See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/317300472

Isolation and identification of cellulose degrading bacteria and optimization

of the cellulase production

Article · July 2016

CITATIONS READS

19 4,426

1 author:

Joseph Vimal
Regional Cancer Center, Trivandrum
4 PUBLICATIONS 39 CITATIONS

SEE PROFILE

All content following this page was uploaded by Joseph Vimal on 02 June 2017.

The user has requested enhancement of the downloaded file.

 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

International Journal of Research in Biosciences

Vol. 5 Issue 3, pp. (58-67), July 2016
Available online at http://www.ijrbs.in
ISSN 2319-2844

Research Paper

Isolation and identification of cellulose

degrading bacteria and optimization of the
cellulase production
Joseph Vimal, Akhil Venu, and *Jini Joseph
Department of Biotechnology, St. Peter’s College, Kolenchery, Kerala, INDIA

(Received June 02, 2016, Accepted June 29, 2016)

Abstract

The cellulase producing bacteria were isolated from industrial and agricultural areas in Kerala.
Potential isolates with cellulase production were identified by Grams iodine dye staining
method. The isolate were tentatively identified to be Bacillus species based on cultural,
morphological, biochemical analysis and labelled as CB3, CB4 and CB8. Further, the genomic
DNA was isolated and amplified with universal primers 27F and 1492s specific for 16S rRNA.
The amplified 16S rRNA PCR product of 1500bp was sequenced and the unknown organism
was identified using the maximum aligned 16SrRNA sequences available in the GenBank of
NCBI through BLAST search. The sample CB3 and CB4 showed (100% and 99% respectively)
homology to Bacillus subtilis strain. The sample CB8 showed 98% homology to the Bacillus
cereus strain. To test the evolutionary relationships, phylogenetic analysis was performed
with the program MEGA 6.0 using the 16SrRNAsequence. The isolates were then evaluated by
submerged fermentation process for maximum cellulase production. The various process
parameters like pH, temperature, incubation period, substrate concentration and inoculum
volume were then optimized for the maximum production of cellulase by the isolates. The
0
optimum temperature for cellulase production for CB4, CB4 and CB8 was found to be 40 C,
0 0
30 C and 40 C respectively. The optimum PH was found to be 7 for the three samples. The
incubation period of 48 hours, 72 hours and 96 hours were found to be optimum for CB3, CB4
and CB8 respectively. An inoculum size of 6% was found to be ideal for CB3 and CB4 whereas
an inoculums volume of 8% was found to be ideal for CB8 which showed a maximum activity
of 4.12U/ml. The CMC concentration of 1.5% was found to be ideal for CB3 and CB4 whereas
CB8 showed a maximum activity of 3.21U/ml at a CMC concentration of 1%. Among the three
isolates the Bacillus cereus strain (CB8) was found to be the most active cellulase producer
with maximum activity of 4.12 IU/ml in submerged fermentation.

Keywords: Cellulolytic bacteria, 16srRNA, BLAST, Bacillus species, Carboxy methyl cellulose.

Introduction

Cellulase is an important and essential kind of enzyme for carrying out the depolymerisation of
cellulose into fermentable sugar. Cellulases are commonly used in many industrial applications and
the demands for more stable, highly active and specific enzymes are growing rapidly. Further, the
value of cellulose as a renewable source of energy has made cellulose hydrolysis the subject of
[1].
intense research and industrial interest Despite a worldwide and enormous utilization of natural
cellulosic sources, there are still abundant quantities of cellulosic sources, cellulose containing raw
[2]
materials and waste products that are not exploited or which could be used more efficiently .

58
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

Cellulases are the inducible bioactive compounds produced by microorganisms during their growth on
Cellulosic matters. Cellulose degrading microorganisms can convert cellulose into soluble sugars
either by acid and enzymatic hydrolysis. Successful bioconversion of cellulosic materials mainly
depends on the nature of cellulose, sources of cellulolytic enzyme and optimal conditions for catalytic
activity and production of enzymes. Cellulose quality, temperature, aeration, carbon sources,
incubation period, medium additives, pH of the medium and presence of inducers are important
[3,4]
parameters for the optimized production of cellulase enzymes . Several previous reports have
shown that certain microbes are able to utilize cellulose as a source of energy.

Microorganisms are important in conversion of lignocelluloses wastes into valuable products like
biofuels produced by fermentation. These microbes produces extracellular cellulose and hence known
as cellulolytic microorganisms. Bacilli and fungi are most popular class for commercial production as
these cellulases have very high economic value[5-7]. Bacteria which have high growth rate as
compared to fungi have good potential to be used in cellulase production in industries. For many
years, cellulose degrading bacteria have been isolated and characterized for obtaining more effective
cellulases from variety of sources such as soil, decayed plant materials, hot springs, organic matters,
feces of ruminants and composts.

Cellulases are now used in the textile industry for cotton softening and denim finishing, in laundry
detergents for colour care, cleaning, in the food industry for mashing, in the pulp and paper industries
for drainage improvement and fibre modification, and they are even used for pharmaceutical
applications[8]. For understanding the mechanism of cellulose degradation by cellulase, it is necessary
to isolate, purify and characterize this enzyme. Therefore, the present investigation was designed to
isolate, identify and optimize the fermentation conditions for maximum production of cellulase by the
isolates.

Materials and Methods

Sample collection
The samples for isolation of microorganisms were collected from various environments where the
natural process of cellulose degradation is taking place. Soil and water samples were collected from
industrial and agricultural areas in Kerala, and were transported in sterile bottles to the Microbiology
laboratory of St.Peter’s College, Kolenchery, kerala for bacterial isolation.

Screening and isolation of bacteria

The samples were collected in sterile containers and stored at 4ºC until used. The samples were
allowed to grow directly in the CMC agar plates. The microorganisms capable of growing in the
cellulose only medium were isolated and checked for the cellulolytic activity by gram’s iodine clearing
zone assay method. Tenfold serial dilutions of each soil sample were prepared in sterilized distilled
water and 0.1 ml of the diluted sample was spread on Carboxymethyl cellulose medium with the
following composition (g/l) : Carboxymethylcellulose (CMC), 10, Tryptone, 2, KH2PO4, 4, Na2HPO4, 4,
MgSO4.7H2O, 0.2, CaCl2.2H2O, 0.001, FeSO4.7H2O, 0.004, Agar, 15 and pH adjusted to 7[9] . Plates
were incubated at 37ºC until the visible colonies form. The plates were flooded with Grams Iodine and
distilled water to see the cellulolytic activity of isolated strain. The formation of a clear zone of
hydrolysis indicated the cellulose degradation. The ratio of the clear zone diameter to colony diameter
was measured in order to select for the highest cellulose producer[10]. The largest ratio was assumed
to contain the highest activity. Bacterial colonies were purified by repeated streaking. The purified
o
colonies were preserved at 4 C for further identification and screening for cellulase production.

Grams Iodine Stain

[10]
0.133 g Potassium iodide and 0.067 g Iodine were dissolved in 20 ml distilled water .

Morphological and cultural characteristics

The morphological identification and cultural characteristics of isolates were examined. Colonies were
compared for their diameters, overall colors, texture, size, cell arrangement, elevation and
pigmentation. All the isolates were also subjected to microscopic analysis for their characterization
and identification by the methods given by Bergey’s Manual of determinative bacteriology[11].

59
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

Biochemical characterization
Different biochemical tests were analyzed including Indole test, Methyl red test, Vogues-Proskauer
test, Citrate utilization test, starch hydrolysis, Nitrate reduction, Catalase test, Oxidase test,
Phenylalanine deteramination and Sugar fermentation test.

Molecular Identification of Bacteria

Pure culture of the target Bacteria was grown overnight on nutrient Broth for the isolation of DNA. The
DNA was isolated from the bacteria using the Phenol - Chloroform method and 16S rRNA was
amplified by Thermocycler (Eppendorff) using the primers, 27F and 1492R.The primers for PCR
amplification were obtained from Sigma-Aldrich[12].

Universal Primer
27 forward 5AGAGTTTCCTGGCTCAG 3
1492 reverse 5ACGGCTACCTTGTTACGATT 3

The PCR was performed in 50μl reaction mixture containing 5μl of 10X assay buffer, 5μl dNTP mix of
2.0 mM, 3.0μl of MgCl2, 0.1μl each of forward and reverse primer (0.02μmol), 0.5μl of Taq
polymerase, 5μl of template DNA and 31.3μl of HPLC grade water with the following amplification for
16s rRNA initial denaturation at 94ºC for 5 min followed by 38 cycles of denaturation, annealing and
extension (94ºC for 30 sec, 55ºC for 30 sec and 72ºC for 1.5 min) and final extension at 72ºC for 10
min followed by hold for infinity at 4ºC.

The amplified 16S rRNA PCR product was sequenced using automated sequencer (SciGenom Labs
Pvt. Ltd., Kochi, India.). The unknown organism was identified using the maximum aligned 16SrRNA
sequences available in the GenBank of NCBI through BLAST search. The best sequence alignment
results were noted. To test the evolutionary relationships, phylogenetic analysis was performed with
the program MEGA 6.0 using the 16SrRNAsequence [13].

Optimization of Culture Conditions on cellulase activity

In order to determine effects on cellulase production, the selected bacterial isolates were grown in
CMC broth and incubated at various parameters. The influence of all factors on enzyme activity was
determined by measuring cellulase activity at varying pH values from 6 to 7.5, temperature varying
from 30 to 45ºC, incubation period varying from 48 to 120 h at 37°C, inoculums size varying from 1%
to 6% and substrate concentration (CMC) varying from 0.2% to 1.5%. Carbon and nitrogen sources
have been replaced with various substances. The influence of the factors on enzyme activity was
determined by measuring cellulase activity.

Submerged Fermentation process

For preparation of standard inoculum, those isolates showed a maximum zone of hydrolysis were
cultured in 20 ml inoculation medium [composition (g/l): Carboxymethylcellulose (CMC) 5, Tryptone 2,
KH2PO4 4, Na2HPO4 4, MgSO4.7H2O 0.2, CaCl2.2H2O 0.001, FeSO4.7H2O 0.004 and pH adjusted to
7] individually and incubated at 37ºC for 24 h until an average viable count of 2-3.5x106 cells /ml
culture was obtained. This was used as inoculums for the production medium. The composition of
production medium was same as of inoculums medium except the concentration of Carboxymethyl
cellulose which was 1% instead of 0.5%. Fermentation was carried out in 250 ml Erlenmeyer flasks,
each containing 100 ml sterile production medium and inoculated with 5% of standard inoculums
(containing 2-3.5x106 cells /ml). The flasks were incubated at 37ºC on a rotary shaker at 150 RPM for
72h[9].

Preparation of crude enzyme:

After incubation, the cultures were centrifuged at 1600 RPM for 20 min at 4°C and supernatant was
used as a source of crude enzyme. The crude enzyme solution was utilized for determination of
enzyme activities [9].

Cellulase enzyme assay

Carboxymethylcellulase (CMCase) activity was estimated using a 1% solution of
carboxymethlycellulose (CMC) in 0.05 M citrate buffer (pH 4.8) as substrate. The reaction mixture
contained 1 ml citrate buffer, 0.5 ml of substrate solution and 1ml of crude enzyme solution. The
reaction was carried out at 45°C for 30 min. The amount of reducing sugar released in the hydrolysis
was measured by DNSA method. The Enzyme unit (EU) was determined as the amount of CMCase

60
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

[14]
required to release of 1μmole of reducing sugar per ml per minute under above assay condition .
One International Unit (IU) of enzyme activity for endoglucanase was defined as the amount of
enzyme releasing 1 μmol of reducing sugar from CMC per minute. The specific activity was
determined as the number of units of enzyme activity per milligram of enzyme protein[9].

Protein determination
Protein concentrations in a crude sample were determined by using a Folin Lowry method with bovine
serum albumin (BSA) as a standard[15].

Optimization of cellulase production

The optimum parameters were determined for cellulase production from the efficient isolates. The
cellulase fermentation was carried out at different ranges of parameters including temperature, pH,
incubation period, substrate concentration and inoculums size. After fermentation at different
parameters the crude enzyme sample was collected from each to check the enzyme activity.

Effect of temperature
To determine the optimum temperature for cellulase production, fermentation was carried out at
various temperatures in the range of 30ºC, 35ºC, 40ºC and 45ºC.

Effect of pH
Different values of pH ranged from 6.0, 6.5, 7.0 and 7.5 were chosen for studying their effects on
cellulase enzyme production.

Incubation period
To obtain maximum cellulase production fermentation was carried out at different incubation periods
ranging from 48, 72, 96 and 120 hours.

Effect of substrate concentration:

To evaluate the effect of substrate concentration on cellulase production the production medium was
supplemented with different concentration of CMC including, 0.2%, 0.5%, 1% and 1.5%.

Inoculums size
The inoculum size was optimized for maximal enzyme production. The fermentation medium was
inoculated with 1, 2, 4, and 6% of standard young log phase inoculums (containing 2-3.5x106 cells
/ml).

Results and Discussion

Isolation and primary screening for cellulase producing bacteria

Total 7 samples were collected from 6 different sites and 12 isolates were obtained. From these, 9 out
of 12 isolates were removed due to similar colonial and morphological characteristics. The resulting 3
isolates were then tested on CMC agar for cellulase activity. The CMCase activity was assessed
based on the formation of zone of hydrolysis or the halo zone formed due to the secretion of cellulase
and subsequent hydrolysis of cellulose incorporated in the medium by the bacterial isolates. The ratio
obtained by dividing zone diameter by colony diameter gives a measurement of cellulase reactivity
(Table: 1). The ratio for an effective cellulase producer will be ≥1.5. Three isolates which showed
potent CMCase secreting activity with the ratio greater than 1.5 were selected for further studies. The
CMCase activity was found to be in the following order based on the formation of zone of hydrolysis
CB8> CB4 > CB3.The isolates were maintained in pure culture in CMC agar slants.

Degradation of cellulosic materials is a complex process requiring participation by a number of

microbial enzymes. Habitats that contain these substrates are the best sources to find these
microorganisms[16]. So the sites for sample collections were selected as those were rich in cellulosic
biomass such as wood furnishing region, paper industry waste, agricultural waste and cow dung,
hence there were maximum possibilities to get potential cellulose producing bacterial strain. A rapid
primary screening of isolates was carried out for their cellulase activity using media containing 1%
CMC as a sole source of carbon and after incubation the plates were flooded with grams iodine and
poured off after 10 minutes which showed the cellulase activity by a clear zone formation around the
[10]
cellulase producing colonies . Around 12 bacterial samples were isolated from the 7 samples out of
which, 3 strains were found to be potent cellulase producers.

61
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

The three isolates gave the maximum ratio of clear zone diameter to colony diameter on the CMC
agar plate as compared to plates cultured with the other strains. Based on the calculation of the ratio
of the diameter (mm) of the zone of clearance to the diameter of the colony, it was determined that
these bacterial isolates demonstrated potential ability to degrade CMC. The isolated bacterial colonies
were characterized for their morphological and biochemical characteristics as described by
Cappuccino and Sherman. The stains CB3, CB4 were identified as Bacillus subtilis and CB8 as
Bacillus cereus respectively. The strains (CB3, CB4 and CB8) were further subjected to molecular
identification by analysing 16SrRNA amplified PCR product.

Table 1: Zone of hydrolysis

Clear zone Colony Zone diameter /
Organism
diameter (cm) diameter (cm) colony diameter (cm)
CB3 1.5 0.9 1.67
CB4 1.6 0.7 2.29
CB8 1.2 0.4 3

Morphological, cultural and biochemical characteristics

A microscopic examination revealed that the three isolates were Gram negative spore forming
bacteria. Furthermore, the biochemical analysis of the isolates was performed and identified to be
Bacilli species. Their colonial, morphological, and biochemical characteristics are tabulated in Table 2
and 3.

Table 2: Colony and Morphological characteristics

Organism Colony characteristics Morphology

Gram Positive, Rod shaped, Arranged

3-5 mm colonies, rough, flat, complete,
CB3 in chains, Actively motile, with central
irregular, Spreading type, granular.
spore.
4mm colonies, rough, flat, entire, Gram Positive, Long to short rod
CB4 irregular margin, Spreading type, shaped, motile, arranged in a chain of 3
granular, whitish. to 4 cells, sporulating.
2-5mm colonies, rough, flat, complete, Gram Positive, Short rods shaped,
CB8 irregular, Spreading type, granular, off motile, Arranged in chains, spore
white colour. producing.

Table 3: Biochemical characteristics

Organism
Biochemical Test
CB3 CB4 CB8
Indole - - -
Methyl Red - - -
Voges-Proskauer test (VP) + + +
Citrate + + +
Oxidase + - +
Catalase + + +
Casein Hydrolysis + + +
Starch hydrolysis + + +
Urease - + -

Sugar Fermentation
Glucose ++ ++ ++
Fructose ++ ++ ++
Sucrose ++ -- ++
Starch ++ ++ ++
Lactose ++ -- --

62
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

Molecular identification of cellulolytic bacteria

Being highly sensitive and selective, molecular methods are currently used to identify
microorganisms. The strains were further subjected to molecular identification by analyzing 16S r
RNA sequence. DNA isolated from the three pure cultures of CB3, CB4 and CB8 were amplified with
27F and 1498R primers specific for 16srRNA and generated specific amplicons of 1500 bp. The
amplified 16S rRNA PCR product was sequenced at SciGenom Labs Pvt. Ltd., Cochin, Kerala. The
Sequence Similarity Search was done for the 16S rDNA sequence using online search tool called
BLAST (http://www.ncbi.nlm.nih.gov/blast/).

The isolates were identified using the maximum aligned sequence through BLAST search. The results
have shown that CB3 had highest homology (100%) with Bacillus subtilis. CB4 had highest homology
(99%) with Bacillus subtilis and CB8 had highest homology (98%) with Bacillus cereus. The size of
amplified PCR product was determined by 2.5% agarose gel electrophoresis using DNA markers of
500bp (Figure 1). The amplified product was sent for sequencing to SciGenom Labs Pvt. Ltd., Cochin,
Kerala. The sequencing information was subjected to phylogenetic analysis in order to establish
genetic relatives of the isolated organisms (Figure 2, Figure 3 and Figure 4).

The 16S rRNA sequencing appears to have the potential ability to differentiate strains at the
subspecies level[17]. When compared to morphological and biochemical characterization methods,
16S rDNA analysis is found to be the novel and accurate method for identifying unknown species. The
DNA from the strains CB3, CB8 and CB4 was isolated and the 16S rDNA was amplified using the
primers (27F and 1492R) and sequenced. The partial amplification of 16S rRNA confirmed on the
agarose gel electrophoresis. The BLAST analysis of the strains using its 16S rDNA sequence data
showed that strains had highest homology (100 %) with Bacillus subtilis and Bacillus cereus.

Figure 1: Polymerase Chain reaction amplification

Lane 1: 500 bp marker, Lane 2: sample CB3, Lane 3: sample CB4, Lane 4: sample CB8

Figure 2: Phylogenetic tree Bacillus Subtilis (CB3)

Figure 3: Phylogenetic tree Bacillus Subtilis (CB4)

63
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

Figure 4: Phylogenetic tree Bacillus Cereus (CB8)

Optimization of cellulase production

The optimum parameters were determined for cellulase production from the efficient isolates. After
fermentation at the different parameters the crude enzyme product was collected for determination of
enzyme activity. Enzyme activity was determined by DNSA method.

Figure 5: The effect of inoculums volume on the activity of cellulase

The enzyme activities of CB3, CB8 and CB4 at the different parameters are tabulated in Table 4 and
figure 5. The 4.0% inoculums volume results in maximum cellulase activity of 4.12U/ml (figure 5).
These data indicated that the isolate CB8 is a more efficient cellulase producer when compared to
CB3 and CB4.

The different parameters for submerged fermentation were optimized at lab scale for both isolates to
improve the performance and for reducing the cost of production process. Submerged fermentation
was carried out at different pH, temperature, and incubation period, different concentration of CMC
and at a different inoculums size. Many efforts were taken to generate microorganisms with high
ability to produce cellulase that can degrade native cellulose[18]. From the present study among all
isolated strains, the three cellulolytic bacterial strains the maximum enzyme activity were showed in
Bacillus cereus (4.12 IU/ml) followed by Bacillus subtilis (3.83 IU/ml) at 4% and 6% inoculum volume
respectively. Nakamura et al[19] reported cellulase activity of 66 U/ml from Bacillus cereus and the
strain was confirmed by 16s rDNA method.

The optimum temperature for cellulase production for CB4, CB4 and CB8 was found to be 400C, 300C
and 400C respectively. The optimum pH was found to be around neural for the three strains. The
incubation period of 48 hours, 72 hours and 96 hours were found to be optimum for CB3, CB4 and
CB8 respectively. An inoculum size of 6% was found to be ideal for CB3 and CB4 whereas an
inoculums volume of 8% was found to be ideal for CB8 which showed a maximum activity of
4.12U/ml. CMC was selected as a substrate which gave the highest yield of enzyme because it was
assumed that this was due to the less complexity and hence easy assimilation of it by the isolated
microbe[20]. The CMC concentration of 1.5% was found to be ideal for CB3 and CB4 whereas CB8
showed a maximum activity of 3.21U/ml at a CMC concentration of 1%.

64
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

Table 4: Optimization of cellulase production

Enzyme activity of isolates (U/ml)

Different Parameters Different Values
CB3 CB4 CB8
48 2.56 1.87 2.971
72 2.50 2.01 3.154
Incubation Time
96 2.012 2.09 2.487
(hours)
120 1.871 1.60 2.814
30 1.235 1.713 1.173

Temperature 35 1.45 1.36 1.301

(oC) 40 1.812 1.21 1.832
45 1.471 1.11 1.636
6 2.669 1.85 2.689
6.5 2.68 3.07 2.891
pH
7 3.52 2.97 2.96
7.5 3.41 2.64 2.63
1 2.887 2.56 3.2
Inoculum Size 2 3.011 2.33 2.69
(%) 4 3.63 3.03 4.12
6 3.83 3.40 3.74
0.2 2.211 2.014 2.45
Concentration of CMC 0.5 2.487 2.403 3.01
(%) 3.21
1.0 2.70 2.9
1.5 2.76 3.15 2.98

Conclusion

Habitats that contain these substrates are the best sources to find these microorganisms [19]. Several
microorganisms have been discovered for decades which have capacity to convert cellulose into
[3]
simple sugars but the need for newly isolated cellulose degrading microorganism still continues .The
present work was carried out to isolate and identify potential cellulose producing bacteria from areas
rich in cellulosic biomass as well as optimize the fermentation conditions in order to achieve the
maximum production of cellulase by the isolated microorganisms. Three bacterias were isolated from
the paper industry waste based on its ability to grow in the CMC coated plates. The potential cellulase
producing activity of the strains were confirmed by the ability to form clear zone in the presence of
Grams iodine. The strains CB3, CB4 and CB8 were identified by its morphological, cultural and
biochemical characteristics as Bacillus subtilis and Bacillus cereus respectively. The isolates were
subjected to molecular identification by analysing 16s r RNA sequence. The 16s rRNA sequencing
makes it possible to identify and distinguish closely related bacterial species. Further the phylogenetic
tree constructed from the sequence analysis gives the evolutionary relatives of the isolates. The
Optimum parameters for maximum cellulase activity and stability was also studied. From the
determination of enzyme activity maximum enzyme activity was shown by Bacillus cereus (4.12 IU/ml)
followed by Bacillus subtilis (3.83 IU/ml) at 4% and 6% inoculum volume respectively. Further studies
are in progress to get cellulase with high yield, purity and stability.

Acknowledgement

The authors are grateful to Kerala State Council for Science, Technology and Environment (KSCSTE)
for their financial support & for all the academic and technical help rendered by the members of
Department of Biotechnology, St. Peter’s College, Kolenchery.

65
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

References

1. Bhat M.K.., Cellulases and related enzymes in biotechnology, Biotechnol. Adv.,18, 355-383
(2000).

2. Sethi S., Datta A.B., Gupta L. and Gupta S., Optimization of Cellulase production from bacteria
isolated from soil, ISRN Biotechnology , 1-7, (2013)

3. Immanuel G., Dhanusha R., Prema P and Palavesam., A Effect of different growth parameters
on endoglucanase enzyme activity by bacteria isolated from coir retting effluents of estuarine
environment, Int. J. of Environmental Sci. and Technol., 3(1), 25- 34 ( 2006)

4. Angsana R., Warinthorn S., Annoop N and Pawinee C., Combination effect of pH and acetate on
enzymatic cellulose hydrolysis, J. of Environmental Sci., 21(7), 965- 970 (2009)

5. Gerardi M., The Microbiology Of Anaerobic Digesters, John Wiley & Sons Inc. Publication, New
York (2003)

6. Karan R., Capes M.D. and Dassarma S., Function and biotechnology of extremophilic enzymes in
low water activity, Aquatic Biosystems, 8, 4, (2012)

7. Gopinath S.C.B., Anbu P. and Hilda A., Extracellular enzymatic activity profiles in fungi isolated
from oil-rich environments. Mycoscience, 46, 119 -126, (2005)

8. Sazci A., Erenler K., Detection of cellulolytic fungi by using Congo red as an indicator: a
comparative study with the dinitrosalicyclic acid reagent method, J. of Applied Bacteriol., 61, 559-
562, (1986)

9. Shaikh N.M., Patel A.A., Mehta S.A. and Patel N.D., Isolation and screening of cellulolytic
bacteria inhabiting different environment and optimization of cellulase production, Univer. J. Env.
Res. Technol., 3(1), 39-49, (2013)

10. Hardik R., Gohel, A comparative study of various staining techniques for determination of extra
cellular cellulase activity on carboxy methyl cellulose (CMC) agar plates, Int. J. Curr. Microbiol.
App. Sci., 3(5), 261-266, (2014)

11. Buchana R.E., Gibbons N.E., Bergey’s manual of determinative bacteriology, Baltimore: The
Williams and Wilkins Co., (1974)

12. Lane D.J., Stackebrandt E., M. Good fellow B, 16S/23S rRNA sequencing, In Nucleic Acid
Techniques in Bacterial Systematics, Wiley, New York, 115 - 175, (1991)

13. Tamura K., Dudley J.,Nei M., Kumar S.,MEGA4: molecular evolutionary genetics analysi (MEGA)
software version 4.0, Mol. Biol. Evol., 24, 1596-1599, (2007)

14. Miller G.L., Use of Dinitrosalicyclic acid reagent for determination of reducing sugar, Analytical
chemistry, 31, 426-429, (1959)

15. Lowry O.H., Rosenberg W.J., Farr A.L. and Randell R.J., Quantification of protein using Folin
Ciocalteu reagent, J Biol Chem, 193, 265-275, (1951)

16. Ariffin H., Abdullah N., Umi K., Shirai Y., Hassan MA Production and characterization by Bacillus
pumilus EB3, Int. J. Eng. Technol., 3, 47-53, ( 2006)
17. Huang X.P., Monk C., Purification and characterization of a cellulase from a newly isolated
thermophilic aerobic bacterium Caldibacillus cellulovoransgen, nov. sp. World J. of Micro and
Biotech., 20(1), 85-92, (2004)

66
 J. Vimal et al. Int. J. Res. Biosciences, 5(3), 58-67, (2016)

18. Saraswati Bai, Ravi kumar M., Mukesh kumar D.J., Balashanmugam P., Bala kumaran M.D.,
Kalaichelvan P.T., Cellulase Production by Bacillus subtilis isolated from Cow Dung, Archives of
Applied Science Research, 4(1), 269-279, (2012)

19. Nakamura K., Kappamura K., Isolation and identification of crystalline cellulose hydrolyzing
bacterium and its enzymatic properties, J. Ferment. Technol., 60(4), 343, (1982)

20. Teeri T.T., Crystalline cellulose degradation: New insights into the function of cellobiohydrolases,
Trends Biotechnol., 15, 160-167, (1997)

67

View publication stats