Australasian Plant Pathology (2021) 50:309–317

https://doi.org/10.1007/s13313-021-00774-4

ORIGINAL PAPER

Development of a new real-time TaqMan PCR assay for the detection

of the Prunus pathogen Monilinia kusanoi
K. Dharmaraj 1 & B. J. R. Alexander 1 & M. Toome-Heller 1

Received: 8 September 2020 / Accepted: 5 January 2021 / Published online: 15 January 2021
# Australasian Plant Pathology Society Inc. 2021

Abstract
Monilinia kusanoi causes shoot blight, leaf blight and fruit rot of several Prunus species, and is currently known to be present
only in Japan and Korea. Despite the restricted distribution range, the risk remains that the pathogen could spread with the
transportation of plant material, especially since no DNA based diagnostic methods are available to detect this fungus. In this
study, a new TaqMan probe-based real-time assay was developed for specific and rapid detection of M. kusanoi. The assay targets
the single copy elongation factor gene and enables the detection down to 1 pg of pathogen DNA in a plant sample, which
corresponds to approximately 25 hyphal cells. When testing a panel of fungal cultures, all M. kusanoi isolates were detected and
there was no cross-reaction with other Monilinia species or related fungi. The assay was duplexed with a plant internal control
assay to allow simultaneous detection of the pathogen and cytochrome oxidase gene from host plants. This newly developed real-
time PCR assay will facilitate rapid and sensitive pathogen screening of imported plant material, as M. kusanoi is a pathogen of
biosecurity concern in New Zealand and Australia and would also be useful for research and screening purposes in areas where
the pathogen is already established.

Keywords Biosecurity . Elongation factor . Plant disease . Probe-based assay . Young fruit rot

Introduction young shoots, and rot of immature fruit. Unlike many

Monilinia species that have established in a range of geo-
The genus Monilinia contains plant pathogenic fungi that graphic regions (Di Francesco and Mari 2018; Landi et al.
cause significant econo mic damag e to plan ts i n 2019), M. kusanoi is currently known to be present only in
Empetraceae, Ericaceae and Rosaceae families (Holst- Japan and Korea (Willetts and Harada 1984; Farr and
Jensen et al. 1997; Di Francesco and Mari 2018). Among Rossman 2020).
the Monilinia species, M. fructicola, M. fructigena and Early detection and precise identification of plant patho-
M. laxa are the main causal agents of a disease called brown gens are important for better management of the disease as
rot in stone fruits around the globe. However, there are also well as for ensuring that new and unwanted pathogens are not
other significant Monilinia species that cause brown rot and introduced to new areas via infected plant material (Acero
are of concern to stone and pome fruit growers (Byrde and et al. 2011; Garrido et al. 2012). The detection and identifica-
Willetts 1977; Marin-Felix et al. 2017; Cox et al. 2018). One tion of Monilinia species in the past have relied on isolation
such species is Monilinia kusanoi, a pathogen that has been and morphology-based methods (Byrde and Willetts 1977).
reported to infect many Prunus species, particularly cherries This is a time-consuming approach and due to little variation
(Prunus avium, P. cerasus and P. grayana) and Japanese apri- in morphological characters, the results might not be reliable
cot (Prunus mume) (Willetts and Harada 1984; Farr and or conclusive without further DNA-based identification steps.
Rossman 2020). This fungus causes blight on leaves and Therefore, specific PCR-based detection methods are highly
desirable for Monilinia species and real-time PCR would be a
preferred method to enable fast, specific and sensitive detec-
* M. Toome-Heller tion (Mirmajlessi et al. 2015).
Merje.Toome@mpi.govt.nz Several real-time PCR diagnostic assays have been devel-
1
oped for the detection and identification of the widespread
Plant Health and Environment Laboratory, Ministry for Primary
Industries, PO Box 2095, Auckland 1140, New Zealand
Monilinia species like M. fructicola, M. laxa, M. fructigena,
310 K. Dharmaraj et al.

M. polystroma, M. mumecola and M. yunnanensis. These are Beads tube (Roche Life Sciences). The tubes containing my-
based on either microsatellite markers (Luo et al. 2007), the celium plugs were homogenised at 7000 rpm for 1 min in a
ITS region (van Brouwershaven et al. 2010; Garcia-Benitez Bead-Beater (Biospec products). Then, CTAB
et al. 2017), the beta-tubulin gene (Fan et al. 2014), the (Cetyltrimethylammonium bromide) lysis buffer (600 μl)
MO368 marker (Guinet et al. 2016), or the laccase-2 and (2.0% CTAB, 1.0% polyvinylpyrrolidone, 1.4 M NaCl,
elongation factor gene regions (Wang et al. 2018). No assays 20 mM EDTA and 100 mM Tris-HCl pH 8.0) was added into
are currently available for M. kusanoi. Furthermore, there is the tubes which were incubated in a Thermomixer
very limited genetic information available for M. kusanoi with (Eppendorf) for 30 min at 65 °C with regular shaking for
only the ITS region from ten isolates being sequenced to date. 20 s with a 2 min interval (2000 rpm). The tubes were then
These sequences are only available from the NARO centrifuged at 14000 g for 2 min and the supernatant (420 μl)
Genebank (www.gene.affrc.go.jp/databases-micro_search_ was collected for DNA extraction with InviMag® Plant DNA
en.php) and none have been submitted to NCBI Genbank, Mini Kit (Stratec Molecular) in an automated KingFisher set-
which further limits the accessibility to the data by up (Thermo Fisher Scientific), following manufacturer’s in-
diagnosticians and researchers. struction. Extracted DNA was eluted in 100 μl elution buffer
Monilinia kusanoi is a regulated organism in New Zealand and the concentration was determined with a NanoDrop™
(MPI 2020) and determined to be of quarantine importance in 8000 Spectrophotometer (Thermo Fisher Scientific). To ex-
Australia (Constable 2016). The introduction of the pathogen tract DNA from plants, approximately 0.5 g of plant tissue
into these, as well as other countries, could have a significant was placed in an extraction bag (Bioreba) with 5 ml CTAB
impact on their stone-fruit industries. Therefore, it is important lysis buffer. The tissue was homogenized using an automatic
to have specific and reliable diagnostic methods available to Homex grinder (Lenze) and approximately 1.5 ml of the ho-
screen imported Prunus germplasm or suspected infected mogenized sample was used for DNA extraction as described
plants for this fungus. In this study, we present the develop- above.
ment of a probe-based real-time PCR assay for the detection of
M. kusanoi. Monilinia kusanoi specific primers and probe
development and optimisation

Materials and methods To design the primers and probe for M. kusanoi, the ITS, beta-
tubulin (TUB2) and elongation factor (EF1) gene regions
Fungal isolates were analysed. For the ITS region analysis, a total of 63 se-
quences of Monilinia species were used. Of these, 58
Five M. kusanoi isolates, 52 isolates of 11 other Monilinia Monilinia spp. and five M. kusanoi ITS sequences were ob-
species and 19 non-Monilinia isolates were used for assay tained from the NCBI GenBank (www.ncbi.nlm.nih.gov) and
development (Table 1). These fungal isolates originated from the NARO Genebank (www.gene.affrc.go.jp/databases-
different hosts and geographical regions and their identity was micro_search_en.php), respectively. The remaining five M.
confirmed by amplifying and sequencing the ITS region using kusanoi ITS sequences were generated in this study (see
primers ITS5 and ITS4 (White et al. 1990). Due to the un- Table S1). Similarly, 191 TUB2 gene sequences and 45 EF1
availability of M. kusanoi beta-tubulin (TUB2) and elongation sequences of Monilinia species were obtained from the NCBI
factor (EF1) sequences in the public domain, the amplification GenBank and combined with the sequences for the five M.
and sequencing of the TUB2 and EF1 genes were performed kusanoi isolates and one M. ssiori isolate that were sequenced
using primers Bt2a and Bt2b (Glass and Donaldson 1995) and in this study (see Table S2 for the used sequences). The align-
EF1-728F (Carbone and Kohn 1999) and EF2 (O'Donnell ment for each region was prepared using MUSCLE in
et al. 1998), respectively. Obtained sequences were curated Geneious and analysed for regions that would be specific to
and analysed in Geneious software (Geneious 10.2.5; M. kusanoi. The specific primers and probe were synthesized
Biomatters Ltd) and submitted to NCBI GenBank under ac- only for the EF1 region. These were Mks EF1–F, Mks EF1–R
cession numbers MT904280–904219 and MT895947– and Mks EF1–Probe (Table 2). The primers were synthesised
985952. by Thermo Fisher Scientific and the probe was synthesised by
Applied Biosystems.
DNA extraction A gradient end-point PCR was carried out on an Applied
Biosystems® Veriti® 96-Well Thermal Cycler to test the
Selected fungal isolates were cultured on Potato Dextrose newly designed specific primers (Mks EF1–F and Mks
Agar (PDA) at room temperature. From each culture plate, EF1–R). For this, 20 μl PCR reaction volume was prepared
two to three plugs of agar with mycelium (2 mm diameter) by adding 1 μl (250 nm) of each forward and reverse primers,
were collected and transferred to a 2 ml MagNA Lyser Green 10 μl 2x GoTaq Green master mix (Promega), 1 μl Bovine
Development of a new real-time TaqMan PCR assay for the detection of the Prunus pathogen... 311

Table 1 The list of fungal isolates that were used to validate the Monilinia kusanoi specific assay, along with their host and geographic origin information

Species Isolate number1 Host Country of origin

Monilinia fructicola CBS 101508 Prunus persica Japan

CBS 101512 Prunus domestica USA
ICMP 15067 Prunus persica New Zealand
ICMP 15068 Prunus persica New Zealand
ICMP 15069 Prunus persica New Zealand
ICMP 15070 Prunus persica var. nucipersica New Zealand
ICMP 2709 Prunus armeniaca New Zealand
ICMP 2710 Prunus armeniaca New Zealand
ICMP 7639 Prunus armeniaca New Zealand
ICMP 7640 Prunus persica New Zealand
ICMP 7641 Prunus persica New Zealand
ICMP 7642 Prunus persica New Zealand
ICMP 9455 Prunus persica New Zealand
ICMP 9456 Prunus persica New Zealand
ICMP 9811 Prunus persica New Zealand
ICMP 9812 Prunus persica New Zealand
NBRC 9068 Unknown Japan
NBRC 30451 Prunus salicina Japan
Monilinia fructigena CBS 101504 Malus pumila Japan
CBS 231.57 Prunus domestica Netherlands
CBS 492.50 Unknown Unknown
Monilinia kusanoi MAFF 240797 Prunus pendula Japan
MAFF 410230 Prunus cerasoides Japan
MAFF 410839 Prunus Japan
MAFF 410852 Prunus Japan
MAFF 410855 Prunus Japan
Monilinia laxa CBS 133.21 Unknown United Kingdom
CBS 298.31 Malus sylvestris Ireland
CBS 101503 Prunus persica Italy
CBS 101506 Prunus cerasus Netherlands
CBS 122536 Prunus mume Japan
ICMP 2683 Prunus New Zealand
ICMP 2684 Prunus glandulosa New Zealand
ICMP 2686 Prunus persica New Zealand
ICMP 2688 Prunus persica var. nucipersica New Zealand
ICMP 2690 Prunus persica New Zealand
ICMP 2692 Prunus glandulosa New Zealand
ICMP 2711 Unknown New Zealand
Monilinia linhartiana CBS 150.22 Mespilus germanica Germany
Monilinia mali NBRC 8159 Unknown Japan
NBRC 30253 Malus pumila var. domestica Japan
Monilinia mume MAFF 240257 Prunus mume Japan
Monilinia mumecola ICMP 20665 Prunus mume Japan
ICMP 20667 Prunus mume Japan
ICMP 20668 Prunus mume Japan
ICMP 20669 Prunus mume Japan
H1370 Prunus mume Japan
H1890 Prunus mume Japan
H3231 Prunus mume Japan
312 K. Dharmaraj et al.

Table 1 (continued)

Species Isolate number1 Host Country of origin

H5140 Prunus mume Japan

Monilinia polystroma CBS 102688 Malus pumila Japan
CBS 122306 Malus pumila Japan
Monilinia seaveri CBS 170.24 Unknown Unknown
Monilinia ssiori NBRC 9725 Prunus ssiori Japan
Monilinia yunnanensis CFCC 82694 Unknown China
CFCC 82717 Unknown China
AF 2011002 Unknown China
Alternaria alternata T15_02124 C Prunus domestica Sample in post entry quarantine
Botryosphaeria dothidea T19_03078A Prunus sp. New Zealand
Botrytis cinerea T16_02935 A Rosa sp. Sample in post entry quarantine
Botrytis sp. T18_03053 A Pyrus pyrifolia China
Ceratocystis destructans CBS 114717 Prunus dulcis USA
Chaetomium globosum T19_05924 B Prunus avium Unknown
Chalaropsis thielavioides ICMP 2116 Rosa sp. Australia
Chondrostereum purpureum ICMP 2881 Prunus persica New Zealand
Cladosporium sphaerospoermum T14_02533 D Prunus avium Sample in post entry quarantine
Cryptosporiopsis keinholzii T14_00854A Malus sp. New Zealand
Cylindrocladiella parva ICMP 19020 Prunus armeniaca New Zealand
Ganoderma australe T19_00255 Pyrus communis New Zealand
Hypholoma acutum T15_02124 A Prunus domestica Sample in post entry quarantine
Penicillium sp. T18_03123A Pyrus sp. China
Phomopsis sp. T17_02160B Malus sp. Sample in post entry quarantine
Sclerotinia sclerotiorum T18_02900_1 Raphanus sativus Netherlands
T18_03882A Helianthus annus France
Stigmina carpophila ICMP 11202 Prunus persica New Zealand
Trichothecium roseum T18_03022 D Pyrus pyrifolia China
1
Culture sources; CBS–Westerdijk Fungal Biodiversity Institute, Netherlands; ICMP–International Collection of Microorganisms from Plants, New
Zealand; NBRC–the NITE Biological Resource Centre, Japan; MAFF–the NARO gene bank, Ministry of Agriculture, Forestry and Fisheries, Japan; H–
the Hirosaki University, Japan; CFCC–the China Forestry Culture Collection Centre, China; AF–the China Centre for Type Culture Collection, China;
T–MPI Plant Health and Environment Laboratory, New Zealand

Serum albumin (10 mg/ml), 2 μl DNA template and 5 μl elongation at 72 °C for 5 min. The PCR products were exam-
sterile water. The PCR conditions were as follows: initial de- ined in gel electrophoresis and sequenced to confirm the prim-
naturation at 95 °C for 5 min followed by 35 cycles of dena- er binding specificity.
turation at 95 °C for 30 s, annealing at 56 °C, 57 °C, 58 °C, A gradient real-time PCR to optimise M. kusanoi specific
59 °C and 60 °C for 30 s, elongation at 72 °C for 30 s and final real-time PCR, including the probe (Mks EF1–Probe), was

Table 2 Monilinia kusanoi

specific and plant internal control Primer name Sequence (5′–3′) Reference
(COX) primers and probes used
in this study Mks EF1–F ATCTGTGCAAGATGTTAGAAGATG This study
Mks EF1–R CATGGGTTTTGGACAAGCTCAAG This study
Mks EF1–Probe FAM–AATGTGCGAAGGAGACAAA–MGBNFQ This study
COX–F CGTCGCATTCCAGATTATCCA Weller et al. 2000
COX–R CAACTACGGATATATAAGAGCCAAAACTG Weller et al. 2000
COX–P CAL Fluo Red-610–TGCTTACGCTGGATGGAATGCCCT–BHQ2 Weller et al. 2000
Development of a new real-time TaqMan PCR assay for the detection of the Prunus pathogen... 313

performed on a CFX96™ Real-Time System Thermocycler used for duplex assay. The thermocycling conditions used
(Bio-Rad). A PCR reaction volume of 20 μl comprising 10 μl were: initial denaturation at 95 °C for 3 min and 40 cycles
of master mix (2x PerfeCTa qPCR ToughMix (Quanta of denaturation at 95 °C for 10 s and annealing and elongation
Bioscience)), 0.8 or 1 μl (200 or 250 nM) of each forward at 60 °C for 40 s.
and reverse primers, 0.4, 0.6 or 0.8 μl (100 to 200 nM) probe,
2 μl DNA and sterile water (volume up to 20 μl) was pre- Assay repeatability and reproducibility
pared. The gradient real-time PCR was carried out using the
following thermocycler conditions: initial denaturation at The repeatability and reproducibility of the M. kusanoi specif-
95 °C for 3 min, followed by 40 cycles of denaturation at ic real-time PCR assay was determined by the coefficient of
95 °C for 10 s, and annealing and elongation at 57 °C, variation (CV) using mean cycle threshold values and stan-
58 °C, 59 °C, 60.2 °C, 61.2 °C or 62 °C respectively for 40 s. dard deviation of intra and inter assays respectively. The intra-
assay repeatability CV was calculated from eight technical
Assay specificity and sensitivity replications in the same run from three dilutions (1, 0.1 and
0.01 ng/μl) of M. kusanoi DNA in water. The reproducibility
To assess the specificity of the newly developed M. kusanoi (inter-assay CV) was calculated from the results of three in-
assay, the isolates listed in Table 1 were tested using the fol- dependent assays (with eight replications) performed on dif-
lowing PCR conditions: initial denaturation at 95 °C for 3 min ferent days, real-time PCR machines and by different blind
and 40 cycles of denaturation at 95 °C for 10 s, annealing and panel testing using the samples from the same dilution series
elongation at 60 °C for 40 s. To determine the assay sensitiv- as described above.
ity, DNA from isolate MAFF 410230 (10 ng/μl) was serially
diluted (10−1–10−5) in sterile water or in DNA extracted from
a healthy peach stem and used to perform the sensitivity test- Results
ing using the above PCR conditions. The sensitivity assay was
repeated three times with dilution series in water and peach Analysis of the ITS region sequences for designing
DNA. In each assay, two replicates of the same DNA samples M. kusanoi specific primers and probe detected a very limited
were used. To estimate the sensitivity of the assay, standard number of nucleotide differences from other species and
curves were generated by plotting cycle threshold (Cq) values showed that M. linhartiana, M. mali, M. ssiori and
of the assay and serially diluted MAFF 410230 DNA (10 ng/ M. yunnanensis sequences were very similar. Also, some nu-
μl) in sterile water (100–10−4) on Y and X axes, respectively. cleotide polymorphisms were found when analysing the se-
The efficiency of amplification was calculated using lected ITS sequence regions of some M. kusanoi isolates. The
E = (101/−m − 1) × 100 (Ginzinger 2002). analysis of the TUB2 gene did find regions specific to
M. kusanoi, but these also showed minor sequence variation
Duplex assay development when compared to M. linhartiana and M. ssiori. Thus, the ITS
and TUB2 regions were excluded as unsuitable for M. kusanoi
A duplex real-time PCR assay consisting of the primers and specific primer and probe design.
probes from the M. kusanoi real-time PCR assay and the cy- Species-specific regions were however found in the EF1
tochrome oxidase gene (COX) based assay by Weller et al. region and in-silico analysis showed the Mks EF1–F primer
(2000) was performed to co-amplify M. kusanoi and plant and Mks EF1–Probe to be specific to M. kusanoi and Mks
DNA. The DNA from isolate MAFF 410230 was serially EF1–R primer to be specific to M. kusanoi and M. ssiori.
diluted in healthy peach stem DNA for the duplex assay de- These primers and probe did not have any secondary struc-
velopment. Initially, a gradient real-time PCR to optimise tures or hairpins. The amplification of the PCR product of
COX assay was performed, using the PCR reaction containing expected size (159 bp) was obtained in an end point PCR at
0.8 or 1 μl (200 or 250 nM) of each COX-F and COX-R all annealing temperatures (56 to 60 °C) and sequencing of the
primers, 10 μl 2x PerfeCTa qPCR ToughMix (Quanta product from one of the annealing temperatures (60 °C) con-
Bioscience), 0.4 or 0.6 μl (100 or 150 nM) of COX-P (labelled firmed the amplification of the region of interest.
with CAL Flour Red-610 dye), 2 μl DNA, and sterile water to A gradient real-time PCR for the optimisation of the
20 μl. Then, real-time PCR reaction containing 10 μl 2x primers and probe showed that the target was amplified at
PerfeCTa qPCR ToughMix (Quanta Bioscience), 1 μl all annealing and elongation temperatures (57–62 °C) with
(250 nM) of each forward and reverse primer from little difference in Cq values between the temperatures and
M. kusanoi assays, 0.8 μl (200 nM) of Mks EF1–Probe (la- the annealing and elongation temperature of 60 °C was chosen
belled with FAM fluorophore), 1 μl (250 nM) of each COX-F for subsequent assay development. The optimum probe con-
and COX-R, 0.6 μl (150 nM) COX-P (labelled with CAL centration testing showed no significant difference in Cq
Flour Red-610 dye), 2 μl DNA, and sterile water to 20 μl were values between the tested concentrations (100 nM, 150 nM
314 K. Dharmaraj et al.

and 200 nM), but a slight Cq value reduction by about 1 cycle

was observed when using the 200 nM concentration.
Similarly, the primer concentration of 250 nM showed slightly
better performance than 200 nM. These concentrations were
therefore selected for further assay development.
Assay specificity was tested using five M. kusanoi isolates
from Japan, 52 other Monilinia species and 19 non-Monilinia
species isolates. The assay only detected the M. kusanoi isolates
and none of the other tested Monilinia species or related spe-
cies. Analytical sensitivity testing showed that the assay detec-
tion limit was 1 pg of pathogen DNA, regardless if it was
diluted in sterile water or in DNA from the healthy peach
stem (Table 3). Fig. 1 The amplification curve of the duplex real-time PCR assay detect-
The assay was duplexed with plant internal control (COX) for ing M. kusanoi isolate MAFF 410230 DNA serially diluted in healthy
concurrent detection of pathogen and plant DNA, and no reduc- peach stem DNA (blue) and plant internal control (pink) in a single
tion in each other’s amplification was detected after combining reaction. The relatively flat curve for plant internal control is characteristic
for Prunus DNA and was shown not to be a result of M. kusanoi assay
the two assays (Fig. 1). The detection limit for M. kusanoi assay inhibiting the amplification of the plant genes n
was 1 pg, consistent with the single-plex testing results.
The repeatability and reproducibility testing of serially di- ITS and TUB2 regions has been previously reported in other
luted M. kusanoi DNA in water (10−1 –10−3) demonstrated species like M. fructicola, M. fructigena and M. laxa (Guinet
that the assay produced similar Cq values when repeated on et al. 2016). Although the ITS region has been previously used
different PCR machines or carried out in blind panel setting. to develop a real-time PCR assay for the detection of other
Coefficient of variation that was calculated for the intra and Monilinia species (van Brouwershaven et al. 2010), subsequent
inter-assays test results showed little or no difference between validation of that assay detected non-specific amplification
the obtained results (Table 4). (Garcia-Benitez et al. 2017).
The EF1 region has been previously used for designing
species-specific real-time PCR assays for Monilinia mumecola
Discussion and M. yunnanensis (Wang et al. 2018) and the region was also
proven here to be specific to M. kusanoi. No cross-reaction with
In this study we analysed the suitability of three different DNA other Monilinia species or other non-target fungi was detected
regions (ITS, TUB2 and EF1) for developing a probe-based with the designed primers and probe either during in-silico or in-
species-specific real-time PCR assay for rapid and sensitive de- vivo testing in this study. The decision to select EF1 for species-
tection of M. kusanoi from plant material. Very limited sequence specific assay development is further supported by previous phy-
variation was found in the ITS region of M. kusanoi. Analysis of logenetic studies that have recommended to use ITS for genus
TUB2 and EF1 regions, which have been previously used for level identification of Monilinia, and EF1 for differentiating be-
developing specific real-time PCR assays for M. fructicola, M. tween species (Marin-Felix et al. 2017). To ensure the specificity
mumecola and M. yunnanensis (Fan et al. 2014; Wang et al. of the newly developed M. kusanoi assay, the used probe was
2018), revealed that the TUB2 region of M. kusanoi also had synthesised with 3’ MGB (minor groove binder) non-
very limited sequence variation, but the EF1 region was suitable
for primer and probe design. Poor inter-species variation in the
Table 4 Coefficient of variation for intra and inter-assay results is based
on the mean cycle threshold values and was calculated using eight repli-
cates for each DNA sample. Monilinia kusanoi isolate MAFF 410230
Table 3 Standard curve analysis for M. kusanoi specific real-time PCR DNA was diluted in water
assay, using serially diluted DNA in healthy peach stem DNA
M. kusanoi DNA (ng/μl) CV%
Parameters Standard curve results
Intra-assay Inter-assay
Slope of linear regression 3.54
Y-intercept 39.70 1 0.3 0.4
Coefficient of determination (R2) 0.999 0.1 0.2 0.4
Efficiency of amplification (E) 92% 0.01 1.0 2.4
Development of a new real-time TaqMan PCR assay for the detection of the Prunus pathogen... 315

fluorescence quencher (NFQ). Including NFQ in TaqMan regions (e.g. TUB2 and EF1) made it difficult to confirm any
probes helps to reduce background signal and improve the spec- finds of M. kusanoi following the current recommendations
ificity by stabilizing the hybridization of the probe to the target for molecular identification of Monilinia (as per Marin-Felix
(Kutyavin et al. 2000). et al. 2017). Currently, there are only ten M. kusanoi isolates
High assay sensitivity is required to detect pathogens in publicly available in culture collections. Five of these,
plant samples that might be asymptomatic or only display representing all the different hosts and geographical origins,
minor symptoms. The detection limit of the newly developed were chosen for our assay validation and the ITS, EF1 and
M. kusanoi assay was 1 pg, similar to the sensitivity reported TUB2 sequence for these are now made publicly available via
for a single-copy laccase 2 gene-based real-time PCR assay GenBank. This contributes to improved understanding of the
that was developed for the detection of M. fructigena (Wang genetic variation between M. kusanoi isolates and within the
et al. 2018). This was also close to the sensitivity of the multi- genus Monilinia in general and will also assist with identifi-
copy ITS region-based real-time PCR assays that have been cation of M. kusanoi via blast analysis. As an example, the
shown to detect 0.6 pg of DNA from a number of Monilinia EF1 sequence region amplified with the here presented
species (M. fructicola, M. fructigena, M. laxa and M. kusanoi assay could be sequenced and identified via blast
M. polystroma; van Brouwershaven et al. 2010). The average analysis for further validation of positive detections.
haploid genome size of Monilinia species is 0.04 pg as per the Monilinia kusanoi is considered as an organism of
currently available genome data for four Monilinia species biosecurity concern in New Zealand and Australia
(Landi et al. 2018, 2019; De Miccolis Angelini et al. 2019; (Constable 2016; MPI 2020). This pathogen can infect
Rivera et al. 2018). While there are no genome size estimates cherries and a range of other Prunus species and therefore
available for M. kusanoi, it is estimated that the assay could cause economic damage to stone-fruit growers. Very limited
detect the presence of approximately 25 hyphal cells, based on information is available about the biology of M. kusanoi, how-
the known Monilinia genome sizes and the fact that there is ever, its life cycle, and therefore the mode of spread and sur-
one nucleus in each hyphal cell. vival, most likely resemble other Monilinia species. Despite
Since M. kusanoi is a pathogen of leaf and stem, this de- the current limited geographical distribution of M. kusanoi in
veloped assay would be used mostly to screen plant propaga- Japan and Korea, the spread of the pathogen into new geo-
tion material. To facilitate fast sample processing, the primers graphical regions is considered possible via imported nursery
and probe specific for plant cytochrome oxidase gene (Weller stock and potentially also fruit, like it has been determined for
et al. 2000) were used to develop a duplex assay. The incor- M. fructicola (EFSA 2011). It has also been suggested that
poration of the plant internal control allows to confirm the Monilinia species might be distributed with planting material
successful extraction of plant DNA and therefore avoid that have latent bud infections or very small overwintering
false-negative detections due to PCR inhibition. The duplex stem cankers, which might go unnoticed during the inspec-
assay that we developed in this study was able to co-amplify tions (Cox et al. 2018). Therefore, it is necessary to have
both M. kusanoi and plant internal control in a single reaction diagnostic tools in place for efficient and rapid screening of
without compromising the sensitivity shown in the single-plex imported commodities, as well as for detection in order to
M. kusanoi assay. It is also possible to triplex the M. kusanoi contain or eradicate the pathogen if introduced. The real-
specific real-time PCR assay and COX assay with other time PCR assay presented here is the first published assay
Monilinia assays without compromising the sensitivity, as for the detection of M. kusanoi, allowing robust, specific and
we have also successfully added the van Brouwershaven sensitive detection of the pathogen. The assay can be used for
et al. (2010) assay for co-amplification of a number of biosecurity screening as well as for research purposes, e.g. in
Monilinia species for quick screening (data not shown). the areas where M. kusanoi is known to be established.
It should be noted that in the duplex assay, the amplifica-
tion curve for the plant internal control was found to be rela- Supplementary Information The online version contains supplementary
material available at https://doi.org/10.1007/s13313-021-00774-4.
tively flat with lower relative fluorescence unit values (Fig. 1).
Similar trend was also observed in single-plex assays (data not
Acknowledgments This work was funded by the Operational Research
shown), indicating that the COX assay might be somewhat Programmes, Ministry for Primary Industries, New Zealand. We thank
inhibited by Prunus stem DNA itself. However, stem DNA the members of the project team Abigail Durrant, Sue Escott-Brown,
was chosen for assay validation since this is the material used Richard Lardner, Claire McDonald, Robert Taylor and Zhidong Yu for
their suggestions and advice throughout the work. We also thank
for introducing new germplasm and will be used in post entry
Filomena Ng and Luciano Rigano for completing blind panel testing,
quarantine to test non-symptomatic plant material. and Jeyaseelan Baskarathevan for extracting DNA and generating se-
Prior to this study, the limited availability of M. kusanoi quence data for a number of Monilinia isolates that were used for assay
ITS sequences and the lack of sequence data for other gene validation. Robert Taylor and Subuhi Khan are acknowledged for their
316 K. Dharmaraj et al.

critical review of an earlier version of this manuscript. We would also like Glass NL, Donaldson GC (1995) Development of primer sets designed
to thank the genetic resources centre, National Agriculture and Food for use with the PCR to amplify conserved genes from filamentous
Research Organization (NARO), Japan for providing the M. kusanoi iso- ascomycetes. Appl Environ Microbiol 61:1323–1330
lates that were used for assay development. Guinet C, Fourrier-Jeandel C, Cerf-Wendling I, Ioos R (2016) One-step
detection of Monilinia fructicola, M. fructigena, and M. laxa on
Prunus and Malus by a multiplex real-time PCR assay. Plant Dis
100:2465–2474. https://doi.org/10.1094/PDIS-05-16-0655-RE
Holst-Jensen A, Kohn LM, Jakobsen KS, Schumacher T (1997)
Molecular phylogeny and evolution of sMonilinia
(Sclerotiniaceae) based on coding and non-coding rDNA sequences.
Am J Bot 84:686–701
Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov
References ES, Singer MJ, Walburger DK, Lokhov SG, Gall AA, Dempcy R,
Reed MW, Meyer RB, Hedgpeth J (2000) 3′-minor groove binder-
Acero FJ, Carbu M, El-Akhal MR, Garrido C, Gonzalez-Rodriguez VE, DNA probes increase sequence specificity at PCR extension tem-
Cantoral JM (2011) Development of proteomics-based fungicides: peratures. Nucleic Acids Res 28:655–661. https://doi.org/10.1093/
new strategies for environmentally friendly control of fungal plant nar/28.2.655
diseases. Int J Mol Sci 12:795–816. https://doi.org/10.3390/ Landi L, De Miccolis Angelini RM, Pollastro S, Abate D, Faretra F,
ijms12010795 Romanazzi G (2018) Genome sequence of the brown rot fungal
Byrde RJW, Willetts HJ (1977) The brown rot fungi of fruit: their biology pathogen Monilinia fructigena. BMC Res Notes 11:758. https://
and control. Pergamon Press, New York doi.org/10.1186/s13104-018-3854-z
Carbone I, Kohn LM (1999) A method for designing primer sets for Landi L, Pollastro S, Rotolo C, Romanazzi G, Faretra F, De Miccolis
speciation studies in filamentous ascomycetes. Mycologia 91:553– Angelini RM (2019) Draft genomic resources for the brown rot
556. https://doi.org/10.1080/00275514.1999.12061051 fungal pathogen Monilinia laxa. Mol Plant-Microbe Interact 33:
Constable F (2016) Development of molecular diagnostic tools to detect 145–148. https://doi.org/10.1094/MPMI-08-19-0225-A
endemic and exotic pathogens of Prunus species for Australia. Luo Y, Ma Z, Reyes HC, Morgan D, Michailides TJ (2007)
https://www.horticulture.com.au/globalassets/laserfiche/assets/ Quantification of airborne spores of Monilinia fructicola in stone
project-reports/mt12005/mt12005-final-report-816.pdf. Accessed fruit orchards of California using real-time PCR. Eur J Plant
28 April 2020 Pathol 118:145–154. https://doi.org/10.1007/s10658-007-9124-x
Cox KD, Villani SM, Poniatowska A, Schnabel G, Holb I, Fajardo J Marin-Felix Y, Groenewald JZ, Cai L, Chen Q, Marincowitz S, Barnes I,
(2018) Recovery plan for Monilinia polystroma causing Asiatic Bensch K, Braun U, Camporesi E, Damm U, de Beer ZW,
brown rot of stone fruit. Plant Health Prog 19:107–124. https://doi. Dissanayake A, Edwards J, Giraldo A, Hernández-Restrepo M,
org/10.1094/PHP-12-17-0080-RP Hyde KD, Jayawardena RS, Lombard L, Luangsa-ard J,
Di Francesco A, Mari M (2018) Monilinia species of fruit decay: a com- McTaggart AR, Rossman AY, Sandoval-Denis M, Shen M,
parison between biological and epidemiological data. Ital J Mycol Shivas RG, Tan YP, van der Linde EJ, Wingfield MJ, Wood AR,
47:13–23. https://doi.org/10.6092/issn.2531-7342/7817 Zhang JQ, Zhang Y, Crous PW (2017) Genera of phytopathogenic
De Miccolis Angelini RM, Romanazzi G, Pollastro S, Rotolo C, Faretra fungi: GOPHY 1. Stud Mycol 86:99–216. https://doi.org/10.1016/j.
F, Landi L (2019) New high-quality draft genome of the brown rot simyco.2017.04.002
fungal pathogen Monilinia fructicola. Genome Biol Evol 11:2850– MPI (Ministry for Primary Industries) (2020) Import Health Standard:
2855. https://doi.org/10.1093/gbe/evz207 Prunus plants for planting, New Zealand. https://www.mpi.govt.
EFSA Panel on Plant Health (PLH) (2011) Pest risk assessment of nz/news-and-resources/consultations/draft-import-health-standard-
Monilinia fructicola for the EU territory and identification and eval- for-importing-prunus-plants-for-planting. Accessed 20 April 2020
uation of risk management options. EFSA J 9(4):2119. https://doi. O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple evolu-
org/10.2903/j.efsa.2011.2119 tionary origins of the fungus causing Panama disease of banana:
Fan JY, Luo Y, Michailides TJ, Guo LY (2014) Simultaneous quantifi- concordant evidence from nuclear and mitochondrial gene genealo-
cation of alleles E198A and H6Y in the β-tubulin gene conferring gies. Proc Natl Acad Sci U S A 95:2044–2049. https://doi.org/10.
benzimidazole resistance in Monilinia fructicola using a duplex real- 1073/pnas.95.5.2044
time (TaqMan) PCR. Pest Manag Sci 70:245–251. https://doi.org/ Mirmajlessi SM, Loit E, Mand M, Mansouripour SM (2015) Real-time
10.1002/ps.3549 PCR applied to study on plant pathogens: potential applications in
Farr DF, Rossman AY (2020) Fungal Databases, U.S. National Fungus diagnosis – a review. Plant Protect Sci 51:177–190. https://doi.org/
Collections, ARS, USDA. https://nt.ars-grin.gov/fungaldatabases. 10.17221/104/2014-PPS
Accessed 28 April 2020 Rivera Y, Zeller K, Srivastava SK, Sutherland J, Galvez ME, Nakhla
MK, Poniatowska A, Schnabel G, Sundin G, Abad ZG (2018)
Garcia-Benitez C, Melgarejo P, De Cal A (2017) Detection of latent
Draft genome resources for the phytopathogenic fungi Monilinia
Monilinia infections in nectarine flowers and fruit by qPCR. Plant
fructicola, M. fructigena, M. polystroma and M. laxa, the causal
Dis 101:1002–1008. https://doi.org/10.1094/PDIS-11-16-1682-RE
agents of brown rot. Phytopathol 108:1141–1142. https://doi.org/
Garrido C, Acero FGF, Carbu M, Rodriguez VEG, Liniero E, Cantoral
10.1094/phyto-12-17-0418-a
JM (2012) Molecular microbiology applied to the study of phyto-
van Brouwershaven IR, Bruil ML, van Leeuwen GCM, Kox LFF (2010)
pathogenic fungi. In: Magdeldin S (ed) Biochemistry, Genetics and
A real-time (TaqMan) PCR assay to differentiate Monilinia
Molecular Biology. Rijeka, InTech, pp. 139–156
fructicola from other brown rot fungi of fruit crops. Plant Pathol
Ginzinger DG (2002) Gene amplification using real-time quantitative 59:548–555. https://doi.org/10.1111/j.1365-3059.2009.02220.x
PCR: an emerging technology hits the mainstream. Exp Hematol
Wang JR, Guo LY, Xiao CL, Zhu XQ (2018) Detection and identification
30:503–512. https://doi.org/10.1016/S0301-472X(02)00806-8
of six Monilinia spp. causing brown rot using TaqMan real-time
Development of a new real-time TaqMan PCR assay for the detection of the Prunus pathogen... 317

PCR from pure cultures and infected apple fruit. Plant Dis 102: Willetts HJ, Harada Y (1984) A review of apothecial production by
1527–1533. https://doi.org/10.1094/PDIS-10-17-1662-RE Monilinia fungi in Japan. Mycologia 76:314–325. https://doi.org/
Weller SA, Elphinstone JG, Smith NC, Boonham N, Stead DE (2000) 10.1080/00275514.1984.12023840
Detection of Ralstonia solanacearum strains with a quantitative, White TJ, Bruns TD, Lee S, Taylor J (1990) Amplification and direct
multiplex, real-time, fluorogenic PCR (TaqMan) assay. Appl sequencing of fungal ribosomal RNA genes for phylogenetics. In:
Environ Microbiol 66:2853–2858. https://doi.org/10.1128/aem.66. Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols, a
7.2853-2858.2000 guide to methods and applications. Academic Press, San Diego, pp
315–322