS provides the
proliferative signal, whereas mutant NPM1 might serve to impair
differentiation in the multistep pathogenesis model of AML.35
Notably, the discriminative genes identified by SAM and PAM
revealed a strong HOX and TALE gene–specific signature associ-
ated with AML cases with mutant NPM1, as was published
recently.24 Thus, although CD34 has generally been used as marker
for immature hematopoietic progenitor cells, the NPM1 mutant
CD34% cells display a molecular signature similar to that of
hematopoietic stem cells (HSCs). Recent studies have shown that
CD34% HSCs exist as well.36,37 These CD34% cells also possess
HSC-specific characteristics, including the ability for hematopoi- Figure 4. Survival analyses of intermediate cytogenetic risk AML patients with and
without FLT3 ITD and/or NPM1 mutations. Kaplan-Meier estimates of OS (panels A and
etic engraftment.36,37 This brings up the question as to whether the
B) and EFS (panels C and D) for patients with intermediate-risk AML and FLT3 ITD
NPM1 mutant AML cells in fact represent a more primitive mutations (FLT3 ITD positive [panels B and D]) versus those with intermediate-risk AML
population of HSCs with a HOX gene signature. without FLT3 ITD mutations (FLT3 ITD negative [panels A and C]).
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12 NPM1 MUTATIONS IN AML 3753

Table 5. Univariable and multivariable analyses of NPM1 mutation as prognostic factor for EFS, DFS, and OS in AML
EFS DFS OS
HR (95% CI) P* HR (95% CI) P* HR (95% CI) P*

Univariable
Intermediate† 2.06 (1.33-3.20) .001* 2.82 (1.63-4.87) & .001* 2.67 (1.62-4.41) & .001*
Poor† 3.88 (2.29-6.56) & .001* 5.09 (2.61-9.91) & .001* 4.44 (2.49-7.93) & .001*
WBC count‡ 1.14 (0.84-1.53) .39 1.18 (0.84-1.68) .34 1.19 (0.87-1.62) .29
Age, decades 1.05 (0.94-1.19) .38 1.06 (0.92-1.22) .41 1.17 (1.03-1.32) .014*
FLT3 ITD§ 1.76 (1.28-2.41) .001* 1.71 (1.17-2.50) .006* 1.89 (1.36-2.62) & .001*
NPM1 mutation" 0.88 (0.64-1.21) .43 0.93 (0.64-1.34) .69 0.90 (0.65-1.27) .57
Multivariable
Intermediate† 2.18 (1.36-3.50) .001* 3.11 (1.74-5.55) & .001* 2.87 (1.69-4.86) & .001*
Poor† 3.96 (2.34-6.74) & .001* 5.73 (2.93-11.22) & .001* 4.68 (2.60-8.43) & .001*
WBC count‡ 1.06 (0.78-1.44) .72 1.10 (0.77-1.58) .60 1.18 (0.85-1.63) .32
Age, decades 1.07 (0.95-1.21) .27 1.10 (0.95-1.27) .21 1.19 (1.05-1.35) .008*
FLT3 ITD§ 1.96 (1.39-2.76) & .001* 2.00 (1.31-3.06) .001* 2.13 (1.49-3.05) & .001*
NPM1 mutation" 0.59 (0.41-0.85) .005* 0.52 (0.34-0.80) .003* 0.49 (0.33-0.72) & .001*

CI indicates confidence interval.

*P values & .05.
†Cytogenetic risk versus cytogenetic good risk.
‡More than 20 " 109/L versus less than 20 " 109/L.
§FLT3 ITD versus no FLT3 ITD.
"NPM1 mutation versus no NPM1 mutation.

impact. This implies that in univariable analysis the positive effect of outcome for patients with AML. Because NPM1 mutations are
NPM1 mutations, as measured by the method of Kaplan and Meier or by predominantly found in patients with standard-risk AML, determi-
the HR, is less pronounced, because the adverse effects of FLT3 ITD, nation of the NPM1 mutation status, in combination with other
high WBC count, and age might mask this effect. In fact, NPM1 prognostically relevant markers, will be useful for further risk
mutations distinguish a favorable subgroup among intermediate cytoge- stratification of adult patients with de novo AML.
netic risk FLT3 ITD–negative AML that shows comparatively better OS
and EFS (Figure 4). In addition, in the multivariable analyses the effect
of NPM1 mutations is more pronounced than is apparent in the Acknowledgments
univariable analyses. This is not only true for NPM1 mutations but also
for the independent prognostic effect of FLT3 ITD mutations, age, and We are indebted to our colleagues from the bone marrow transplan-
cytogenetic risk (Table 5). tation group and molecular diagnostics laboratory of the Depart-
The data presented here demonstrate that the frequent C- ment of Hematology at the Erasmus Medical Center for storage of
terminal insertion mutations in NPM1 correlate with favorable the samples and molecular analyses, respectively.

References
1. Lowenberg B, Downing JR, Burnett A. Acute my- 7. Levis M, Small D. FLT3: ITDoes matter in leuke- with a normal karyotype. N Engl J Med. 2005;
eloid leukemia. N Engl J Med. 1999;341:1051- mia. Leukemia. 2003;17:1738-1752. 352:254-266.
1062. 14. Dumbar TS, Gentry GA, Olson MO. Interaction of
8. Shiah HS, Kuo YY, Tang JL, et al. Clinical and
2. Slovak ML, Kopecky KJ, Cassileth PA, et al. biological implications of partial tandem duplica- nucleolar phosphoprotein B23 with nucleic acids.
Karyotypic analysis predicts outcome of pre- tion of the MLL gene in acute myeloid leukemia Biochemistry. 1989;28:9495-9501.
remission and postremission therapy in adult without chromosomal abnormalities at 11q23. 15. Cordell JL, Pulford KA, Bigerna B, et al. Detection
acute myeloid leukemia: a Southwest Oncology Leukemia. 2002;16:196-202. of normal and chimeric nucleophosmin in human
Group/Eastern Cooperative Oncology Group cells. Blood. 1999;93:632-642.
9. Dohner K, Tobis K, Ulrich R, et al. Prognostic sig-
Study. Blood. 2000;96:4075-4083. 16. Borer RA, Lehner CF, Eppenberger HM, Nigg EA.
nificance of partial tandem duplications of the
3. Byrd JC, Mrozek K, Dodge RK, et al. Pretreat- MLL gene in adult patients 16 to 60 years old with Major nucleolar proteins shuttle between nucleus
ment cytogenetic abnormalities are predictive of acute myeloid leukemia and normal cytogenetics: and cytoplasm. Cell. 1989;56:379-390.
induction success, cumulative incidence of re- a study of the Acute Myeloid Leukemia Study 17. Morris SW, Kirstein MN, Valentine MB, et al. Fu-
lapse, and overall survival in adult patients with Group Ulm. J Clin Oncol. 2002;20:3254-3261. sion of a kinase gene, ALK, to a nucleolar protein
de novo acute myeloid leukemia: results from gene, NPM, in non-Hodgkin’s lymphoma. Sci-
Cancer and Leukemia Group B (CALGB 8461). 10. Barjesteh van Waalwijk van Doorn-Khosrovani S,
ence. 1994;263:1281-1284.
Blood. 2002;100:4325-4336. Erpelinck C, van Putten WL, et al. High EVI1 ex-
pression predicts poor survival in acute myeloid 18. Redner RL, Rush EA, Faas S, Rudert WA, Corey
4. Grimwade D, Walker H, Oliver F, et al. The impor- leukemia: a study of 319 de novo AML patients. SJ. The t(5;17) variant of acute promyelocytic leu-
tance of diagnostic cytogenetics on outcome in Blood. 2003;101:837-845. kemia expresses a nucleophosmin-retinoic acid
AML: analysis of 1,612 patients entered into the receptor fusion. Blood. 1996;87:882-886.
MRC AML 10 trial. The Medical Research Council 11. Preudhomme C, Sagot C, Boissel N, et al. Favor-
19. Yoneda-Kato N, Look AT, Kirstein MN, et al. The
Adult and Children’s Leukaemia Working Parties. able prognostic significance of CEBPA mutations
t(3;5)(q25.1;q34) of myelodysplastic syndrome
Blood. 1998;92:2322-2333. in patients with de novo acute myeloid leukemia:
and acute myeloid leukemia produces a novel
a study from the Acute Leukemia French Associa-
5. Grimwade D, Walker H, Harrison G, et al. The fusion gene, NPM-MLF1. Oncogene. 1996;12:
tion (ALFA). Blood. 2002;100:2717-2723.
predictive value of hierarchical cytogenetic classi- 265-275.
fication in older adults with acute myeloid leuke- 12. van Waalwijk van Doorn-Khosrovani SB, Er- 20. Valk PJ, Delwel R, Lowenberg B. Gene expres-
mia (AML): analysis of 1065 patients entered into pelinck C, Meijer J, et al. Biallelic mutations in the sion profiling in acute myeloid leukemia. Curr
the United Kingdom Medical Research Council CEBPA gene and low CEBPA expression levels Opin Hematol. 2005;12:76-81.
AML11 trial. Blood. 2001;98:1312-1320. as prognostic markers in intermediate-risk AML.
21. Valk PJ, Verhaak RG, Beijen MA, et al. Prognosti-
Hematol J. 2003;4:31-40.
6. Gilliland DG, Griffin JD. The roles of FLT3 in he- cally useful gene-expression profiles in acute my-
matopoiesis and leukemia. Blood. 2002;100: 13. Falini B, Mecucci C, Tiacci E, et al. Cytoplasmic eloid leukemia. N Engl J Med. 2004;350:1617-
1532-1542. nucleophosmin in acute myelogenous leukemia 1628.
 From bloodjournal.hematologylibrary.org at VRIJE UNIVERSITEIT Medical Library 34942 on March 31, 2014. For
personal use only.
3754 VERHAAK et al BLOOD, 1 DECEMBER 2005 ! VOLUME 106, NUMBER 12

22. Bullinger L, Dohner K, Bair E, et al. Use of gene- script: implications for RT-PCR diagnosis. Hema- 36. Engelhardt M, Lubbert M, Guo Y. CD34($) or
expression profiling to identify prognostic sub- tol J. 2001;2:206-209. CD34(%): which is the more primitive? Leukemia.
classes in adult acute myeloid leukemia. N Engl 29. Choy YS, Dabora SL, Hall F, et al. Superiority of 2002;16:1603-1608.
J Med. 2004;350:1605-1616. denaturing high performance liquid chromatogra- 37. Guo Y, Lubbert M, Engelhardt M. CD34- hemato-
23. Ross ME, Mahfouz R, Onciu M, et al. Gene ex- phy over single-stranded conformation and con- poietic stem cells: current concepts and contro-
pression profiling of pediatric acute myelogenous formation-sensitive gel electrophoresis for muta- versies. Stem Cells. 2003;21:15-20.
leukemia. Blood. 2004;104:3679-3687. tion detection in TSC2. Ann Hum Genet. 1999; 38. Grier DG, Thompson A, Kwasniewska A,
63(pt 5):383-391. McGonigle GJ, Halliday HL, Lappin TR. The
24. Alcalay M, Tiacci E, Bergomas R, et al. Acute my-
30. Valk PJM, Bowen DT, Frew ME, Goodeve AC, pathophysiology of HOX genes and their role in
eloid leukemia bearing cytoplasmic nucleophos-
Löwenberg B, Reilly JT. Second hit mutations in cancer. J Pathol. 2005;205:154-171.
min (NPMc$AML) shows a distinct gene expres-
sion profile characterized by up-regulation of the RTK/RAS signalling pathway in acute myeloid 39. Daser A, Rabbitts TH. The versatile mixed lin-
leukaemia and inv(16) [letter]. Haematologica. eage leukaemia gene MLL and its many associa-
genes involved in stem cell maintenance. Blood.
2004;89:106. tions in leukaemogenesis. Semin Cancer Biol.
2005;106:899-902.
31. Care RS, Valk PJ, Goodeve AC, et al. Incidence 2005;15:175-188.
25. Lowenberg B, Boogaerts MA, Daenen SM, et al.
and prognosis of c-KIT and FLT3 mutations in 40. Armstrong SA, Staunton JE, Silverman LB, et al.
Value of different modalities of granulocyte- core binding factor (CBF) acute myeloid leukae- MLL translocations specify a distinct gene ex-
macrophage colony-stimulating factor applied mias. Br J Haematol. 2003;121:775-777. pression profile that distinguishes a unique leuke-
during or after induction therapy of acute myeloid
32. Tusher VG, Tibshirani R, Chu G. Significance mia. Nat Genet. 2002;30:41-47.
leukemia. J Clin Oncol. 1997;15:3496-3506.
analysis of microarrays applied to the ionizing 41. Chang H, Salma F, Yi QL, Patterson B, Brien B,
26. Lowenberg B, van Putten W, Theobald M, et al. radiation response. Proc Natl Acad Sci U S A. Minden MD. Prognostic relevance of immunophe-
Effect of priming with granulocyte colony- 2001;98:5116-5121. notyping in 379 patients with acute myeloid leu-
stimulating factor on the outcome of chemo- kemia. Leuk Res. 2004;28:43-48.
33. Tibshirani R, Hastie T, Narasimhan B, Chu G. Di-
therapy for acute myeloid leukemia. N Engl agnosis of multiple cancer types by shrunken 42. Myint H, Lucie NP. The prognostic significance of
J Med. 2003;349:743-752. centroids of gene expression. Proc Natl Acad Sci the CD34 antigen in acute myeloid leukaemia.
27. Ossenkoppele GJ, Graveland WJ, Sonneveld P, U S A. 2002;99:6567-6572. Leuk Lymphoma. 1992;7:425-429.
et al. The value of fludarabine in addition to 34. Cazzaniga G, Dell’oro MG, Mecucci C, et al. Nu- 43. Raspadori D, Lauria F, Ventura MA, et al. Inci-
ARA-C and G-CSF in the treatment of patients cleophosmin mutations in childhood acute my- dence and prognostic relevance of CD34 expres-
with high-risk myelodysplastic syndromes and elogenous leukemia with normal karyotype. sion in acute myeloblastic leukemia: analysis of
AML in elderly patients. Blood. 2004;103:2908- Blood. 2005;106:1419-1422. 141 cases. Leuk Res. 1997;21:603-607.
2913. 35. Gilliland DG. Molecular genetics of human leuke- 44. Lowenberg B. Prognostic factors in acute myeloid
28. Van der Reijden BA, de Wit L, van der Poel S, et mias: new insights into therapy. Semin Hematol. leukaemia. Best Pract Res Clin Haematol. 2001;
al. Identification of a novel CBFB-MYH11 tran- 2002;39:6-11. 14:65-75.