Biomedicine & Pharmacotherapy 127 (2020) 110118

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Original article

Benign prostatic hyperplasia treatment using plasmonic nanoparticles T

irradiated by laser in a rat model
Omid Koohi Hosseinabadia,b,1, Mohammad Ali Behnamc,1, Arezoo Khoradmehrd,1,
Farzin Emamic, Zahra Sobhanie, Amir Reza Dehghanianf, Ali Dehghani Firoozabadig,
Farhad Rahmanifarh, Homeira Vafaeii, Aryan-Dokht Tamadond, Nader Tanidehj,k,**,
Amin Tamadond,*
a
Laparoscopy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
b
Central Research Laboratory, Shiraz University of Medical Sciences, Shiraz, Iran
c
Nano-Opto-Electronic Research Center, Electrical and Electronics Engineering Department, Shiraz University of Technology, Shiraz, Iran
d
The Persian Gulf Marine Biotechnology Research Center, The Persian Gulf Biomedical Sciences Research Institute, Bushehr University of Medical Sciences, Bushehr, Iran
e
Quality Control of Drug Products Department, Faculty of Pharmacy, Shiraz University of Medical Sciences, Shiraz, Iran
f
Pathology Department, Shiraz University of Medical Sciences, Shiraz, Iran
g
Yazd Cardiovascular Research Center, Shahid Sadoughi University of Medical Sciences, Yazd, Iran
h
Department of Basic Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, Iran
i
Maternal-Fetal Medicine Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
j
Stem Cells Technology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
k
Department of Pharmacology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

ARTICLE INFO ABSTRACT

Keywords: Objective: In the current study we have stimulated the efficacy of plasmonic nanoparticles (NPs) by laser hy-
Benign prostatic hyperplasia perthermia to achieve a less invasive method for tumor photothermal therapy of benign prostatic hyperplasia
Plasmonic nanoparticles (BPH).
Caspase Methods: The levels of apoptosis on induced BPH in rats were assessed after treatment and revealed and recorded
Apoptosis
by various assayed. Moreover, the expression of caspases was considered to demonstrate the apoptotic pathways
Laser
Photothermal therapy
due to laser induced plasmonic NPs.
Results: In the Laser + NPs group prostate size of induced BPH decreased. Laser + NPs also decreased prostate
specific antigen in comparison with the BPH groups. Furthermore, Laser + NPs attenuated BPH histopathologic
indices in the rats. Laser + NPs induced apoptosis in prostatic epithelial cells via caspase-1 pathway.
Conclusions: Altogether, the approach and findings from this study can be applied to introduce the laser irritated
NPs method as a novel and less invasive therapy for patients suffering from BPH.

Abbreviations: BPH, benign prostatic hyperplasia; BW, body weight; CNTs, carbon nanotubes; DHT, dihydrotestosterone; GPR160, G protein receptor 160; NPs,
nanoparticles; ANOVA, one-way analysis of variance; O-CNT, oxidized-carbon nanotube; PEG, polyethylene glycol; SD, standard deviation; TUNEL, terminal
deoxynucleotidyl transferase dUTP nick end labeling; TEM, transmission electron microscopy
⁎
Corresponding author at: The Persian Gulf Marine Biotechnology Research Center, The Persian Gulf Biomedical Sciences Research Institute, Bushehr University of
Medical Sciences, Bushehr, Iran.
⁎⁎
Corresponding author at: Stem Cells Technology Research Center, 3rd Floor, Muhammad Rasulollah Research Tower, Shiraz University of Medical Sciences,
Khalili Ave., Shiraz, 7193635899, Iran.
E-mail addresses: koohiomid@yahoo.com (O. Koohi Hosseinabadi), m.behnam@sutech.ac.ir (M.A. Behnam), mehrarezoo@gmail.com (A. Khoradmehr),
emami@sutech.ac.ir (F. Emami), sobhani@sums.ac.ir (Z. Sobhani), adehghan@sums.ac.ir (A.R. Dehghanian),
ali.dehghani.molmed@gmail.com (A. Dehghani Firoozabadi), f.rahmanifar@yahoo.com (F. Rahmanifar), vafaeih@gmail.com (H. Vafaei),
aryan_tamaddon@yahoo.com (A.-D. Tamadon), tanidehn@gmail.com (N. Tanideh), amintamaddon@yahoo.com (A. Tamadon).
1
These authors have same contribution as the first authors.

https://doi.org/10.1016/j.biopha.2020.110118
Received 21 December 2019; Received in revised form 12 March 2020; Accepted 19 March 2020
0753-3322/ © 2020 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY license
(http://creativecommons.org/licenses/BY/4.0/).
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

Fig. 1. Electron microscope images of plasmonic nanoparticles. A, carbon nanotubes (CNTs) with polyethylene glycol (PEG) coating; B, CNTs without PEG coating.

1. Introduction subsequently irradiated adjacent the surface plasmon resonance

[15,16]. This specific feature participates in ablation of solid tumors in
Benign prostatic hyperplasia (BPH) is defined as a wide-spread a particular location, which is called hyperthermia technique [17,18].
chronic condition in elderly males that can lead to annoying lower Altogether, the recent researches have implied the critical role of
urinary tract symptoms and decrease the sense of well-being [1]. plasmonic photo-thermal therapy to induce various ranges of patho-
Generally, most of patients with symptoms of mild to moderate BPH physiological interactions such as regulating of localized tumor growth,
recover and do well without operative therapy and others require metastasis and angiogenesis [19,20]. Laser photothermal therapy for
pharmacological and medical therapies and also surgery [2]. Thus far, prostate tumors or lesions has an ideal potential to be an attractive
the various methods to improve the symptoms of BPH including phar- alternative to surgical method, due to its minimally invasive procedures
macological therapy such as alpha 1 adrenergic receptor antagonists and the opportunity of performing it on patients when surgical pro-
and 5 alpha reductase inhibitors as two main drug classes, finasteride blems are happen [21]. Laser light suggests an excellent means of in-
[3] and finally transurethral resection of prostate surgery [4] do not ducing local heat by irritation of NPs in tissue, which can be in-
demonstrate an entirely therapeutic outcomes. Therefore, novel and vestigated for treatment of BPH. Hence, in the current study, the
noninvasive therapeutic technique is required to improve the patients influence of plasmonic nanoparticles irritated by laser is surveyed in
with BPH. Traditional cancer therapies, such as operation, radio- testosterone-induced BPH in male rats.
therapy, and chemotherapy, are including various side effects, like the
possibilities of killing normal cells or destroying the immune systems of 2. Materials and methods
the patients. In contrast, the advantage of minimally invasive hy-
perthermia therapy has been emerged as a promising method for ab- 2.1. Preparation, characterization and cytotoxicity assay of carbon
lation of tumor cells, specifically [5]. nanotubes-polyethylene glycol
Hyperthermia therapy can cause apoptosis in cancer cells. The ex-
posure of cancer cells to hyperthermia promotes caspase-3 dependent To wrap multi-walled carbon nanotubes (CNTs, Plasmachem,
apoptosis and induces G2/M cell cycle arrest [6]. Hyperthermia can Berlin, Germany; number of walls: 3–15, outer diameter: 5–20 nm,
also promote Caspase-I dependent apoptosis. Targeted magnetic intra- length: 1–10 μm) with polyethylene glycol (PEG, PEG1000, Sigma-
lysosomal hyperthermia causes production of lysosomal reactive Aldrich, St Louis, MO, USA), the CNTs were oxidized. Oxidized-CNTs
oxygen species and induces caspase-1 dependent cell death [7]. Fur- (O-CNT) were mixed with PEG1000 (Fig. 1). The details of O-CNT-PEG
thermore, nanoparticles also can induce activation of Caspase 1. Acti- preparation, characterization, and cytotoxicity assay have been pre-
vation of Caspase 1 causes pore formation in cell membranes and cy- viously described [11].
tokine processing, osmotic pressure enhancement, cellular ionic
gradient dissipation, cell swelling, water influx, osmotic lysis and re-
2.2. Testosterone-induced BPH and treatment groups
lease of cytokines [8].
Nanoparticles (NPs) are considered as the effective agents to induce
Forty-eight adult male Sprague Dawley rats weighing 200−250 g
heating in tumors [9]. Thus, NPs have attracted increased attention in
were used in the similar condition. (n = 24) The rats were kept in 22 ±
recent years, due to their wide variety of application in medicine,
2 temperature and 50 % humidity under a 12 h light/dark photoperiod
particularly in tumor therapy [10,11]. The unique features of NPs, in-
and were provided with food and water freely. All procedures were
cluding high surface-to-volume ratios, broad optical properties, ease of
carried out in accordance to the Shiraz University of Medical Sciences
functionalization, and facile surface chemistry and synthesis make them
Guidelines for Animal Handling, and the project was performed ac-
a proper candidate in the clinical field for cancer therapeutics [12,13].
cording the instruction of working on laboratory animal of the Ethics
Moreover, they can efficiently alter light or radiofrequencies into heat,
Committee of Shiraz University of Medical Sciences.
hence supporting thermal ablation of targeted tumor cells [14]. The
Rats were acclimatized for 1 week prior to randomized division into
significant application of NPs is identified in generating of extensive
six groups (8 rats/group) (Fig. 2A). (a) normal control group received
heating after absorption of specific light’s wavelengths and
subcutaneous injection of corn oil. (b) BPH group received

2
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

Fig. 2. Procedures of induction and evaluation of benign prostatic hyperplasia treatment using plasmonic nanoparticles irradiated by laser in a rat model. A) Graph of
study procedures and grouping of rats for induction of benign prostatic hyperplasia (BPH) and treatment using plasmonic nanoparticles irradiated by laser. The tests
have been done on each group samples are shown. B) Induction of BPH in rat prostate. C) Laser irradiation of BPH in rat. D) Ultrasonography of rat prostates in
different groups and the therapeutic effects of laser and nanoparticles (NPS) therapy on the prostate size.

subcutaneous injection of testosterone (5 mg/kg body weight (BW), Finasteride is one of the common therapeutic mediators which in-
daily for 2 weeks; Tokyo Chemical Ins. Co.). BPH induction were con- hibit the conversion of dihydrotestosterone (DHT) by interfering of 5-α-
firmed by gross pathologic evaluation (Fig. 2B) and comparing them reductase that leads to reduction of DHT concentration and prostate
with sonographic images (Fig. 2D). (c) BPH, NPs group received sub- size [22]. Therefore, this agent was considered as one of the treatment
cutaneous injection of testosterone and after 2 weeks, 1 mg/mL NPs group in order to compare with therapeutic effect of NPs irritated by
was injected into their prostates at a dose of 200 μL/cm3 (prostate laser as a novel method.
volume) with the guide of sonography (Supplementary video 1). (d) All rats received treatments once, and after 2 weeks at the end of the
BPH, laser group received subcutaneous injection of testosterone and experiment, rats were fasted overnight, anesthetized by intraperitoneal
after 2 weeks, prostate area irradiated using an 808 nm continuous- injection of pentobarbital (100 mg/kg BW), and dissected to obtain
wave near-infrared laser diode 808-2W with the intensity of 2 W/cm2 blood from caudal vena cava. This blood was centrifuged, and serum
and spot size of 0.25 cm2 for 5 min (Fig. 2C). (e) BPH, laser + NPs was stored at −80 °C until further analysis. Prostate specific antigen
group received subcutaneous injection of testosterone and after 2 was measured in the serum. The ventral prostate of each rat was fixed
weeks, received same dose of NPs as group “c” and same dose of laser as overnight in 10 % neutral buffered formalin, and the rest of the prostate
group “d”. (f) BPH, finasteride group received subcutaneous injection of was snap-frozen in liquid nitrogen for mRNA assays.
testosterone and after 2 weeks, received oral finasteride (10 mg/kg BW;
Sigma, St. Louis, MO, USA).

3
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

2.3. Hematoxylin and eosin staining of prostate tissue 2.7. Statistical analysis

Prostate tissues of each rat were stained with H&E (Sigma) and The results are expressed as the means ± standard deviation (SD).
examined under a microscope (Nikon ECLIPSE Ni-U, Tokyo, Japan) at Differences between the mean values were statistically examined using
200×magnification. Images were captured from 10 randomly selected one-way analysis of variance (ANOVA) and Bonferroni post hoc test
fields per rat. Histopathological evaluation of the prostate was per- between the groups. The statistical analyses were carried out by SPSS®
formed in each group by a blind pathologist for the following features statistical software, version 20.0 (SPSS Inc., Chicago, IL, USA) for
including presence and degree of epithelial hyperplasia (glandular hy- Windows® to determine significant differences. P < 0.05 was con-
perplasia), stromal edema, inflammation and their degrees. sidered to indicate a significant difference statistically.

2.4. Terminal deoxynucleotidyl transferase dUTP nick end labeling 3. Results

(TUNEL) assay
3.1. Laser + NPs decreased the BPH-induced prostate size
Paraffin-embedded tumor tissues were evaluated via TUNEL
staining after using an in situ apoptosis detection kit (Millipore, MA, The in vivo influences of Laser + NPs on the testosterone-induced
USA), in order to detection of prostate epithelial cell apoptosis. For this BPH rats were assessed by monitoring the tumor size by ultra-
purpose, positive cells with apoptotic nuclei were recognized and cal- sonography. Prostate size was evaluated before and 3 days after the
culated in 10 accidentally selected fields (×400). In details, paraffin- laser irradiation. The reduction of the prostate size was observed in the
embedded sections of prostate epithelial cell apoptosis (5 μm thick) Laser + NPs group in comparison with the other groups (Fig. 2D).
were investigated according to the manufacturer’s protocol. Firstly,
sections were deparaffinized and dehydrated in ordered concentration 3.2. Laser + NPs decreased prostate specific antigen
of xylene and ethanol, and afterwards, the prostate tissue sections were
digested with 20 μg/mL proteinase K solution and maintained at room Prostate-specific antigen (PSA) concentrations increased in BPH
temperature for 15 min; reactions were terminated by washing and group in comparison with normal rats after model induction (P < 0.05,
incubating of slides with the TUNEL reaction mixture including enzyme Fig. 3A). Treatment of BPH rats with finasteride could not decrease the
solution and labeling solution for 1 h at 37 °C. Subsequently, mounted PSA. However, Laser + NPs decreased PSA concentration to the level of
sections on slides were analyzed by using a fluorescent microscope. control group. Laser therapy had the same effect as Laser + NPs but
NPs could not reduce PSA in BPH rats.
2.5. Transmission electron microscopy (TEM)
3.3. Laser + NPs attenuated BPH histopathologic indices
The formalin fixed prostates were post-fixed with osmium tetroxide
(1%). They were dehydrated by passing through the ethanol series and To examine whether Laser + NPs affects the histological abnorm-
embedded in resin. Semi-thin sections were stained with toluidine blue alities arising from BPH, samples of prostate tissue were stained with H
and examined under light microscope. Ultra-thin sections were col- &E. As displayed in Fig. 3B and D, the prostates in the BPH group re-
lected on copper grids. They were stained with uranyl acetate/lead vealed shows frank epithelial hyperplasia and multi-layering of the
citrate and then examined by TEM (Philips, 906E, Germany). epithelium with serrated luminal surface. Stromal edema and in-
flammation were also evaluated, separately (Fig. 3C and D). This result
contradicted with the prostate tissue in the normal control group, which
2.6. RNA isolation and RT-PCR
presented epithelial cells arranged in a single layer. The histological
abnormalities indices associated with BPH were decreased in the Laser
The RNeasy mini kit (Qiagen, USA) was used to extract total RNA
+ NPs group in comparison with BPH group (P < 0.05, Fig. 3B and C).
from prostate tissues and the A260/A280 ratio was used to determine
Furthermore, epithelial hyperplasia-which is the most reliable criterion
RNA purity on a Nanodrop 2000 (Wilmington, Delaware, USA). A
for the diagnosis of BPH is more attenuated in the Laser + NPs treated
commercially available reverse transcription kit (Thermo Fisher
rats than the other groups.
Scientific Baltics, Vilnius, Lithuania) was used to generate cDNA from 1
μg of total RNA. Then, PCR was performed using an Applied Biosystems
Real-Time PCR System (Life Technologies, CA, USA), with the 3.4. Laser + NPs induced apoptosis in prostatic epithelial cells
Quantifast SYBR Green PCR kit (Qiagen, USA) according to the man-
ufacturer’s instructions. The PCR primers are listed in Table 1. The data To determine the effects of Laser + NPs on prostatic hyperplasia,
were analyzed using SPSS 20, and mRNA expression was calculated we evaluated the changes in prostate tissue by histological techniques
using the 2−ΔΔCt method, with β-actin as the control. and detected the apoptotic cells by TUNEL method (Fig. 4A). Induction
of apoptosis was higher in the Laser + NPs group compared with the
Table 1 BPH group (P < 0.05, Fig. 4B). Moreover, the finasteride treated group
The primers used in real-time PCR. could not induce cell apoptosis as much as the Laser + NPs group (P <
0.05).
Gene Primer sequence (5′–3′) Tm
TEM imaging demonstrated nuclear disassembly and apoptotic
Caspase 1 Forward: GGAGCTTCAGTCAGGTCCATCAG 58.7 chromatin condensation in the Laser + NPs group (Fig. 5). Elastin and
Reverse: TGTAACCGGGTGGGTGTTTTCATTATTG 58 collagen breakdowns were also observed in the Laser + NPs group in
comparison with BPH rats. The Golgi apparatus fragmented during
Caspase 3 Forward: AGGCCGACTTCCTGTATGCT 55
Reverse: GGCGCAAAGTGACTGGATGA 58.1 apoptosis in the Laser + NPs group in comparison with BPH rats. Mi-
tochondrial condensation/darkening in the Laser + NPs group was also
Caspase 7 Forward: CTCTGCGTCTTTGTCCGTCC 56.8 observed in comparison with normal mitochondria in BPH rats. The
Reverse: ACCGCTCCACCATCATCTCA 57.4 Laser + NPs group showed morphological disorders of the rough en-
doplasmic reticulum, such as braided structure, atypical arrangement,
β-Actin Forward: GTGCTATGTGTCCCTAGACTTTG 56.7
Reverse: GATGCCACAGGATTCCATACCC 58.9 increased luminal density, luminal swelling, and dissociation of ribo-
somes from rough endoplasmic reticulum in comparison with BPH rats.

4
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

Fig. 3. Serum prostate-specific antigen (PSA) concentration (A) and prostate histopathologic evaluation of benign prostatic hyperplasia (BPH) treatment using
plasmonic nanoparticles (NPs) irradiated by laser in a rat model. B) Epithelial hyperplasia evaluation in prostates. C) Stromal edema and inflammation evaluation in
prostates. Lines above the columns show significant differences between the groups (P < 0.05). D) Histopathology sections of the prostate glands. Histopathologic
changes including glandular epithelial hyperplasia with back to back arrangement of them indicative of benign prostatic hyperplasia (BPH) in the BPH group (X100).
Histopathologic changes in the BPH, Laser + NPs group show flattening of the glandular epithelium, mild edema of the stroma in vicinity of the affected glands.
(X100).

Fig. 4. TUNEL methods to identification of apoptotic cells in BPH prostate of rats after treatment by laser induced plasmonic NPs in compared with BPH prostate as
negative control. A) TUNEL staining. B) Ratio of positive cells in different groups. Lines above the columns show significant differences between the groups
(P < 0.05).

5
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

Fig. 5. Electron microscope images of prostate tissue, which are collected from BPH rats treated with plasmonic nanoparticles irradiated by laser and BPH rats as
control group in compared with normal prostate sample. c, collagen; el, elastin; G, Golgi apparatus; m, mitochondria; n, nucleus; re, rough endoplasmic reticulum.

3.5. Laser + NPs induced apoptosis via caspase-1 Apoptosis plays a significant role in control of cell proliferation and
moreover, inhibitors of apoptosis proteins effect on cell death pathway
Activation of the caspase cascade has been associated with the be- via direct inhibition of caspases [27]. Overexpression of caspase-1, as
ginning of apoptosis [23]. The expression of caspases-1, 3 and 7 was an apical activator of cell death pathway, has been demonstrated to
determined in all groups (Fig. 6D). Relative expressions of caspase-1 induce apoptosis in mammalian cells [28]. In addition, knockdown of G
mRNA in the Laser + NPs group was more than the control and laser protein receptor 160 (GPR160) in prostate cancer cells induced cell
groups (P < 0.05, Fig. 6A). The BPH induction increased caspase-3 cycle arrest and cell death pathway by elevation of caspase-1 and IL-6
mRNA expression in the NPs and BPH groups in comparison with the expression, which demonstrates the activator role of caspase-1 in
laser treated groups (P < 0.05, Fig. 6B). Relative expressions of cas- apoptosis pathway [29]. Carbon NPs can induce pyroptosis and is
pase-7 mRNA in the BPH group was more than other groups (P < 0.05, shown by increase of caspase-1 [30]. Furthermore, the Golgi apparatus
Fig. 6C). fragmentation during apoptosis was observed in the Laser + NPs group
which has been shown as a result of caspase-mediated cleavage of
4. Discussion several Golgi-associated proteins [31]. In the present study Laser + NPs
could induce apoptosis via caspase-1.
Hyperthermia therapy using injected NPs in the induced BPH rats In conclusion, irritated NPs have demonstrated to be promising
demonstrated high level of improvement and epithelial cells apoptosis agents against BPH. The approach of this study can be applied to in-
compared with other groups including the BPH, normal and finasteride troduce the laser irritated NPs method as a novel and less invasive
treated groups. Histopathological assays provided the main evidences therapy for patients suffering from BPH. Although, required further
for the therapeutic role of Laser + NPs in treatment of BPH in rat investigation and characterization for complete understanding of their
models by induction of apoptosis. Previously, Photo-thermal therapy by whole therapeutic potential. Moreover, the toxicity and interaction of
using the near infrared absorbing nanoparticles was examined to tumor NPs with living normal cells must be more studied to achieve a safe and
ablation in mice and the treated animals was appeared tumor free after less invasive treatment method.
about 90 days [24]. The therapeutic effect of plasmonic gold NPs with
laser irradiation in ablation of tumor emboli structure assumed by in-
flammatory breast cancer in vivo [25]. Gandra and coworkers eval- Funding
uated the tumor selectivity potential of plasmonic gold NPs during
thermal ablation of tumor cell specifically from their co-cultured This study was financially support by the research grants of Shiraz
normal cells which introduces the plasmonic gold NPs a promising University of Medical Sciences, and The Persian Gulf Biomedical
candidate for nanomedicine as well as the current findings [26]. These Research Center, Bushehr University of Medical Sciences.
findings confirm the influence of plasmonic NPs in treatment of BPH by
site-specific cell death.

6
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

Fig. 6. Real-time PCR and detection of caspase 1, caspase 3 and caspase 7 which are play a remarkable role in cell death pathway in BPH prostate samples of rat due
to treatment by laser induced plasmonic NPs. A) Relative fold change of caspase 1. B) Relative fold change of caspase 3. C) Relative fold change of caspase 7. Lines
above the columns show significant differences between the groups (P < 0.05). D) Gel electrophoresis.

Authors’ contributions [2] M.H. Davidian, Guidelines for the treatment of benign prostatic hyperplasia, US
Pharm 41 (8) (2016) 36–40.
[3] L. Pirozzi, P. Sountoulides, P. Castellan, F. Presicce, R. Lombardo, M. Romero,
OKH, MAB, NT and AT conceived and planned the experiments. C.D. Nunzio, A. Tubaro, L. Schips, L. Cindolo, Current pharmacological treatment
OKH, MAB, AK, FE, ZS, ARD, ADF, FR, HV, and ADT carried out the for male LUTS due to BPH: dutasteride or finasteride? Curr. Drug Targets 16 (11)
experiments. OKH, MAB, and AK contributed to sample preparation. (2015) 1165–1171.
[4] F.C. Carnevale, A. Iscaife, E.M. Yoshinaga, A.M. Moreira, A.A. Antunes, M. Srougi,
AK, FE, ZS, ARD, ADF, FR, HV, and ADT contributed to the inter- Transurethral resection of the prostate (TURP) versus original and PErFecTED
pretation of the results. AT, NT and ADT took the lead in writing the prostate artery embolization (PAE) due to benign prostatic hyperplasia (BPH):
manuscript. All authors provided critical feedback and helped shape the preliminary results of a single center, prospective, urodynamic-controlled analysis,
Cardiovasc. Intervent. Radiol. 39 (1) (2016) 44–52.
research, analysis and manuscript. [5] M.-C. Chen, Z.-W. Lin, M.-H. Ling, Near-infrared light-activatable microneedle
system for treating superficial tumors by combination of chemotherapy and pho-
Declaration of Competing Interest tothermal therapy, ACS Nano 10 (1) (2015) 93–101.
[6] Y.-Y. Zhao, Q. Wu, Z.-B. Wu, J.-J. Zhang, L.-C. Zhu, Y. Yang, S.-L. Ma, S.-R. Zhang,
Microwave hyperthermia promotes caspase‑3-dependent apoptosis and induces G2/
There is no conflict of interest to declare. M checkpoint arrest via the ATM pathway in non‑small cell lung cancer cells, Int. J.
Oncol. 53 (2) (2018) 539–550.
[7] P. Clerc, P. Jeanjean, N. Hallali, M. Gougeon, B. Pipy, J. Carrey, D. Fourmy,
Acknowledgment V. Gigoux, Targeted Magnetic Intra-Lysosomal Hyperthermia produces lysosomal
reactive oxygen species and causes Caspase-1 dependent cell death, J. Control.
We specially thank the personnel of Animal Laboratory of Shiraz Release 270 (2018) 120–134.
[8] T. Bergsbaken, S.L. Fink, B.T. Cookson, Pyroptosis: host cell death and inflamma-
University of Medical Sciences, Shiraz, Iran. tion, Nat. Rev. Microbiol. 7 (2) (2009) 99–109.
[9] X. Song, Q. Chen, Z. Liu, Recent advances in the development of organic photo-
Appendix A. Supplementary data thermal nano-agents, Nano Res. 8 (2) (2015) 340–354.
[10] S.R. Panikkanvalappil, N. Hooshmand, M.A. El-Sayed, Intracellular assembly of
nuclear-targeted gold nanosphere enables selective plasmonic photothermal
Supplementary material related to this article can be found, in the therapy of cancer by shifting their absorption wavelength toward near-infrared
online version, at doi:https://doi.org/10.1016/j.biopha.2020.110118. region, Bioconj. Chem. 28 (9) (2017) 2452–2460.
[11] Z. Sobhani, M.A. Behnam, F. Emami, A. Dehghanian, I. Jamhiri, Photothermal
therapy of melanoma tumor using multiwalled carbon nanotubes, Int. J. Nanomed.
References 12 (2017) 4509–4517.
[12] G.S.R. Raju, L. Benton, E. Pavitra, J.S. Yu, Multifunctional nanoparticles: recent
progress in cancer therapeutics, Chem. Commun. 51 (68) (2015) 13248–13259.
[1] O.A.H. Alawamlh, R. Goueli, R.K. Lee, Lower urinary tract symptoms, benign
[13] M.A. Behnam, F. Emami, Z. Sobhani, O. Koohi-Hosseinabadi, A.R. Dehghanian,
prostatic hyperplasia, and urinary retention, Med. Clin. 102 (2) (2018) 301–311.
S.M. Zebarjad, M.H. Moghim, A. Oryan, Novel combination of silver nanoparticles

7
O. Koohi Hosseinabadi, et al. Biomedicine & Pharmacotherapy 127 (2020) 110118

and carbon nanotubes for plasmonic photo thermal therapy in melanoma cancer (2018) 723–729.
model, Adv. Pharm. Bull. 8 (1) (2018) 49. [23] S. Ergun, K. Arman, E. Temiz, I. Bozgeyik, Ö. Yumrutaş, M. Safdar, H. Dağlı,
[14] H. Sharma, P.K. Mishra, S. Talegaonkar, B. Vaidya, Metal nanoparticles: a ther- A. Arslan, S. Oztuzcu, Expression patterns of miR-221 and its target Caspase-3 in
anostic nanotool against cancer, Drug Discov. Today 20 (9) (2015) 1143–1151. different cancer cell lines, Mol. Biol. Rep. 41 (9) (2014) 5877–5881.
[15] O. Brzobohatý, M. Šiler, J. Trojek, L. Chvátal, V. Karásek, A. Paták, Z. Pokorná, [24] D.P. O’Neal, L.R. Hirsch, N.J. Halas, J.D. Payne, J.L. West, Photo-thermal tumor
F. Mika, P. Zemánek, Three-dimensional optical trapping of a plasmonic nano- ablation in mice using near infrared-absorbing nanoparticles, Cancer Lett. 209 (2)
particle using low numerical aperture optical tweezers, Sci. Rep. 5 (2015) 8106. (2004) 171–176.
[16] M.A. Behnam, F. Emami, Z. Sobhani, A.R. Dehghanian, The application of titanium [25] B.M. Crawford, R.L. Shammas, A.M. Fales, D.A. Brown, S.T. Hollenbeck, T. Vo-Dinh,
dioxide (TiO2) nanoparticles in the photo-thermal therapy of melanoma cancer G.R. Devi, Photothermal ablation of inflammatory breast cancer tumor emboli using
model, Iran. J. Basic Med. Sci. 21 (11) (2018) 1133–1139. plasmonic gold nanostars, Int. J. Nanomed. 12 (2017) 6259.
[17] F. Wang, Y. Yang, Y. Ling, J. Liu, X. Cai, X. Zhou, X. Tang, B. Liang, Y. Chen, [26] N. Gandra, C. Portz, S.Z. Nergiz, A. Fales, T. Vo-Dinh, S. Singamaneni, Inherently
H. Chen, Injectable and thermally contractible hydroxypropyl methyl cellulose/ stealthy and highly tumor-selective gold nanoraspberries for photothermal cancer
Fe3O4 for magnetic hyperthermia ablation of tumors, Biomaterials 128 (2017) therapy, Sci. Rep. 5 (2015) 10311.
84–93. [27] L. Minutoli, M. Rinaldi, H. Marini, N. Irrera, G. Crea, C. Lorenzini, D. Puzzolo,
[18] F. Pelaez, N. Manuchehrabadi, P. Roy, H. Natesan, Y. Wang, E. Racila, H. Fong, A. Valenti, A. Pisani, E. Adamo, Apoptotic pathways linked to endocrine system as
K. Zeng, A.M. Silbaugh, J.C. Bischof, Biomaterial scaffolds for non-invasive focal potential therapeutic targets for benign prostatic hyperplasia, Int. J. Mol. Sci. 17 (8)
hyperthermia as a potential tool to ablate metastatic cancer cells, Biomaterials 166 (2016) 1311.
(2018) 27–37. [28] I. Chang, Y. Mitsui, S.K. Kim, J.S. Sun, H.S. Jeon, J.Y. Kang, N.J. Kang, S. Fukuhara,
[19] X. Yang, H. Li, C. Qian, Y. Guo, C. Li, F. Gao, Y. Yang, K. Wang, D. Oupicky, M. Sun, A. Gill, V. Shahryari, Cytochrome P450 1B1 inhibition suppresses tumorigenicity of
Near-infrared light-activated IR780-loaded liposomes for anti-tumor angiogenesis prostate cancer via caspase-1 activation, Oncotarget 8 (24) (2017) 39087.
and Photothermal therapy, Nanomed. Nanotechnol. Biol. Med. 14 (7) (2018) [29] C. Zhou, X. Dai, Y. Chen, Y. Shen, S. Lei, T. Xiao, T. Bartfai, J. Ding, M.-W. Wang, G
2283–2294. protein-coupled receptor GPR160 is associated with apoptosis and cell cycle arrest
[20] Jq. Tang, Xy. Hou, Cs. Yang, Yx. Li, Y. Xin, Ww. Guo, Zp. Wei, Yq. Liu, G. Jiang, of prostate cancer cells, Oncotarget 7 (11) (2016) 12823.
Recent developments in nanomedicine for melanoma treatment, Int. J. Cancer 141 [30] A.C. Reisetter, L.V. Stebounova, J. Baltrusaitis, L. Powers, A. Gupta, V.H. Grassian,
(4) (2017) 646–653. M.M. Monick, Induction of inflammasome-dependent pyroptosis by carbon black
[21] N. Manuchehrabadi, L. Zhu, Development of a computational simulation tool to nanoparticles, J. Biol. Chem. 286 (24) (2011) 21844–21852.
design a protocol for treating prostate tumours using transurethral laser photo- [31] S. Mukherjee, R. Chiu, S.M. Leung, D. Shields, Fragmentation of the Golgi appa-
thermal therapy, Int. J. Hyperthermia 30 (6) (2014) 349–361. ratus: an early apoptotic event independent of the cytoskeleton, Traffic 8 (4) (2007)
[22] T. Jiang, Y. Zhang, Z. Hu, B. Jiang, X. Hou, Treatment of benign prostatic hyper- 369–378.
plasia with finasteride: evidence from a meta-analysis, Trop. J. Pharm. Res. 17 (4)