Electrophoresis

ELECTROPHORESIS
Woro Anindito Sri Tunjung

Lab of Biochemistry
Faculty of Biology
Universitas Gadjah Mada
Electrophoresis Techniques :
is a method of separating charged
biomolecules through a gel in the
presence of electric field
THE BIOMOLECULE MUST HAVE CHARGE

In this list of biomolecule,
which one have a charge?
Carbohydrate
Lipid
Nucleic acid (DNA, RNA)
Protein
In this list of biomolecule, which one have a
charge?
 Carbohydrate = C,H,O
No charged
 Lipid = C,H,O
No Charged
 Nucleic acid (DNA, RNA) = C,H,O,N,P
Negative charge, because of phosphate group

 Protein = C,H,O,N
Negative or positive charge, depend on R side

With this technique the charged particles
will move towards the electrodes that have the opposite charge
The anode (‘+’ electrode) attracts the anion
The cathode (‘-’ electrode) attracts the cation
Separation requires a buffer motion phase.
Commonly used buffers are:
TBE = Tris borate EDTA

TAE = Tris acetate EDTA
Not only does it provide the right pH condition

but it also provides ions to aid conductivity
In this condition, several things need attention:
A molecular splitting process is better stopped when it has
not reached its equilibrium point.
When the electric field is turned off (power supply turns off),
the separated molecules will spread out again so that the
separation is unstable.
for that separation is not carried out in solution but using a

matrix
matrix will keep the sample from spreading anymore and

give a "frictional effect" which affects the sample migration
rate
The stationary phase / matrix that is commonly used is a gel.
A type of gel commonly used in electrophoresis

Polyacrylamide  protein
Agarose  DNA
1. Agarosa
• obtained from the extraction of seaweed

is fragile and easily crushed
• have large pores (bigger than polyacrylamide)
• used to separate molecules that are as large
as 200-50000 bp
• preparation is easier than with
polyacrylamide, but lower resolution  less
sharp separation results
• the concentration used ranges from 0.5 - 2%
2 polyacrylamide (Raymond and Weintraub,
1959)
pore sizes can be varied to provide a filtering effect
commonly used to separate proteins
commonly used concentration: 3.5 -20%

can separate molecules by 5 - 200 kd
more flexible and provides a sharper separation result
it is more difficult to prepare because O2 blocks its

polymerization.
DNA Gel Electrophoresis
 Separates DNA
fragments based on
length. To begin:
 DNA is mixed with a loading
buffer (glycerol & tracking
dye).
 Glycerol (or other dense
substance): allows the DNA to
sink into the well and not
dissipate into the water.
 Tracking dye (Coomassie blue
or other dyes): A visible
marker so the DNA doesn’t
run out the end of the gel.
 DNA/loading buffer is
placed in a gel made of
agarose.
 TAE/TBE buffer is placed

around the gel
 Salt solution that carries
current, buffers pH and
inhibits enzymes that might
degrade DNA
 An electric field is applied,

causing molecules to move
through the gel (short
fragments move faster).
placed in a gel made of What would happen if you
agarose. switched these wires?

around the gel
degrade DNA

placed in a gel made of What would happen if you
agarose. switched these wires?
Sample would be lost!

around the gel
degrade DNA

Visualizing DNA
 DNA is optically clear (absorbs light in UV
range)
 A fluorescent dye is usually used to see it
(ethidium bromide, sybr safe, etc.)
 Dyes “intercalate” into DNA
What is the approximate size of the
DNA molecule marked by the arrow?
L 1 2 3
A. 62 base pairs 100
90
B. 68 base pairs 80
C. 73 base pairs
70
D. 81 base pairs 60
50
40
15
What is the approximate size of the
DNA molecule marked by the arrow?
L 1 2 3
A. 62 base pairs 100
90
B. 68 base pairs 80
C. 73 base pairs
70
D. 81 base pairs 60
50
40
16
SDS-PAGE (Sodium Dodecyl Sulfate-
Polyacrilamide Gel Electrophoresis)
for the determination of protein molecular weight protein must
have the same charge
used SDS = sodium dodecyl sulfate / laurel sulfate
SDS is bound to proteins with hydrophobic bonds according to

the size (size) of the protein molecule
SDS will give a negative charge in all pH conditions except

very acidic conditions
Therefore the ratio between molecular weight and charge

becomes constant the protein migrates according to its mass
towards the anode
The mass of the protein can be distinguished

protein is always separated in denatured
conditions.
sample preparation: protein is heated so that

the secondary and tertiary structures have
been lost  SDS will be bound along the
existing polypeptides
 Separates PROTEINS based on size. To begin:
 Proteins are denatured in 3 ways: by mixing with
SDS (a detergent), boiling, and with the addition of
beta-mercaptoethanol (to reduce disulfide bonds).
 SDS is negatively charged, so that when proteins form
complexes with SDS they will migrate through a gel
when an electric field is applied.
 Proteins are mixed with a loading buffer (glycerol

& tracking dye) as described in an earlier slide.
Tracking Dye VS Visualization Staining
 When we separate the sample with gel
electrophoresis we don't know when to stop so
we need a marker to know when to stop the
electrophoresis.
 Dyes are small molecules, can absorb visible
light, have the same charge as the sample being
separated. faster migration of samples 
bromphenol blue
 Visualization of electrophoretic separation results
 For DNA and RNA ethidium bromide,syber green
For protein Coomassie Brilliant Blue, silver
staining
Visualizing DNA
Visualizing proteins
 Dyes (example: Coomassie
blue):
 Gels infused with solution of
coomassie blue.
 Solution is rinsed away.
 Proteins remain stained with
dye.
 Antibody staining (also

known as western blot or
immunostaining) can be
used to detect a specific
protein.
SDS-PAGE “Hall of Shame”
http://www.ruf.rice.edu/~bioslabs/studies/sds-page/sdsgoofs.html
Good website for troubleshooting SDS-PAGE gels
Short case study (Adapted from: Justin F. Shaffer, UC Irvine)
National Center for Case Study Teaching in Science
University at Buffalo, State University of New York
 Earl Washington
 Accused of murder 1983,
convicted and sentenced to
death in 1984
 9 days before scheduled
execution, it is delayed.
 In 2000, lawyers convince
courts to perform DNA
tests (STR analysis)
Short Tandem Repeats
 STR  Short Tandem Repeat
 Stretches of DNA that are repetitive
AGATAGATAGATAGATAGATAGATAGATAGATAGATA
GAT
Here, 10 total repeats
 STR lengths are usually highly variable between
people from different families.
 One person might have 10 AGATs in a row, another
might have 17 AGATs in a row.
 These repeats occur at the same place in the
genome.
29
STR Analysis
 What are the two main properties of STRs?
 STRs vary in length between people
 They occur at the same places in everyone’s
genome (and they occur at multiple sites)
 How could this information be used to compare

people’s DNA? What methods could you use?
 Isolate DNA
 Use PCR to amplify STRs
 Compare sizes of STRs using gel electrophoresis
30
Which suspect is innocent? (Did
NOT commit the crime?)
A. B.
31
 Feb 12, 2001, Earl
released and given
full pardon by
Virginia governor
James Gilmore.
Summary
 Electrophoresis for both DNA and Proteins

 Separation based on size/mass
 Movement of charged biomolecules through a
gel in the presence of electric field

Electrophoresis

Uploaded by

Copyright:

Available Formats

Electrophoresis

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Electrophoresis

Uploaded by

Copyright:

Available Formats

ELECTROPHORESIS

Woro Anindito Sri Tunjung

THE BIOMOLECULE MUST HAVE CHARGE

Negative charge, because of phosphate group

Negative or positive charge, depend on R side

Commonly used buffers are:

TBE = Tris borate EDTA

Not only does it provide the right pH condition

for that separation is not carried out in solution but using a

matrix will keep the sample from spreading anymore and

A type of gel commonly used in electrophoresis

• obtained from the extraction of seaweed

commonly used to separate proteins

commonly used concentration: 3.5 -20%

more flexible and provides a sharper separation result

it is more difficult to prepare because O2 blocks its

 TAE/TBE buffer is placed

 An electric field is applied,

 TAE/TBE buffer is placed

 An electric field is applied,

Sample would be lost!

 An electric field is applied,

SDS is bound to proteins with hydrophobic bonds according to

SDS will give a negative charge in all pH conditions except

Therefore the ratio between molecular weight and charge

The mass of the protein can be distinguished

sample preparation: protein is heated so that

 Proteins are mixed with a loading buffer (glycerol

 Antibody staining (also

 How could this information be used to compare

 Electrophoresis for both DNA and Proteins

You might also like