ENCH 535 / 619.

68 – Principles of Biochemical Engineering

Midterm 1 – February 11, 2022 (2 hours). Documents can be submitted until 6:00 with a 15-minute
contingency time for submitting your document.
Exam will be open-book and open-notes. You are permitted to access your own course notes, the textbook
and the course D2L site. You are not permitted to search the internet, communicate with classmates or
other individuals, or share examinations with classmates or other individuals during the assessment
period. Once the assessment is started, assessment solutions must be submitted within the time limits
listed above.
The course Teaching Assistant, Mr. Brett Abraham, will be monitoring his email (bdabraha@ucalgary.ca)
during the scheduled midterm examinations. Students are encouraged to reach out to him as soon as
possible if they are having any issues accessing, completing, or submitting assessments in D2L. If you are
unable to submit your completed assessment to the dropbox by the deadline due to technical issues with
D2L, please email your submission to the teaching assistant as soon as possible in order to timestamp
your submission. You must also reach out to the Teaching Assistant if it appears that you will not be able
to take a test at the scheduled time, and provide a reason for consideration by the instructor.
Instructor also availability: February 11 from 4:00 pm to 6:00 pm

Please provide your answers in a separate document in the format:

Q1: answer
Q2: answer
…
Q9:
a) Answer
b) Answer . . .
Save your submission as a PDF and upload it with the name:
ENCH535or619_Midterm1_firstname_lastname
The last section of the test requires handwritten work. Please either insert pictures of your work into your
answer document for the appropriate questions or upload a separate PDF document clearly indicating
which questions are answered in each document.
Multiple choice section
1. [1 point] Restriction endonuclease act as a defence mechanism in bacterial system against foreign
DNA such as viruses. But how do bacteria protect their own DNA from endonuclease activity?
a) By methylation of bacterial DNA by restriction enzyme
b) By methylation of foreign DNA by restriction enzyme
c) By phosphorylation of bacterial DNA by restriction enzyme
d) By phosphorylation of foreign DNA by restriction enzyme

2. [1 point] Thermostable DNA polymerases are very important in PCR. How are they obtained?
a) They are obtained by heating the bacteria manually over high temperatures
b) They are isolated from extremely stable thermophilic bacteria which are often found growing
in oceanic vents
c) They are found everywhere in the nature
d) They are obtained by genetically modifying the E. coli bacteria with thermal stability property

3. [1 point] Gel electrophoresis separates nucleic acid molecules based on:

a) charge on molecules
b) size of the molecules
c) nature of the molecules i.e. whether DNA or RNA
d) chemical properties of the nucleic acids

4. [1 point] An operon is defined as:

a) A related set of genes each having different promoters and are present differently
b) A set of genes which are present together but are controlled by different promoters
c) A set of genes which are present together and are controlled by the same promoter
d) A set of genes which are not present together but controlled by the same promoter

5. [1 point] Where does the Glycolysis process take place in anaerobic organism
a) cell membrane
b) cytoplasm
c) mitochondria
d) Golgi body

6. [1 point] On a molecular level DNA differs from RNA due to

a) the presence of a 2’ OH group
b) the type of bases that bind the sugar ring
c) the number of carbons in its sugar ring
d) Only a) and b)
e) all the above
7. [1 point] Different complex carbohydrates are formed due to
a) the presence of different monosaccharides bound by glycosidic bonds
b) the presence or lack of branching glycosidic bonds
c) the steric orientation of glycosidic bonds
d) Only a) and b)
e) all the above

8. [1 point] A phospholipid is amphipathic because

a) it can act as a dense energy source
b) it has both hydrophilic and hydrophobic groups
c) it forms cell membranes in bacteria and eukaryotic cells
d) it can be saturated or unsaturated

Short Answer section

This section does not need to be completed by hand, feel free to type your short answers in your
submission document

9. Using an electron microscope, you can view enzymes and organelles in a cell, including those involved
with gene expression.

(a) [3 points] How could you tell that a particular sample is a prokaryotic cell rather than a eukaryotic
cell? (Give three major differences)

(b) [5 points] If it is a bacterial cell, what technique could you use to identify if it is a gram-positive or
gram-negative bacterium (1 point)? Briefly explain the steps behind this technique (1 point per step).

(c) [10 points] If you saw the image below, please label the following structures of A-E and provide a
brief description of their function (1 point for correct label, 1 point for correct function):
10. [16 points] For each of the biological macromolecules (a-d) listed below, are they polymers? If so,
describe the basic structure of the monomers that make the polymer and name the bond that links the
monomers together. If not describe why. Give a biological example for each macromolecules and its role
in the cell.

(a) Lipids; (b) Carbohydrates; (c) Nucleic acids; (d) Proteins.

― Is it a polymer? (1 point)
o If so: what is basic structure of monomer and the bond that links monomers? (2 points)
o If not: why? (2 points)
― Give examples and their functions for each macromolecules in cells (1 point)

11. [4 points] State and describe the different levels of protein structure.

12. [6 points] What components and reagents are required for a PCR reaction? Describe the steps
involved in PCR.

13. [8 points] Below is a diagram of DNA replication in E. coli. Answer the questions 1-8. (4 and 5
require you to label the name of the fragment)
Handwritten section
Please complete this section by hand and insert pictures into your submission document or upload a
separately scanned PDF document with your submission.

14. [4 points] The recognition sequence for BamHI is 5’ G|GA _ _ _ 3’. The ‘|’ represents the cutting site.
a) Complete the palindromic sequence and write the complementary strand
b) draw the two sticky ends after BamHI cleavage

15. [16 points] Shown below is the DNA sequence of a gene from a virus that encodes a short viral
peptide (only one strand is shown). Also shown is the sequence of the mRNA synthesized from this gene.

Genomic DNA sequence:

5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3'

Mature mRNA sequence (G* = G cap):

5'-G*AGCUCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3'

(a) Determine the DNA sequence on the complementary strand. (5 points)

(b) In the genomic DNA sequence shown above or in the sequence you obtained in (a), draw a box around
each of the two exons in the gene. (2 points)

(c) In the mature mRNA above, some nucleotides are present that are not coded for in the genomic DNA
sequence. Name the two steps that have occurred to add these nucleotides to the mRNA. (2 points)

(d) Determine the primary structure of the viral peptide encoded by this gene from N terminal to C
terminal. (5 points)

(f) Is this virus more likely to replicate in prokaryotic or eukaryotic cells? Briefly explain your reasoning.
(2 points)
 Arryo@all

QI:
Q2: B
03: 6

04: C

Qs: B

Q6; D

QT: f
Qg: B
 09
Ca) A particular Sumpte is cu pookelayotic cell
fatherfothen cl CutKiltyoh'e cell perane
the llo coing Mesons!
hug
particudels sumple Nuclens VS
(1) It o
menucleor region
CEO) TA ou particular: Sample Contains Exitezral
sti Structures Like pill cind flagelle.
perticulu% Seimple hoss membrane pound
CH*+ c
Organelles.
(C p Sa

• anterial cell techniques aled to

Cb I i0 IS L14 i+ is ou , rumm-positive DI grrum-
NATO
identis of Pollocsing:
negatil borterin cisse

Coon Stein teahm'que is used +o identity

TE it is et coum-positive 06 gram- nEjitive
besterium.
Steps to determint berteium a cholos Pollo co ma'
eleantberte
Step1 Stair the baite-Delocell coith Crystal violet
Herl stain diffuses into both Gram
Ond g ret negative portend sarane
poite
130
Step. An clodine Sol who n is used to fix the Stein.
this step helps the Coystal VioLet to tof
contin the h to pl of mi. tourshe aire
atto.
 Ethermol 06
Step 3: Wes hing the Golestion coith
acetone. By doing sHiis the Lipid
BiJa3-of the cell becomes m00 we

†o Crystal violet stuin.

permeable the
Hairs is stropped inside the
then
A Teton
the
POsitNe cells due to the preseme
of their Hick peptidog Lycan cooshed
con d

On- the Other hund: the is

Out Oh the gram negative cells
Of the ismaller peptido
Step 4 In this lost step counter the Steuin coith
Sufferin red BJ doing this stef Proctol
positive stin cells COiLI TEno'Apuopule
cohered the guan megative cells : coill
chemge in to the Lighter pink shade.

A.
Nucleus It is *the Location cohere: DNA
Sinthegis emd transliption
eind a lo protects DNA
ß. Cell membrame O% Phos pholipid bilusex:
I+ is toe Location cObexe cell
Separates from its SU3 MD 2122 dings
end the semi per me able cell
me brune ..allOws the s Seer
†ran spoT+ ot nutof ents und coastes
m and Out ot the call,
C. Ribosomes: Ribosomer ure the RNA Contouct
cothch tuns lute mRNA into
protein.

D, Coolgi apperratus: 7 does the portein

ais coelIcs Sowting
modification
coith localization Cond tacosportutio
E. Mito chonda It is sne power howe 0+
the cell. These core segponible tur
-the paddaution Of AT?.

090 HO
Dib Lao srAe

fouls

20 6 Alcell,
MAD /9 repoed

to sal tal
2 028 LA 00
bor SeE : 6A
Lip to feel
AM
fibroy
Q10

(al) Lipids:
THiS not a polymes.

- Examples: Tricaiiglyceml-used ene+91

Storage
Steroida hormonel signal lirai
molecules:
CHI Cosbohyd-satest
It is a polymer. In the Carbohydrates ;
monos acchulsides are the busic polymes
Then Colgeosidic bonds link thee into
poly meas.
Examples: Calycogen- used pot Ami mul
EnRIgI
Celludose- plunt Starretenal molecules

Co Nucleic ceide:
Me 46 meT THis aL pod goer. In she
Nucleic uci de monomed Composed 0€ bese,
ribose Sugax erad phosphute Then monomeat
Linted bi phos pho di eter bond,
Focamples: PNA They contain store
genetic informatin
RNA - the code thut converts
DNA (Fo pot cios,
 Protein:
+ §s or pol tone 7 . Monomers Of
paoteiw ase Umino ceiLg colich hos tre
bodic
Statuse
Cr R funti ona l
0+ cl N cC backbone coith
op. •
2 Examples: Enzy• the Cotulpts ot
Pac biologicul Tectiony
Membrume protein these
involved nutrient
are
in to unsport
Qi L The dittese-it Levess of patein Stout unort
casse os following:

Primary Stature - Tt hos lined o Senueme

Of ac
SeconderogShowthrol-It huf cilpher he lie
Cond betce Sheet

Tertiary Atomitune- It has sthe

folding of the peptide coith the
nON-Covalent boade
Quaternard Stoutuse- It is the formation
Cot a Comples 0+ multiple Sub
unit in to u Lingle Pen Honul
protein.
 Q42) The Compome-Ats send Desgents ove
for a PC R secution use COS folLoco/ny:
ON A Templuge
dNTi
Proton eSs

Polymerase
Steps involved in
-
PCRE

Step: Denatumi 03 g4-ag 'c beleme

he cet. nsf +o
DNA Strum de †o denature ,be less
Single Strumded DN N 2210 Pi1
Step: 2 Ammealing In Huis step tEmperatstorei
Locuered to $0-65 'C, lets
prime zs erneut +0 † e §S ON A.

Step:3 Factension - In tuts step increase the teenpe

HO H-LO'C. TI the temperatu
That allocos fog Tat polyancre
do fumtion. Then, DNA 'S
Stelh Repeat Steps 1+0 3.

Kilroy
Q13)
l. §l
2. To poisomesase
3. Helcase
ds Rimness

S.
Okazaki fougment
6 Ligas e

Lugging.
G §
Q:14
Ca 3 Ag çlo
3 GAT CAS
CC TA, O S

AlriL65 4• 9300 Aircr

Cb The +roo SHiCIad Ends uf+es BamHI cleavaze!

DOA TR LA LA DEODA
CCTA O
CAT CR

dISA

Hilroy
GUs
C
Cad The DNA senuencer on the Comple mentory
Strand.
Li) Caenome DNA Serence -D CO diNT} Strand

§! MACTCATORTOCHAATECTRACACTORA
CTA&OF - 3

it Complementag Serence Cremplete stound)

BI -TCCAOTA CACOCTCACACACTALAA CTA
. ATCC-C

Cb)
Coding Star cios:
2
SHADETCATORTIRCCARCATCCTO 'OCTRA ITA Cala

O 3 exon1
17 = 080n t
2 1440- get spli'ced Out
 Cc)
Stepy El Copping - sthe st guarne cop iS edded
Step'2 and poly ademylution- A FoiL is
added to the 3' en b.

C met Cad Avg Step

S- (* AC CUCU
~y
CUNACUA lA l AAA
AAAAA.. masture mRNA

(H Thic Vignd ís the Erraoyotic cells Because

N
Tenures the modification †o Sitesize
The M-RNA

Hilroy
 ENCH 535 / 619.68 (Winter 2021) Page 1 of 5
Principles of Biochemical Engineering
Approved by
Dept. Head
A.S.
FINAL EXAMINATION
Student Name: Student ID: Lecture Section:
Print Last Name, First Name
Instructor(s): Jinguang Hu jinguang.hu@ucalgary.ca 4032203990

TEST RULES AND INFORMATION

1. This test is: X Open Course Book X Open Course Notes Closed Book Closed Notes
2. This test is: Synchronous X Asynchronous
3. This test is being made available to you on: April 28 , 2021 at 6:30 PM MT.
4. This test is designed to be completed in no more than 2 hour(s) and 0 minutes.
5. This is a timed test. Once you access the test, you have 3 hour(s) and 0 minutes to submit your answers/solutions.
6. Answers/Solutions to this test will not be accepted beyond: April 29 , 2021 at 6:30 PM MT.
7. This test is 5 pages long. It has 18 question(s) worth a total of 100 marks.
8. You are not permitted to collaborate or consult with others when developing solutions and determining answers. The
solutions/answers you submit must be your own, and developed only by you. You must abide by University of Calgary's
Statement on Academic Integrity:
"Academic integrity is the foundation of the development and acquisition of knowledge and is based on values
of honesty, trust, responsibility, and respect. We expect members of our community to act with integrity."
"Research integrity, ethics, and principles of conduct are key to academic integrity. Members of our campus
community are required to abide by our institutional code of conduct and promote academic integrity in
upholding the University of Calgary’s reputation of excellence."
9. You can record solutions to the test questions in the following ways (X marks all that apply):
Downloading the test paper as a PDF document, and writing electronically on (i.e. annotating) the PDF
document using your device screen (e.g. iPAD, Surface etc.).
Printing out the test paper, and writing solutions by hand on the printed test paper.
X Writing solutions by hand on loose‐leaf or lined paper. If you choose this option, you do not need to include
this cover page (page 1 of the examination paper) when submitting your solutions.
Other (Specify)
10. Write your answers neatly and legibly, show all your work and clearly state any assumptions you make. Ensure each of
the following: (i) your name and/or your ID number appears at the top of each page of your solutions, (ii) each page is
numbered, and (iii) you specify the question number being answered on each page.
11. You can submit solutions written on paper, or as an annotated PDF, as follows (X marks all that apply):
Save your annotated PDF, and upload it to D2L
X Scan solutions written on paper, and upload all pages (in order) as a single PDF file. If you don't have a scanner,
use the Microsoft Lens app on your phone to photograph and create a PDF of your solutions. Upload your PDF
file to D2L
X Scan solutions written on paper, and email all pages (in order) as a single PDF file to your instructor(s). If you
don't have a scanner, use the Microsoft Lens app on your phone to photograph and create a PDF of your solutions.
12. The submitted file name format should be: Last Name, First Name, Student ID, ENCH 535 619 SOLUTIONS.pdf
13. By submitting solutions to the test questions, you acknowledge that the solutions you are submitting are yours,
and were developed by you alone, and that you adhered to the University of Calgary Principles of Conduct.
14. Keep your original handwritten solutions as part of your records should questions arise during marking.
15. For questions and clarifications about the test content, you can contact your instructor(s) by:
X Email Phone Instructor(s) will not clarify or answer questions about the test content
16. For technical issues that arise during submission, contact instructor(s) by: X Email Phone
17. The instructor(s) will be available at the following times: April 29, 9am to 6pm

18. If during the test you become ill or receive word of domestic affliction, and feel that you are unable to continue,
submit your unfinished work to your instructor with a request that it be cancelled.
19. If you submit solutions for marking, and later report extenuating circumstances to support a request for cancellation
of the paper and for another test, such a request will be denied.
1. Multiple Choice Section (10 questions, 2.5 points each)
(1) List all the different domains into which living organisms can be classified.
All living organisms can be classified into which domains of life?
a) Bacteria
b) Archaea
c) Eukarya
d) Protozoa
e) A,b, and c only
f) All of the above

(2) All living organisms fall into which major groups of life?
a) prokaryotic
b) eukaryotic
c) fungi
d) a and b only
e) all of the above

(3) During DNA replication, why does the lagging strand have Okazaki fragments?
a) Because the lagging strand is replicated in the opposite direction that the replication fork is
proceeding
b) Because DNA polymerase can only proceed 5’ to 3’
c) Because RNA primers can only anneal to the lagging strand
d) A and b only
e) All of the above

(4) A student isolated a cell strain in which the joining together of Okazaki fragments is impaired.
He/she suspected that a mutation has occurred in an enzyme found at the replication fork. Which
enzyme is most likely to be mutated?
a) DNA polymerase
b) DNA helicase
c) Ligase
d) Topoisomerase

(5) A biologist is trying to perform DNA replication in a test tube (in vitro) using a single-stranded
linear DNA as the template and the appropriate DNA primer. Which proteins are required for one
round of replication?
a) DNA polymerase
b) RNA polymerase
c) Ligase
d) d)helicase

(6) Which enzyme is responsible for breaking the hydrogen bonds, and thus separating the DNA
strands during DNA replication?
a) polymerase
b) topoisomerase
c) Ligase
d) Helicase

(7) How many copies of DNA would you have after ten PCR replication cycles if you start with four
copies?
a) 1024

ENCH 535 / 619.68 (Winter 2021) – Final Examination 2

 b) 4096
c) 16000
d) 1048576

(8) In Eukaryotes, where does glycolysis take place and where does the citric acid cycle take place?
a) Both glycolysis and the citric acid cycle take place in the cytoplasm
b) Glycolysis takes place in the cytoplasm, citric acid cycle takes place in the mitochondria
c) Both glycolysis and the citric acid cycle take place in the mitochondria
d) Glycolysis takes place in the cytoplasm and the citric acid cycle takes place across the cellular
membrane.

(9) Which statement about enzymes is incorrect?

a) Enzymes works by lowering the energy of activation of the reaction
b) enzymes spontaneously bind to substrates to form an enzyme-substrate complex.
c) The free energy difference between the initial and final states of an enzyme catalyzed reaction
does not change.
d) The enzyme only modifies the intermediate steps of a reaction not the overall reaction.
e) All of the above are true

(10) Why would Escherichia coli not be preferred for the production of recombinant human
therapeutic proteins.
a) Bacterial cells do not have the machinery to remove introns from the eukaryotic DNA – resulting
in a different peptide
b) Bacterial cells are typically much easier to transform with foreign DNA
c) Bacterial cells are unable to perform the same posttranslational modifications that occur in
Human cells which could result in a non-functional protein
d) Bacterial cells typically grow much faster than eukaryotic cells, resulting in a more efficient
bioprocess.
e) A and b only
f) C and d only

2. Short answer section (5 questions, 40 points in total)

SA1. (16 points) Refer to the following diagram when answering the questions below.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 3

(a) Indicate whether each statement below is True (T) or False (F). If the statement is false, rewrite it to
make it true or explain why it is incorrect:
___ The structures labeled A and B are identical in both cell types: A and B are both composed of two
subunits (small and large) with an overall size of 80S.
___ Right after the polypeptide is synthesized it is ready to act as a functional protein.
___ The molecule labeled C usually codes for many different proteins in bacterium, but it normally codes
for a single protein, or a few functionally related proteins, in Eukaryotes.
___ If molecule H (from an eukaryotic cell) is transferred to a bacterium cell, then the polypeptide
assembled by A will be identical to the polypeptide assembled by B.

(b) Identify and briefly describe (1 sentence) the function of the molecules/organelles referred in the
figure:
– A/B:
– C:
– F:
– G/H:

(c) The molecules labeled C and D in the Eukaryotic cell contain a cap and a poly-A tail. What is the
function of these groups?

(d) List two differences between molecules G and H.

Difference 1:
Difference 2:

SA2. (8 points) The following DNA sequence contains the code for a protein:
5’ TATTGGGGATGCTATCTTTCGCCGTTCCCCACTAAGGGGCAAAAACC 3’
a. Determine the DNA sequence on the complementary strand
b. Determine the sequence of the mRNA
c. Determine the primary structure of the protein
d. List 2 major assumptions you have made about this DNA sequence / protein

SA3. (6 points) Draw two simplified flow diagrams and use them to explain the difference between
aerobic respiration and fermentation for the metabolism of glucose to provide energy to the cells.

SA4. (4 points) An enzyme has a vmax of 10 mmol/sꞏmg. The Michaelis-Menten constant km is 0.5
mM. What is the initial rate when the substrate concentration is 0.5 mM and why?

SA5. (6 points) It is very difficult to determine the equilibrium constant (K′eq) for the hydrolysis of
ATP by measuring the concentrations of reactants and products, since there is very little ATP
present at equilibrium. Instead, K′eq for this reaction can be determined by measuring K′eq for the
following two separate reactions:
Glucose-6-phosphate + H2O ⇔ glucose + Pi K′eq = 270
ATP + glucose ⇔ ADP + glucose-6-phosphate K′eq = 890
Using this information, calculate the value of K′eq and of ΔG° for ATP hydrolysis at 25 ºC (298 K):
ATP + H2O ⇔ ADP + Pi
Show your work.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 4

3. Long Answer Section (3 questions, 35 points each)
LA1. (10 Points) Aerobic growth of Saccharomyces cerevisiae on ethanol is simply described by the
following overall reaction:
C2H5OH + aO2 + bNH3 → cCH1.704N0.149O0.408 + dCO2 + eH2O
a. Determine the coefficients a, b, c, d, and e, where RQ = d/a = 0.66
b. Determine the biomass yield coefficient, YX/S, and oxygen yield coefficient YX/O (g of cells / g of
O2).

LA2. (15 Points) Pseudomonas sp. has a mass doubling time of 2.4h when grown on acetate. The
half-saturation constant (Ks) using this substrate is 1.3 g/L and the cell yield on acetate is 0.46 g cell
per g acetate. If we operate a chemostat on a feed stream containing 38 g/L acetate, find:
a) Cell concentration when D = 0.5 max
b) Substrate concentration when D = 0.5 max
c) Cell volumetric productivity when D = 0.5 max

LA3. (10 Points) A steam sterilizer is used to sterilize liquid medium for fermentation. The initial
concentration of contaminating organisms is 108 per litre. For design purposes, the final acceptable
level of contamination should be taken to be 10-3 cells; this corresponds to a risk that one batch in a
thousand will remain contaminated even after the sterilization process is completed. For how long
should 1 m3 medium be treated if the temperature is:
(a) 80°C
(b) 121°C
(c) 140°C
To be safe, assume that the contaminants present are spores of Bacillus stearothermophilus, one of
the most heat-resistant microorganisms known. For these spores the activation energy for thermal
death is 283 kJ gmo1-1 and the Arrhenius constant is 1036.2 s-1.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 5

 ENCH 535 / 619.68 (Winter 2021) Page 1 of 5
Principles of Biochemical Engineering
Approved by
Dept. Head
A.S.
FINAL EXAMINATION
Student Name: Student ID: Lecture Section:
Print Last Name, First Name
Instructor(s): Jinguang Hu jinguang.hu@ucalgary.ca 4032203990

TEST RULES AND INFORMATION

1. This test is: X Open Course Book X Open Course Notes Closed Book Closed Notes
2. This test is: Synchronous X Asynchronous
3. This test is being made available to you on: April 28 , 2021 at 6:30 PM MT.
4. This test is designed to be completed in no more than 2 hour(s) and 0 minutes.
5. This is a timed test. Once you access the test, you have 3 hour(s) and 0 minutes to submit your answers/solutions.
6. Answers/Solutions to this test will not be accepted beyond: April 29 , 2021 at 6:30 PM MT.
7. This test is 5 pages long. It has 18 question(s) worth a total of 100 marks.
8. You are not permitted to collaborate or consult with others when developing solutions and determining answers. The
solutions/answers you submit must be your own, and developed only by you. You must abide by University of Calgary's
Statement on Academic Integrity:
"Academic integrity is the foundation of the development and acquisition of knowledge and is based on values
of honesty, trust, responsibility, and respect. We expect members of our community to act with integrity."
"Research integrity, ethics, and principles of conduct are key to academic integrity. Members of our campus
community are required to abide by our institutional code of conduct and promote academic integrity in
upholding the University of Calgary’s reputation of excellence."
9. You can record solutions to the test questions in the following ways (X marks all that apply):
Downloading the test paper as a PDF document, and writing electronically on (i.e. annotating) the PDF
document using your device screen (e.g. iPAD, Surface etc.).
Printing out the test paper, and writing solutions by hand on the printed test paper.
X Writing solutions by hand on loose‐leaf or lined paper. If you choose this option, you do not need to include
this cover page (page 1 of the examination paper) when submitting your solutions.
Other (Specify)
10. Write your answers neatly and legibly, show all your work and clearly state any assumptions you make. Ensure each of
the following: (i) your name and/or your ID number appears at the top of each page of your solutions, (ii) each page is
numbered, and (iii) you specify the question number being answered on each page.
11. You can submit solutions written on paper, or as an annotated PDF, as follows (X marks all that apply):
Save your annotated PDF, and upload it to D2L
X Scan solutions written on paper, and upload all pages (in order) as a single PDF file. If you don't have a scanner,
use the Microsoft Lens app on your phone to photograph and create a PDF of your solutions. Upload your PDF
file to D2L
X Scan solutions written on paper, and email all pages (in order) as a single PDF file to your instructor(s). If you
don't have a scanner, use the Microsoft Lens app on your phone to photograph and create a PDF of your solutions.
12. The submitted file name format should be: Last Name, First Name, Student ID, ENCH 535 619 SOLUTIONS.pdf
13. By submitting solutions to the test questions, you acknowledge that the solutions you are submitting are yours,
and were developed by you alone, and that you adhered to the University of Calgary Principles of Conduct.
14. Keep your original handwritten solutions as part of your records should questions arise during marking.
15. For questions and clarifications about the test content, you can contact your instructor(s) by:
X Email Phone Instructor(s) will not clarify or answer questions about the test content
16. For technical issues that arise during submission, contact instructor(s) by: X Email Phone
17. The instructor(s) will be available at the following times: April 29, 9am to 6pm

18. If during the test you become ill or receive word of domestic affliction, and feel that you are unable to continue,
submit your unfinished work to your instructor with a request that it be cancelled.
19. If you submit solutions for marking, and later report extenuating circumstances to support a request for cancellation
of the paper and for another test, such a request will be denied.
1. Multiple Choice Section (10 questions, 2.5 points each)
(1) List all the different domains into which living organisms can be classified.
All living organisms can be classified into which domains of life?
a) Bacteria
b) Archaea
c) Eukarya
d) Protozoa
e) A,b, and c only
f) All of the above

(2) All living organisms fall into which major groups of life?
a) prokaryotic
b) eukaryotic
c) fungi
d) a and b only
e) all of the above

(3) During DNA replication, why does the lagging strand have Okazaki fragments?
a) Because the lagging strand is replicated in the opposite direction that the replication fork is
proceeding
b) Because DNA polymerase can only proceed 5’ to 3’
c) Because RNA primers can only anneal to the lagging strand
d) A and b only
e) All of the above

(4) A student isolated a cell strain in which the joining together of Okazaki fragments is impaired.
He/she suspected that a mutation has occurred in an enzyme found at the replication fork. Which
enzyme is most likely to be mutated?
a) DNA polymerase
b) DNA helicase
c) Ligase
d) Topoisomerase

(5) A biologist is trying to perform DNA replication in a test tube (in vitro) using a single-stranded
linear DNA as the template and the appropriate DNA primer. Which proteins are required for one
round of replication?
a) DNA polymerase
b) RNA polymerase
c) Ligase
d) d)helicase

(6) Which enzyme is responsible for breaking the hydrogen bonds, and thus separating the DNA
strands during DNA replication?
a) polymerase
b) topoisomerase
c) Ligase
d) Helicase

(7) How many copies of DNA would you have after ten PCR replication cycles if you start with four
copies?
a) 1024

ENCH 535 / 619.68 (Winter 2021) – Final Examination 2

 b) 4096
c) 16000
d) 1048576

(8) In Eukaryotes, where does glycolysis take place and where does the citric acid cycle take place?
a) Both glycolysis and the citric acid cycle take place in the cytoplasm
b) Glycolysis takes place in the cytoplasm, citric acid cycle takes place in the mitochondria
c) Both glycolysis and the citric acid cycle take place in the mitochondria
d) Glycolysis takes place in the cytoplasm and the citric acid cycle takes place across the cellular
membrane.

(9) Which statement about enzymes is incorrect?

a) Enzymes works by lowering the energy of activation of the reaction
b) enzymes spontaneously bind to substrates to form an enzyme-substrate complex.
c) The free energy difference between the initial and final states of an enzyme catalyzed reaction
does not change.
d) The enzyme only modifies the intermediate steps of a reaction not the overall reaction.
e) All of the above are true

(10) Why would Escherichia coli not be preferred for the production of recombinant human
therapeutic proteins.
a) Bacterial cells do not have the machinery to remove introns from the eukaryotic DNA – resulting
in a different peptide
b) Bacterial cells are typically much easier to transform with foreign DNA
c) Bacterial cells are unable to perform the same posttranslational modifications that occur in
Human cells which could result in a non-functional protein
d) Bacterial cells typically grow much faster than eukaryotic cells, resulting in a more efficient
bioprocess.
e) A and b only
f) C and d only

2. Short answer section (5 questions, 40 points in total)

SA1. (16 points) Refer to the following diagram when answering the questions below.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 3

(a) Indicate whether each statement below is True (T) or False (F). If the statement is false, rewrite it to
make it true or explain why it is incorrect:
___ The structures labeled A and B are identical in both cell types: A and B are both composed of two
subunits (small and large) with an overall size of 80S.
___ Right after the polypeptide is synthesized it is ready to act as a functional protein.
___ The molecule labeled C usually codes for many different proteins in bacterium, but it normally codes
for a single protein, or a few functionally related proteins, in Eukaryotes.
___ If molecule H (from an eukaryotic cell) is transferred to a bacterium cell, then the polypeptide
assembled by A will be identical to the polypeptide assembled by B.

(b) Identify and briefly describe (1 sentence) the function of the molecules/organelles referred in the
figure:
– A/B:
– C:
– F:
– G/H:

(c) The molecules labeled C and D in the Eukaryotic cell contain a cap and a poly-A tail. What is the
function of these groups?

(d) List two differences between molecules G and H.

Difference 1:
Difference 2:

SA2. (8 points) The following DNA sequence contains the code for a protein:
5’ TATTGGGGATGCTATCTTTCGCCGTTCCCCACTAAGGGGCAAAAACC 3’
a. Determine the DNA sequence on the complementary strand
b. Determine the sequence of the mRNA
c. Determine the primary structure of the protein
d. List 2 major assumptions you have made about this DNA sequence / protein

SA3. (6 points) Draw two simplified flow diagrams and use them to explain the difference between
aerobic respiration and fermentation for the metabolism of glucose to provide energy to the cells.

SA4. (4 points) An enzyme has a vmax of 10 mmol/sꞏmg. The Michaelis-Menten constant km is 0.5
mM. What is the initial rate when the substrate concentration is 0.5 mM and why?

SA5. (6 points) It is very difficult to determine the equilibrium constant (K′eq) for the hydrolysis of
ATP by measuring the concentrations of reactants and products, since there is very little ATP
present at equilibrium. Instead, K′eq for this reaction can be determined by measuring K′eq for the
following two separate reactions:
Glucose-6-phosphate + H2O ⇔ glucose + Pi K′eq = 270
ATP + glucose ⇔ ADP + glucose-6-phosphate K′eq = 890
Using this information, calculate the value of K′eq and of ΔG° for ATP hydrolysis at 25 ºC (298 K):
ATP + H2O ⇔ ADP + Pi
Show your work.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 4

3. Long Answer Section (3 questions, 35 points each)
LA1. (10 Points) Aerobic growth of Saccharomyces cerevisiae on ethanol is simply described by the
following overall reaction:
C2H5OH + aO2 + bNH3 → cCH1.704N0.149O0.408 + dCO2 + eH2O
a. Determine the coefficients a, b, c, d, and e, where RQ = d/a = 0.66
b. Determine the biomass yield coefficient, YX/S, and oxygen yield coefficient YX/O (g of cells / g of
O2).

LA2. (15 Points) Pseudomonas sp. has a mass doubling time of 2.4h when grown on acetate. The
half-saturation constant (Ks) using this substrate is 1.3 g/L and the cell yield on acetate is 0.46 g cell
per g acetate. If we operate a chemostat on a feed stream containing 38 g/L acetate, find:
a) Cell concentration when D = 0.5 max
b) Substrate concentration when D = 0.5 max
c) Cell volumetric productivity when D = 0.5 max

LA3. (10 Points) A steam sterilizer is used to sterilize liquid medium for fermentation. The initial
concentration of contaminating organisms is 108 per litre. For design purposes, the final acceptable
level of contamination should be taken to be 10-3 cells; this corresponds to a risk that one batch in a
thousand will remain contaminated even after the sterilization process is completed. For how long
should 1 m3 medium be treated if the temperature is:
(a) 80°C
(b) 121°C
(c) 140°C
To be safe, assume that the contaminants present are spores of Bacillus stearothermophilus, one of
the most heat-resistant microorganisms known. For these spores the activation energy for thermal
death is 283 kJ gmo1-1 and the Arrhenius constant is 1036.2 s-1.

ENCH 535 / 619.68 (Winter 2021) – Final Examination 5

 ENCH 535 / ENCH 619.68 (Winter 2020) Page 1
Principles of Biochemical Engineering
Approved by
Dept. Head
A.S.
FINAL EXAMINATION

Instructor(s): Jinguang Hu jinguang.hu@ucalgary.ca Phone: 587.436.1109

EXAMINATION RULES AND INFORMATION

1. This examination is: X Open Book X Open Notes Closed Book Closed Notes
2. This examination is being made available to you on: April 24 , 2020 at 3:00 PM MDT.
3. Your answers/solutions must be submitted no later than: April 25 , 2020 at 3:00 PM MDT
4. This examination is designed to be completed in no more than 3 hours.
5. This examination has 11 questions worth a total of 100 marks.
6. This examination is being administered entirely through D2L.
7. You are not permitted to collaborate or consult with others when developing solutions and determining answers. The
solutions/answers you submit must be your own, and developed only by you. You must abide by University of Calgary's
Statement on Academic Integrity:
"Academic integrity is the foundation of the development and acquisition of knowledge and is based on values
of honesty, trust, responsibility, and respect. We expect members of our community to act with integrity."
"Research integrity, ethics, and principles of conduct are key to academic integrity. Members of our campus
community are required to abide by our institutional code of conduct and promote academic integrity in
upholding the University of Calgary’s reputation of excellence."
8. All final answers should be entered directly into D2L.
9. You are required to upload handwritten solutions to support the answers you entered into D2L: X Yes No
10. If you are required to provide handwritten solutions to support your answers (i.e. the answer to point 9 above is "Yes"):
(a) You can write solutions by hand as follows:
X On loose‐leaf or lined paper.
X Electronically on a digital document using your device screen (e.g. iPad, Surface etc.)
(b) Write your solutions neatly and legibly, show all your work and clearly state any assumptions you make. Ensure
each of the following: (i) your name and/or your ID number appears at the top of each page of your solutions,
(ii) each page is numbered, and (iii) you specify the question number being answered on each page.
(c) Scan solutions written on paper, and upload all pages (in order) as a single PDF file to D2L Dropbox. If you don't
have a scanner, use the Microsoft Lens app on your phone to photograph and create a PDF of your solutions.
For digital documents, save them as a pdf file, and upload the file to D2L Dropbox.
(d) The submitted file name format should be: Last Name, First Name, Student ID, ENCH535 SOLUTIONS.pdf for ENCH 535
Last Name, First Name, Student ID, ENCH619 SOLUTIONS.pdf for ENCH 619.68
(e) Keep your original handwritten solutions as part of your records should questions arise during marking.
11. By submitting answers/solutions to the final exam questions, you acknowledge that the answers/solutions you are
submitting are yours, and were determined by you alone, and that you adhered to the University of Calgary Principles
of Conduct.
12. For questions and clarifications about the exam content, you can contact your instructor(s) by:
X Email Phone Instructor(s) will not clarify or answer questions about the exam content
14. For technical issues that arise with respect to D2L, contact instructor(s) by: X Email Phone
14. The instructor(s) will be available at the following times: From April 24, at 3 pm to April 25, at 3 pm.

15. If during the exam you become ill or receive word of domestic affliction, and feel that you are unable to continue,
submit your unfinished work to your instructor with a request that it be cancelled.
16. If you submit solutions for marking, and later report extenuating circumstances to support a request for cancellation
of the paper and for another exam, such a request will be denied.
ENCH 535 / ENCH 619.68 – Principles of Biochemical Engineering – FINAL EXAMINATION
Wednesday, 3 hours within the period of April 24, 3:00 pm and April 25, 3:00 pm

1. (5 points)
(a) List all the different domains into which living organisms can be classified.
(b) Indicate the differences between eukaryotic and prokaryotic cells and between gram
positive and gram negative bacteria.

2. (10 points)
(a) During DNA replication, why does lagging strand has Okazaki fragments?
(b) A student isolated a cell strain in which the joining together of Okazaki fragments is impaired.
He/she suspected that a mutation has occurred in an enzyme found at the replication fork. Which
enzyme is most likely to be mutated and what is the major role of that enzyme in the DNA
replication?
(c) A biologist is trying to perform DNA replication in a test tube (in vitro) using a single-stranded
linear DNA as the template and the appropriate DNA primer. Which proteins are required for one
round of replication?
(d) Which enzyme is responsible for breaking the hydrogen bonds, and thus separating the DNA
strands during DNA replication?
(e) How many copies of DNA would you have after ten replication cycles if you start with four
copies?

3. (5 points) Would you consider the process of electron transfer down the electron transport
chain to be exergonic or endergonic? Explain your answer.

4. (10 points) The following DNA sequence is the template strand for a short polypeptide:
TEMPLATE STRAND
5’-ATCATAGATGCGTCATGAAGTTTGCTGAAGTGA-3’
a) Determine the DNA sequence on the complementary strand
b) Determine the sequence of the mRNA for the coding strand
c) Determine the primary structure of the protein

5. (5 points) An enzyme has a vmax of 10 mmol/s·mg. The Michaelis-Menten constant km is 0.5

mM. What is the initial rate when the substrate concentration is 0.5 mM and why?

6. (6 points) List two advantages and two disadvantages of using immobilized enzymes as
opposed to free soluble enzymes.

Page 2 of 4
7. (15 points) Orlistat is a drug designed to treat obesity. Its primary function is preventing the
absorption of fats from the human diet by inhibiting gastric and pancreatic lipases, the enzyme
that break down triglycerides in the intestine. When lipase activity is blocked, triglycerides from
the diet are not hydrolyzed into absorbable free fatty acids and are excreted undigested
instead.
The rate of fat hydrolysis was measured in-vitro in the absence and presence of Orlistat, with
an Orlistat concentration of 2x10-9 M:
Substrate
Hydrolysis rate (μM/min) Hydrolysis rate (μM/min)
concentration
No Orlistat with Orlistat
(μM)
10 0.51 0.33
15 0.61 0.37
35 0.80 0.43
120 0.95 0.47

Q1 (5 points). Determine the Michaelis-Menten constants (Km and Vm) for the lipase enzyme
without Orlistat.

Q2 (5 points). Determine the Michaelis-Menten constants (Km and Vm) for the lipase enzyme in
the presence of Orlistat.

Q3 (5 points). What type of inhibitor is Orlistat? Briefly explain your answer.

8. (10 Points) Aerobic growth of Saccharomyces cerevisiae on ethanol is simply described by

the following overall reaction:
C2H5OH + aO2 + bNH3 → cCH1.704N0.149O0.408 + dCO2 + eH2O

Q1 (5 points). Determine the coefficients a, b, c, d, and e, where RQ = d/a = 0.66

Q2 (5 points). Determine the biomass yield coefficient, YX/S, and oxygen yield coefficient YX/O
(g of cells / g of O2).

9. (12 Points) The following information may be useful for the next 2 questions
- Diffusivity of Oxygen in media at 310K = 2.86x10-9 m2/s
- Henrys constant for oxygen in media at 310K = 1.3x10-3 mol/L atm
- Viscosity of media at 310K = 7.82x10-7 m2/s
- Density of media at 310K = 997 kg/m3
Q1 (6 points). You have a cell culture in a 100ml stirred suspension bioreactor. After 6 days the
glucose concentration in the culture medium has dropped to 0.2 g/L from an initial value of
2.0g/L. the initial cell density in the bioreactor was 20,000 cells/mL. if Ygluc/x=3x10-7 g/L cell,
what is the exponential growth rate of the cells? (assume no lag phase)

Page 3 of 4
Q2 (6 points). Cells are grown in a 25 cm2 static culture dish. If cells are grown to 150,000
cells/cm2, at what volume of media will the oxygen concentration be limiting if the oxygen
consumption (rO2) is 5.5x10—17 mol.O2/s.cell. Assume atmospheric pressure of 0.873 atm.

10. (12 Points) Consider a continuous, aerobic culture of E.coli fed with a sterile solution
containing glucose. There different dilution rates D are tested, and the biomass concentration x
and glucose concentration S in the exit stream are measured. The results are as follows:
Dilution rate Biomass concentration Glucose concentration
D (h-1) X (g/L) S (g/L)
0.05 2.48 0.067
0.5 2.08 1.667
5 0 10

Q1 (5 points). Calculate the biomass/sugar yield coefficient Yx/s (g of biomass / g of glucose)

Q2 (7 points). Assuming Monod kinetics, calculate the maximum specific growth rate μman (h-1)
and the half saturation constant Ks (g/L)

11. (10 points) Stevia is a sweetener extracted from the leaves of a

green plant native to subtropical and tropical regions (Stevia
rebaudiana). The active compound in stevia, shown in the figure to the
right, has about 150 times the sweetness of glucose and has a negligible
effect on blood glucose. Stevia-based sweeteners are used today in
dairy products, health drinks and carbonated beverages. Both Coca Cola
and PepsiCo have introduced drinks containing stevia-based sweeteners
under the commercial names of Truvia and PureVia, respectively. Stevia
sweeteners are presently extracted from the leaves of stevia plants. However, recent advances
have enabled the production of stevia sweeteners via fermentation.

Propose a separation scheme to extract and purify stevia from the fermentation broth. Assume
that stevia production is accomplished via fermentation in yeast that secretes stevia molecules,
reaching a product titer in the fermentation broth of 75 g/liter. The expected production
capacity is 5,000,000 kg of stevia sweetener per year. Present your proposed process in the
form of a flowchart or block flow diagram. List all factors that guide your selection of unit
operations.

Known:
― Stevia is secreted into the medium (i.e. no need to break the cells)
― Stevia is a relatively small molecule
― Stevia concentration in the medium is 75 g/L
― Production capacity is very large (i.e. continuous processes will be required)

Page 4 of 4