ICPPB2014 Program&Abstracts - China

Table of Contents
General Information ................................................................................................................................. 5

Venue .................................................................................................................................................. 5
Registration ......................................................................................................................................... 5
Registration Hours .............................................................................................................................. 5
On-site Registration Fee ..................................................................................................................... 5
Name Badge ....................................................................................................................................... 5
Instructions for Oral Presentations ..................................................................................................... 6
Instructions for Poster Preparation ..................................................................................................... 6
Poster Hours ....................................................................................................................................... 6
Lunch................................................................................................................................................... 5
Excursion............................................................................................................................................. 5
Congress Dinner ................................................................................................................................. 7
Emergency Number ............................................................................................................................ 7
Maps........................................................................................................................................................... 8
ICPPB2014 Program-at-a-Glance.......................................................................................................... 10
ICPPB2014 Conference Program.......................................................................................................... 12
Monday June 9.................................................................................................................................. 12
Tuesday June 10............................................................................................................................... 17
Thurday June 12 ............................................................................................................................... 21
Friday June 13 .................................................................................................................................. 23
ICPPB2014 Abstracts ............................................................................................................................. 25
Abstract Index........................................................................................................................................113
Participants in ICPPB2014 ...................................................................................................................116
Notes ...................................................................................................................................................... 125
Access Map ........................................................................................................................................... 135
4
General Information
Venue
Shanghai Everbright International Hotel: No. 66, Caobao Road, Shanghai Xuhui District (上海徐汇区漕宝路
66 号)
The Conference Room (Grand Ballroom) locates in the second floor of Shanghai Everbright International
Hotel.
Registration
The registration desk is located at the entrance of Shanghai Everbright International Hotel. Advance and
on-site registrants may pick up their congress materials upon registration.
Registration Hours
Sunday, June 8 8:30–20:30
Monday, June 9 8:30–15:30

Tuesday, June 10 8:30–12:00
Wednesday, June 11 8:30–12:00
Thursday, June 12 8:30–12:00
Friday, June 13 8:30–12:00
On-site Registration Fee
For those who wish to register after May 20, 2014, please register at the on-site registration desk. Only cash
(RMB and USD) are available for payment of on-site registrations:
Domestic Delegate RMB 2,800
Domestic Student RMB 1,800
Domestic Accompanying Adult RMB 1,000
Domestic Accompanying Child RMB 500
Overseas Delegate USD 700
Overseas Student USD 500
Overseas Accompanying Adult USD 200
Overseas Accompanying Child USD 100
Name Badge
All participants, accompanying persons and exhibitors should wear the provided name badge in the congress
areas. Accompanying persons CANNOT attend any scientific sessions.
5
Instructions for Oral Presentations
Presenters must gather in the Grand Ballroom 15 minutes prior to the session start time to conduct a brief
meeting to coordinate the session.
The Organizing Committee will prepare computers for oral presentations. Please bring your flash drive to the
PC operation booth.
Instructions for Poster Preparation
Posters will be displayed in the second floor (Poster viewing section, see the map of second floor plan) of
Shanghai Everbright International Hotel.
Posters will be numbered as indicated in the PDF file of the abstract book, and The Organizing Committee will
provide a poster board marked with a corresponding poster number for each poster.
Please make your poster fit the space within the display panel. The panel size is shown in the figure below.
Poster Hours
Monday, June 9 08:30–17:30 Poster setup

Monday, June 9 17:30–20:30 Poster viewing
Tuesday, June 10 17:30–20:30 Poster viewing
Thursday, June 12 08:30–17:30 Poster take-down
Lunch
Buffet lunches are to be provided by the Conference in exchange for lunch vouchers only. If you are a
vegetarian or Muslim, please tell the staff in reception desk when you register. We will provide you the
requested food.
Lunch place (Guangyun No.6) locates at the first floor of Shanghai Everbright International Hotel.
Excursion
Tourist Destination: Chiang Kai-shek hometown, Xikou, Zhejiang
Date & Time: Wednesday, June 11, 2014
Pick-up Location:
In front of Shanghai Everbright International Hotel
Schedule:
 7:00: Shanghai Everbright International Hotel
6
 10:30: Xikou Xudou MT. Reception Desk
 11:00-12:00 Wuling Gate-Wenchang Pavilion-Chiang’s Amdent Temple-Fenggao Hall-Yutai Salt-
Vending Shop (1 h guided tour & free time)
 12:30-13:30 Lunch time
 13:30-17:00 Qian Zhang Cliff Waterfall-Miaogao Terrace-Three Hidden Pools (2.5 h guided tour & free
time)
 17:30-19:30 Dinner time
 19:30-22:30 Back to Shanghai Everbright International Hotel
Congress Dinner
The Conference Dinner will take place at Grand Ballroom (Conference Room) on June 13, 2014 from 18:30
to 21:00.
Emergency Number
Medical emergencies should be communicated to a Congress Secretariat member at the registration desk or
to an employee of Shanghai Everbright International Hotel.
Please contact
Dr. Gongyou Chen
Cell phone: 15000461301
Dr. Lifang Zou
Cell phone: 13917740049
Mr. Yu Chen
Cell phone: 13916299367
7
Maps
Shanghai Everbright International Hotel
Floor Plan
8
9
ICPPB2014 Program-at-a-Glance
June, 9 June, 10
Time Speech Order Chairs Time Speech Order Chairs
8:30-9:00 CS1 8:30-9:00 S2-K2
Dr. Philippe Prior

S1 9:00-9:30 S1-K1 9:00-9:20 S2-O4 Dr. Marie-Agnes
Dr. Jacob Dirk
9:30-9:50 S1-O1 9:20-9:40 S2-O5 Jacques
Janse S2
Dr. James
9:50-10:10 S1-O2 9:40-10:00 S2-O6
Alfano
S2-P13 to
10:00-10:20
10:10-10:40 Photo and Coffee Break S2-P24
10:20-10:40 Coffee Break
10:40-11:10 S2-K1 10:40-11:10 S3-K2
11:10-11:30 S2-O1 11:10-11:30 S3-O4

Dr. Jie Feng Dr. Isaac Barash
11:30-11:50 S2-O2 Dr. Ramesh V 11:30-11:50 S3-O5 Dr. Jianmin
S2 S3
11:50-12:10 S2-O3 Sonti 11:50-12:10 S3-O6 Zhou
12:10-12:30 S2-P1 to S2-P12 12:10-12:30 S3-O7
12:30-13:30 Lunch 12:30-13:30 Lunch
13:30-14:00 S3-K1 13:30-14:00 S4-K2
14:00-14:20 S3-O1 14:00-14:20 S4-O4

Dr. Jan E. Leach Dr. Olivier
14:20-14:40 S3-O2 Dr. David S 14:20-14:40 S4-O5 Pruvost
S3 S4
14:40-15:00 S3-O3 Guttman 14:40-15:00 S4-O6 Dr. Cindy Morris
15:00-15:20 S3-P1 to S3-P13 15:00-15:20 S4-O7
15:20-15:40 Coffee Break 15:20-15:40 Coffee Break
15:40-16:10 S4-K1 15:40-16:10 S1-K2
16:10-16:30 S4-O1 16:10-16:30 S1-O3 Dr. Wenxian

Dr. Nicola sante
16:30-16:50 S4-O2 16:30-16:50 S1-O4 Sun
S4 Iacobellis S1
Dr. Magdalen
16:50-17:10 S4-O3 Dr. Nian Wang 16:50-17:10 S1-O5
Lindeberg
17:10-17:30 S4-P1 to S4-P13 17:10-17:30 S1-P1 to S1-P12
17:30-20:30 Poster Reviewing 17:30-20:30 Poster Reviewing
10
June, 12 June, 13
Time Speech Order Chairs Time Speech Order Chairs
8:30-9:00 CS2 8:30-9:00 CS3
9:00-9:30 S3-K3 9:00-9:20 S4-O12

Dr. Ya-Wen He
Dr. Bing Yang
S3 9:30-9:50 S3-O8 S4 9:20-9:40 S4-O13 Dr. Steven E
Dr. Shengyang He
Lindow
9:50-10:10 S3-O9 9:40-10:00 S4-O14
10:10-10:30 S3-O10 10:00-10:20 S4-O15
10:40-11:10 S4-K3 10:40-11:10 S1-K4
11:10-11:30 S4-O8 11:10-11:30 S1-O10

Dr. Jean Martin
11:30-11:50 S4-O9 Dr. Jianhua Guo 11:30-11:50 S1-O11
S4 S1 van der Wolf
Dr. Carolee Bull
11:50-12:10 S4-O10 11:50-12:10 S1-O12 Dr. Jiliang Tang
S4-O11
12:10-12:30 12:10-12:30 S1-O13
12:30-13:30 Lunch 12:30-13:30 Lunch
13:30-14:00 S1-K3 13:30-14:00 S2-K4
14:00-14:20 S1-O6 14:00-14:20 S2-O11

Dr. Fengquan Liu Dr. Wei Qian
S1 14:20-14:40 S1-O7 S2 14:20-14:40 S2-O12
Dr. Ian Toth Dr. Caitilyn Allen
14:40-15:00 S1-O8 14:40-15:00 S2-O13
15:00-15:20 S1-O9 15:00-15:20 S2-O14
15:40-16:10 S2-K3 15:40-16:10 S3-K4
16:10-16:30 S2-O7 16:10-16:30 S3-O11

Dr. Chatterjee Dr. Casiana
16:30-16:50 S2-O8 Subhadeep 16:30-16:50 S3-O12 Vera Cruz
S2 S3
Dr. Ching-Hong Dr. Tsutomu
16:50-17:10 S2-O9 16:50-17:10 S3-O13
Yang Kawasaki
S2-O10
17:10-17:30 17:10-17:30 S3-O14
CS, Conference-invited keynote speaker (25-minute talk + 5-minute discussion);

S1-K, Keynote speaker (25-minute talk + 5-minute discussion ) in Session1;
S1-O, Oral presentation (15-minute talk + 5-minute discussion) in Session 1;
S1-P, Poster presentation (2-minute presentation) in Session 1;
S1-A, abstracts Only in Session 1;
The same abbreviations in other sessions.
11
The 13th International Conference on Plant Pathogenic Bacteria
Conference Program
Monday, June 9
S1: Omics & Evolution
Chairs: Dr. Philippe Prior, INRA-CIRAD, France; Dr. Jacob Dirk Janse, Dutch General Inspection Service, Netherland
Conference special talk

8:30 CS1 38 years phytobacteriology - in retrospect and perspectives and challenges for its/the future
Jacob Dirk Janse
Keynote talks
9:00 S1-K1 Expanding the framework of plant-pathogen co-evolution beyond the current PTI-ETI arms race
paradigm
Boris A. Vinatzer
Session talks
9:30 S1-O1 Division of the plant pathogen Ralstonia solanacearum into three species: R.solanacearum, R.
sequeirae sp. nov., and R. syzygii
Caitilyn Allen, Benoît Remenant, Beth Dalsing, Borja Sanchez, Florent Ailloud, Philippe Prior
9:50 S1-O2 The whole genome sequence of Pseudomonas syringae pv. actinidiae: insights into evolution,
genome dynamics and pathogenicity
Honour McCann, Erik HA Rikkerink, Frederic Bertels, Elena Colombi, Ashley Lu, Bernhard Haubold,
Christina Straub, Paul BRainey, Matthew DTempleton
10:10 Photo and Coffee Break
S2: Pathogenesis & Regulation

Chairs: Dr. Jie Feng, Institute of Plant Protection, CAAS, China; Dr. Ramesh V Sonti, Centre for Cellular and Molecular
Biology, India
Keynote talks
10:40 S2-K1 Induction and suppression of DAMP induced innate immunity in rice-Xanthomonas interactions
Ramesh V. Sonti
Session talks
11:10 S2-O1 Phenotypic variationin the cucurbit pathogenic bacterium Acidovorax citrulli: characterization of
the phenomenon and relationship with virulence
Saul Burdman, Tally Rosenberg, Ram Kumar Shrestha
11:30 S2-O2 Regulatory role of T6SS Hcp and antibiotic weakens the pathogenicity and colonization of
resistant strain RS-1 in Acidovorax avenae subsp. Avenae
Mengyu Ge, Bin Li, Guanlin Xie
11:50 S2-O3 Comparative analysis of the regulators involved in the virulence of Dickeya solani strains
Ewa Lojkowska, Marta Potrykus, Małgorzata Golanowska, Marco Galardini, Alesio Mengoni,
Marco Bazzicalupo, Nicole HugouvieuxCottePattat
Posters
12:10 S2-P1 The ColR-regulated alanine-rich outer membrane protein AOMP exerts a pleiotropic role in T3SS
12
formation in Xanthomonas citris pp. citri
Jing Guo, XueSong, XiaojingFan, Huasong Zou,Gongyou Chen
S2-P2 A three-component signalling system fine-tunesexpression kinetics of HPPK responsible for
folatesynthesis by positive feedback loop during stressresponse of Xanthomonas campestris
Fangfang Wang, ChaoyingDeng, Zhen Cai, Ting Wang, Li Wang, XiaozhengWang, Xiaoying Chen,
RongxiangFang, Wei Qian
A
S2-P3 Effects of mutagenesis of PhaR gene of Xanthomonas oryzae pv. oryzae PXO99 on the virulence
in rice and hypersensitive response in tobacco
Xiao fang Cui, Xiao lan Peng, Congfeng Song
S2-P4 HrcT is a key component of the type III secretion system in Xanthomonas and also regulates the
expression of the key hrp transcriptional activator HrpX
Zhiyang Liu, LifangZou, XiaoboXue, Lulu Cai, Wenxiu Ma, Li Xiong, ZhiyuanJi, Gongyou Chen
S2-P5 Identification and Characterization of Integron-Mediated Antibiotic Resistance in the
Phytopathogen Xanthomonas oryzae pv. oryzae
Ying Xu, QingquanLuo, MingguoZhou
S2-P6 Inhibition of type III secretion system of Xanthomonas oryzae pv. oryzae by plant phenolic
compounds and its derivatives
Susu Fan, Fang Tian, Huamin Chen, Chinghong Yang, Chenyang He
S2-P7 Lon is involved in negative regulation of the hrp gene expression via resolving HrpX in
Xanthomonas oryzae pv. oryzae
Tsuge S, Ikawa Y, Majima A, Furutani A
S2-P8 StoS and SreKRS positively regulate EPS, swarming, and stress resistance but negatively regulate
hrp genes in Xanthomonas oryzae pv. Oryzae
Dehong Zheng, Lifang Ruan
S2-P9 The quorum sensing system of Xanthomonas hortorum pv. pelargonii affects virulence and
movement in pelargonium plants
Laura Chalupowicz, Victoria Barel, Isaac Barash, Michal Reuven, Orit Dror, Saul Burdman,
Shulamit Manulis Sasson
S2-P10 TriP, a response regulator interacting with PdeR, regulated exopolysaccharides secretion and
virulence of Xanthomonas oryzae pv. oryzae
Haiyun Li, Fang Tian, Huamin Chen, Chenyang He
S2-P11 Molecular biology of Xanthomonas pathogenesis
Xingyu Wang, Jiayuan Wang, Ming Li, Lian Zhou, Yawen He
S2-P12 parB2 deficiency in Ralstonia solanacearum affects morphology and motility
XiaomanShe, Zifu He
12:30 Lunch break
S3: Disease Resistance & Effector Biology
Chairs: Dr. Jan E. Leach ; Colorado State University, USA; Dr. David S Guttman, University of Toronto, Canada
Keynote talks
13:30 S3-K1 Heterologous functional genomic screens to identify conserved cellular processes targeted by
bacterial effectors
David S. Guttman
13
Session talks
14:00 S3-O1 The Xanthomonas secreted effector AvrRxo1 and its chaperone Arc1 act as a toxin-antitoxin
system in bacteria
Jan E. Leach, Lindsay Triplett, LoicDeblais, John Long, BingyuZhao
14:20 S3-O2 Domain dissection of AvrRxo1 for suppressor, avirulence and toxicity functions
Haifeng Liu, Qingle Chang, Wenjie Feng,Baoguang Zhang, Tao Wu, Ning Li, Xinhua Ding, Zhaohui
Chu
14:40 S3-O3 The last half-repeat of transcription activator-like effector is dispensable and thereby TALE-based
technology can be simplified
Chongke Zheng, Chunlian Wang, Xiaoping Zhang, Fujun Wang, Tengfei Qin, Kaijun Zhao
Posters
15:00 S3-P1 Pathogen of Kiwifruit Bacterial Canker Originally Isolated from Three Non-Kiwifruit Hosts in China
Rong He, Pu Liu, Jiayong Hu, Bing Jia, Lorenzo Gallipoli, Angelo Mazzaglia, Giorgio M. Balestra,
Liwu Zhu
S3-P2 Divergence of Acidovorax citrulli into three lineages based on type III secreted effector sequence
analysis
N. EckshtainLevi, R. Walcott, J. Sikorski,S. Burdman
S3-P3 Characterization of factor(s) responsible for antagonism of Pseudomonas sp. P482 against
pathogens of potato
A. Ossowicki, D. Krzyżanowska, S. Jafra
S3-P4 Genotypic and Pathotypic diversity of Xanthomonas oryzae pv. oryzae in Taiwan
Lin H A, Tzeng J Y, Huang S Z, Kuo C C, Huang C M, Shi Y C, Deng W L, Chung C L
S3-P5 Diversity of Xanthomonas arboricola pv. juglandis population in Poland
J Pulawska, M Kałużna, MWaleron, P Sobiczewski
S3-P6 The Xanthomonas campestris effector protein XopDXcc8004 triggers plant disease tolerance by
targeting DELLA proteins
Leitao Tan, Wei Rong, Hongli Luo, Yinhua Chen, Chaozu He
S3-P7 In silico characterization and functional analysis of vgrGs in Acidovoraxavenaesub sp. avenae
strain RS-1
ZhouqiCui, Zhongyun Tao, Guohua Liang, Bin Li
S3-P8 Rice FLS2-mediated perception of bacterial flagellins is evaded by Xanthomonas oryzae pv. oryzae
and oryzicola
Shanzhi Wang, Zhe Sun, Huiqin Wang, Lijuan Liu, Fen Lu, Jun Yang, Min Zhang, Shiyong Zhang,
Zejian Guo, Andrew F. Bent, Wenxian Sun
S3-P9 Biological Control of Bacterial Canker of Tomato with Streptomyces setonii Z-L-22
Sai Zhao, Weihong Zhang, Na Zhang, Lirong Zhang, Wenxiang Yang, Daqun Liu
S3-P10 Aetiology, Epidemiology and Control Methods of Bacterial Canker of Kiwifruit caused by
Pseudomonas syringae pv. actinidiae
Joël Vanneste, J Yu , D.A.Cornish, D.E Pattemore, F. Spinelli, L.Forientini, A.Cunty
S3-P11 Genetic and Pathogenetic Diversity of Rice Bacterial Blight Pathogen, Xanthomonas oryzae pv.
oryzae Population in Northeast China
Jichun Wang, Jiahuan Zhang, Wenping Liu, Xian Wu, Chunwei Wang
S3-P12 Silicon induced resistance against Xanthomonas campestrispv. musacearumin bananas
MburuK.N., R.O. Oduor, A.J. Mgutu, L. Tripathi
S3-P13 Bacillus sp. strain 37-1 suppresses black rot of crucifers via priming of induced defense responses
14
Chiahua Lin, YuntingOu, Chaoying Chen
15:20 Coffee break
S4: Taxonomy, Epidemiology, Ecology & Control
Chairs: Dr. Nicola sante Iacobellis, University Degli Studi Della Basilicata, Italy; Dr. Nian Wang, University of Florida, USA
Keynote talks
15:40 S4-K1 Exploration of the virulence mechanism of Xanthomonas citri and its application in control of
citrus canker
Nian Wang
Session talks
16:10 S4-O1 Molecular epidemiology and virulence typing of Ralstonia solanacearum raise new prospects for
sustainable control of Solanaceae bacterial wilt
Aya Carine N Guessan, Flora Pensec, Christophe Lemaire, Pierre Lefeuvre, Emmanuel Wicker
16:30 S4-O2 Rhizobacteria isolated from bean produce volatiles that inhibit plant pathogens and support plant
health
Giorgio A, Lo Cantore P, De Stradis A, Lamorte D, Bakker PAHM, Iacobellis NS
16:50 S4-O3 Comparative Genomics Approaches for Detection and Identification of Ralstoniasolanacearum
race 3 bv 2
Xiang (Sean) Li, Kat (Xiaoli) Yuan, JingbaiNie, ZakyAdam, James Tambong, Wen Chen, Christopher
T.Lewis, Solke H. De Boer and C. André Lévesque
Posters
17:10 S4-P1 Monitoring Ralstonia solanacearum strains causing potato brown rot in Taiwan and their
virulence on tomato, eggplant, and pepper
Chihhung Lin, Jawfen Wang, Yeafang Wu, Anhsiu Cheng
S4-P2 A flow cytometric method for counting viable Xanthomonascampestris pv.campestris
Xin Xu, Xiaowei Huang, Laixin Luo, Jianqiang Li
S4-P3 R & D and Commercialization of novel effective microbial pesticides for controlling plant
diseases--the series products of Paenibacillus polymyxa HY96-2
Yuanguang Li, Sulan Li, Yuanchan Luo, Daojing Zhang, Xunyi Huang, Jie Chen, Panxi Liu
S4-P4 Characteristics of the new group of Pseudomonas spp. causing bacterial canker on cherry in
Poland – phylogenetic position of known pathovars and races
Monika Kaluzna, Joanna Pulawska
S4-P5 Research and Development of the novel marine microbial pesticides for controlling plant disease--
the series product of Bacillus marinus B-9987
Yuanchan Luo, Yuanguang Li, Sulan Li, Daojing Zhang , Xunyi Huang , Jie Chen, Panxi Liu, Tiam Li
S4-P6 Genetic diversity among strains of fluorescent Pseudomonads isolated from squash fruits and
leaves
Dong Xu, Vicky Toussaint
S4-P7 Detection of Clavibacter michiganensis subsp. michiganensis in tomato seed by loop-mediated
isothermal amplification based on chpC gene sequence
Qingyang Lv, Yumin Kan, Na Jiang, Jianqiang Li, Laixin Luo
S4-P8 The impact of environmental conditions on survival of bacteria Clavibacter michiganensis subsp.
sepedonicus
Anna Mackowiak Sochacka, Krzysztof Krawczyk
15
S4-P9 A 16SrII-A*Phytoplasma Detected in Grapefruit (Citrus paradisi) Showing Huanglongbing-like
Syptoms in Guangxi, P. R. China
Binghai Lou, Xianjin Bai, Yaqin Song, Chongling Deng, Chuanwu Chen
S4-P10 Bacterial communities associated with surfaces of leafy greens: temporal development shifts and
host specificity
Merete Wiken Dees, Erik Lysøe, BeritNordskog, May BenteBrurberg
S4-P11 Evaluation of six housekeeping genes for normalization in RT-qPCR analysis in Clavibacter
michiganensis subsp. michiganensis in vitro
Na Jiang, Sining Han, Jianqiang Li, Laixin Luo
S4-P12 Evaluation of cross-priming amplification method for on-site detection of Acidovorax citrulli
Qian Tian, Jing Zhang, ShuifangZhu,WenjunZhao, FengquanLiu
S4-P13 Phylotyping Ralstonia solanacearum isolates associated with bacterial wilt of Eucalyptus spp.
Carstensen, G.D., Venter S.N., Wingfield M.J ,Coutinho,T.A.
17:30 Poster Reviewing
16
Tuesday, June 10
Chairs: Dr. Marie-Agnes Jacques, IRHS-INRA, France; Dr. James Alfano, University of Nebraska, USA
Keynote talks
8:30 S2-K2 Pseudomonas syringae type III effectors: their injection into plant cells, plant targets, and
immunity suppression
James Alfano
Session talks
9:00 S2-O4 Flagellar motility and fitness in xanthomonads
Marie Agnès Jacques, Jean François Guimbaud, Arnaud Indiana, Armelle Darrasse
9:20 S2-O5 Use of genome-wide analysis for deciphering the role of the PecS masterregulator during the
early stages of Arabidopsis infection by the enterobacterium Dickeya dadantii
J. Pédron, B. Alunni, P. Malfatti, E. Chapelle, F.Van Gijsegem
9:40 S2-O6 Emerging complexities of the action of the Rpf/DSF system in the regulation of Xanthomonas
virulence
Max Dow, Yvonne McCarthy, Melanie Febrer, Shiqi An, Robert Ryan
Posters
10:00 S2-P13 Biofilm formation of Ralstonia solanacaerum in intercellular spaces and implication of
ralfuranones in its biofilm formation
Yuka Mori, Hideyuki Ohnishi, KanakoInoue, Kenichi Ikeda, Hitoshi Nakayashiki, Shiho Ishikawa,
AkinoriKiba, KouheiOhnishi, Kenji Kai, YasufumiHikichi
S2-P14 A newly identified positive regulator PrhN is essential for the hrp expression and pathogenecity
in Ralstonia solanacearum
Dousheng Wu, YongZhang, AkinoriKiba, YasufumiHikichi, KouheiOhnishi,Wei Ding
S2-P15 Swarming motility play the key role in colonization and migration in Bacillus subtilis
Shengfeng Gao, Huijun Wu, Yan Zhang, Xuewen Gao
S2-P16 hopA1 gene of Pseudomonas cichorii JBC1 reduced its virulence on plants, biofilm formation,
and swarming motility
Nguyen Bao Hung, Rajalingam Nagendran, Ha Kyoung Lee, Yong Hoon Lee
S2-P17 GidA is a global regulator affected antibiotic production and quorum sensing in Pseudomonas
fluorescens 2P24
Wei Zhang, Zhao Zhao , Liqun Zhang
S2-P18 Colonization of ‘Candidatus Liberibacter asiaticus’ in Pollen, Seed Coat and Endosperm of
Pummelo
Yaqin Song, Binghai Lou, Xiaolong Zhao, Xianjin Bai and Chongling Deng
S2-P19 Identification and characterization of genes specifically up-regulated in Dickeya solani at
different growth temperatures
Natalia Kaczyńska, Ewa Łojkowska, Robert Czajkowski
S2-P20 Pre detection method for sub species Pectobacterium confirmed in Potato (Solanum tuberosum)
(Mont.) wilt disease
Kelaniyangoda D. B, Salgadoe A.S.A
S2-P21 A rapid assay for indirect measurement of acylated homoserine lactones (AHLs) using
Chromobacterium violaceum in liquid systems without violacein extraction
17
Siphathele Sibanda, Rudi Pretorious, Lucy Moleleki, Jacques Theron, Teresa A. Coutinho
S2-P22 Identification and characterisation of pili mediating attachment of Pantoea ananatis to

Eucalyptus leaf surfaces
Tania Weller Stuart, Ian Toth, Jacques Theron, Teresa Coutinho
S2-P23 Metabolomic and transcriptomic analysis of the response of rice leaf tissue to staurosporine
treatment
Jeong Gu Kim, Hyang Yeon Kim, Mee youn Lee, Sait Byul Park, Joo Won Suh, In Ae Lee, Jinhua
Cheng, Choong Hwan Lee
S2-P24 Xanthomonadins biosynthesis and regulation in the phytopathogen Xanthomonas campestris
pv. campestris
Lian Zhou, Yawen He
10:20 Coffee break

Chairs: Dr. Isaac Barash,Tel-Aviv University, Israel; Dr. Jianmin Zhou,Institute of Genetics and Developmental Biology,
CAS, China
Keynote talks
10:40 S3-K2 Roles of PBL family kinases in plant-bacterial interactions
Jianmin Zhou
Session talks
11:10 S3-O4 Activation-independent resistance to Xanthomonas oryzae TAL effectors in rice
Lindsay Triplett, Valerie Verdier, Mariko Alexander, Adam Bogdanove, Jan Leach
11:30 S3-O5 Developing bacterial disease-resistant bananas using genetic engineering
L. Tripathi, J.N. Tripathi, K. Mburu, A. Kiggundu, W.K. Tushemereirwe
11:50 S3-O6 AvrXa7-Xa7 Mediated Defense in Rice Can Be Suppressed by A Transcriptional Activator-like
Effector TAL6 from Xanthomonasoryzaepv. oryzicola
Lulu Cai, ZhiyuanJi, Li Xiong, LifangZou,YurongLi, WenxiuMa, Liang Liu, Muhammad Zakria,
Guanghai Ji, Gongyou Chen
12:10 S3-O7 Nonpathogenic xanthomonads: a new aspect in Xanthomonas phylogeny
B Cottyn, E Gavrila, C Van Malderghem, M Maes
12:30 Lunch break
Chairs: Dr. Olivier Pruvost, CIRAD, France; Dr. Cindy Morris, INRA, France
Keynote talks
13:30 S4-K2 From the ecology of Pseudomonas syringae to probable scenarios of future disease
emergence
Cindy E. Morris
Session talks
14:00 S4-O4 Diagnostics through Ralstonia solanacearum genomics:grasping the broad diversity of a complex
plant pathogen
Gilles Cellier, Florent Ailloud, Bruno Hostachy, Philippe Prior, Isabelle RobèneSoustrade
14:20 S4-O5 Protection of tomato seedlings from bacterial wilt (Ralstonia solanacearum) with rhizosphere
bacteria
18
Triwidodo Arwiyanto,Bambang Hendro Sunarminto
14:40 S4-O6 A MLVA genotyping scheme for global surveillance of the citrus pathogen Xanthomonas citri pv.
citri suggests a worldwide geographical expansion of a single genetic lineage
Pruvost O, Magne M, Boyer K, Leduc A, Tourterel C, Drevet C, Ravigné V, Lionel Gagnevin L,
Guérin F, Chiroleu F, Koebnik R, Verdier V , Vernière C
15:00 S4-O7 Insights to the pathogenicity and control of Pseudomonas syringaepv. aesculi, an epidemic tree
pathogen
Sarah LJames, Federico Dorati, Dawn LArnold, Benjamin WNeuman, Ian MJones, Glynn Percival,
Michael A Brockhurst, Robert WJackson
15:20 Coffee break
Chairs: Dr. Wenxian Sun, China Agricultural University, China; Dr. Magdalen Lindeberg, Cornell University, USA
Keynote talks
15:40 S1-K2 Identification of virulence and defense components determining the outcome the Pto
DC3000-tomato interaction
Magdalen Lindeberg
Session talks
16:10 S1-O3 RNA-Seq-Based global transcriptomic analysis of rice pathogen Acidovorax avenae subsp.
avenae under in vitro, in vivo and rice rhizobacterium Burkholderia seminalis coculutre
condition
Bin Li, Muhammad Ibrahim, Zhouqi Cui, Mengyu Ge, Guanlin Xie
16:30 S1-O4 A genomic approach to the diagnosis of pseudomonadsin kiwifruit orchards
Sandra Visnovsky, Ashley Lu, Kerry Everett, Shamini Pushparajah, Robert Taylor, Andrew Pitman
16:50 S1-O5 Transposon mutagenesis identifies pathogenicity factors of grapevine bacterial blight pathogen,
Xylophilus ampelinus
Yolanda Petersen
Posters
17:10 S1-P1 Three distinct hrp genotypes of Acidovorax avenae subsp. citrulli cause bacterial fruit blotch in
cucurbit crops
Lifang Zou , Lanqing Li, Baishi Hu, Laixin Luo, Jianqiang Li, Tingchang Zhao, Gongyou Chen
S1-P2 Draft genome sequence of a hypersensitive reaction-inducing Pantoeaagglomerans strain
isolated from olive knots caused by Pseudomonas savastanoipv.savastanoi
C Moretti, C Cortese, D Passos da Silva, G Devescovi, E Torelli, V Venturi, G Firrao, R Buonaurio
S1-P3 Plant pathogenenic bacteria have proteins converting sucrose into products with potential
applications in functional food
Triinu Visnapuu, Karin Mardo, Andres Mäe, Eerik Jõgi, Tiina Alamäe
S1-P4 Molecular characterization of Clavibacter michiganensis subsp. michiganensisisolated from
pepper showing bacterial canker disease
ChungyunBae, Han-BeoylLee, Eom-JiOh, Mi Chi Yea, Kyu-OckYim, Duck Hwan Park, ChangSikOh
S1-P5 Transcriptomic analysis of Nicotiana benthamiana responses to two HR eliciting protein: Hpa1
and SSB from Xanthomonas oryzae
Wenxiu Ma, Yujing Sun, Lifang Zou, Gongyou Chen
S1-P6 Investigating the genetic diversity of Pantoea ananatis
19
G Shin, T A Coutinho, S N Venter
S1-P7 Identification and characterization of the Dickeya sp. causing banana (Musa paradisiaca) soft rot
disease in China
Guofen Wang, Lijia Guo, Lei Liu，Yinhua Chen, Junsheng Huang
S1-P8 Comparative genomics of plant-associated pathogenic Herbaspirillum rubrisubalbicans and
beneficial H. seropedicae bacteria
Mingyue Chen, Shuting Ye, Bo Zhu, Qianli An
S1-P9 Influence of agroecology, altitude and geographic positions on the occurrence and intensity of
Citrus Canker (Xanthomonas axonopodis pv. citri) in Ethiopia
Eshetu Derso, Girma Kassa ,Mesfin Haile
S1-P10 Recent progress and perspectives on yellow leaf disease of arecanut
Q.H. Tang, W.W. Song, H. Zhu, F.Y. Yu, X.Q. Niu, W.Q. Qin
S1-P11 Genetic Diversity of Transcriptional Activator-like Effectors genes in Chinese Isolates of
Xanthomonas oryzae pv. oryzicola
Zhiyuan Ji, Muhammad Zakria, Lifang Zou, Gongyou Chen
S1-P12 Virulence factors in Xanthomonas translucens pv. graminis: sometimes less is more
Lena Hersemann, Franco Widmer, Frank Jörg Vorhölter, Roland Kölliker
17:30 Poster Reviewing
20
Thursday, June 12
Chairs: Dr. Bing Yang, Iowa State University, USA; Dr. Shengyang He, Michigan State University, USA

8:30 CS2 TAL effectors: From pathogenesis to genome editing
Bing Yang
Keynote talks
9:00 S3-K3 Pseudomonas syringae pathogenesis in microbe-colonized and microbe-free Arabidopsis
plants
Shengyang He
Session talks
9:30 S3-O8 Resistant Reaction of Citron C-05 to the Pathogen of Citrus Canker Disease
Liping Liu, Jiawen Yan, Ziniu Deng, Dazhi Li
9:50 S3-O9 Tolerance mechanisms of potato plants against Pectobacterium carotovarum subsp brasiliense
Mosina G , Tanui C , Coutinho T, Moleleki L
10:10 S3-O10 Complete and Cost-Effective Microbe Genome Assembly by PacBio Single Molecule
Sequencing
Meiji copany
10:30 Coffee break
Chairs: Dr. Jiahua Guo, Nanjing Agricultural university, China; Dr. Carolee Bull, USDA/ARS, USA
Keynote talks
10:40 S4-K3 The essential nature of type and pathotype strains of plant pathogenic bacteria
Carolee T. Bull
Session talks
11:10 S4-O8 Characterization and phylogeny of Pseudomonas syringae pv. actinidiae strains isolated from
kiwifruit in France
Amandine Cunty, Sophie Cesbron, Rivoal Carène, Françoise Poliakoff, Marie Agnès Jacques,
Joël Vanneste, Charles Manceau
11:30 S4-O9 Consensus model to project thepotentialglobal habitat suitability of kiwifruit bacterial canker
(Psa)
HA Narouei Khandan, SP Worner, EE Jones, SLH Villjanen Rollinson, L Gallipoli, AMazzaglia, GM
Balestra
11:50 S4-O10 The multiplicity of an enterobacterial pectinolytic phytopathogen in a specific commodity: a
Pectobacterium carotovorum species complex in seed potatoes.
Johan Van Vaerenbergh, Steve Baeyen, Cinzia Van Malderghem, Paul De Vos, Martine Maes
12:10 S4-O11 Identification and characterization of Xylella fastidiosa isolated from coffee plants in France
Bruno Legendre, Stelly Mississipi, Valérie Olivier, Emmanuelle Morel, Dominique Crouzillat,
Karine Durand, Perrine Portier, Marie Agnès Jacques, Françoise Poliakoff
12:30 Lunch break
21
Chairs: Dr. Fengquan Liu, Nanjing Agricultural university, China; Dr. Ian Toth, James Hutton Institute, United Kingdom
Keynote talks
13:30 S1-K3 The impacts of bacterial genomics research on plant disease control
Ian Toth
Session talks
14:00 S1-O6 Metagenomic analysis of the bacterial exudate from Eucalyptus trees with symptoms of
bacterial wilt in China
Carstensen G.D., Venter S.N., Chen, S.F., Wingfield, M.J. and Coutinho, T. A
14:20 S1-O7 Genome-based estimation of metabolic fluxes in Xanthomonas campestris pv. Campestris
Sarah Schatschneider, Jochen Blom, Jessica Schneider, Alexander Goesmann, Alfred Pühler,
Karsten Niehaus, Frank Jörg Vorhölter
14:40 S1-O8 Whole-genome sequence analysis of Pseudomonas fuscovaginae reveals divergence among
ecotypes and provides insight into virulence mechanism to cause sheath brown rot in rice
Ian Quibod, Genelou Grande, Sylvestre Dossa, Frances Borja, Eula Oreiro, Neilyn Villa, Ramil
Mauleon,Casiana VeraCruz, Ricardo Oliva
15:00 S1-O9 Applying multi-omics approach to study host-pathogen interactions: application on rice sheath
blight reveals photosynthesis as primary affecting pathway
Lie-Bo Shu, Xiao Liu
15:20 Coffee break

Chairs: Dr. Chatterjee Subhadeep, Centre for DNA Fingerprinting and Diagnostics, India; Dr. Ching-Hong Yang,
University of Wisconsin Milwaukee, USA
Keynote talks
15:40 S2-K3 Small things, big Impact: Regulation of virulence factors by c-di-GMP and regulatory small
RNA in a bacterial pathogen
Ching-Hong Yang
Session talks
16:10 S2-O7 Role of a chemotaxis sensor, XCC0324, in the leaf ingress of Xanthomonas campestris pv.
Campestris
Arnaud Indiana, Armelle Darrasse, Martial Briand, Marie-Noëlle Brisset, Jacky Guillaumes,
Céline Rousseau, Laurent Noël, and Marie-Agnès Jacques
16:30 S2-O8 Cyclic nucleotide signalling and the regulation of virulence in the phytopathogen
Xanthomonas campestris
ShiqiAn, Robert P. Ryan
16:50 S2-O9 Coordination of virulence traits in Xanthomonas: a common motif with dual role
Rai R, Pradhan BB, Samal B, Kakar A, Kondareddy A, Chatterjee S
17:10 S2-O10 Functional characterization of the sigma factors in Xanthomonas campestris pv. campestris
Li-Yan Yang, Lin Wang, Li-Chao Yang, Le Zhou, Yong-Liang Gan, and Bo-Le Jiang
22
Friday, June 13
Chairs: Dr. Yawen He, Shanghai Jiao Tong University, China; Dr. Steven E Lindow, University of California, Berkeley,
USA
8:30 CS3 The many cell density-dependent behaviors of Xylella fastidiosa: Achieving disease control via
pathogen confusion
Steven E. Lindow
Session talks
9:00 S4-O12 Isolation and genetic and morphological characterization of a new soil-borne, broad host lytic
bacteriophage D5 infecting Dickeya spp.
Robert Czajkowski, Zofia Ozymko, Ewa Lojkowska
9:20 S4-O13 Genetic diversity of plant pathogenic Streptomyces spp.
MI Lapaz, MI Siri, JC Huguet Tapia, R Loria, MJ Pianzzola
9:40 S4-O14 A revised circumscription of the Ralstonia solanacearum species complex based on polyphasic
taxonomy analysis
Irda Safni, Ilse Cleenwerck, Paul De Vos, Mark Fegan, Lindsay Sly, Ulrike Kappler
10:00 S4-O15 Influence of primary inoculum on Huanglongbing spread in managed citrus areas
Ferreira RV, Paiva PEB, Yamamoto PT, Bergamin Filho A, Wulff NA, Belasque J
10:30 Coffee break

Chairs: Dr. Jean Martin van der Wolf, Plant Research International, Netherlands; Dr. Jiliang Tang, Guangxi University,
China
Keynote talks
10:40 S1-K4 Construction of an entire mutant library and its use to identify comprehensively virulence
determinants of the plant pathogen Xanthomonas campestris pathovar campestris
Jiliang Tang
Session talks
11:10 S1-O10 Diversity of Dickeya and Pectobacterium spp. in potato in the Netherlands
JM van der Wolf, BH de Haas, MK rijger, EH Nijhuis, PS van der Zouwen, O Mendes, P Kastelein, L
Nunes Leite, EG de Haan
11:30 S1-O11 Genome-wide identification of small non-coding RNAs related with quorum sensing and virulence
in Xanthomonas axonopodis pv. manihotis using directed transcriptomics
Bernal Galeano Vivian, Rodríguez Andrés, Perlaza Laura, Restrepo Mariana, Bernal Adriana
11:50 S1-O12 Comparative genomics of Pantoeastewartii subspecies and development of a TaqManReal-Time
PCR assay for specific detection of P. stewartii subsp. stewartii
JT Tambong, Z Adam, CT Lewis, CA Lévesque, W Chen, IU Khan, ESP Bromfield, R Xu
12:10 S1-O13 Genomics and bacterial interactions of soft rot pathogen Dickeya solani
Linda Garlant, Ying Liu, Johanna Nykyri, Minna Pirhonen
12:30 Lunch break
23
Chairs: Dr. Wei Qian, Institute of Microbiology, CAS, China; Dr. Caitilyn Allen, University of Wisconsin-Madison, USA
Keynote talks
13:30 S2-K4 The Battle of the Rhizosphere: How Ralstonia solanacearum defeats competitors and
overcomes plant defenses to invade host roots
Caitilyn Allena
Session talks
14:00 S2-O11 PhoP-PhoQ is an Essential Two-Component Signal Transduction System in Xanthomonas
campestris pv. campestris 8004
Baoyu Peng, Xiaoying Chen, Rongxiang Fang, Wei Qian
14:20 S2-O12 The C-terminal extension of PrhGimpairsits activation on hrp expression and pathogenicity in
Ralstonia solanacearum
Yong Zhang, AkinoriKiba, YasufumiHikichi,KouheiOhnishi
14:40 S2-O13 Regulation of motility-mediated virulence in Pseudomonas syringae pv. tabaci 6605
Yuki Ichinose, Fumiko Taguchi
15:00 S2-O14 Plant antimicrobial phenolics: arms in the battle against Pectobacterium carotovorum
Iris Yedidia, J. R. Joshi, T. LuzzattoKnaan, S. Yariv, Z. Kerem
15:20 Coffee break

Chairs: Dr. Casiana Vera Cruz, International Rice Research Institute, Philippines; Dr. Tsutomu Kawasaki, Kinki
University, Japan
Keynote talks
15:40 S3-K4 Biological function of Xanthomonas effectors in suppression of plant immunity
Tsutomu Kawasaki
Session talks
16:10 S3-O11 Insights into the molecular interactions between Clavibacter michiganensis subsp. michiganensis
and tomato
Shulamit Manulis-Sasson, Laura Chalupowicz, Karl.-Heinz Gartemann, Guido Sessa, Isaac Barash
16:30 S3-O12 Dynamics of defense responses and cell fate change during Arabidopsis-Pseudomonas syringae
interactions
SafaeHamdoun, ZheLiu, ManroopGill, Nan Yao, Hua Lu
16:50 S3-O13 Climate changes and rice bacterial blight: an approach to enhance rice tolerance to abiotic and
biotic stresses
Gerbert Sylvestre C. Dossa, Amelia Henry, Rolando Torres, Arvind Kumar, Ricardo Oliva, Edgar
Maiss, Kerstin Wydra, Casiana M. Vera Cruz
17:10 S3-O14 The differentential responses of potato cultivars to tuber inoculum of Candidatus Liberibacter
solanacearum and their epidemiological significance
Pitman AR, Thompson S, Butler R, Taylor N, Wright P, Shah F, Berry N, Read S, Dohmen Vereijssen
J, Walker M, Beard S, Jorgensen N
24
ICPPB2014 Abstracts
CS1 38 years phytobacteriology - in retrospect large input of expertise from of the University of
and perspectives and challenges for its/the California, Berkeley, USA was organised at and with the
future Mediterranean Agronomic Institute of Bari (MAIB),
Italy in 2010. The pathogen was detected and identity
Jacob Dirk Jansea*
a confirmed in 2013/14 in Southern Italy from olive,
Dept of Laboratory Methods and Diagnostics, Dutch
Nerium oleander and almond and insect vectors. Some
General Inspection Service (NAK), PO Box 1115, 8300
other emerging diseases will be presented such as
BC Emmeloord, The Netherlands
‘Candidatus Liberibacter’ spp of citrus and potato/carrot,
jjanse@nak.nl
Xanthomonas citri pv. citri of citrus, Acidovorax citrulli
In this presentation an overview is given of c. 38 years in cucurbits, P.s pv. actinidiae in yellow and green
activity in the field of phytobacteriology. Some new kiwifruit and X. campestris (vasicola) pv. musacearum in
pathogens, diseases and hosts or occurrence in new Musaceae. Perspectives for phytobacteriology are the
geographic areas are indicated. It will be stressed that a developments in regional PPO’s such as EPPO, that
polyphasic approach treating a pathogenic bacterium as a create/support databases (datasheets) and reference
whole (competitive) organism using its DNA/RNA will collections, quarantine and alert lists, diagnostic
give best results for its detection and most ‘real’ protocols and quality standards, pest risk analysis and
classifications as shown for Dickeya spp. These species further the development of fast, cheap and reliable (deep)
will be used to highlight the role of cultural measures in sequencing methods. A main challenge for the future of
control and the sometimes false impression that we phytobacteriology is the loss of ‘green bacteriologists
detect new pathogens when using low taxonomic level with practical field knowledge in high speed, a
discriminating molecular methods. The successful perspective is the recognition by universities of that
functional eradication in the Netherlands of bacterial threatening gap and adaptation of their education
brown rot and ring rot and for brown rot also in Egypt, program.
offering possibilities of similar control in other areas of
CS2 TAL effectors: From pathogenesis to
the world will be highlighted. The importance of
genome editing
surface/irrigation water for the spread of bacterial
pathogens, such as R. solanacearum will be explained, Bing Yang*
furthermore the role of wild hosts and the production of Dept. of Genetics, Development and Cell Biology, Iowa
ornamentals in developing countries. Best ways of State University, USA
prevention and control of bacterial diseases as observed byang@iastate.edu
over the years will be indicated, which include important
factors such as: planting material; (introduction of) TAL (transcription activator-like) effectors of
vectors; travellers (pilgrims, military, tourists, collectors); Xanthomonasoryzae pv. oryzae determine the outcome
wild and ornamental hosts; pro-active training; of bacterial blight of rice by directly activating of the
compensation/insurance; correct and fast diagnosis as a disease-associated host genes. A prominent example is a
core in the control; climatic conditions; resistance group of TAL effectors of major virulence induce a
(breeding) . The sense and nonsense of select agent lists sub-clade of SWEET genes to promoter disease
will be addressed. The principle of pathway protection susceptibility through recognition of the cognate
will be elaborated: regulatory systems ensuring promoter element, so called EBE (effector binding
importation of plant material free of all quarantine and element). The nonresponsive EBE variants of the disease
regulated non-quarantine pests and practically free of susceptibility (S) genes, for example, the recessive
non-regulated pests. The place of production should have resistance gene xa13, confer rice cultivars resistance (or
integrated pest management practices: pre-export loss of susceptibility). The TAL/EBE recognition is
treatments, clean growing media associated with plants, mediated by a simple cipher, -i.e. one of the central
waste management, availability of expertise diagnostic near-identical 34 amino acid repeats of TAL effector
services, inspections at growing sites, clean packing recognizes one base of the target DNA sequence in a
practices. (Im)possibilities of sampling and testing in the sequential order. On the other hand, the TAL recognition
control of diseases will be addressed as well. Work in cipher can be exploited to engineer artificial TAL
international projects in harmonization and networking, effectors or DNA binding domains that specifically bind
facilitating trade and production, will be mentioned from to the preselected target DNA sequences. TALENs (TAL
Eastern Europe, Middle East and Africa. The importance effector nucleases) are fusion proteins of TAL effectors
of a proactive attitude towards emerging pathogens to and the DNA cleavage domain of FokI nuclease.
prevent them from entering or eradicating them in a very TALENs, as a powerful genetic toolkit, are capable of
early stage of occurrence will be exemplified with inducing site-specific chromosomal DNA double-strand
Xylella fastidiosa and ‘Candidatus Liberibacter’ species breaks (DBSs) that lead to efficient introduction of
of citrus. In the EU COST 873 project ‘Bacterial diseases sequence modifications or insertions through homology
of stone fruits and nuts’ a first European hands-on recombination or mutagenic insertions/deletions through
training workshop on diagnosis of X. fastidiosa with nonhomologous end-joining. We exploit TALEN
technology to edit the specific rice genes to thwart the
25
ICPPB2014 Abstracts
virulence strategy of Xanthomonasoryzae and, thereby, transgenic plants, resulting in high levels of disease
engineer heritable genome modifications for resistance to resistance.X. fastidiosa is also capable of producing large
bacterial blight. Multiple designer TALENs are numbers of outer membrane vesicles. The production
custom-engineered to precisely edit the TAL effector and release of the vesicles is suppressed by the
binding elements within the promoters of the S genes accumulation of DSF, with wild type strains releasing
targeted by three native TAL effectors of essential less than 10% as many vesicles as rpfF mutants
virulence of pathogen. The resulting promoter incapable of DSF production. These membranous
modifications in transgenic plants result in loss of vesicles strongly inhibit attachment of cells of X.
inducibility of disease gene by the cognate TAL effectors fastidiosa to xylem vessels; the number of cells of X.
and concomitantly loss of disease susceptibility (or gain fastidiosa attached to xylem vessels incubated with
of resistance) to pathogen. The TALEN gene constructs vesicles is less than 5% that of cells incubated in the
can be genetically segregated out in some modified absence of such vesicles. The movement of X.
plants. The results demonstrate the feasibility of using fastidiosa, which occurs preferentially in vesicles
TALENs for targeted editing of important genes for crop harboring relatively low numbers of cells of X. fastidiosa,
improvement and also raise the prospect of producing and which thus experience relatively low levels of DSF
genetically modified plants without a trace of “foreign” is thus facilitated by the release of membranous vesicles
DNA left in the genome. that bind to pit membranes and other sites that cells of
the pathogen itself would otherwise bind, thus
CS3 Cell density-dependent behaviors of facilitating its movement through the plant.
Xylella fastidiosa: achieving disease control via
pathogen confusion S1-K1 Expanding the framework of plant –
pathogen co-evolution beyond the current PTI –
Steven E. Lindow*, CleliaBaccari, Michael Ionescu ETI arms race paradigm
Department of Plant and Microbial Biology, University
of California, Berkeley, California 94720, USA Boris A. Vinatzera*, Christopher R. Clarkea, Caroline L.
icelab@berkeley.edu Monteilb
a
The bacterium Xylella fastidiosa causes Pierces disease Department of Plant Pathology, Physiology, and Weed
of grape and other important diseases of citrus, almond Science, Virginia Tech, Latham Hall room 551,
and other crops by progressively moving to and Blacksburg, USA.
b
multiplying in many xylem vessels after inoculation by INRA, UR0407 Pathologie Végétale, 84143 Montfavet
xylem-feeding insect vectors. While most xylem vessels cedex, France
harbor only small numbers of the pathogen, blockage of vinatzer@vt.edu
some vessels occurs and is associated with disease, The simplicity of the current model of plant - pathogen
apparently by restricting water flow. X. fastidiosa co-evolution is extremely attractive. No student seminar
exhibits strong cell density-dependent behaviors that and no invited talk in the field of molecular plant –
tend to self-limit its population size in plants, presumably microbe interactions is without a slide explaining how
to avoid the cell death that is associated with the first there were microbe-associated molecular patterns
plugging of vessels due to bacterial over-growth. X. (PAMPs), then came plant PAMP-receptors that elicit
fastidiosa employs a quorum sensing system that utilizes PAMP-triggered immunity (PTI), then bacteria invented
fatty acid signal molecules (DSF) including type III secreted effectors to suppress PTI, and - finally -
2-Z-tetradecenoic acid that increase in local plants evolved resistance genes to recognize effectors
concentration in proportion to cell numbers in a vessel to and respond with effector-triggered immunity (ETI).
suppress the production of type IV pili enabling Additionally, effector genes and resistance genes are
twitching motility and extracellular enzymes such as hypothesized to co-evolve in a molecular arms race
pectinases and that enable transit between xylem vessels whereby bacteria try to escape recognition by resistance
and also contribute to cell multiplication by liberating genes mutating, acquiring, and losing effectors and
consumable carbon sources, while enhancing expression plants react evolving new resistance genes. In this talk I
fimbrial and afimbrial adhesins that restrict movement expand the current PTI-ETI arms race model to include 1.
within the plant, but which are required for acquisition allelic diversification of PAMPs and PAMP receptors, 2.
byinsect vectors, and hence transmission to new hosts by molecular aspects of plant – bacteria interactions that are
such vectors. The population of cells in a plant is thus independent of either PTI or ETI, 3. differences in plant
physically partitioned based on their local cell density – pathogen co-evolution before and after the advent of
between those capable of plant colonization and those agriculture, 4. facets of evolution and ecology of plant
capable of transmission by sap-sucking insect vectors. pathogenic bacteria that go beyond molecular
Expression of rpfF from X. fastidiosa encoding a DSF plant-microbe interactions.
synthase in grape results in accumulation of DSF within
the xylem of transgenic plants, causing the pathogen to
exhibit a restricted movement phenotype in such
26
ICPPB2014 Abstracts
S1-K2 Identification of virulence and defense AvrPtoB, as well as genes specific to ETI and PTI are
components determining the outcome the Pto being characterized in tomato by transcriptome
DC3000-tomato interaction sequencing. Gene silencing in N. benthamiana is
revealing kinase families involved in defense and in the
Magdalen Lindeberga*, Alan Collmera, Gregory B. Martinb,
case of the FIRE genes, a cell wall-associated kinase
Christine Smartc, Boris Vinatzerd
a
(SlWAK1)linked to suppression of pathogen growth and
Department of Plant Pathology and Plant-Microbe virulence[2]. Ongoing work is focused on deciphering the
Biology, Cornell University, Ithaca NY, USA WAK1-dependent signaling pathwaysand the nature
b
Boyce Thompson Institute for Plant Research, Ithaca ofthe WAK1 elicitors. Variation in response to flgII-28,
NY, USA cold shock protein, and variants of AvrPto has been
c
Department of Plant Pathology and Plant-Microbe observed among cultivated and wild tomato accessions.
Biology,Cornell University, Geneva, NY, USA Sequencing of segregating populations is facilitating
d
Department of Plant Pathology, Physiology and Weed rapid progress toward identification of the genetic factors
Sciences,Virginia Tech, Blacksburg, VA, USA responsible for differential host responses. This
ML16@cornell.edu approach is also being used to identify sources of
Characterization of factors determining the outcome of resistance to Pto T1 vs. NYS-T1.
the Pto DC3000-tomato interaction is a long-standing Acknowledgement: This work is supported by NSF
goal, though redundanciesin Type III effector (T3E) Plant Genome Research Program Grant DBI-0605059.
functionsand defense signaling pathways have presented
a significant barrier to identification ofspecific system References:
components. Several new tools and strategies are [1]Z. Bao, P.V. Stodghill, C.R. Myers, et al. (2014).
facilitating progress, including the creation of Pto PLoS One, 9, e86628.
DC3000 mutants deleted for all T3E genes and recently [2]H.G. Rosli, Y. Zheng, M.A. Pombo, et al. (2013).
confirmed by genome sequencing [1]. These mutants are Genome Biol, 14,R139.
being used to evaluate the contributions of specified sets
of T3Esto PTI suppression and ETI elicitation and to S1-K3 The impacts of bacterial genomics
identify functionalredundancies and minimal T3E research on plant disease control
repertoires required for virulence on different hosts. Ian Totha, Leighton Pritchardb, Sonia Humphrisa, Emma
Hypotheses are informed by comparisonsamong 11 Campbella
genome sequences for P. syringae Group I strains a
Cell and Molecular Sciences, James Hutton Institute,
pathogenic on tomato and/or brassica species. Different Invergowrie, DD2 5DA, Dundee, UK.
sets of T3E genes are found to be specific to the T1-like b
Information and Computational Sciences, James Hutton
subgroup pathogenic on tomato and to members of the Institute, Invergowrie, DD2 5DA, Dundee, UK.
DC3000/Pma sub-group pathogenic on both tomato and ian.toth@hutton.ac.uk
brassica species, indicative of different strategies for
achieving virulence on tomato. The T3E set conserved In the year 2000 Xylella fastidiosa became the first plant
in the latter subgroup is significantly larger than that pathogenic bacterium to be fully sequenced. 14 years
conserved in the former, suggesting that genes required later there are now many hundreds of fully or partially
for virulence on one or both hosts may elicit ETI in sequenced plant pathogenic bacteria available for study.
tomato, requiring additional T3Es for ETI During this time period it is clear that these genome
suppression.Genome-wide OrthoMCLanalysisfurther sequences have led to a plethora of new insights into the
supports correlation of host range with T3Esand select biology of pathogens and their interaction with plants.
members of the non-T3E hrpLregulon. One of the 11 However, it is less clear what impact they have made to
Pto strains usedfor genome comparison is a highly more practical aspects of disease control. Has crop
virulent strain in the T1 subgroup (NYS-T1) isolated production truly benefitted from the genomics era? This
from tomato in upstate New York and sequenced presentation will address this question using examples on
primarily for development of diagnostic tools. NYS-T1 Pectobacterium from our own research as well as
is more virulent on tomato than other T1-like strains and examples from others.
overcomes resistance in wild tomato species. No single
genome difference has been identified as the source ofits S1-K4 Construction of an entire mutant library
highvirulence, though the specific combination of PAMP and its use to identify comprehensively
elicitor sequences and virulence factors in NYS-T1 is not virulence determinants of the plant pathogen
shared by other sequenced members in the T1-like Xanthomonas campestris pathovar campestris
subgroup.Progress in deciphering hostdefense pathways Jiliang Tang*, BL Jiang, W Jiang, YQ He, GT Lu, DJ Tang
is facilitated by availability of genome sequences for State Key Laboratory for Conservation and Utilization of
tomato, Nicotianabenthamiana, and an increasing Subtropical Ago-bioresources, Guangxi University,
number of heirloom and wild tomato accessions. FIRE Nanning, Guangxi 530004, China
genes, induced by flgII-28 and suppressed by AvrPto and jltang@gxu.edu.cn
27
ICPPB2014 Abstracts
The gram-negative bacterium Xanthomonas campestris four phylotypes. Comparative analysis of 29 whole
pv. campestris (Xcc) is the causal agent of black rot of genomes by Maximal Unique Matches index (MUMi)
crucifers and has been used as a model bacterium for [1,2,3] and the use of protein profiling on a larger set of
studying the molecular mechanisms of pathogen-plant bacterial strains by Matrix-Assisted Laser
interactions. The genome sequences of several Xcc Desorption/Ionization-Time of Flight Mass Spectrometry
strains including strain 8004 have been determined and a (MALDI-TOF-MS) [4,5], both indicate that the diversity
number of genes involved in pathogenicity have been within this group warrants division into three species.
identified randomly. However, the total number of genes We therefore propose two new species consistent with
associated with the pathogenesis of Xcc remains to be genomic and proteomic data as well as biological
definite. We initiated a project to identify
differences: Ralstonia sequeirae sp. nov. (se.que.i’ra.e.
comprehensively virulence determinants ofXcc by
N.L. masc. gen. n. sequeirae, of Sequeira, named after
construction of an entire mutant library. We employed
Luis Sequeira), corresponding to phylotype I strains
random transposon-insertionalmutagenesis and
site-directed mutagenesisapproaches to create the mutant (from Asia) and phylotype III strains (from Africa), with
library. Initially, mutants were generated by random the type strain GMI1000T (=CFPB705T =ATCC
transposon-insertionalmutagenesisofXccwild-type strain BAA-1114 T); and Ralstonia syzygii, corresponding to
8004, which contains 4,273 predicted ORFs. About 20 phylotype IV (from Indonesia and Japan). Based on
thousands of mutants were collected and exposed to differences in pathological phenotype, R. syzygii is
insertion-site determination by TAIL-PCRand further divided into three subspecies. The broad
sequencing analyses of the DNA sequences adjacent to host-range soilborne strains should be renamed R. syzygii
transposon insertion sites. Mutants of 2,438 ORFs were subspecies haywardii subsp. nov. (hay.war’di.i. N.L.
obtained. The remainingunmutated ORFs except 27 masc. gen. n. haywardii, of Hayward, named after A.
encoding transposase were submitted to site-directed Christopher Hayward) with the type strain PSI07T
mutagenesis. 1,351of them were successfullymutated. (=CFBP7288T). The unclassified banana Blood Disease
Collected all the mutants obtained, a total of 3,789 Bacterium is proposed R. syzygii subspecies celebensis
individual ORFs (88.7% of the whole predicted subsp. nov., proposed type strain R229T (=CFBP3568T
ORFs)were mutated and 484 were not, which include the =NCPPB3726T). The former R. syzygii, which causes
27 transposase-coding ones.To identify genes required Sumatra disease of cloves, is proposed as R. syzygii
for virulence of Xcc, mutants were individually tested on subspecies syzygii subsp. nov., type strain R001T
the host plant Chinese radish by leaf clipping method. (=NCPPB3446T =LMG10661T). Phylotype II strains
Lengths of lesions in radish leaves caused by mutants (from the Americas), which include the species type
and wild type were compared. In total, 523 mutants strain K60T (=ATCC11696T =LMG2299T), will remain in
displayed significantly reduced lesion lengths compared R. solanacearum.
to the wild type (P = 0.05 by t test). Some of the mutants
lost virulence completely. The functions of these Acknowledgement: We are grateful to A. Michault from
virulence-related genes were analysis. CHU de La Réunion Groupe Hospitalier Sud Réunion,
which generously shared MALDI-TOF-MS instrument
S1-O1 Division of the plant pathogen Ralstonia
(Bruker DaltonicsTM, Wissembourg, France) for bacterial
solanacearum into three species:
species differentiation. Borja Sánchez has received the
R. solanacearum, R. sequeirae sp. nov., and R.
support of Inra and the European Union, in the
syzygii
framework of the Marie-Curie FP7 COFUND People
Caitilyn Allena, Benoît Remenantab, Beth Dalsinga, Borja
Programme, through the award of an AgreenSkills’
Sanchezbde, Florent Ailloudbc, and Philippe Priorbd
fellowship (under grant agreement n° 267196).
a
Department of Plant Pathology, University of
References:
Wisconsin-Madison, 1630 Linden Drive, Madison, WI,
[1] M. Deloger, M. E. Karoui, M.-A. Petit. 2009. J.
USA.
b Bacteriol. 191:91-99.
UMR Peuplements Végétaux et Bioagresseurs en
[2] M. Richter, R. Rossello-Mora. 2009. Proc Natl Acad
Milieu Tropical, CIRAD, Saint Pierre, La Réunion,
Sci USA 106:19126-19131.
France.
c [3] J. Chun, F. A. Rainey. 2014. IJSEM 64:316–324.
Anses – Plant Health Laboratory (LSV), 7 chemin de
[4] S. Sauer, A. Freiwald, T. Maier, M. Kube, R.
l'IRAT, Saint-Pierre, La Réunion,, France
d Reinhartdt. 2008. PLoS One 3:e2843
Department of Plant Health and Environment (SPE),
[5] A. Melmann, T. Cloud J. Maier, U. Keckevoet, I.
Inra, France.
e Ramminger. 2008. J. Clin. Microbiol. 46:1946.
Department of Analytical and Food Chemistry,
University of Vigo,Ourense, Spain.
philippe.prior@cirad.fr
The Ralstonia solanacearum group, which causes
bacterial wilt diseases of many plants, has been described
as a highly heterogeneous species complex composed of
28
ICPPB2014 Abstracts
S1-O2 The whole genome sequence of 80 draft genomes will be presented. Genomic
Pseudomonas syringaepv. actinidiae: insights comparisons show a dynamic genome with evidence of
into evolution, genome dynamics and positive selection on type III effectors and other
pathogenicity candidate virulence genes. Each clade has highly varied
complements of accessory genes encoding effectors and
HonourMcCanna, Erik HA Rikkerinkb, Frederic Bertelsc, Elena
toxins with evidence of gain and loss via multiple genetic
Colombia, Ashley Lud, Bernhard Haubolde,Christina Strauba,
routes.
Paul BRaineya,e, Matthew DTempletonb,f*
a
New Zealand Institute for Advanced Study and Allan Acknowledgement: We thanks Ross Crowhurstfor
Wilson Centre, Massey University, Auckland, New optimizing genome assemblies, Mike Manning, Canhong
Zealand Cheng (PFR); Zhuang Qiguo,SPANRS, Chengdu;Ming
b
The New Zealand Institute for Plant & Food Research Xie,Zhejiang Academy of Agriculture and Science,
Limited, Auckland, New Zealand Hangzhou;Prof. Yunfeng Wu,Northwest A & F
c
Biozentrum, University of Basel and Swiss Institute of University, Xi’an;Li Liand Prof Hongwen Huang Wuhan
Bioinformatics, Basel, Switzerland Institute of Botany, Wuhan for collecting and providing
d
The New Zealand Institute for Plant & Food Research Psa isolates.
Limited, Lincoln, New Zealand
e
Max Planck Institute for Evolutionary Biology, Plön, References:
Germany [1]E.H.Stukenbrock, T.Bataillon (2012).PloSPathog 8.
f
School of Biological Sciences, University of Auckland, [2]E.H.Stukenbrock, T.Bataillon, J.Y.Dutheil, T.T.Hansen,
Auckland, New Zealand. R.Q.Li, et al. (2011).Genome Research, 21: 2157.
m.templeton@auckland.ac.nz [3]H.C.McCann, E.H.A.Rikkerink, F.Bertels, M.Fiers,
A.Lu, J.Rees-George, M.T.Andersen, A.P.Gleave,
It has been proposed that modern daydiseases of B.Haubold, M.W.Wohlers, D.S.Guttman, P.W.Wang,
domesticated crops evolved from pathogens of wild C.Straub, J.L.Vanneste, P.B.Rainey, M.D.Templeton
ancestors of those plants [1-2]. Since most crops were (2013).PLoSPathog, 9(7): e1003503.
domesticated centuries, even millennia ago, the
opportunity to understand the emergence of disease is S1-O3 RNA-Seq-Based global transcriptomic
limited. Kiwifruit(Actinidia spp.) which has its centre of analysis ofrice pathogen Acidovorax avenae
origin in central China, is an exception. Domestication subsp. avenae under in vitro, in vivo and rice
of this plant began in the 1930s with commercial rhizobacteriumBurkholderia seminalis coculutre
plantings of Actinidiadeliciosa ‘Hayward’, followed by condition
release of several A. chinensis cultivars, most notably Bin Li*, Muhammad Ibrahim, Zhouqi Cui, Mengyu Ge,
‘Hort16A’ in the 1990s. Pseudomonas syringaepv. Guanlin Xie
actinidiae (Psa) caused two outbreaks of canker disease State Key Laboratory of Rice Biology, Institute of
in Japan and Korea in the mid 1980s and 1990s Biotechnology, Zhejiang University, 310058, Hangzhou,
respectively.However these disease outbreaks did not China
spread from their country of origin. In 2008 a libin0571@zju.edu.cn
particularly virulent strain of Psa was reported in Italy
and it quickly decimated plantings of A. chinensis. Determining how a bacterial pathogen responds to its
Furthermore the disease spread rapidly to other kiwifruit host and other bacterial speciesby altering gene
growing regions around the world such as New Zealand expression is key to understand its pathogenesis and
and Chile, in addition the disease was reported to have environmental adaption. Here, we used RNA-seq to
been found in China. Based on SNP analyses of two comprehensively and quantitatively assess the
circularized and 30 draft genomes, Psa was shown to be transcriptional response of the rice bacterial pathogen,
comprised of four distinct clades exhibiting negligible Acidovorax avenae subsp. avenae strain RS-1, under in
within-clade diversity[3]. Three of the clades vitro medium, in vivorice planta and coculutre with rice
correspond to their geographical source of isolation, rhizobacteriumBurkholderia seminalis R456
while the fourth encompasses the lineage responsible for conditions.In general, results from this study revealed a
the 2008 outbreak, which is now globally distributed.Psa surprisingly large number of regulatory differences
has an overall clonal population structure, however between the above mentioned three conditions,
genomes carry a marked signature of within-pathovar indicatingthe adaptation of A. avenae subsp. avenae to
recombination. These data areconsistent with disease the specific ecological condition. In particular, a number
arising byindependent samplings from a source of potential virulence factors like type 3 secretion system
population. Recent efforts have focused on identifying protiens were expressed under in vivo conditions,
this source population. To this end we have collected a whereas genes whose protein products are involved in
further 16 strains from several growing regions in China inter-bacterial interaction like Auxin efflux carrier,
and sequenced more isolates from Italy and New Zealand. Mechanosensitive ion channel MscS, and
Phylogenetic analyses of the core genome from now over Ureidoglycolate hydrolase were among those induced
29
ICPPB2014 Abstracts
under coculture conditions. Inaddition, global genomic from57Pseudomonas genomes, 26 from pseudomonads
analysis of strain RS-1 identified 406 putative isolated from kiwifruit orchardsand 31 from other hosts
non-coding (nc)RNA genes. Interestingly, 8 ncRNA or environments, divided the strains into two clades.
genes that were uniquely expressed under in vivo may be Clade I clusteredTypestrains of pathogenic P.
linked to bacterial pathogenicty to rice while 4 ncRNA syringaefrom various hosts,as well as strains from
genes that were uniquely expressed under coculture kiwifruit orchards that could cause disease lesions on
conditions may play an important role in bacterial kiwifruit. Clade II clustered strainsofP fluorescens andP
adaption to other bacterial species. Overall, this putidathat were unable to elicit disease when inoculated
studygive a global information bacterial pathogen adapt ontokiwifruit,indicating non-pathogenicity.Twenty-seven
to the coculture environment and host environment by loci wereidentified that differentiate pathogenic strains
altering their patterns of gene expression. from non-pathogenic strains. Three genes were
optimized for development of a diagnostic to
Acknowledgement:This project was supported by differentiate the two clades. These diagnostics were
Zhejiang Provincial Natural Science Foundation of applied to the detection of pseudomonads on other
China (R13C140001),National Natural Science commodities to establish their suitability in assessing risk
Foundation of China (31371904), the Fundamental of exotic variants on imported propagative plant material
Research Funds for the Central Universities, the by biosecurity laboratories in New Zealand.
Agricultural Ministry of China (nyhyzx 201303015;
201003015; 201003066), and Key Subject Construction Acknowledgement:Authors thank to the
Program of Zhejiang for Modern Agricultural ScienceSolutions for Better Border Biosecurity (B3)
Biotechnology and Crop Disease Control funding.
(2010DS700124-KF1101; -KF1203; - KF1309).
References:
S1-O4 A genomic approach to the diagnosis of [1] K. Everett, et al. (1994). Plant Pathology,43,824-830.
pseudomonadsin kiwifruit orchards [2]H.C.McCann, et al. (2013). PLoS Pathog,9,e1003503.
[3]A. Mazzaglia, et al. (2012). PLoS ONE,7,e36518.
Sandra Visnovskya*, Ashley Lua, Kerry Everettb,
[4]G. Balestra, et al. (2013). Plant Disease,97,472-478.
ShaminiPushparajahb, Robert Taylorc, Andrew Pitmana
a
[5]C.R.Clarke, et al. (2010). Mol Plant-Microbe
The New Zealand Institute for Plant & Food Research Interact,23,198-210.
Ltd, Private Bag 4704, Christchurch 8140, New Zealand
b
The New Zealand Institute for Plant & Food Research S1-O5 Transposon mutagenesis identifies
Ltd, Private Bag 92169, Auckland 1142, New Zealand pathogenicity factors of grapevine bacterial
c
Plant Health and Environment Laboratory, Ministry for blight pathogen, Xylophilusampelinus
Primary Industries, P.O.Box 2095, Auckland 1140, New
Yolanda Petersen*
Zealand
sandra.visnovsky@plantandfood.co.nz Agricultural Research Council, Infruitec-Nietvoorbij,
Private Bag X5026, Stellenbosch 7599, South Africa.
Several Pseudomonas species are associated with peterseny@arc.agric.za
kiwifruit diseases. Pseudomonas syringae causes
blossom blight as well as bacterial canker of kiwifruit Grapevine bacterial blight, caused by the quarantine
vines[2-4]. Pseudomonas viridiflavaalso infects buds and regulated pathogenXylophilusampelinus,results in
flowers, causing moderate to severe blossom loss[1]. extensive financial losses within the table grape industry
Accordingly, the focus of research has been on these of the Western Cape Province of South Africa. This is
economically important pathogens. Yet other less attributable to the reduced yield and shortened lifespan
virulent and non-pathogenic pseudomonads also exist in of infected vines, as well as the costs associated with
kiwifruit orchards. For example, epiphytic P. syringaeand re-establishing productive vineyards. Cultural practices
P. fluorescens strains exist on leaf surfaces of kiwifruit. as well as environmental conditions appear to play
Little is known about the pathogenicity or aggressiveness important roles in the expression and severity of disease
of these less-studied pseudomonads and the risk they symptoms, with latent infection of vines not an
pose to production. uncommon phenomenon. Despite the economic impact
of the disease, very little is known about the genetics of
A genomics approach has been taken to understand the X. ampelinus.One of the approaches we have taken to
diversity of pseudomonads on economically important shed light on genetic factors that contribute to the
crops, using kiwifruit as a model system. The pathogenicity of this bacterium, is the application of
pathogenicity of isolates was also defined on random invivo transposon (Tn) mutagenesis using the
Actinidiadeliciosa‘Hayward’ andA. chinensis‘Hort16A’. EzTn5 transposome system (Epicentre). This system
Using these data, diagnostic protocols were developed to facilitated not only the identification of genes via
target loci that differentiate between pathogenic and sequencing of insertion sites, but also the assessment of
non-pathogenic pseudomonads on this commodity. the ability of selected mutants with single Tn insertions
to cause disease in the susceptible grapevine cultivar,
Genome-based phylogenies using 674 ‘core’ genes
30
ICPPB2014 Abstracts
Red Globe. Thus far, 27% of the mutants inoculated of these isolates were confirmed to be R. solanacearum,
caused symptom development that differed from the wild 24 were identified as Enterobacter spp. while the
type. In one of the mutants causing less severe symptoms, remaining isolates included the genera Klebsiella,
the Tn insertion was located in an open reading frame Burkholderia, Pseudomonas, Pantoea and Lysinibacillus.
with no significant homology to NCBI data entries. The results obtained from the 16S rRNA metagenomic
However, further sequencing of the region surrounding study differed between trees. Enterobacter spp. were the
the insertion site identified one of the most important most abundant in the samples from healthy trees that also
virulence factors in Gram negative bacteria, namely, a included R. solanacearum as well as Burkholderia,
hrp gene cluster encoding Type III secretion system Salinospora , Erwinia, Pseudomonas , Clostidium,
(T3SS) components. Targeted in vitroTn mutagenesis of Cupriavidis and Brenneria. Both Enterobacter spp. and
individual core hrpgenes (hrcJ, hrcN, HrcT, hrcU, hrcV, R. solanacearum were present in the samples taken from
hrcQ, hrcR, hrcS and hrpX) in this cluster was carried the diseased trees but their abundance differed between
out to determine the role of the T3SS in the disease the trees. The role of thevarious bacterial species
process. The T3SS mutants showed a loss of associated with wilt symptoms on Eucalpytus spp. is
pathogenicity when inoculated in Red Globe and unknown, but it is clear that more than one bacterium is
assessed under greenhouse conditions and they also lost associated with the disease syndrome and the purported
the ability to elicit the hypersensitive response (HR) in pathogen is present in healthy trees.
the non-host, tobacco. This illustrated the requirement
for a functional T3SS to elicit disease in grapevine. This References:
research represents the first major step to understanding [1]T.A. Coutinho, J. Roux, K-H.Riedel, J. Terblanche
the strategies deployed by X. ampelinus as a pathogen of and M.J. Wingfield (2000).Forest Pathology, vol. 30,
grapevine. 205.
S1-O7 Genome-based estimation of metabolic
S1-O6 Metagenomic analysis of the bacterial fluxes in Xanthomonas campestris pv.
exudate from Eucalyptus trees with campestris
symptoms of bacterial wilt in China
Sarah Schatschneider a,b, Jochen Blom a,c, Jessica Schneider
a* a b a
Gabrielle Carstensen , Venter S.N. , Chen, S.F. , Wingfield, , Alexander Goesmann a,c, Alfred Pühler a, Karsten Niehaus a,
M.J.b and Coutinho, T.Aa Frank Jörg Vorhöltera*
a a
Department of Microbiology and Plant Pathology, CeBiTec, Universität Bielefeld, Universitätsstr. 27,
Forestry and Agricultural Biotechnology Institute (FABI), 33615 Bielefeld, Germany.
b
University of Pretoria, Pretoria 0002, South Africa. Current address: School of Pharmacy, University of
b
China Eucalypt Research Centre (CERC), Chinese Nottingham, Boots Science Building, Nottingham NG7
Academy of Forestry (CAF), ZhanJiang, 524022, 2RD, UK
c
GuangDong Province, China. Current address: Bioinformatik und Systembiologie,
gabrielle.carstensen@fabi.up.ac.za Justus-Liebig-Universität Giessen, 35392 Giessen,
Germany.
Ralstonia solanacearum is a destructive bacterial plant frank@cebitec.uni-bielefeld.de
pathogen that is distributed worldwide and is able to
infect a wide variety of plant species. Recorded hosts Proteobacteria of the genus Xanthomonas are world-wide
include Eucalyptus species that are important to forestry relevant as hazards of important crops [1]. X. campestris
industries in the tropics and sub-tropics where this pathovar campestris (Xcc) affects brassicaceae, among
pathogen is also found. Symptoms reported from them the model plant Arabidopsis thaliana, besides
bacterial wilt on Eucalyptus spp. include wilting of the being employed in biotechnology to produce the
leaves, discoloration of the xylem tissue, reduced growth polysaccharide xanthan. In the past, we have established
and tree death [1]. A bacterial exudate is typically seen genome and postgenome data for Xcc strain B100 [2,3,4]
streaming from the xylem tissue on cut surfaces of as well as bioinformatics tools to analyze [1] and integrate
[5]
diseased Eucalyptus trees. In this study, samples of this such data. On this foundation, we reconstructed the
bacterial exudate were collected from diseased Xcc metabolism [6] and revealed the enzymatic base for
Eucalyptus trees showing typical symptoms of bacterial glycolysis in this organism [7]. Systems biology tools
wilt in China. Additional samples of xylem tissue were were applied to analyze metabolic dynamics [8]. Thereby,
also collected from apparently healthy Eucalyptus trees flux balance analysis (FBA) indicated metabolic flux of
as controls. The exudates were processed using both imported glucose mainly via the Entner-Doudoroff
culture-dependent and culture-independent techniques. pathway and the citrate cycle [8]. Deeper insights into
The culture-independent method was a 16S rRNA gene metabolic processes of these pathogens may ultimately
metagenomic study using 454 pyrosequencing. The facilitate designing novel plant protective strategies.
samples from the healthy control trees were used in
culture-independent analyses only. Fifty six bacterial Acknowledgement: The project benefitted substantially
isolates were obtained from the diseased trees. Only six from technologies developed by the CeBiTec Technology
31
ICPPB2014 Abstracts
Platform Genomics headed by Jörn Kalinowski. The pathogen to colonize plant tissue.
project was mainly funded by the German Federal Comparative genomics analysis of P. fuscovaginae
Ministry of Education and Research (BMBF). ecotypes reveals structural polymorphism and high levels
of genetic diversity. We also compared the core genome
References: of P. fuscovaginae with all Pseudomonas genomes
[1]R.P. Ryan, F.J. Vorhölter, N. Potnis, J.B. Jones, reported so far and identified unique set of genes. P.
M.A.Van Sluys, A.J. Bogdanove, J.M. Dow (2011). Nat. fuscovaginaegenomeharbors clusters of
Rev. Microbiol., 9, 344. pathogenicity-related genes, several secretion systems,
[2]F.J. Vorhölter, S. Schneiker, A. Goesmann, L. Krause, toxin and a range of secondary metabolites that appear to
T. Bekel, O. Kaiser, B. Linke, T. Patschkowski, C. facilitate infectionof rice cell.Compare to other
Rückert, J. Schmid, V.K. Sidhu, V. Sieber, A. Tauch, S.A. pathogenic bacteria that causes brown rot, cell-wall
Watt, B. Weisshaar, A. Becker, K. Niehaus, A. Pühler degrading enzymes are poorly represented in the
(2008). J. Biotechnol., 134, 33. P.fuscovaginae genome. Our data will contribute to the
[3]V.K. Sidhu, F.J. Vorhölter, K. Niehaus, S.A. Watt understanding of the molecular pathogenesis and natural
(2008). BMC Microbiol., 8, 87. variation of rice bacterial sheath brown rot.
[4]J. Serrania, F.J. Vorhölter, K. Niehaus, A. Pühler, A. Transcriptome profiling of rice genes is underway and
Becker (2008). J. Biotechnol., 135, 309. will provide additional clues of pathogenicity mechanism
[5]J. Schneider, F.J. Vorhölter, E. Trost, J. Blom, Y.R. reflected on rice immune response.
Musa, H. Neuweger, K. Niehaus, S. Schatschneider, A.
Tauch, A. Goesmann (2010). Genet. Mol. Res., 9, 1660.
[6]S. Schatschneider, F.J. Vorhölter, C. Rückert, A. S1-O9 Applying multi-omics approach to study
Becker, W. Eisenreich, A. Pühler, K. Niehaus (2011). host-pathogen interactions: application on rice
Mol. Genet. Genomics, 286, 247. sheath blight reveals photosynthesis as primary
[7]M. Frese, S. Schatschneider, J. Voss, F.J. Vorhölter, K. affecting pathway
Niehaus (2014). Arch. Biochem. Biophys., 546, 53. Lie-Bo Shua, Xiao Liub
[8]S. Schatschneider, M. Persicke, S.A. Watt, G. Hublik, a
GFK Biotech (shanghai) Inc., Shanghai, P.R. China,
A. Pühler, K. Niehaus, F.J. Vorhölter (2013). J. 201112
Biotechnol., 167, 123. b
Shanghai Bo-Yuan Biological Technology Co., LTD,
S1-O8 Whole-genome sequence analysis of Shanghai, P. R. China, 102206
Pseudomonasfuscovaginae reveals divergence slb@boyuanbio.com
among ecotypes and provides insight into Host-pathogen interaction is a complex biological
virulence mechanism to cause sheath brown rot process. With multi-omics approach, we now can
in rice reconstruct comprehensive quantitative regulation model.
Ian Quiboda,c, Genelou Grandea, Sylvestre Dossaa, Frances
In this work, intergrated enrichment analysis was applied
Borjab, Eula Oreiroa, Neilyn Villac, Ramil Mauleonb,Casiana
to proteomic (iTRAQ) and metabolomic (GC-MS) data
VeraCruza, Ricardo Olivaa*
obtained after pathogen infection of 2 days, 4 days and 8
a
Plant Breeding, Genetics, and Biotechnology Division, days on pathogen sensitive and resistant rice material.
International Rice Research Institute, Los Baños, The plant pathogen interaction was observed at Day2 in
Philippines pathogen sensitive material and Day8 in pathogen
b
T.T. Chang- Genetic Resources Center, International resistance material. The enrichment result suggests the
Rice Research Institute, Los Baños, Philippines pathogen effect is positively correlated with the damage
c
University of the Philippines, Los Baños, Philippines degree on the photosynthesis. After damage in
r.oliva@irri.org photosystem I and phtosythethic electron transport via
Seed-borne and seed-transmitted pathogens, such as down regulation of PsbD and PetH, the cytosolic Ca2+
Pseudomonas fuscovaginae, cause direct economic concentration is increased due to down-regulated carbon
losses to farmers and represent an important obstacle for fixation; it leads to programmed cell death. Furthermore,
germplams exchange and quarantine measures. Although the metabolomics evidenced that oligosaccharide; polyol
the pathogen infects important crop species such as transporter and monosaccharide transporter are found
maize, sorghum, wheat, and rice, very little is known specific to pathogen resistant material and sensitive
about genomic features related to its life cycle. In this material, respectively, suggesting an alternative
study, we analyzed the whole genome sequenceof activating of ABC transporter systems in response to the
P.fuscovaginae strains isolated from rice in different pathogen. Additionally, several proteins and metabolites
parts of the worldand compare its functional annotations were selected as candidate biomarkers for
with other plant pathogenic Pseudomonas genomes. In pathogen-resistance variety filtering and breeding.
addition, we studied transcript accumulation of bacteria Acknowledgement:Thisstudy provided a comprehensive
genes during its interaction with rice and provide protein-to-metabolites network model about rice
evidence of a consorted array of mechanism used by the pathology through novel multi-omics integration
32
ICPPB2014 Abstracts
approach. It is a powerful tool to elucidate the dynamic that all (sub)species are able to cause blackleg.
activities and complex regulation in various cellular Co-inoculations of tubers with two (sub)species can
layers for better understanding of the mechanism of plant result in a decrease, but also in an increase of the
pathology. blackleg incidence in comparison to inoculations with a
single strain. The use of detection techniques in seed
Reference: testing programs for this variety of blackleg causing
[1] Weckwerth, W. & Morgenthal, K. organisms will be discussed.
(2005).Metabolomics: from pattern recognition to
biological interpretation. Drug Discov Today 10, Acknowledgement: The contribution of Henk Velvis,
1551–1558. Kees Kristelijn and Doretta Boomsma (HZPC,
[2] Morgenthal, K., Weckwerth, W. & Steuer, R. Metslawier, the Netherlands) to the field experiments is
(2006). Metabolomic networks in plants: Transitions highly appreciated.
from pattern recognition to biological interpretation.
Biosytems 82, 108–117. S1-O11 Genome-wide identification of small
[3] Morgenthal, K., Wienkoop, S., Wolschin, F. & non-coding RNAs related with quorum sensing
Weckwerth, W. (2007).Integrative profiling of andvirulence in Xanthomonas axonopodis pv.
metabolites and proteins: improving pattern recognition manihotis using directed transcriptomics
and biomarker selection for systems level Bernal Galeano Vivian*, Rodríguez Andrés, Perlaza Laura,
approaches.Methods Mol Biol 358, 57–75. Restrepo Mariana, Bernal Adriana
[4] Wienkoop, S., Morgenthal, K., Wolschin, F., Department of Biological Sciences, Universidad de los
Scholz, M., Selbig, J. & Weckwerth, W. (2008). Andes, Cr. 1 No. 18a-12, Bogotá D.C., Colombia
Integration of metabolomic and proteomic phenotypes. va.bernal35@uniandes.edu.co
Mol Cell Proteomics 7, 1725–1736.
[5] Leˆ Cao, K. A., Martin, P. B., Robert-Granie´ , C. Small noncoding RNAs (sRNA) are widely distributed
& Besse, P. (2009). Sparse canonical methods for through all domains of life [1]. Bacterial sRNAs generally
biological data integration: application to a range between 50 and 500 nucleotides (nt) in length and
cross-platform study. BMC Bioinformatics 10, 34. they can act as post-transcriptional and post-translational
[6] Arakawa, K., & Tomita, M. (2013). Merging regulators [2]involved in processes such as quorum
Multiple Omics Datasets In Silico: Statistical Analyses sensing [3], stress responses [4], protein composition of the
and Data Interpretation. In Systems Metabolic outer membrane[5], virulence and infection[6]. Some
Engineering (pp. 459-470). Humana Press. sRNAs have been reported for Xanthomonas
euvesicatoria[7], X. campestris pv. campestris[8]and X.
S1-O10 Diversity of Dickeya and oryzae pv. oryzae [9]. sRNAs studies have not been
Pectobacterium spp. in potato in the performed in Xanthomonas axonopodis pv. manihotis
Netherlands (Xam), which is the causal agent of bacterial blight in
Jean Martin van der Wolfa*, BH de Haasa, MK rijgera, EH
cassava. The objective of this study was to identify and
Nijhuisa, PS van der Zouwena, O Mendesa, P Kasteleina, L
characterize sRNAs in Xam, potentially related with
Nunes Leiteab, EG de Haanc
virulence and the quorum sensing process. Here, we
a
Plant Research International, P.O. Box 69, 6700 AB, implemented a directed transcriptomic analysis through
Wageningen, The Netherlands the sequencing of the total RNA (library <200nt) from
b
Universidade Federal de Uberlândia, PO Box 593, the wild type strain CIO151, a strain over-expressing a
38400-902, Uberlândia, MG, Brazil constitutively active version of the global virulence
c
Dutch General Inspection Service for agricultural seeds regulator HrpG, and a strain with a mutation in three
and seed potatoes (NAK) - Randweg 14, 8304 AS genes implicated in the perception of the Quorum
Emmeloord, The Netherlands Sensing signal. Bioinformatic analyses to discover
Jan.vanderWolf@wur.nl sRNAs expressed in all strains and those that were
differentially expressed among strains, were performed.
Pectobacterium and Dickeya spp. that can cause blackleg These included size selection, GC content, secondary
and slow wilt, isolated from Dutch potato material from structure and genomic context. Additionally, the sRNAs
1965 till 2012 were characterized with a variety of were classified as cis or trans-encoded and homologs
phenotypic and genetic techniques, including the use of were searched in other members of the genus
species-specific TaqMan assays, whole genome Xanthomonas. Potential transcriptional regulatory
sequence analysis and multilocus sequence analysis. It regions for the sRNAs were detected, as well as potential
was shown that the diversity of strains of Pectobacterium targets in the genome of Xam. Seventy-eight sRNAs
carotovorum subsp. brasiliensis and Dickeya solani, were found, 72 of which are novel bacterial sRNAs.
pathogens recently introduced, was low compared to P. 90.3% of the sRNAs detected correspond to cis-encoded
wasabiae, P. atrosepticum, and D. dianthicola that are antisense sRNAs and 9.7% to trans-encoded sRNAs.
already present in the Netherlands for decades. Field 79.5% of all sRNA detected possess at least one
experiments with vacuum-infiltrated tubers demonstrated regulatory region. The expression of trans-encoded
33
ICPPB2014 Abstracts
sRNAs was confirmed through RT-PCR. The possible of Pantoeastewartii subsp. indologenes(Psi) are reported
targets of the cis-encoded antisense sRNAs were to cause leaf spot on foxtail millet (Setariaitalica) and
classified as genes implied in regulation expression, pearl millet (Pennisetumamericanum) or rot of pineapple
response to stress, oxidation-reduction process and (Ananascomosus), and one strain was isolated from a
metabolic process. Forty-six sRNA were differentially diseased cluster bean (Cyamopsistetragonolobus)[4,5]. It
expressed in the strain incapable of sensing the QS signal is important to differentiatePssfrom Psi, phylogenetically
with 97.8% of them being down-regulated. Additionally, and by using specific diagnostic tools, since only the Pss
for most of the sRNAs homologues were identified in causes Stewart’s wilt[3,5].We successfully used a
several Xanthomonas species. This is the first study of multilocus phylogeny (fusA, gyrB, leuS, pyrG, rlpB and
sRNAs in Xanthomonas axnopodis pv. manihotis and rpoB) to phylogenetically differentiate the subspecies of
could shed light on the regulation of the infection and P. stewartii. Also, multilocusphylogeny indicated that the
Quorum Sensing process. strains of Psiare genetically heterogeneous, withtwo
strains (LMG 2630 and LMG 2631), clustering
Acknowledgements: We thank Ralf Koebnik from distinctively from the type strain (LMG 2632).This could
Institut de Recherche pour le Développement, impact reliable detection of Pss and certification of corn
Montpellier, France, for kindly providing the plasmids shipments.Previously reported TaqMan real-time PCR
used in this study. assays[2,5] are not subspecies specific, requiring
References: additional analysis to confirm a positive reaction for the
[1]D. Jost, A. Nowojewski, E. Levine (2011). BMB Rep., presence of Pss. Here, we report the comparative
vol. 44, no. 1, pp. 11–21. genomics of P. stewartii and the development of the first
[2]L. S. Waters, G. Storz (2009). Cell, vol. 136, no. 4, pp. TaqMan real-time PCR assay for specific detection of
615–628. Pss in pure cultures and infected plant parts. The
[3]M. Bejerano-Sagie and K. B. Xavier (2007). Curr. whole-genome sequences of PssDOAB 21,PsiLMG 2632
Opin. Microbiol., vol. 10, no. 2, pp. 189–198. and Psi LMG 2630 were determined by paired-end
[4]C. Hoe, C. A. Raabe, T. S. Rozhdestvensky, and T. sequencing using an IlluminaHiSeq instrument with
Tang (2013). Int. J. Med. Microbiol., vol. 303, no. 5, pp. TrueSeq V3 chemistry. Assemblyof the genomeswas
217–229. based on kmer values using Velvet and AByss
[5]J. Vogel and K. Papenfort (2006). Curr. Opin. assemblers and scaffolding the contigs using SSPACE.
Microbiol., vol. 9, no. 6, pp. 605–611. Also,65 contigs of Pss DC283 were downloaded from
[6]K. Papenfort and J. Vogel (2010). Cell Host Microbe, GenBank. Preliminary annotations using RAST server
vol. 8, no. 1, pp. 116–127. identified 5547, 4690 and 5249 coding sequences for
[7]C. Schmidtke, S. Findeiss, C.M. Sharma, J. Kuhfuss, DC283, LMG 2630 and LMG 2632 respectively.Whole
S. Hoffmann, J. Vogel, P. F. Stadler, U. Bonas (2012). genome SNP analysis revealed 36770 or 39000 SNPs
Nucleic Acids Res., vol. 40, no. 5, pp. 2020–31. between Pss DC283 and PsiLMG 2632 or Psi LMG 2630
[8]R. Jiang, D. Tang, X. Chen, Y. He, J. Feng, B. Jiang, G. respectively. The most prominent polymorphisms were
Lu, M. Lin, and J. Tang (2010). thymine-cytosine (6500 SNPs), adenine-guanine (6300
[9]H. Liang, Y.T. Zhao, J.Q. Zhang, X.J. Wang, R.X. SNPs), cytosine-thymine (5500 SNPs)
Fang, and Y.T. Jia (2011). BMC Genomics, vol. 12, no. 1, andguanine-adenine (5500 SNPs). Within the cps gene
p. 87. cluster, 141 SNPs were identified,andthe absence of a
cpsintergenicspacer region in Psi strains was observed. A
S1-O12 Comparative genomics of TaqMan real-time PCR assay developed from this
Pantoeastewartii subspecies and development intergenicregion readily differentiatedPssfrom Psi strains
of a TaqManReal-Time PCR assay for specific and other bacterial species. This novel assay may find
detection of P. stewartiisubsp.stewartii application in the routine certification of corn shipments.
James T. Tambong*, Z Adam, CT Lewis, CA Lévesque, W Acknowledgement:This research was funded by
Chen, IU Khan, ESP Bromfield, R Xu Defence R&D Canada-Centre for Security Science
Agriculture and Agri-Food Canada, 960 Carling Avenue, project # CRTI 09S-462RD and Agriculture and
Ottawa, Ontario, CANADA. Agri-Food Canada through project #1800. We are
james.tambong@agr.gc.ca thankful to Rafik Assabgui for providing technical
assistance with multi-locus DNA sequencing.
Plantpathogens constitute the majority (80%) of all
validlydescribedPantoea References:
species.Pantoeastewartiiconsists of two subspecies based [1]Michener, P. M., Pataky, J. K., and White, D. G. (2002)
on indole production. Pantoeastewartiisubsp.stewartii Plant Dis. 86:167-172.
(Pss) is the causal agent of Stewart's bacterial wilt and [2]Coplin, D. L., Majerczak, D. R., Zhang, Y., Kim, W.-S.
leaf blight of sweet corn and maize. This bacterium can et al.(2002). Plant Dis. 86:304-311.
be seed transmitted at a low frequency [1] so it is subject [3]Tambong, J.T., Mwange, K.N., Bergeron, M.,.et
to quarantine restrictions by many countries [2,3]. Strains al.(2008). J. Appl.Microbiol, 104: 1525-1537.
34
ICPPB2014 Abstracts
[4]Mergaert, J., L. Verdonck, and K. Kersters. (1993). Int. S1-P1 Three distinct hrp genotypes of
J. Syst. Bacteriol. 43:162–173. Acidovoraxavenae subsp. citrulli cause bacterial
[5]Wensing A., Zimmermann, S. and Geider K. (2010). fruit blotch in cucurbit crops
Appl. Environ. Microbiol. 76: 6248-6256.
Lifang Zou a†, Lanqing Lia†, Baishi Hub, Laixin Luoc, Jianqiang
Lic, Tingchang Zhaod, Gongyou Chena*
S1-O13 Genomics and bacterial interactions of a
School of Agriculture and Biology, and State Key
soft rot pathogen Dickeya solani
Laboratory of Microbial Metabolism, Shanghai Jiao
Tong University, 800 Dongchuan Road, Shanghai
Linda Garlant*, Ying Liu, Johanna Nykyri, Minna Pirhonen
200240, China.
Department of Agricultural Sciences, University of b
Department of Plant Pathology, College of Plant
Helsinki, Latokartanonkaari 7, 00014 Helsinki. Finland.
Protection, Nanjing Agricultural University, Nanjing
linda.garlant@helsinki.fi
210095, China
c
Dickeya solani is a new species of soft rot pathogen that Department of Plant Pathology, China Agricultural
might have moved from ornamental plants to potato in University, Beijing 100193, China
d
the Netherland. D. solani causes blackleg and wilting of Institute of Plant Protection, Chinese Academy of
the potato stems and rotting of plants and tubers in the Agricultural Sciences, Beijing 100193, China
†
field and also during storage. D. solani has replaced the These authors contributed equally to this work
closely related but less virulent potato pathogens, such as zoulifang202018@sjtu.edu.cn
Pectobacterium and other Dickeya spp., in some
Bacterial fruit blotch (BFB) caused by
European countries [1]. The availability of a recently
Acidovoraxavenae subsp. citrulli (Acc), is a destructive
sequenced genome of a Finnish D. solani isolate allowed
seed-borne disease in melon production worldwide[1].
the investigation of its biological properties. The genome
Comparison of the hrp pathogenicity islands among three
content analysis revealed a unique combination of large
plant pathogenic bacteria A. avenae subsp. citrulli
gene clusters possibly involved in production and
AAC00-1, A. avenae subsp avenae N1141 and A. avenae
secretion of toxic secondary metabolites [2]. The
subsp avenae K1 revealed that there are two obvious
production of toxins may give invasive properties to this
variable regions VR1(hrpD5-hrpK) and VR2
novel pathogen and explain why it is spreading fast in
(hpaH-hrpW) in hrp pathogenicity islands.Three hrp
Europe. We observed that the growth of potato
genotypes A, B and C were confirmed among 101
pathogenic bacteria Pectobacterium atrosepticum and P.
collected Acc strains from a range of cucurbitaceous
carotovorum subsp. carotovorum was inhibited in dual
hosts mainly in the USA, China and Australia according
cultures in vitro and invivo with D. solani. A mutant
to the PCR amplification of the VR1 and VR2. The
strain of D. solani showing lack of inhibition activity,
genotype A and B correspondingly fit to previous
revealed the presence of a gene cluster involved in the
identified group I and II, respectively, however, the
production of a not yet known bacteriocin-like molecule.
genotype C contains group I and II. Sequence analysis
The cluster is partially conserved only in other Dickeya
revealed that the VR1 or VR2 regions of the genotype A
spp., but with crucial differences in genes content. The
strains merely showed 91% identity to the same regions
toxic molecule which seems to be responsible for the
of the genotype B strains, whereas both of VR1 and VR2
growth inhibition of Pectobacterium spp. might confer
regions of the genotype A and B strains from USA
advantages in competitiveness and colonization to D.
showed 100% identity to the according regions of the
solani and explain its high invasiveness.
genotype A and B strains from China and Australia. The
References: results suggest that the genotype A and B strains are two
[1]J.M.van der Wolf, E.H. Nijhuis, M.J. genetically distinct groups, whereas the same genotype A
Kowalewska, G.S. Saddler, N. Parkinson, J.G. (or B) strains around the world originated from the same
Elphinstone, L. Pritchard, I.K. Toth, E. Lojkowska, M. place. Pathogenicity assay demonstrated that cantaloupe,
Potrykus, M. Waleron, P. de Vos, I. Cleenwerck, M. rockmelon, muskmelon are more susceptible to
Pirhonen, L. Garlant, V. Hélias, J.F. Pothier, V. Pflüger, B. thegenotype A than calabash and pumpkin. Watermelon
Duffy, L. Tsror, S. Manulis (2014). Dickeya solani sp. and muskmelon are more susceptible to the genotype B
nov., a pectinolytic plant pathogenic bacterium isolated strains than others, and the genotype C is more virulent
from potato (Solanum tuberosum), Int. J. Syst. Evol. in all six tested host plants than the genotype A and B.
Microbiol., 64: 768-774. Watermelon is susceptible to two A. avenae subsp
[2] L. Garlant, P. Koskinen, L. Rouhiainen, P. Laine, L. avenae stratins isolated from rice. The results above
Paulin, P. Auvinen, L. Holm, M. Pirhonen (2013). suggest that the A. avenae subsp avenae bacteria from
Genome sequence of Dickeya solani, a new soft rot other plants, like rice and cereal weeds, are potential
pathogen of potato, suggests its emergence may be BFB pathogen in melon crops.
related to a novel combination of non-ribosomal
Acknowledgement: This work is supported by the
peptide/polyketide synthetase clusters, Diversity,
Special Fund for Agro-Scientific Research in the Public
5(4):824-842.
Interest of China (201003066)
35
ICPPB2014 Abstracts
References: R. Buonaurio, C. Ramos, V. Venturi (2014).
[1]R. R. Walcott Walcott, A. Fessehaie and A. C. Castro Microbiology 160, 556.
(2004). J. Phytopathology 152, 277–285. [2]A. M. Rojas, J. E. García de los Rios, M. Fischer-Le
Saux, P. Jimenez, P. Reche, S. Bonneau, , L. Sutra, F.
S1-P2 Draft genome sequence of a Mathieu-Daudé, M. McClelland (2004). International
hypersensitive reaction-inducing Journal of Systematic and Evolutionary Microbiology, 54,
Pantoeaagglomerans strain isolated from olive 2217.
knots caused by Pseudomonas [3]D. Passos da Silva, G. Devescovi, K. Paszkiewicz, C.
savastanoipv.savastanoi Moretti, R. Buonaurio, D. J. Studholme, V. Venturi
C Morettia, C Cortesea, D Passos da Silvab, G Devescovib, E (2013). Genome Announcements, 1, e00205-13.
Torellic, V Venturib, G Firraoc, Roberto Buonaurioa* [4]C. Moretti, T. Hosni, K. Vandemeulebroecke, P. De
a
Dipartimento di Scienze Agrarie, Alimentari e Vos, R. Buonaurio, I. Cleenwerck (2010). International
Ambientali, Università degli Studi di Perugia, Perugia, Journal of Systematic and Evolutionary Microbiology, 61,
Italy 2745.
b
International Centre for Genetic Engineering and [5]T. Hosni, C. Moretti, G. Devescovi, Z. R.
Biotechnology, Trieste, Italy Suarez-Moreno, M. Fatmi, C. Guarnaccia, S. Pongor, A.
c
Dipartimento di Scienze Agrarie e Ambientali, Onofri, R. Buonaurio, V. Venturi (2011). The ISME
Università degli Studi di Udine, Udine, Italy Journal, 5, 1857.
roberto.buonaurio@unipg.it S1-P3 Plant pathogenenic bacteria have
Knots caused by Pseudomonas savastanoipv. savastanoi proteins converting sucrose into products with
in olive trees provide an interesting niche for studying potential applications in functional food
bacterial multispecies interactions. Among the high Triinu Visnapuu, Karin Mardo, Andres Mäe, Eerik Jõgi, Tiina
number of bacterial species detected inside the olive Alamäe*
knots by metagenomics, those belonging to the genera Institute of Molecular and Cell Biology, University of
Pantoea, Pectobacterium, Erwinia and Curtobacterium Tartu, Riia 23, 51010 Tartu, Estonia
are the most represented [1]. In addition, some species talamae@ebc.ee
such as Erwiniatoletana[2, 3] and Erwiniaoleae[4] are well
characterized. We demonstrated that E. toletana or Many plants are rich in sucrose. Thereby they harbor
Pantoeaagglomerans isolated from olive knots: i) bacteria that have evolved to metabolize sucrose for
provoke an increase in disease severity when carbon and energy. Several plant-pathogenic bacteria
co-inoculated with P. savastanoipv. savastanoi in olive such as Erwinia amylovora and Pseudomonas syringae
plants; ii) communicate through a quorum sensing possess extracellular levansucrases that convert sucrose
system mediated by N-acyl-homoserine lactones, to (i) high-molecular fructan (levan) and (ii)
forming a stable interspecies community with P. fructooligosaccharides (FOS) of varied chain length.
savastanoipv. savastanoi[5]. Since we have frequently Both these products have β-2,6 linkage between the
isolated from olive knots many strains of P. fructose residues that differentiates them from inulin and
agglomeransinducing hypersensitive reaction (HR) in inulin-derived FOS which have β-2,1 linkage between
tobacco plants, we further investigated the role of this these residues. Prebiotic potency of inulin-type FOS is
bacterium in disease development, through genome well documented – they act as strong and selective
sequencing of the strain DAPP-PG 734. We assembled a growth stimulators of beneficial bacteria, lactobacilli and
genome draft of total length of 5.3 Mbp, comprising 195 bifidobacteria, in the gut resulting in production of
contigs with a maximum length of 172 kbp and N50 of 53 short chain fatty acids. Biological effects of levan-type
kbp, assuming a genome size of 5.3 Mb. The G+C FOS are poorly studied as they are not commercially
content was 54.6%, which is similar to that of other available. FOS with β-2,1 linkage type are produced
sequenced P. agglomerans genomes. The HR induced by from inulin extracted from plant tissues e.g. chicory roots
the strain seems to be explained by the presenceof a and Dahlia tubers. We have isolated and thoroughly
complete hrp/hrc gene cluster showing remarkable characterized levansucrase protein Lsc3 of Pseudomonas
synteny and high sequence similarity with syringae pv. tomato DC3000 [1]. Lsc3 is a highly active
Erwiniaamylovora and Erwiniapyrifoliaehomologs. On catalyst, having kcat of sucrose splitting a 504.4 s -1 and
the basis of these results, we inoculated pear fruitlets producing both, levan and FOS as polymerization
with P. agglomeransDAPP-PG 734. Weak rotted tissues products [2-3]. According to size-distribution of FOS, the
were observed in correspondence of the inoculation sites, Lsc3-produced FOS are highly similar to commercial
5 days after the inoculation. Mutants of hrpN, hrpY and prebiotic β-2,1 FOS preparations, such as P95 from
hrpJ genes were obtained and the determination of their Orafti [4]. We assume that Lsc3-produced FOS have
phenotypes is in progress. prebiotic effect. We have elaborated a feasible system to
heterologously express and purify a large amount of
References: Lsc3 protein. We are isolating and constructing
[1]D. Passos da Silva, M. P. Castañeda-Ojeda, C. Moretti, appropriate mutants of Lsc3 and optimizing reaction
36
ICPPB2014 Abstracts
conditions for the synthesis of FOS and levan for their In general, >95% of ANI corresponds to >70%
further testing as prebiotics. We will introduce a set of DNA-DNA hybridization, which is an important criterion
methods elaborated and used by us in levansucrase assay. for species differentiation. More detail comparison will
Most of these methods are cost-efficient and be also presented.
high-throughput. Some tests exploit permeabilized cells
of levansucrase-expressing E. coli as catalyst. Acknowledgment:This work was funded by the
National Quarantine Service of Korea in 2014.
Acknowledgement: This study was financed by EU
project Functional Food Ingredients (3.2.0701.12-0041; Reference:
SLOMR12215T) managed by Archimedes Foundation [1]R. Eichenlaub, K. Gartemann (2011). Annu. Rev.
and ESF grant GLOMR9072. Phytopathol., 49, 445.
References: S1-P5 Transcriptomic analysis of Nicotiana

[1]T. Visnapuu et al.(2008). Process Biochem, 43, 414. benthamiana responses to two HR eliciting
[2]T. Visnapuu et al.(2011). J Biotechnol ,155, 338. protein: Hpa1 and SSB from Xanthomonas
[3]K. Mardo et al. (2014). Biotechnol and Appl oryzae
Biochemistry , 61, 11. Wenxiu Ma, Yujing Sun, Lifang Zou, Gongyou Chen*
[4]T. Visnapuu et al. (2009). Rapid Commun Mass Shcool of Agriculture and Biology, Shanghai Jiao Tong
Spectrom, 23, 1337. University, 800 Dongchuan Rd. Shanghai, China.
S1-P4 Molecular characterization of gyouchen@sjtu.edu.cn
Clavibacter michiganensis subsp. Previously our lab has identified that Hpa1 (harpin) and
michiganensisisolated from pepper showing SsbX (harpin-like protein, highly conserved
bacterial canker disease single-stranded DNA-binding protein in Xanthomonas
ChungyunBaea, Han-BeoylLeea, Eom-JiOha, Mi Chi Yeab,
species) of X. oryzae pv. oryzicola (the causal agent of
Kyu-OckYimb, Duck Hwan Parkc, ChangSikOha*
bacterial leaf streak in rice) triggers hypersensitive
a
Department of Horticultural Biotechnology,College of response (HR) in nonhost tobaaco. Accompanied with
Life Sciences, Kyung Hee University, Yongin 446-701, HR caused by Hpa1 and SsbX was the activated
Korea expression of HR marker genes (HIN1, HSR203J), the
b
National Plant Quarantine Service, Anyang 430-016, deposition of callose and reactive oxygen species (ROS)
Korea burst. In order to reveal the differential expression
c
Department of Applied Biology, Kangwon National profiles of Nicotiana benthamiana responding to Hpa1
University, Chuncheon 200-701, Korea and SSB, we generated RNA-seq data of N. benthamiana
co35@khu.ac.kr in which Agrobacterium-mediated Hpa1 and SsbX were
individually infiltrated 24 hours post inoculation.
Clavibacter michiganensis subsp. michiganensis(Cmm) Comparing to RNA-Seq data of the empty vector by
is a Gram-positive plant-pathogenic bacterium causing referring to false discovery ratio (FDR) (≤0.05) and
bacterial canker disease in tomato [1]. Similar bacterial log2FC (fold change ≥ 2.0), we found that 54
canker disease has been reported in pepper and its causal differentially-expressed genes (DEGs) in N.
bacterial pathogen was classified as Cmm. This benthamiana were up-regulated and 288 were down-
classification was based on identity of 16S rRNA gene regulated by Hpa1, while 129 genes were up-regulated
sequenceand similarity of disease symptom in both and 710 genes down-regulated by SsbX. 16 genes were
tomato and pepper. In this study, we tried to re-confirm up-regulated 23 genes were down-regulated by both
the identity of Cmm isolated from infected pepper Hpa1 and SSB. One of the up-regulated DEGs by both
(named as Cmm-P, compared to Cmm-T isolated from proteins is cysteine proteinase inhibitor, which acts as a
tomato). First, phylogenetic analysis with 16S rRNA defense protein against pests and pathogens in literatures.
gene sequence of Cmm-P and closely related bacteria, In addition, both Hpa1 and SsbX made cytokinin oxidase
including Cmm-T and other Cm subspecies, was and cytokinin dehydrogenase (helping degrade cytokinin
performed. Based on this analysis, Cmm-P was assigned to promote cell death) lower expressed in tobacco.
to a separate clade from Cmm-T, although their overall Interestingly, the expression of MAPK and WRKY72
identity was over 99%. Interestingly, Cmm-P looked was up-regulated only by SsbX, and bHLH128
closer to Cm subsp. sepedonicus, which is a potato transcrptional factor only by Hpa1. The expression of
pathogen. Second, the genome of a Cmm-P strain was chloroplastic proteins (chlorophyll a/b binding proteins
fully sequenced and compared with that of Cmm-T strain and thylakoid luminal protein, for examples) were
NCPPB382 available at GenBank database. Based on up-regulated by Hpa1 but not SsbX. However, the
genome comparison with Cmm-T strain genome by ACT verification of what specific tobacco genes for HR
(Artemis comparison tool at Sanger Institute), average induction in tobacco are required and how are signalings
nucleotide identity (ANI) was onlyapproximately 90%, of HR events in tobacco by Hpa1 and/or SsbX is under
although overall gene arrangement was well conserved. our investigation.
37
ICPPB2014 Abstracts
S1-P6 Investigating the genetic diversity of [4]C. Brady, I. Cleenwerck, S. Venter, M. Vancanneyt, J.
Pantoea ananatis Swings, T. Coutinho (2008). Systematic and Applied
Microbiology, 31, 447.
G Shin, T A Coutinho, Stephanus Venter*
Department of Microbiology and Plant Pathology and S1-P7 Identification and characterization of the
Forestry and Agricultural Biotechnology Institiute Dickeya sp. causing banana (Musa paradisiaca)
(FABI), University of Pretoria, Pretoria 0002, South soft rot disease in China
Africa
Guofen Wanga,c*, Lijia Guoa,c, Lei Liua,cˈYinhua Chenb,
fanus.venter@up.ac.za
Junsheng Huanga,c
a
Pantoea ananatis is an ubiquitous bacterium which has Environment and Plant Protection Institute, Chinese
been recovered from a diverse range of ecological niche Academy of Tropical Agricultural Science ˈ Haikou
but more importantly, it is a pathogen of several 571101, China
b
economically important crops such as maize, rice and College of Agriculture, Hainan University, Haikou
onions as well as plantation species such as Eucalyptus. 570228, China
c
Since the first report as the causal agent of brown rot of CATAS/ Key Laboratory of Integrated Pest Management
pineapple [1], P. ananatis is now considered as an on Tropical Crops, Chinese Academy of Tropical
emerging plant pathogen due to an increase in the disease Agricultural Science, Haikou 571101, China
incidence, as well as the host and geographical range guofenwang7810@163.com
reported for this pathogen[2]. Despite this emergence, the
genetic diversity and population structure of P. ananatis Abstract˖Banana soft rot disease (BSR) was recently
remains largely unknown. It has previously been identified in Guangzhou, Guangdong province, China [1].
suggested that the population could be divided into 3 Typical symptoms of the disease are necrosis of growing
groups based on host specificity and and the presences of point, new leaf wilt, pseudostems collapse and unusual
selective genetic characteristics [3]. The aim of this study odor, total yield can be lost when the disease was severed.
was, therefore, to investigate the genetic relatedness of P. Unlike the symptoms of Fusarium wilt disease caused by
ananatis strainsisolated from different hosts and Fusarium oxysporum f.sp. cubense [2], symptoms of BSR
geographic locations using a MLST (Multi-locus generally started in three to four month after planting and
sequence typing) approach. A total of 217 strains were the disease spread quickly than Fusarium wilt disease.
collected from various parts of the world and were Four selected BSR strains caused two separation
sequenced for 6 loci. Three of the loci represented symptoms in banana seedling inoculation experiments.
housekeeping genes (atpD, gyrB and infB) commonly One tiypical symptom appeared in 3-4 days after
used for species identification [4], while the rest were inoculation. BSR strains affect banana new leaf wilt,
more variable genes, (ompF, pmrB and ydiV)involved in midrib salient, and yellowing from edge of the leaf. They
specific functions within the cell. A concatenated also induced banana growing point necrosis, dark brown
maximum likelihood phylogenetic tree for the discoloration and unusual odor. Another symptom
housekeeping genes had poor resolution, resulting in a appeared in 10-11 days after inoculation. The plant leaf
few groupings that with weak bootstrap support. In yellowing started from the bottom leaves of the plants,
contrast, well supported groupings of strains were and then moved upward. The inoculated plants grow thin
observed for the single gene trees of the more variable and weakly. Based on the NGM media culture profiles,
genes, but no grouping based on host or geographic Biolog metabolic characteristics, indC gene PCR
association could be observed. It was also observed that amplification and sequence analysis of the partial 16S
only a few clusters wereconsistent between these single rDNA and rpoB genes four BSR strains were identified
gene trees. No correlation with the previously prosed as members of the genus Dickeya sp.. Among the four
scheme was observed. This lack of congruency between representative strains (36-8, E.ch, B12-1 and B12-3),
the different trees suggests that the genesselected are 36-8 was isolated from Yunnan (Honghe) has tiypical
under different selection and that recombination could characteristic of the blue pigment proudction and specific
play an important role in this population. Further studies indC-PCR result. 16S rDNA and rpoB gene sequences
will have to be performed to improve our current revealed 36-8 and the D. dadantii type strain CFBP1269
understanding of the population dynamics and evolution and LMG25992 have a close relationship. Other three
of P.ananatis. strains E.ch, B12-1 and B12-3 isolated from Guangdong
(Zhanjiang) profiled a seemly character accroding to the
References: former reports of D. zeae [3, 4]. The causal agent for BSR
[1]F.B. Serrano (1928). Philippine Journal of Science, 36, was previously reported to be only D. zeae [5], however,
271. this study found that other Dickeya sp. (D. dadantii) also
[2]T.A. Coutinho, S.N. Venter (2009). Molecular Plant cause BSR. Our research enchance the comprehension of
Pathology, 10, 325. Dickeya sp. which as an important plant pathogenic
[3]K. Kido, M. Hasegawa, H. Matsumoto, M. Kobayashi, bacterium, has important academic value to the further
Y. Takikawa (2010). Journal of General Plant Pathology, study analysis.
76, 208.
38
ICPPB2014 Abstracts
Acknowledgements:This research was financially between each Os strain and the H. rubrisubalbicans type
supportedby the National Natural Science Foundation of strain, and about 30% between each Os strain and the
China(31260345 ˈ 31371900), Chinese Ministry of H.seropedicae type strain. All the genomes of H.
Science and Technology Agricultural Ministry of rubrisubalbicansand H. seropedicae contain genes
China(200903049) and the Ph.D Start Foundation of encoding the typeI, II, III, Vand VI secretion systems and
CATA (Hzs1003). the twin-argininetranslocase secretion system. The
deduced protein components of the type III secretion
References: systems of the H. rubrisubalbicans strains showed over
[1]B. Lin, H. Shen, X. Pu (2010). Plant Disease, 92% identity to each other and rather lower identities to
94(5):640-640. H. seropedicae. Four to five type III effector proteins
[2]R.H. Stover (1990). In: Ploetz RC, ed.Fusarium Wilt were found in H. rubrisubalbicans whereas only one
of Banana.StPaul,MN,USA:APSPress,1–7. effector protein in H. seropedicae. Cellulases and
[3]R. Samson, J. B. Legendre, R. Christen (2005). pectinases that facilitate the bacterial invasion are present
International Journal of Systematic and Evolutionary in H. rubrisubalbicans but absent in H. seropedicae.
Microbiology, 55, 1415-1427. Together, the comparative genomics revealed that the
[4]C. L. Brady, I. Cleenwerck, S. Denman (2012). type III secretion systems and cell wall-degrading
International Journal of Systematic and Evolutionary enzymes likely determined the pathogenesis of H.
Microbiology, 62(Pt 7),1592-1602. rubrisubalbicans and the contrasting relationships to
[5]J. Zhang, H. Shen, J. Hu(2013). Plant Disease, plant hosts between H. rubrisubalbicansandH.
2014,98(4):436-442. seropedicae.
S1-P8 Comparative genomics of Acknowledgement: This work was supported by the
plant-associated pathogenic Herbaspirillum State Key Laboratory of Rice Biology, China.
rubrisubalbicansand beneficial H. seropedicae
bacteria References:
[1]R.A. Monteiro, E. Balsanelli, R. Wassem et al. (2012).
Mingyue Chen, Shuting Ye, Bo Zhu, Qianli An*
Plant Soil, 356, 175.
State Key Laboratory of Rice Biology, Institute of [2]M.A. Schmidt, E. Balsanelli, H. Faoro et al. (2012).
Biotechnology, Zhejiang University, Hangzhou 310058, BMC Microbiology, 12, 98.
China
an@zju.edu.cn S1-P9 Influence of agroecology, altitude and
geographic positions on the occurrence and
Herbaspirillum bacteriaare widely associated with plants, intensity of Citrus Canker (Xanthomonas
particularly important cereals in the family Poaceae.H. axonopodis pv.citri) in Ethiopia
seropedicae and H. rubrisubalbicans are
phylogenetically more closely related to each other than Eshetu Derso, Girma Kassa ,Mesfin Haile
to other Herbaspirillum species. H. seropedicae bacteria Ethiopian Institute of Agricultural Research (EIAR),
are known endophytic nitrogen-fixing bacteria and plant Debre Zeit Research Center, P.O.Box,2003, Addis
growth-promoting bacteria.H. rubrisubalbicanshas Ababa/Ethiopia,
similar physiological characteristics but can cause the eshetudrs4@gmail.com, ederso@yahoo.com
mottled stripe disease in some sugarcanevarieties and the
red stripe disease insome sorghum varieties[1]. The type Citrus canker, which is a very destructive and highly
III secretion system is a key factor to determine the invasive disease, was first reported in Ethiopia in
pathogenesis of the most virulent H. rubrisubalbicans 2004[3]. Thereafter, diagnosis and genetic diversity
strain M1 [2]. We isolated five Herbaspirillumstrains studies on the pathogen (Xanthomonas axonopodis pv.
(Os34, Os38, Os44, Os45 and Os49) from rice roots and citri) were undertaken using PCR based DNA molecular
found that they inhibited the growth of rice seedlings and markers. Accordingly, all of the Ethiopian strains were
induced hypersensitive response in tobacco leaves. We identified as pathotype A* that are epidemiologically
used comparative genomics to decipher the genetic important on Mexican lime and alemow [2]. In bringing
differences between the pathogenic and beneficial together environmental factors that influence the
Herbaspirillum bacteria (the five Os strains, the H. intensity and spread of citrus canker, it is quite pertinent
rubrisubalbicans type strain B579T and virulent strain to map disease distribution areas which would help
M1, and the H. seropedicae type strain Z67Tand strain determine the best locations for the placement of disease
SmR1). surveillance resources [1]. Based on this, surveys were
conducted in the major citrus growing regions of
The five Os strains were determined to belong to H. Ethiopia at representative locations during 2011-2013
rubrisubalbicans by the online Genome-to-Genome cropping seasons. The main objectives were to avail
Distance Calculator (version 2.0; http://ggdc.dsmz.de). information and map the occurrence and intensity of
The digital DNA-DNA hybridization (DDH) valuesare citrus canker; determine influence of agroecological
about 90% among the five Os strains, about 72% zones [4], altitudes and geographic locations on disease
39
ICPPB2014 Abstracts
distribution. Overall, seven regional statesand95 Province revealed that diseased areca growing areas
geographic locations that were found in 20 arrived at 1 000 ha, with an incidence of 10-30%; in the
administrative zones were covered in the surveys. severely infected areas, the incidence was as high as
Twenty five randomly selected Mexican lime trees at approximately 90%. As a result, reduction in yield was
each location were observed for determining up to 50-80% even 100%, and early infected gardens has
diseaseintensity both on leaves and fruits. The positional been thoroughly destroyed. To date, it has spread to all
and attribute components were recorded using GPS and arecanut-growing areas in India and most regions where
visual assessments respectively. The projection utilized betel palm is an economically important crop in Hainan.
for mapping was GCS WGS 84 and accomplished using
QGIS and ArcGIS computational facilities. Citrus canker The typical symptom of YLD is yellowing in leaves. In
was recorded only in four regional states and 12 severe cases the crowns of palm fall off and the
geographic locations, within the Rift Valley solely on arecanut trees dies. The causal agent is phytoplasma. In
Mexican lime (Citrus aurantifolia). With respect to 1978, Nayar and Seliskar observed Mycoplasma Like
agroecological zones, 33.3% were recorded in warm arid Organisms (MLOs), namely mycoplasma, from leaf
lowland plains, 33.3% in warm moist and sub-moist tissues of diseased arecanut trees by electron microscopy.
lowlands, 16.6% in Tepid sub-humid mid highlands and The association of phytoplasma with YLD was
the rest 16.6% in Tepid moist and sub-moist mid confirmed by the reproduction of symptoms on young
highlands. The altitudes ranged between 800-1900m.a.s.l. areca seedlings by transmission tests using dodder laurel
The result of this study indicated that pathotype (Cassiytha filiformis) and the plant hopper Proutista
A*adapted under wide agroecological zones, and moesta. Other evidences including tetracycline
altitudes. This might suggest that under Ethiopian hydrochloride, sequence of 16S rDNA gene amplified by
conditions agro-ecological zones and altitude have major nested-polymerase chain reaction (nested-PCR) also
influence on occurrence and distribution of the pathogen. supported the fact that phytoplasma as the causal agent.
On the other hand, the influences of geographic Recently, the phytoplasma was classified as a new
locations seem to be limited. However, further studies subgroup, subgroup G, of Aster yellows group (16Sr I
along this line seem to be pertinent. group), and was named as areca nut yellow leaf
phytoplasma, but another report indicated that it
It appears that, spread of the citrus canker belonged 16Sr I-B subgroup.
pathogenseems to have been restricted to the central Rift
Valley ofEthiopia. Hence, proper quarantine and YLD is also an ‘auxonic disease’ like other phytoplasma
containment measures to prevent the movement of diseases, and a series changes followed infection. The
infected citrus fruitsand planting materials from one area diseased palms exhibited high leaf sap capacity, total
to another should be in place. Moreover, a strategy which phenols, solids, tannin and dehydrogenase activity,
entails eradicationof infected citrus trees should be reduction in photosynthetic efficiency, altered
initiated at large scale citrus farms, orchards and in metabolism, lower transpiration, higher water and turgor
residential areas. potential. Changes of the most important metabolic
pathways including accumulation of amino acids (cystine,
References: aspartic acid, phenylalanine, threonine, alanine,
[1]Eshetu and Vernière . 2010. Pest Management, 13 (2): threonine, glutamic acid) and progressive increase in
1-11 lysineˈ argenineˈand methinonine during advanced
[2]Eshetu et al., 2009. Plant Dis., 93, (2): 203. stage of YLD; and the infected samples were higher than
[3]Eshetu and Sijam. 2007. Fruits, 62 (2): 89-98 that of healthy in terms of endogenous hormone IAA,
[4]MoARD. 2005.MajorAgro-ecological Zones of GA, ZR; on the contrary, ABA in the diseased samples
Ethiopia (AEZ), pp.8-9 were lower.
S1-P10 Recent progress and perspectives on So far, YLD has become the greatest threat and has
yellow leaf disease of arecanut caused devastating loss in India and China, in which the
betel palm production take a very important part for the
QinghuaTang, W.W. Song, H. Zhu, F.Y. Yu, X.Q. Niu, W.Q. Qin*
local economy. However, unfortunately, there is no
Coconut Research Institute, Chinese Academy of effective method for the control of YLD. Measures
Tropical Agricultural Sciences, Wenchang, Hainan recommended are as follows: (1) grow healthy seedlings;
571339 P. R. China. (2) Block disease transmission, it includes restrictive
QWQ268@163.com quarantine measures and control the potential insect
Yellow leaf disease (YLD) of arecanut (Areca catechu hosts such as Proutista moesta; (3) healthy agricultural
L.), an destructive disease of betel palm, was first management to enhance the resistance to YLD; (4) breed
reported from Muvattupuzha, Meenachil and Chalakudi and plant resistant or tolerant varieties.
areas of Central Kerala in 1949 in India and it was Though, and certain cross germplasm material exhibited
discovered in Tunchang, a county of Hainan Province in higher yield with minimum disease intensity in India;
China, in 1981. A survey conducted in 2005 in Hainan unfortunately, no variety resistant/tolerant to YLD has
40
ICPPB2014 Abstracts
been discovered. As phytoplasma diseases are not of China (31230059), and the Special Fund for
amenable to any chemical control method and no Agro-Scientific Research in the Public Interest of China
resistant/tolerant varieties available, researchers resort to (201303015).
modern molecular technology to study these uncultivable
in cell-free media, insect-transmitted, phloem-limited S1-P12 Virulence factors in Xanthomonas
bacterial pathogen. So far, a number of candidate translucens pv. graminis: sometimes less is
virulence proteins have been identified by mining of the more
phytoplasma genome sequence date, these studies, we Lena Hersemanna*, Franco Widmera, Frank Jörg Vorhölterb,
believe, will help us to control Yellow leaf disease of Roland Köllikera*
arecanut ultimately. a
Institute for Sustainability Sciences (ISS), Agroscope,
S1-P11 Genetic diversity of transcriptional Reckenholzstrasse 191, 8046 Zurich, Switzerland
b
activator-like effectors genes in Chinese Center for Biotechnology (CeBiTec), Bielefeld
isolates of Xanthomonas oryzae pv. oryzicola University, Universitaetsstrasse 27, 33615 Bielefeld,
Germany
Zhiyuan Ji, Muhammad Zakria, Lifang Zou, Gongyou Chen* lena.hersemann@agroscope.admin.ch
School of Agriculture and Biology, Shanghai JiaoTong
University, Shanghai, 200240, As the causal agent of bacterial wilt in forage grasses,
Chinagyouchen@sjtu.edu.cn Xanthomonas translucens pv. graminis (Xtg) belongs to
the most important pathogens in temperate grassland in
Xanthomonas oryzae pv. oryzicola (Xoc) causes bacterial Europe, the USA and Australasia. Xtg is predominantly
leaf streak (BLS), a devastating disease of transmitted by contaminated mowing equipment,
rice. Xoc utilizes repertoires of transcriptional colonizes the plant xylem and leads to withering of
activator-like effectors (TALEs) to manipulate host leaves and tillers. Reported yield losses reach up to 20 %
resistance or susceptibility; thus TALEs can determine in susceptible species such as Italian ryegrass. Whereas
the outcome of BLS. In this report, we studied genetic previous research on bacterial wilt in ryegrass focused
diversity in putative tale genes of 65 Xoc strains that almost exclusively on resistance breeding based on
originated from nine provincesof southern China. recurrent phenotypic selection, little is known about the
Genomic DNAs from the 65 strains were digested underlying pathogenesis mechanisms. Aiming to assist
with BamHI and hybridized with an internal fragment targeted breeding for resistance, we are working on the
of avrXa3, a tale gene originating from the related identification and characterization of virulence factors
pathogen, X. oryzae pv.oryzae (Xoo) that causes bacterial specific to bacterial wilt in Italian ryegrass.
leaf blight (BLB). Southern blot analysis indicated that
the strains contained a variable number (9 to 22) Genome sequencing of two Xtg strains and one X. t. pv.
of avrXa3-hybridizing fragments (e.g. arrhenatheri (Xta) strain which is non-pathogenic on
putative tale genes). Based on the number and size of Italian ryegrass revealed extensive differences in
hybridizing bands, strains were classified into 14 virulence traits. While the non-pathogenic Xta is
genotypes (designated 1 to 14), and genotypes 3 and 10 characterized through flagella-mediated swarming
represented 29.23% and 24.64% of the total, respectively. motility, the lack of the flagella gene cluster in Xtg
A high molecular weight BamHI fragment (HMWB; confirms previous reports on non-motility of this
~6.0 kb) was present in 12 of the 14 genotypes, and X.translucens pathovar. Furthermore, TAL effectors
sequence analysis of the HMWB revealed the presence common to a wide range of Xanthomonas spp. could be
of a C-terminally-truncated tale, an insertion element solely identified in the non-pathogenic Xta. Considering
related to IS1403, and genes encoding phosphoglycerate that both virulence factors, the flagellum and the TAL
mutase (pgm) and endonuclease V (enaV). Virulence effectors, are known as elicitors of plant defense
of Xoc strains was assessed on 23 rice cultivars mechanisms, the absence of the two may minimize
containing different R genes for BLB. The Xoc strains pathogen recognition by the plant defense machinery and
could be grouped into 14 pathotypes (I to XIV), and the therefore contribute to the pathogenicity of Xtg.
grouping of strains was almost identical to the categories Although Xtg generally seems to possess a rather
determined by genotypic analysis. In general, strains reduced set of virulence factors, two effector proteins
containing higher numbers of putative tale genes were have been identified to be exclusively present in the two
more virulent on rice than strains containing fewertales. pathogenic strains. Screening of further Xtg strains from
The results also indicate that there are no gene-for-gene Switzerland, Norway and New Zealand confirmed the
relationships between the tested rice lines and Xoc strains. conservation of both genes on a wide geographic scale.
To our knowledge, this is the first description of genetic Thus, both effector proteins represent excellent candidate
diversity of Xoc strains based on tale gene analysis. genes for a further in-depth analysis of their function in
causing bacterial wilt in Italian ryegrass.
Acknowledgement: This work was supported by the
State Key Basic Research and Development Project of
China (20112CB114003), the Natural Science Foundation
41
ICPPB2014 Abstracts
S1-A1 Transcription activator-like (TAL) Comparing with Xoc strain BLS256, only 9 of the 28 tal
effector genes in Xanthomonas oryzae pv. genes in GX01 share the same repeat units and the RVDs
oryzicola strain GX01 with those in BLS256, while 9 have the same repeat units
but one or more different RVDs, and the others are
Xiangna Niu, Haifan Zou, Yanhua Yu, Feng Wu, Wei Jiang,
various either in repeat units or RVDs, suggesting that
Yongqiang He*, Jiliang Tang
some tal genes in Xoc GX01 might be novel. Our result
State Key Laboratory for Conservation and Utilization of revealed the significant diversity in tal genes between
Subtropical Agro-bioresources, College of Life Science Xoc strains, and provided new material for the study of
and Technology, Guangxi University, Nanning, 530004, the pathogenesis of this phytopathogenic bacterium.
China
yqhe@gxu.edu.cn Acknowledgement:This study is supported by the
National Basic Research Program of China (973 Program)
Transcription activator-like (TAL) effectors, secreted by granted No. 2011CB100701.
a number of phytopathogenic bacteria, play vital roles in
the interactions between the pathogens and their hosts by References:
binding host DNA sequences. Some TAL effectors [1]J. Boch, U. Bonas (2010). Annual Review of
contribute to virulence by activating host genes that Phytopathology, 48: 419-436.
enhance susceptibility, and some work as avirulence [2] J. Boch, H. Scholze, S. Schornack, A. Landgraf, S.
factors by activating resistance genes [1,2]. Their Hahn, S. Kay, T. Lahaye, A. Nickstadt, U. Bonas (2009).
DNA-recognition specificity is determined by a central Science, 326: 1509-1512.
region of the effector that is composed of conserved, [3]A.J. Bogdanove, S. Schornack, T. Lahaye (2010).
33-35 amino acid repeats. Two variable amino acids at Current Opinion in Plant Biology, 13: 394-401.
positions 12 and 13 in each repeat, called the [4]M.J. Moscou, A.J. Bogdanove (2009). Science, 326:
repeat-variable diresidue (RVD), together specify a 1501-1502.
nucleotide in the target so that the number and [5]Y.S. Seo, M. Sriariyanun, L. Wang, J. Pfeiff, J.
composition of RVDs define the length and nucleotide Phetsom, Y. Lin, K.H. Jung, H.H. Chou, A. Bogdanove ,
sequence of the target [3,4]. Thus, determination of the P. Ronald (2008). BMC Microbiol, 8: 99.
sequence and the composition of the tal genes in the
genome is a shortcut to understand the potential S1-A2 Transcriptomic analysis of paulownia
pathogenicity of an Xanthomonas oryzae strain. However, infected by Paulownia Witches'-Broom
the genome-wide multiple copies of the tal genes and the phytoplasma
tandem repeats within a certain tal gene have hindered HaiqingMoua*, JieLua, ShuifangZhua,
the rapid determination of tal genes in a new bacterial CailiLinb,GuozhongTianb, Xia Xua, WenjunZhaoa
strain. a
Institute of Plant Quarantine, Chinese Academy of
The Xanthomonas oryzae pathovar oryzicola (Xoc), Inspection and Quarantine, Beijing, China.
b
which is one of the major pathogenic bacteria in rice, can Institute of Forest Ecology, Environment and
cause rice bacterial leaf streak (BLS) resulting in Protection,Chinese Academy of Forestry, Beijing, China.
significant yield and economic losses [5]. In our previous mouhaiqing@163.com
study, a rifampicin-resistant spontaneous mutant isolate, Phytoplasmas are specialized obligate bacteria at the
designated GX01 strain, was selected from the wild type phloem tissue of plant and are transmitted by insect
strain LT4 isolated from the rice leaf with typical BLS vectors [1].Over 700 plant diseases wordwde are
symptom in Liantang Town of Hezhou City of Guangxi, associated with phytoplasma, which have had a
in the vicinity of the central area of South China rice devastating effect on agricultural production[2].
growing region. In this study, we introduced the Phytoplasma-infected plants show a variety of symptoms
determination of the tal genes in GX01 strain. Southern and the mechanisms they use to physiologically alter the
hybridization analysis of genomic DNA revealed 25-30 host plants are of considerable interest, but poorly
tal genes in strain GX01. To get the accurate sequences understood. In our study we undertook a detailed
of all tal genes in GX01, a high-quality fosmid library analysis of paulownia infected by paulownia
containing 2974 clones with appropriately 22 times witches’-broom (PaWB) Phytoplasma using
coverage of the genome of strain GX01, was constructed. high-throughput mRNA sequencing (RNA-Seq) and
Restriction map of randomly selected clones suggested digital gene expression (DGE). RNA-Seq analysis
that this fosmid library was random and had approximate identified 74,831 unigenes, which were subsequently
36.2 kb DNA insert size. Digested with BamHI used as reference sequences for DGE analysis of
restriction enzyme, followed by Southern blot diseased and healthy paulownia in field grown and tissue
technology, totally 247 clones containing 1 to 6 copies of cultured plants. Blastx and ESTscan analysis indicated
tal genes were selected from the fosmid library. The that 48,712 unigenes had reliable coding sequences
selected fosmid clones were subcloned and the target (65.1% of all unigenes). Our DGE results revealed that
DNA fragments were sequenced. Finally, 28 unique tal dramatic changes occurred in the gene expression profile
genes were obtained, one of which is truncated at 3' end.
42
ICPPB2014 Abstracts
of paulownia after PaWBphytoplasma infection.In the distance 6.86. The most abundant cluster was the fifth
field grown group, 2,557 genes showing significant cluster which was containing 15 isolates which from nine
differential expressions were identified in the diseased locations. The strain BLS256 from Philippines was
sample (FD) compared to healthy sample (FH), of which, divided as a cluster alone. The 40 strains were divided
1,271 were up-regulated genes and 1,286 were into 2 clusters by the gene of AvrRxo1 and XopO with the
down-regulated genes. biosynthesis of other secondary length about 410bp and 583bp, respectively. The strains
metabolites. In the tissue cultured group, 1,206 genes from Yunnan Yuanmou, Yuanjiang, Gengma and Ruili
with significant differential expressions were identified were showed diversity in presence of two genes. The
in the diseased sample (TD) compared to the healthy strain from Lincang distract of Yunnan contain both
sample (TH), of which, 769 were up-regulated and 437 AvrRxo1 and XopO gene, simultaneously. While these
were down-regulated. For instance, Genes encoding key two genes were not contained in strain which was
enzymes in cytokinin biosynthesis, such as isopentenyl collected from Lufeng country of Yunnan. This study
diphosphate isomerase and isopentenyltransferase, were revealed that the VNTR was a fast, effective, expertise
significantly induced in the infected paulownia.Genes and convenient method for molecular typing of bacterial
involved in cell wall biosynthesis and degradation were rice pathogen Xanthomonas oryzae pv.oryzicola. Use
largely up-regulated and genes related tophotosynthesis diversity of VNTR sites for Xoc race classification was a
were down-regulated after PaWBphytoplasma infection. fast and effective technique, which could reflect the level
Our systematic analysis providescomprehensive of leaf streak strains genotype, the relationship between
transcriptomic data about plants infected by phytoplasma. phylogenetic and taxonomic, race classification.
This information will help further our understanding of
the detailed interaction mechanisms between plants and S2-K1 Induction and suppression of DAMP
Phytoplasma. induced innate immunity in riceXanthomonas
Acknowledgement:The work was supported by the interactions
National Science and Technology Support Program Dipanwita Sinha, Mahesh Kumar Gupta, Rajkanwar Nathawat,
(2012BAK11B02). Asfarul S. Haque, RajanSankaranarayanan, Ashsish Ranjan,
Madhumita Dasgupta, Bipin Kumar, V. Sridivya, Kamal
Reference:
Malukani, Shakuntala, Vishal Gupta, Ramesh V. Sonti*
[1]M. Doi, M. Tetranaka, K. Yora, H. Asuyama (1967).
Ann PhytopathologSoc JAPAN, 33, 259–266. CSIR-Centre for Cellular and Molecular Biology, Uppal
[2]I.M. Lee, R.E. Davis, D.E. Gundersen-Rindal Road, Hyderabad, India
(2000).Annu Rev Microbiol, 54, 221–255. sonti@ccmb.res.in
S1-A3 Molecular typing ofbacterial rice Plants have powerful inducible innate immune responses
pathogenXanthomonas oryzae pv.oryzicola in that protect them against the vast majority of potential
China pathogens. These immune responses are induced
following the detection of either MAMPs (microbe
Lihong Zhou, Jun Yang, Miao Li, Guanghai Ji* associated molecular patterns) or DAMPs (damage
College of Plant Protection, Yunnan Agricultural associated molecular patterns). We are studying the
University, Kunming, Yunnan 650201, China mechanisms by which plant innate immune responses are
jghai001@aliyun.com induced and suppressed using the interaction between
rice and the bacterial pathogen, Xanthomonas oryzae pv.
Bacterial leaf streak (BLS) of rice is caused by the oryzae (Xoo) as a model. We had previously shown that
gram-negative plant-pathogenic bacterium Xanthomonas secreted cell wall degrading enzymes such as two
oryzae pv.oryzicola(Xoc). Due to the lack of resistance Cellulases (ClsA and CbsA), Lipase/esterase (LipA), and
cultivars, the study of pathogen population structures, Xylanase (XynB) are important virulence factors of Xoo.
disease prevalence and regional group structure of Xoc Conversely, these enzymes are potent inducers of rice
became the key to prevent BLS outbreak. Unfortunately, immune responses as their activity in degrading the cell
molecular typing techniques for deciphering the wall releases DAMPs that serve as a mark of infection.
epidemiology of Xoc have been of very limited use to Xoo suppresses DAMP induced rice innate immunity
date. For the study of Xocprevalence monitoring and using proteins that are secreted into plant cells using the
population gene structures, we compared toxicity-related Type 3 secretion system (T3S). We are exploring the role
genetic differences( AvrRxo1 and XopO) and a variable of Xoo T3S secreted proteins in suppression of innate
number of tandem repeats (VNTR) of 40 Xoc strains immunity and the role of specific rice genes in induction
from China. AvrRxo1, XopO gene and 10 VNTR sites of innate immunity. Our results obtained using
were used to evaluate the 40 strains in China. The results Agrobacterium mediated transient transfection assays
showed that 10 VNTR sites were diversity for cluster indicate that four Xoo T3S secreted proteins, called
analysis. The phylogenetic tree was constructed based on XopN (Xanthomonas Outer protein N), XopQ, XopX and
the data of 10 sites by the software cluster 3.0. And these XopZ are involved in suppression of cell wall damage
40 strains were divided into 11clusters when the genetic induced rice innate immunity. Our recent results on
43
ICPPB2014 Abstracts
characterization of Xoo XopQ will be presented. The cyclic diguanylate (c-di-GMP), was found to negatively
characterization of certain rice functions whose regulate the T3SS expression and Pel production of D.
expression is upregulated after cell wall damage and dadantii. c-di-GMP is a ubiquitous secondary
which might be involved in elaboration of DAMP messenger in many bacterial species. The cellular
induced innate immunity will also be discussed. levels of c-di-GMP are controlled through the opposing
activities of diguanylatecyclases (DGCs) and
S2-K2 Pseudomonas syringae type III effectors, phosphodiesterases (PDEs). The GGDEF domain of
their targets, and suppression of plant immunity DGCs catalyzes the synthesis of c-di-GMP from GTP,
James Alfano* whereas the EAL domain of PDEsdegrades c-di-GMP to
Center for Plant Science Innovation and the Department GMP. In this work, a dual GGDEF/EAL domain
of Plant Pathology, University of Nebraska, Lincoln, NE protein CsrD was chosen and its effect on virulence
68588-0660 USA factors was examined. Although CsrD contains both
jalfano2@unl.edu GGDEF and EAL domains, it acted as a c-di-GMP
phosphodiesterase. In addition, CsrDwas found to be a
The bacterial pathogen Pseudomonas syringae is regulator of RsmB, a regulatory small RNA.
dependent on a type III secretion system and the type III CsrDregulated T3SS expression and Pel production
effector proteins (T3Es) it injects into plant cells to cause through the RsmA-RsmB pathway by manipulating
disease. The enzymatic activities of T3Es and their plant levels of rsmBRNA. RsmA is a small RNA binding
targets are not well understood. I will discuss the protein that negatively regulates the T3SS and Pel.
progress that we have made on T3E activities and plant RsmB binds to RsmA and neutralizes its effect on the
targets. One T3E that will be discussed is HopE1, which T3SS and Pel production.Finally, a sophisticated
strongly suppresses both effector-triggered and regulatory circuit consisting of other novel regulators
PAMP-triggered immunity. We found that HopE1 which regulatethe T3SS expression and Pelproduction
requires a eukaryotic co-factor that is needed for HopE1 through manipulating RsmB will also be discussed in
to target a plant protein that functions in the microtubule this presentation.
network. Arabidopsis plants expressing HopE1
dissociate this protein from the microtubule network. S2-K4 The Battle of the Rhizosphere: How
Arabidopsis mutants lacking this target are more Ralstonia solanacearum defeats competitors
susceptible to P. syringae and exhibit reduced immune and overcomes plant defenses to invade host
responses.Thus, HopE1 disables the microtubule network roots
and one effect is that HopE1 inhibits protein secretion Caitilyn Allena*, Tuan Minh Trana, Alejandra I. Huertaa,
from plant cells, which is predicted to be beneficial to the Florent Ailloudb, Martha Hawesc, and Philippe Priorb
pathogenbecause it inhibits the delivery of a
Dept. of Plant Pathology, University of
immunity-associated products to the apoplast. I will also Wisconsin-Madison, Madison, WI USA
discuss the progress that we have made on other P. b
Peuplements Végétaux et Bioagresseurs en Milieu
syringae T3Es including an update on HopU1, which is a Tropical, INRA-CIRAD, Saint Pierre, La Réunion,
mono-ADP-ribosyltransferase that modifies several France
RNA-binding proteins including GRP7. We have found c
Dept. of Plant Sciences, University of Arizona, Tuscon,
that over-expression of GRP7 protects plants to multiple AZ, USA
types of pathogens. This benefit is greatly reduced in cza@plantpath.wisc.edu
salicylic acid signaling and biosynthesis mutants. GRP7
binds to several different immunity-associated RNAs and Ralstonia solanacearum, a soilborne pathogen that
enhances their translation. Thus, HopU1 benefits causes bacterial wilt disease of many crops, forms a
pathogenesis by inactivating an RNA-binding protein diverse species complex. Humans have globally
that helps translate immunity-associated RNAs into distributed R. solanacearum strains, but different strains
components of the plant immune response. rarely occur in the same field and have never been found
in the same plant, for unknown reasons. In the stems
S2-K3 Small things, big Impact: Regulation of and rhizospheres of whole tomato plants, a North
virulence factors by c-di-GMP and regulatory American strain (K60) outcompeted both a tropical
small RNA in a bacterial pathogen Asian strain (GMI1000) and a cool temperate Race 3
Chinghong Yang* strain that causes potato brown rot (UW551). Strain K60
Department of Biological Sciences, University of also inhibited growth of other R. solanacearum strains in
Wisconsin-Milwaukee, WI 53211, U.S.A culture. The inhibitory activity was secreted, heat-labile,
chyang@uwm.edu degraded by proteinase K, larger than 50 kDa, and had
no activity against tested non-R. solanacearum bacteria.
The bacterial soft rot pathogen Dickeyadadantii utilizes We hypothesize that the inhibition is caused by
the type III secretion system (T3SS) to suppress the host bacteriocins, antimicrobial proteins active against closely
defense response, and also secretes pectatelyases (Pels) related strains, which may mediate competition among R.
to macerate the plant cell wall. In our previous study, solanacearum strains in the field. Five Tn5 mutants of
44
ICPPB2014 Abstracts
strain K60 had fully or partially lost the ability to inhibit citrullihave been reported in many parts of the world,
growth of Race 3 strains on plates. One insertion mainly in melons and watermelon. To date, there is no
interrupted dsbA, encoding a periplasmic protein-folding reliable source of resistance to A. citrulli, and available
chaperone likely to have pleiotropic functions, but the means to combat the disease are of limited
other four mutants had Tn5 insertions in genes encoding efficiency.Therefore, BFB represents a serious threat to
diverse Rhs domain proteins of around 65 kDa. The K60 the cucurbit industry worldwide [1].Despite the economic
genome encodes 21 putative Rhs proteins, which are cell importance of the disease, little is still known about basic
surface or secreted toxins. Characterization of these aspects of A. citrulli and BFB pathogenesis. We have
genes and their products is underway to better define the previously demonstrated that, as similar as other
role of bacteriocins in competitive fitness and exclusion Gram-negative plant pathogenic bacteria, A. citrulli
of this major pathogen. relies on a functional type III secretion system for
pathogenicity [2], and that polar flagellum is an important
The R. solanacearum genome encodes two extracellular virulence determinant of this pathogen [3]. We have also
nucleases (exDNases). In planta transcriptional analyses shown that A. citrulli mutants impaired in type IV pilus
show these are both expressed during tomato (T4P) biosynthesis or function lose the ability to perform
pathogenesis. We hypothesized that these exDNases twitching motility and are severely affected in biofilm
contribute to bacterial wilt virulence. Microscopic formation and virulence [4, 5]. Recently we have detected
studies revealed that in response to R. solanacearum, the phenomenon of phenotypic variation in strain M6,
tomato and pea root border cells form DNA-containing the A. citrulli model strain in our lab. In bacteria,
extracellular traps that immobilize the pathogen. phenotypic(or phase) variation is often associated with
Treatment of plant roots with DNase I increased root genetic or epigenetic alterations, and is a phenomenon
susceptibility to infection by R. solanacearum. Analysis that allows bacteria to adapt and maintain cell viability
of single and double R. solanacearum mutants lacking under changing environments [6, 7].Colonies of A.
the putative exDNase genes confirmed that both genes citrulliM6 phenotypic variants (PVs) possess a clearly
encode functional secreted deoxyribonucleases, named altered morphology relative to parental strain M6.While
NucA and NucB. A nucA/nucB double mutant was less parental strain colonies possess an opaque and smooth
virulent than wild type on tomato plants following a appearance, PV colonies are translucent, fuzzy and
naturalistic soil-soak inoculation and, surprisingly, also bigger in size than parental strain colonies [8].
after direct inoculation into stems. This indicates that Interestingly, M6 PV colonies resemble those of M6
bacterial exDNases contribute to virulence after root mutants impaired in T4P [4, 8]. Ac M6 colonies are
invasion. This double mutant also had reduced ability typically surrounded by haloes that can be clearly
to inhibit growth of pea and tomato roots. In addition, the detected by the naked eye. These haloes are formed by
nucA/nucB mutant no longer grew on DNA as sole T4P-mediated twitching motility, which occurs at the
carbon source, suggesting that extracellular DNases not edge of the colony. In contrast,as similar as observed for
only degrade plant extracellular traps, but may also serve T4P mutants, no visible haloes are formed around PV
a nutritional purpose. Finally, the nucA/nucB mutant colonies. In agreement with these observations, electron
formed abnormal non-spreading colonies and produced microscopy revealed that PVs do not produce T4P. PVs
abnormally thick biofilms, which contain EPS and DNA. also differ from parental strain in swimming motility and
If R. solanacearum needs exDNases to form normal biofilm formation, and all assessed PVshave reduced
biofilms on xylem vessel walls, this may explain why virulence relative to strain M6 [6].We are currently
NucA and NucB contribute to virulence after root entry. characterizing physiological and genetic alterations in
Together these results indicate that extracellular DNases the PVs to gain insights into the phenomenon of
contribute quantitatively to bacterial wilt virulence, phenotypic variation in this bacterium.
possibly by several different mechanisms.
Acknowledgement: This research was partially
S2-O1 Phenotypic variationin the cucurbit supported by the United States-Israel Binational
pathogenic bacteriumAcidovorax citrulli: Agricultural Research and DevelopmentFund.
characterization of the phenomenon and
relationship with virulence References:
[1] S. Burdman, R. Walcott (2012). Molecular Plant
Saul Burdman*,Tally Rosenberg, Ram Kumar Shrestha
Pathology, 13, 805.
Department of Plant Pathology and Microbiology, The [2] O. Bahar, S. Burdman (2010). Israel Journal of Plant
Robert H. Smith Faculty of Agriculture, Food and Sciences, 58, 19.
Environment, The Hebrew University of Jerusalem, [3] O. Bahar, N. Levi, S. Burdman (2011). Molecular
Rehovot 76100, Israel Plant-Microbe Interactions, 24, 1040.
saul.burdman@mail.huji.ac.il [4] O. Bahar, T. Goffer, S. Burdman (2009). Molecular
The Gram-negative bacteriumAcidovoraxcitrulli (Ac) is Plant-Microbe Interactions, 22, 909.
the causal agent of bacterial fruit blotch (BFB) disease of [5] O. Bahar, L. De La Fuente, S. Burdman (2010).
cucurbits. Serious economic losses caused by A. FEMS Microbiology Letters, 312, 33.
45
ICPPB2014 Abstracts
[6] F. Wisniewski-Dye, L. Vial (2008). Antonie van Agricultural Ministry of China (nyhyzx 201303015;
Leeuwenhoek, 94, 493. 201003015; 201003066), and Key Subject Construction
[7] S.M. Rosenberg (2001). Nature Reviews Genetics, 2, Program of Zhejiang for Modern Agricultural
504. Biotechnology and Crop Disease Control
[8]R.K. Shrestha, T. Rosenberg, D. Makarovsky, N. (2010DS700124-KF1101; -KF1203; - KF1309).
Eckshtain-Levi, E. Zelinger, J. Kopelowitz, J. Sikorski, S.
Burdman (2013). PLoS One, 8, e73189. S2-O3 Comparative analysis of the regulators
involved in the virulence of Dickeya solani
S2-O2 Regulatory role of T6SS Hcp and strains
antibiotic weakens the pathogenicity and
Ewa Lojkowskaa*, Marta Potrykusa, Małgorzata
colonization of resistant strain RS-1 in
Golanowskaa,b, Marco Galardinic, Alesio Mengonic, Marco
Acidovorax avenae subsp. Avenae
Bazzicalupoc, Nicole HugouvieuxCottePattatb
a
Mengyu Ge, Bin Li, Guanlin Xie Department of Biotechnology, Intercollegiate Faculty of
State Key Laboratory of Rice Biology, Institute of Biotechnology, University of Gdansk and Medical
Biotechnology, Zhejiang University, 310058, Hangzhou, University of Gdansk, Kladki 24, Gdansk, Poland
b
China Microbiologie Adaptation et Pathogénie UMR5240,
cythiage@163.com INSA de Lyon, Lyon, France
c
Department of Biology, University of Florence,
The type of six secretion system (T6SS) in Gramnegative Florence, Italy
bacteria represents a new type of secretion system, which ewa.lojkowska@biotech.ug.edu.pl
is largely associated with bacterial pathogenesis, biofilm
forming and virulence factors secretion. The aim of our Bacteria from the genus Dickeya (formerly Erwinia
study is to characterize theregulatory role of Hcp gene chrysanthemi) are plant pathogens causing severe
inAcidovorax avenae subsp. avenaeRS-1,which is the diseases in many economically important crops [1]. A
causal agent of bacterial brown stripe and cause severe majority of the strains responsible for potato disease in
diseases in many plants including rice with huge Europe belong to a newly established Dickeya solani
[2]
economic importance. Previous studies reported that Hcp species . Although some ecological and
acted as a central component of T6SS-dependent epidemiological studies have been carried out, little is
intercellular effector transport. We found thatHcpis known about the regulation of D. solani virulence,
associated withthe other components of T6SS by especially regulation of the expression of pectinolytic
comparing the gene expression of 20 T6SS genes enzymes, the main pathogenicity factors. The
between the wild type and the hcp gene mutant characterization of D. solani strains based on genomic
constructed by the insertional mutagenesis. Furthermore, fingerprinting indicated that they are genetically
the interaction of protein was found between Hcp and homogenous. A phenotypic characterization of the tested
VgrG orLipo. In addition, the mutant strain was able to strains indicated differences in their pathogenicity.
reduce pathogenicity. Overall, our results indicated that Mutants of four D. solani strains were constructed by
hcp gene play a role in pathogenicity of A. avenae subsp. inactivating the genes coding either for one of the main
avenae. negative regulators of D. dadantii virulence (kdgR,
pecSandpecT) or for the synthesis and perception of
The widespread use of antibiotics as growth promoters in signaling molecules (expIandexpR). Analysis of these
agriculture may make bacteria expose to low levels of mutants indicated that PecS, PecT and KdgR play a
the drugs. There are intrinsic mechanisms underlying similar role in both species, repressing to different
resistance to antibiotics in many Gram-negative degrees the synthesis of virulence factors. The
bacteria.Strain RS-1 as a serious pathogenic bacterium thermoregulatorPecT seems to be a major regulator of D.
has its own resistance mechanism. In our study, we solani virulence [3]. The presented study also reveals the
found that low level of antibiotics negatively influenced role of quorum sensing mediated by ExpI and ExpR in D.
the pathogenicity, motility and the expression of T6SS solani virulence on potato [3].
genes and root surface colonizationof Leica DMIRBby
constructing therecombinantRS-1 strains which harbored In addition the presence of pathogenicity-related genes
a constitutively expressed RFP reporter gene. The results (coding for pectate lyases, cellulase and regulators of
showedthat low level of antibiotics was involved in the virulence factors) in eight sequenced D. solani genomes
pathogenicity and colonization of strain RS-1 to rice has been checked performing a Blast-BBH search, using
plants. the genes from D. dadantii 3937 as queries. All the
studied genes appear to have an ortholog inside each D.
Acknowledgement:This project was supported by solani strain. Most of pathogenicity-related genes are
Zhejiang Provincial Natural Science Foundation of highly conserved. This study suggested that the
China (R13C140001),National Natural Science differences in the virulence of tested strains could be
Foundation of China (31371904), the Fundamental related rather to the regulation of the expression of
Research Funds for the Central Universities, the
46
ICPPB2014 Abstracts
pathogenicity-related factors than to the presence of flagellar biosynthetic genes are missing in approximately
specific virulence factor(s). 5 % of the 300 Xanthomonas strains tested, and were
associated to different genetic events. These aflagellate
Acknowledgement: This work was supported by grants strains are also non-motile. We also determined that half
from the NSC 2013/08/M/NZ9/00974 and CNRS and of the Xff strains, which were isolated from the same
MESR to UMR5240. This project also benefited from seed-borne epidemic than Xff 4834-R were non-motile
the Polish-French collaboration program Polonium and and that this ratio is conserved among strains colonizing
Polish-Italian collaboration program Canaletto. the next bean seed generations. No impact of flagellation
References: could be demonstrated on the efficiency of Xff/Xap)
[1]I.K. Toth, J.M. Van der Wolf, G. Saddler,E. transmission to seeds via vascular and floral pathways.
Lojkowska, V. Hellias, M. Pirhonen, L. Tsros, J. We show that aflagellate strains adhere less than motile
Elphinstone (2011).Plant Pathol, 60, 385. strains, have limited dispersal abilities on leaf surface,
[2] J.M. Van der Wolf, E.H. Nijhuis, M. Kowalewska, G. and a reduced aggressiveness, but are as fit as motile
Saddler, N. Parkinson, J. Elphinstone, L.J.G. Pritchard, I. strains within xylem vessels and induce less defense
K. Toth, E. Lojkowska, M. Potrykus, M.Waleron, P. De responses in non-host plants than flagellate strains.
Vos, I. Cleenwerck, M. Pirhonen, L. Garlant, V. Helias, Hence, some advantages to aflagellation may explain the
J.F. Pothier, V. Pflüger, B. Duffy, L. Tsror, S. Manulis, S. maintenance of non-motile strains in natural populations.
(2014). Int. J. Systemat. Evol. Microbiol, 64, 768. Acknowledgement: We thank all members of “The
[3]M.Potrykus,M.Golanowska,N.Hugouvieux-Cotte-Patt French Network on Xanthomonads” for their
at, E. Lojkowska (2014). Mol. Plant-MicrobeInter, DOI: involvement in Xff 4834-R genome sequencing and
10.1094/MPMI-09-13-0270-R. annotation. This work was partly supported by the
S2-O4 Flagellar motility and fitness in TESTA project, grant agreement N°311875 within
xanthomonads FP7-KBBE.
Marie Agnès Jacques*, Jean François Guimbaud, Arnaud References:

Indiana, Armelle Darrasse [1] A. Darrasse, S. Carrère, V. Barbe, et al. (2013). BMC
INRA, UMR1345 Institut de Recherche en Horticulture genomics, 14:761.
et Semences, F-49071 Beaucouzé, France S2-O5 Use of genome-wide analysis for
Marie-agnes.jacques@angers.inra.fr deciphering the role of the PecS masterregulator
Xanthomonads are plant-associated bacteria that during the early stages of Arabidopsis infection
establish neutral, commensal or pathogenic relationships by the enterobacteriumDickeyadadantii
with plants. These γ-proteobacteria cause diseases on J. Pédrona,b, B. Alunnib, P. Malfattib, E. Chapelleb, Frédérique
more than 400 different host plants, many of them having Van Gijsegema,b*
great economic importance (e.g. rice, wheat, cassava, a
UMR1392 Institut d’Ecologie et des Sciences de
citrus, sugar cane, bean, crucifers, cotton). In order to l’Environnement (iEES Paris), 7 quai Saint Bernard
developp effective approaches to control bacterial 75005 Paris, France
pathogens a comprehensive understanding of virulence b
UMR217 INRA/AgroParisTech/UPMC, 16 rue Claude
factors in bacterial pathogens should be proposed. The Bernard, 75005 PARIS, France
genome deciphering of bacterial pathogen is a first step vangijse@agroparistech.fr
in this direction. The recent release of the annotated
genomic sequence of X. fuscans subsp. fuscans strain The broad host range phytopathogenic bacterium
4834-R (Xff 4834-R), one of the agents of the common Dickeyadadantii is the causal agent of soft rot disease in
bacterial blight of bean, revealed a deletion of 34 genes many crops and ornamentals. Soft rot symptoms are
(33 kbp) involved in flagellar biosynthesis, which results mainly caused by the production and secretion of plant
in the abolition of swimming motility for this strain [1]. It cell wall-degrading enzymes (CWDE). Several other
is, however, known that bacterial motility is an important factors are however essential in the early stages of
feature involved in biofilm formation, plant colonization plant-bacterium interactions leading to an efficient plant
and hence considered as a pathogenicity factor. The colonization and ultimately to disease expression. The
objective of this study was to determine the extent of the production of these diverse pathogenicity factors is finely
loss of integrity of the flagellar cluster and the impact of tuned by complex and intertwined bacterial regulatory
the loss of swimming motility capacity in fitness in networks and the role of several global
xanthomonads. Collections representing the genetic regulatorsinvolved in this controlhas been characterized
[1]
diversity of the Xanthomonas genus and of the four . Among them, the PecS master regulator is required
genetic lineages (X. axonopodis pv. phaseoli GL1, GL2, for the expression of virulence factors encoding genes
GL3, and Xff) of the agents responsible for the common both in vitro and in plantaand PecS was shown to
bacterial blight of bean were established and tested with prevent the early expression of these genes during the
markers of the integrity of the flagellar cluster. Groups of asymptomatic colonization phase of infection [2]. To have
47
ICPPB2014 Abstracts
a genome-wide view of the effects of this regulator on factors that contribute to virulence[1]. DSF signalling was
bacterial gene expression in planta, we devised a new first described in the crucifer pathogen Xanthomonas
method allowing the isolation of bacterial RNA from campestris pv. campestris (Xcc) where the signal was
infected plant leaves during the early phases of infection. identified as cis-11-methyl-dodecenoic acid [1,2]. Work in
This permitted us to compare by microarrays the D. Xcc has established that the synthesis and perception of
dadantiitranscriptomicprofiles in bacteria present on the DSF signal require products of the rpf gene cluster
leaves surfaces and in planta. Comparison of the profiles (for regulation of pathogenicity factors). The synthesis of
of a pecS mutant with those of the wild type parent DSF is dependent on RpfF, whereas the RpfC/RpfG
revealed that, in bacteria present on surface leaves at the two-component system is implicated in DSF perception
beginning of infection (6 hours post infection), about 400 and signal transduction [1,3,4]. RpfC is a complex hybrid
genes are differentially modulated in the PecS mutant as sensor kinase whereas the RpfG regulator has a
compared to its wild type parent. In addition to genes CheY-like receiver (REC) domain attached to an
involved in protein secretion or encoding secreted HD-GYP domain, which acts to degrade the second
proteins (pectinases, proteases, type III effectors), the messenger cyclic di-GMP [4]. Mutation of rpfF, rpfG, or
most represented categories included genes involved in rpfC in Xcc leads to a coordinate reduction in the
metabolism, transport, motility/chemotaxis and encoding synthesis of particular virulence factors such as the
regulatory proteins. More than one half of these genes extracellular enzymes endoglucanase, protease, and
arealso modulated in the wild type parent at the onset of endomannanase and the extracellular polysaccharide
maceration (24 hpi) as compared to their expression on (EPS) xanthan, alterations in biofilm formation and a
leaves surfaces. By contrast, at the onset of maceration, reduction in virulence [3,4]. This is consistent with the
only a few dozens of genes show a differential involvement of RpfC/RpfG in perception and
expression in the pecS mutant as compared to the wild transduction of the DSF signal in a linear pathway.
type parent. Among them are the genes clustered around However recent studies using RNA-Seq to compare the
the pecS gene and these genes are highly expressed transcriptomes of wildtype and isogenic rpf mutants in
throughout the infection both during the asymptomatic Xcc has provided evidence for additional complexity in
colonization phase and at the onset of maceration. the Rpf/DSF regulatory system [5]. The findings suggest
Collectively, these data confirmed the role of PecS as a that RpfC can recognize other environmental signals (in
key regulator during the colonization phase of infection addition to DSF) and point to the possibility of
and allowed the identification of new genes putatively alternative sensing mechanisms for DSF. A mutagenesis
important in D. dadantii virulence. approach identified XC_2579 (called RpfS) as a second
sensor for DSF in Xcc [6]. RpfS is a complex sensor
References: kinase predicted to have multiple Per/Arnt/Sim (PAS)
[1] A. Charkowski, C. Blanco, G. Condemine, D. Expert, domains, a histidine kinase domain and REC domain.
T. Franza, C. Hayes, N. Hugouvieux-Cotte-Pattat, E. DSF bound to the isolated N-terminal PAS domain with
LópezSolanilla, D. Low, L. Moleleki, M. Pirhonen, A. a Kd of 1.4 μm. RpfS controlled expression of a sub-set
Pitman, N. Perna, S. Reverchon, P. Rodríguez Palenzuela, of genes distinct from those controlled by RpfC.
M. San Francisco, I. Toth, S. Tsuyumu, J. van der Waals, Mutation of XC_2579 was associated with a reduction in
J. van der Wolf, F. Van Gijsegem, C.H. Yang, I. virulence of Xcc to Chinese Radish when assayed by leaf
Yedidia(2012).Annu Rev Phytopathol, 50:425-449. spraying but not by leaf inoculation, suggesting a role for
[2] N. Mhedbi-Hajri., P.Malfatti, J.Pédron, S.Gaubert, RpfS-controlled factors in the epiphytic phase of the
S.Reverchon, F.Van Gijsegem (2011).Environ Microbiol, disease cycle [6].
13: 2901–2914.
Acknowledgement: The work of the authors has been
S2-O6 Emerging complexities of the action of supported in part by grants awarded by the Wellcome
the Rpf/DSF system in the regulation of Trust WT093314MA to J.M.D and R.P.R and
Xanthomonas virulence WT100204AIA senior fellowship grant to R.P.R.); the
Max Dowa*, Yvonne McCarthya, Melanie Febrerb, Shiqi Anb, Science Foundation of Ireland (SFI 07/IN.1/B955 to
Robert Ryanb J.M.D. and SFI 09/SIRG/B1654 to R.P.R.).
a
School of Microbiology, University College Cork, References:
College Road, Cork, Ireland [1] R.P. Ryan, J.M.Dow (2011).Trends Microbiol, 19,
b
Divisions of Molecular Microbiology and Molecular 145.
Medicine, College of Life Sciences, University of Dundee, [2] L.H. Wang, Y. He, Y. Gao, J.E. Wu, Y.H. Dong, C.
Dundee, UK He, S.X Wang, L.X. Weng, J.L. Xu, L. Tay, R.X. Fang,
m.dow@ucc.ie L.H.Zhang(2004). Mol Microbiol, 51, 903.
Phytopathogens belonging to the genus Xanthomonas [3] H. Slater, A. Alvarez-Morales, C.E. Barber,
use cell-to-cell signalling mediated by molecules of the M.J.Daniels, J.M. Dow Mol. Microbiol(2000). 38, 903.
Diffusible Signal Factor (DSF) family, which comprises
cis-2-unsaturated fatty acids, to regulate expression of
48
ICPPB2014 Abstracts
[4] R.P. Ryan, Y. Fouhy, J.F. Lucey, L.C. Crossman, S. chloroform vapors, we measured the population sizes
Spiro, Y.W.He, L.H. Zhang, S. Heeb, P. Williams, J.M. that colonizes the mesophyll. On the one hand,
Dow (2006). Proc Natl Acad Sci USA, 103, 6712 Xcc∆mcp0324gain the capacity to internalize into leaf
[5] S.Q. An, M. Febrer, Y. McCarthy, D.J., Tang, L. tissues of non-host plants such as tomato, bean and stock,
Clissold, G. Kaithakotti, D. Swarbreck, J.L. Tang, J. in contrast to the wild type, which remains confined to
Rogers, J.M. Dow, R.P. Ryan (2013).Mol Microbiol, 88, the leaf surface of these plants. On the other hand, this
1058. mutant lost the ability to internalize into leaf tissues of a
[6] S.Q. An, J. H. Allan, Y. McCarthy, M. Febrer, J.M. host plant such as A. thaliana. We developed a biotest
Dow and R.P. Ryan (2014).Mol. Microbiol, doi: allowing to demonstrate that Xcc∆mcp0324 is not
10.1111/mmi.12577. attracted by a wound on cabbage leaves, while the
wild-type strain is attracted by these wounds and cause
S2-O7 Role of a chemotaxis sensor, XCC0324, symptoms. The original phenotypes were restored in the
in the leaf ingress ofXanthomonascampestris pv. complemented mutant. Thus, we show that XCC0324
campestris detect host plants of Xcc as favorable environment and
Arnaud Indianaa,b,c*, Armelle Darrassea,b,c, Martial Brianda,b,c, non-host plants as repulsive ones. All these data support
Marie-Noëlle Brisseta,b,c, Jacky Guillaumesa,b,c, Céline the importance of sensing, through MCPs, in
Rousseaua,b,c, Laurent Noëld,e, and Marie-Agnès Jacquesa,b,c colonization of plants by Xcc leading or not to its
a
INRA, UMR1345 Institut de Recherche en Horticulture internalization into the tissues. The identification of the
et Semences, F-49071 Beaucouzé, France. ligand(s) that specifically bind(s) to XCC0324 would
b
AGROCAMPUS OUEST, UMR1345 Institut de allow to propose new control methods limiting the
Recherche en Horticulture et Semences, F-49045 Angers, ingress of Xcc into host tissues.
France. S2-O8 Cyclic nucleotide signalling and the
c
Université d’Angers, UMR1345 Institut de Recherche en regulation of virulence in the phytopathogen
Horticulture et Semences, SFR 4207 QUASAV, F-49045 Xanthomonas campestris
Angers, France.
d
INRA, LIPM UMR441, F-31326 Castanet-Tolosan, Shiqi An*, Robert P. Ryan
France. Division of Molecular Microbiology, College of Life
e
CNRS, LIPM UMR2594, F-31326 Castanet-Tolosan, Sciences, University of Dundee, Dundee, UK
France. s.an@dundee.ac.uk
arnaud.indiana@gmail.com
Signal transduction pathways involving cyclic nucleotide
Xanthomonads are plant pathogenic bacteria that are second messengers occur in all domains of life where
responsible for worldwide diseases with a high they act to link perception of environmental or
socio-economic impact. Understanding early stages of intracellular cues and signal to specific alterations in
the interaction between bacteria and host could help to cellular function. Bacteria use both cyclic
predict and control the emergence of infectious diseases. mononucleotides and cyclic dinucleotides for this
The genus Xanthomonas is known to group bacteria that purpose.The roles of cyclic adenosine
are tightly adapted to their host range. For instance, 3’,5’-monophosphate (cyclicAMP) and
Xanthomonas campestris pv. campestris (Xcc) is bis-(3’–5’)-cyclic di-guanosine monophosphate (cyclic
responsible for black rot on a large range of di-GMP) in control of a variety of bacterial processes
Brassicaceae. During the early stages of infection, including virulence are now well established. However,
pathogenic bacteria such as Xcc must ingress into host the roles in bacterial signalling of cyclic guanosine
plant tissues to colonize the apoplast or the xylem and 3’,5’-monophosphate (cyclic GMP) are poorly
mulitiply. This process may be mediated by plant signals understood, such as the diversity of processes that are
originating from the sites of entry.The objective of this regulated and how regulation is exerted remain largely
work was to demonstrate the involvement of chemotaxis unknown.
and specifically XCC0324 in the ingress of Xcc in host
plant leaves. An OrthoMCL analysis of chemotaxis Xanthomonascampestrispv. campestris (Xcc), the causal
sensor encoding genes in 133 Xanthomonas genomes agent of black rot disease of cruciferous plants
showed that one chemotaxis sensor, XCC0324, is world-wide and it is also a model organism for molecular
specific to X. campestris strains. Divergent alleles of this studies of plant–microbe interactions. A genetic screen in
Methyl-accepting Chemotaxis Protein (MCP) were found Xcc identified that XC_0250, which encodes a protein
in phylogenetically closed species such as X. arboricola, with a class III nucleotidyl cyclase domain, is required
X. dyei, X. hortorum, and X. pisi. This sensor is located for cyclic GMP synthesis. Purified XC_0250 was active
in an integron broadly distributed in xanthomonads. We in cyclic GMP synthesis in vitro. The linked gene
constructed a mutant, Xcc∆mcp0324, which is deleted of XC_0249 encodes a protein with a cyclic
a gene encoding the chemotactic sensor, XCC0324, and mononucleotide-binding (cNMP) domain and a GGDEF
quantified its ability to colonize leaves of hosts and diguanylatecyclase domain. The activity of XC_0249 in
non-hosts plants. Based on leaf surface disinfection using cyclic di- GMP synthesis was enhanced by addition of
49
ICPPB2014 Abstracts
a
cyclic GMP. The isolated cNMP domain of XC_0249 College of Life Science and Technology, Guangxi
bound cyclic GMP and a structure–function analysis, University, 100 Daxue Road, Nanning, 530004, P. R.
directed by determination of the crystal structure of the China
b
holo-complex, demonstrated the site of cyclic GMP College of Biotechnology, Guilin Medical University,
binding that modulates cyclic di-GMP synthesis. 109 North 2nd Huan Cheng Road, Guilin, 541004, P. R.
Mutation of either XC_0250 or XC_0249led to a reduced China
c
virulence to plants and reduced biofilm formation in State Key Laboratory for Conservation and Utilization
vitro. This is the first description of a regulatory pathway of Subtropical Agro-bioresources, 100 Daxue Road,
in which cyclic GMP modulates virulence and biofilm Nanning, 530004,P. R. China
formation through interaction with a novel effector that jbl1971@gxu.edu.cn
directly links cyclic GMP and cyclic di-GMP signalling.
In plant pathogenic bacteria, type III secretion system
S2-O9 Coordination of virulence traits in (T3SS) encoded by hrp (hypersensitive reaction and
Xanthomonas: a common motif with dual role pathogenicity) cluster plays a crucial role in interaction
with the host plants. In Xanthomonas campestris pv.
Rai R, Pradhan BB, Samal B, Kakar A, Kondareddy A,
campestris (Xcc), hrpG and hrpX play a pivotal role in
Chatterjee Subhadeep*
the regulation of hrp genes.In both plants and inducing
Centre for DNA fingerprinting and Diagnostics, medium, HrpG activates the transcription of hrpX and
Hyderabad, INDIA. 500001 HrpX subsequently activates the transcription ofhrp
subhadeep@cdfd.org.in genes.
Xanthomonas group of plant pathogens causes diseases RNA polymerases of bacteria are essential components
in more than 350 different plant hosts. Xanthomonas of the transcriptional apparatus. The transcription
oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. initiation directed by RNA polymerase requires different
oryzicola (Xcola) are important members of the genus sigma factors to recognize specific promoter sequences.
Xanthomonas which causes serious disease of rice. Sigma factors play important roles in transcription. So
Xanthomonas coordinates the production of virulence clarifying the relationship between HrpX/hrpX and
associated function by the production and sensing of sigma factors is remarkable for investigating the hrp
fatty acid signaling molecule known as Diffusible signal regulation and dissecting the pathogenesis of this
factor (DSF) by a process known as quorum sensing. We phytopathogen.
are using molecular genetics and biochemical tools to
understand the quorum sensing process in Xoo and Fourteen sigma factors were annotated in Xcc 8004,
Xcola pathogens. Functional studies indicate that Xoo including a housekeeping gene. In this work, the deletion
and Xcola regulate the production of virulence associated mutants of these sigma factors were constructed. The
function in an atypical manner [1, 2]. We have also phenotypes, pathogenicity and HR reaction of these
identified several components of the DSF mediated mutants were examined. As a result, these mutants have
sensing and factors required for regulation of production no influence on extracellular amylase, extracellular
of virulence associated functions. We have proposed a cellulose, extracellular protease, exopolysaccharide,
model in which DSF regulates functions required for motility and biofilm. These mutants also have no
entry, colonization and movement in a contrasting significant effect on virulence and HR reaction, except
fashion to promote infection and spread inside host. for XC2974. RT-PCR and GUS assay showed that
Apart from the role of DSF in quorum sensing, we have XC2974 activateshrpX in inducing medium, while
identified a novel role of DSF in Xanthomonas-host represseshrpX in plant. General stress response assay
interaction and signaling which will be discussed. revealed that the mutant of XC2974 is sensitive to Cd 2+,
Cu2+, osmotic pressureand alkali pressure.
Acknowledgement: We thank Department of
Biotechnology, Government of India, IYBA grants and S2-O11 PhoP-PhoQ is an essential
CDFD for providing financial support for this work. two-component signal transduction system in
Xanthomonas campestris pv. campestris 8004
References:
[1] R. Rai, B.B. Pradhan, M. Ranjan, S. Chatterjee Baoyu Penga,b, Xiaoying Chena, Rongxiang Fanga, Wei Qiana*
a
(2012). Mol. Plant Microbe Interact, Vol. 25: 789. State Key Laboratory of Plant Genomics, Institute of
[2] B.B. Pradhan, M. Ranjan, S. Chatterjee (2012). Mol. Microbiology, Chinese Academy of Sciences, Beijing
Plant Microbe Interact. Vol, 25: 1157. 100101, China.
b
University of Chinese Academy of Sciences, Beijing
S2-O10 Functional characterization of the 100049, China.
sigma factors in Xanthomonascampestris pv. qianw@im.ac.cn
campestris
Bacteria employ two-component signal transduction
Li-Yan Yanga, Lin Wanga,b, Li-Chao Yanga, Le Zhoua,
systems (TCSTS) to sense and respond to environmental
Yong-Liang Gana, and Bo-Le Jianga,c
stimuli. Although the majority of TCSTSs are
50
ICPPB2014 Abstracts
nonessential and help bacteria to adapt to changing controls many pathogenicity determinants in addition to
environments, essential TCSTSs modulating basic HrpB, while PrhG is dispensable to this signal cascade
biological processes have been identified in multiple and activates very few target genes [3, 4]. Their main
bacteria. Here we demonstrated that TCSTS genes difference is that PrhG is 50-amino acids larger in size
phoPXcc and phoQXcc of Xanthomonas campestris pv. than HrpG, which exists in C-terminal extension of PrhG
campestris are essential, whereas their orthologs in X. but absent in HrpG.PrhG seems to be an ancient
oryzae pv. oryzae are nonessential. Merodiploid phoPXcc duplication of HrpG which took place in R.
and phoQXcc bacterial strains were constructed, in which solanacearum before the divergence of its various
the chromosomal copies of these genes could be strains[3]. PrhG is well conserved in R. solanacearum
genetically deleted only if the plasmid-borne copies, strains, but varied at its C-terminal extension region. It
under the control of arabinose promoters, remained suggests that this extension region might be related to
functional. When transcription of the plasmid-borne their different functions.Here we focused on this
phoPXcc or phoQXcc genes was repressed by an inhibitor, extensionin PrhG C-terminal regionand found that when
growth of the phoP or phoQ mutants was completely this extra extension is deleted, the truncated PrhG can
arrested. In addition, we determined that phoPXcc and completely substitute the function of HrpG. It can
phoQXcc are located in a tetra-cistronic operon. Mutations recover the bacterial growth in planta and pathogenicity
on the chromosomal copies of phoPXcc and phoQXcc of hrpG mutant to wild type. It confirmed that this
resulted in deficiencies in virulence, swimming motility C-terminal extension of PrhGsuppresses its activation to
and flagella assembly. The histidine kinase PhoQXcc has pathogenicity in R.solanacearum.This C-terminal
phosphotransferase and phosphatase activity towards the extension might impair the binding activity of PrhG onto
response regulator PhoPXcc. PhoPXcc binds to one of the promoter of target genes.
promoters within its own operon and autoregulates the
transcription of PhoQXcc. These results suggest that Acknowledgement:
PhoP-PhoQ orthologs are an ideal model to study the This work was supported in part by KAKENHI
molecular basis of the rapid evolutionary emergence of (Grant-in-Aid forScientific Research) from the Japan
essential genes in closely-related bacterial species. Society for the Promotion ofScience (16658020 to Y. H.
and 17380031 to K. O.), in part by grants fromthe
Acknowledgement: This work was supported by the national natural science Foundation of China(31200067
National Basic Research Program of the Ministry of to Y. Z.) and Fundamental Research Foundation for the
Science and Technology of China and the National Central Universities (XDJK2013C156)to YZ.
Science Foundation of China.
References:
S2-O12 The C-terminal extension of [1] S. Genin, T.P. Denny(2012).Annu Rev Phytopathol,
PrhGimpairsits activation on hrp expression and 50, 67–89.
pathogenicity in Ralstonia solanacearum [2] M.Valls, S.Genin, C.Boucher (2006).PLoSPathog,2,
e82.
Yong Zhanga*, AkinoriKibab,
[3] L.P. lener, P.Manfredi, M.Valls, S.Genin (2010).
YasufumiHikichib,KouheiOhnishic
a
Ralstoniasolanacearum. J Bacteriol, 192, 1011–1019.
Research Center of Bioenergy and Bioremediation, [4] Y. Zhang, L. Chen,T.Yoshimochi, A.Kiba, Y.
Southwest University, BeiBei, Chongqing, China Hikichiand K. Ohnishi (2013).Microbiol, 159,
b
Laboratory of Plant Pathology and Biotechnology, 1695-1704.
Kochi University, Nankoku, Kochi, Japan
c
Research Institute of Molecular Genetics, Kochi S2-O13 Regulation of motility-mediated
University, Nankoku, Kochi, Japan virulence in Pseudomonas syringae pv. tabaci
bioyongzhang@swu.edu.cn 6605
Ralstoniasolanacearum is the causative agent of Yuki Ichinose*, Fumiko Taguchi
bacterial wilt disease on many plant species and HrpG is Grad. School of Environ. and Life Science, Okayama
the master regulator of its pathogenicity[1, 2]. PrhG is a University, 1-1-1, Tsushima-naka, Kita-ku, Okayama,
close paralog of HrpG (72% global identity and 96% Japan
similarity in the helix-loop-helix domain) and both them yuki@okayama-u.ac.jp
belong to the OmpR/PhoB family of two-component
response regulators. Although both HrpG and PrhG Pseudomonassyringae pv. tabaci 6605 is able to swim
activate hrpB expression, they show quite distinct using flagella and to swarm using flagella and type IV
function in pathogenicity. hrpG mutant is impaired in pili (T4P). The ∆fliC, a defective mutant of flagellin that
growth in planta and completely lost the pathogenicity is a major component of flagella filament, lost both
on host plants, while PrhG is dispensable for the swimming and swarming motility [1], while the ∆pilA, a
bacterial growth in planta and prhG mutant just shows defective mutant of pilA pilin that is a major component
slightly weaken virulence than that of wild type. HrpG is of T4P, lost swarming motility but retained swimming
activated by PrhA-PrhIR-PrhJ signal cascade and motility [2]. The ∆fliC mutant remarkably reduced the
51
ICPPB2014 Abstracts
ability to produce N-acyl homoserine lactones (AHLs), assumed to depend, at least in part on the activity of
quorum sensing molecules [3], whereas the ∆pilA mutant polyphenol oxidases (PPOs)[3]. These enzymes are known
retained the ability to produce AHLs [2]. Both ∆fliC and to oxidize plant polyphenols to quinonic intermediates.
∆pilA mutants reduced iron acquisition ability and Despite circumstantial evidence only a few reports have
activated tolerance to antimicrobial compounds but by related the production of quinones to plant PPOs and there
different mechanisms. The ∆fliC mutant reduced the is little experimental support if any, for the potency of
production of pyoverdine, a major first siderophore in these plant products against bacterial pathogens. The
this bacterium, and increased tolerance to antimicrobial rarity of research on these compounds can be explained
compounds with an enhanced expression of multidrug either in terms of their instability[4-6], as well as the
efflux pump genes mexEF/oprN[3]. On the other hand, the difficulties in calibrating an in-vitro system capable of
∆pilA mutant reduced expression of genes for investigating them, or a well rooted but wrong consensus.
achromobactin, a second siderophore, and increased Here we provide data to support a mechanism by which
tolerance to antimicrobial compounds with an enhanced self oxidation of plants' polyphenols grants defense to
expression of mexAB/oprM genes [2]. These findings Zantedeschia plants against Pc. By calibrating both
suggest that immobility affects bacterial gene expression concentration and timing in a reaction system containing
in order to adapt to the given environment, and that there PPO and polyphenols, we could demonstrate the
are global networks for the regulation of bacterial PPO-induced activation of specific plant polyphenols as
virulence-related genes. evidenced by the complete killing of the phytopathogen.
The role of quinones was demonstrated using cysteine as a
Acknowledgement: This work was supported in part by trap, and verification of the formed inactive adducts using
Grants-in-Aid for Scientific Research (B) (No. 24380028) mass spectroscopy. While some quinones presented a
from the Ministry of Education, Culture, Sports, Science strong bactericidal effect, others caused growth inhibition.
and Technology of Japan. To the best of our knowledge, and despite numerous
References: reports on the positive inter-correlation among levels of
[1]R. Shimizu, F. Taguchi, M. Marutani, T. Mukaihara, PPO, polyphenols and plant resistance, causal
Y. Inagaki, K. Toyoda, T. Shiraishi and Y. Ichinose relationships of these three components have not been
(2003). Mol. Genet. Genomics,269, 21. demonstrated. Our results provide conclusive evidence
[2]F. Taguchi, Y. Ichinose (2011).Mol. Plant-Microbe that the concerted action of PPOs generating antibacterial
Interact, 24, 1001. quinones from preformed latent polyphenols, play an
[3]F. Taguchi, M. Yamamoto,M. Ohnishi-Kameyama, M. essential role in shaping the true antibacterial potency of
Iwaki, M. Yoshida, T. Ishii, T. Konishi and Y. Ichinose the plants. We anticipate our assay to promote research on
(2010).Microbiology, 156, 72. the relationships between plant's PPO and specific
polyphenols, and resistance to pathogens and herbivores.
S2-O14 Plant antimicrobial phenolics: arms in
the battle against Pectobacterium carotovorum References:
[1]T.Luzzatto, A.Golan, M. Yishay, I.Bilkis, I.Yedidia
Iris Yedidiaa*, J. R. Joshia,b, T. LuzzattoKnaanb, S. Yariva, Z. (2007). J Agric Food Chem, 55, 10315.
Keremb [2] T. Luzzatto-Knaan, ZKerem, A. Doron-Faigenboim,
a
Department of Plant Science, ARO, The Volcani Center, I.Yedidia(2014). Mol. Plant Pathol. In Press.
DerechHamacabim 20, P.O. Box 6, Bet Dagan, 50250, [3]L.Pourcel, J. M.Routaboul,V.Cheynier, L.Lepiniec,
Israel I.Debeaujon(2007).Trends Plant Sci, 12, 29.
b
Department of Plant Pathology and Microbiology, The [4] L.Li, v. Steffens (2002).Planta, 215, 239.
Robert H. Smith Faculty of Agriculture, Food and [5]W.S.Pierpoint(1969). Biochem J, 112, 609.
Environment, The Hebrew University of Jerusalem, P.O. [6]S. Quideau, D.Deffieux, C. Douat-Casassus, L.
Box 12, Rehovot 76100, Israel; Pouysegu(2011).Angewandte Chemie (International ed.
irisy@volcani.agri.gov.il in English), 50, 586.
Phenolic compounds were shown to play a key role in the S2-P1 The ColR-regulated alanine-rich outer
defense response of the ornamental tuberous plant membrane protein AOMP exerts a pleiotropic
Zantedeschia aethiopica to the soft rot pathogen role in T3SS formation in Xanthomonas citris pp.
Pectobacteriumcarotovorum (Pc)[1]. However, their citri
antibacterial activity is relatively weak and doesn't afford
the plant extensive protection in comparison to common Jing Guoa, XueSonga, XiaojingFanb, Huasong Zoub*,Gongyou
antibiotics. Using proteomic tools, we have recently Chena
a
demonstrated the involvement of oxidizing enzymes in Z. School of Agriculture and Biology, Shanghai Jiao Tong
aethiopica defense response to Pectobacterium with University, Shanghai, China
b
special emphasis on polyphenol oxidases (PPOs)[2]. The Department of Plant Protection, Fujian Agriculture and
generation of an efficient antimicrobial plant defense Forestry University
mainly against necrotrophic pathogens, has often been huasongzou@gmail.com
52
ICPPB2014 Abstracts
The membrane topology formed by membrane-spanning reveal that ahybrid histidine kinase, SreS, is involved in
Hrc proteins is essential for type three secretion system the SreKSreRphosphotransfer process to control salt
to determine pathogenicity on host plants and stressresponse in the bacterium
hypersensitive response in nonhosts. Here, we reported Xanthomonascampestris.The N-terminal receiver domain
on the function of an alanine-rich outer membrane of SreS acts as aphosphate sink by competing with the
protein AOMP from Xanthomonascitri spp. citri. Totally, response regulatorSreR to accept the phosphoryl group
49 alanines were identified all over the 114 aa small from thelatter’s cognate histidine kinase SreK. This
protein, nevertheless it was highly conserved in regulatoryprocess is critical for bacterial survival
Xanthomonas species. Deletion mutation of the coding because thedephosphorylated SreR protein participates in
region impaired the pathogenicty in citrus and activatingone of the tandem promoters (P2) at the 5′
hypersensitive eliciting in Nicotianabenthamiana. The endof the sreK-sreR-sreS-hppKoperon, and then
hrp genes in hrpB, hrpC, hrpD and hrpF operons, as well modulatesa transcriptional surge of the
as the hrp associated gene hpa2, were suppressed in stress-responsivegene hppK, which is required for folic
ΔaomPmutant during citrus infection. In vivo secretion acid synthesis.Therefore, our study dissects the
and subcellular localization analysis revealed that AOMP biochemical process of a positive feedback loop in which
was bound to cell membrane but not secreted outer. a ‘three-component’signalling system fine-tunes
Protein-protein interactions showed that AOMP weak expressionkinetics of downstream genes.
interacted with HrpB2 and the interaction was occurred
at plasma membrane. The disruption of aomPalso Acknowledgements: We thank Ms. Yao Wu of our
reduced bacterial tolerance to copper. The transcription Institute for her assistance incarrying out folic
ofaomP was dependent on the ColR gene, either under acid-related experiments. Three anonymousreviewers
copper stress or citrus infection condition. These data gave valuable suggestions for improving the
demonstrated that the alanine-rich outer membrane manuscript.This work was supported by the National
AOMP was involved in bacterial adaption to diverse BasicResearch Program of the Ministry of Science and
environments, especially required for the assembling of Technologyof China (Grant 2011CB100700), the
type III secretion apparatus during infection. National Science Foundationof China (Grants 31070081,
Acknowledgements: This work was supported by the 31370127) and the BasicResearch of Frontiers of the
National Natural Science Foundation of China Chinese Academy of Sciences(Grant KSCX2-EW-J-6).
(31171832, 31230059 and 31071656) and the Special S2-P3 Effects of mutagenesis of PhaR gene of
Fund for Agro-scientific Research in the Public Interest A
Xanthomonas oryzae pv. oryzaePXO99 on the
(201003067). virulence in rice and hypersensitive response in
S2-P2 A three-component signalling system tobacco
fine-tunesexpression kinetics of HPPK Xiaofang Cui, Xiaolan Peng, Congfeng Song*
responsible for folatesynthesis by positive Department of plant pathology, College of Plant
feedback loop during stressresponse of Protection/Key Laboratory of Integrated Management of
Xanthomonas campestris Crop Diseases and Pests,Ministry of Education,Nanjing
Fangfang Wanga,b*, ChaoyingDenga,b, Zhen Caia,b, Ting Wanga,
Agricultural University,Nanjing,China
Li Wanga, XiaozhengWanga,c, Xiaoying Chena,
cfsong@njau.edu.cn
RongxiangFanga, Wei Qiana PhaR is a regulation protein in the synthesis of
a
State Key Laboratory of Plant Genomics, Institute polyhydroxyalkanoates (PHA) in bacteria [1-2]. The
ofMicrobiology,ChineseAcademy of Sciences, function of PhaR in Xanthomonas oryzae pv. oryzae
Beijing100101, China (Xoo) is unknown. In this study, the effects of the
b
University of Chinese Academy of Sciences, mutagenesis of phaR gene of PXO99A on virulence in
Beijing100049, China rice and hypersensitive response in Nicotiana
c
School of Biological Sciences, Capital benthamiana were investigated. The PhaR gene
NormalUniversity, Beijing 100048, China knock-out mutant PXO99'phaR was generated based on
wangff@im.ac.cn double crossover homologous
During adaptation to environments, bacteria recombination[3].PXO99'phaR decreased the
employtwo-component signal transduction systems, extracellular polysaccharide (EPS) production by 50%.
whichcontain histidine kinases and response regulators, When inoculated in rice leaves by leaf clipping method,
tosense and respond to exogenous and cellular stimuliin PXO99'phaR displayed reduced virulence in terms of
an accurate spatio-temporal manner. Althoughthe protein lesion length and bacterial multiplication compared with
phosphorylation process between histidinekinase and the wild type strain. The mutation of PhaR gene
response regulator has been welldocumented, the enhancedhypersensitiveresponseinduction in a manner
molecular mechanism fine-tuningphosphorylation levels dependent on induced expression of hrp- associated
of response regulators iscomparatively less studied. Here protein 1 (hpa1) encoding gene inthe nonhost tobacco
we combinedgenetic and biochemical approaches to leaves. The introduction of a phaR coding sequence
53
ICPPB2014 Abstracts
containing cosmid restored changed phenotype of the 87-15 for this study. We also thank Dr. Carol Bender
mutant to that of the wild type strain.The results indicate (Oklahoma State University,USA) for her critical reading
that the PhaR gene plays an important role in and editing the manuscript prior tosubmission. This work
determining the virulenceof Xooinrice and suppressing was supported by the State Key Basic Research and
immune response of tobacco. Development Project of China (2012CB114003), the
Natural Science Foundation of China (31371905) and the
Acknowledgement: This work was supported by grants Special Fund for Agro-scientific Research in the Public
from the Natural Science Foundation of Jiangsu Province Interest of China (210303015 and 201003067-09).
(BK2012766) and Start-up Foundation for Returned
Overseas of Ministry of Education ([2011]1568). S2-P5 Identification and characterization of
integron-mediated antibiotic resistance in the
References: phytopathogen Xanthomonas oryzaepv. oryzae
[1]A.J. Anderson, E.A. Dawes (1990). Microbiol
Rev,54,450-472. Ying Xua,b*, QingquanLuob, Mingguo Zhoua
a
[2]M. Potter, M.H. Madkour, F. Mayer, et al. (2002). College of Plant Protection, Nanjing Agricultural
Microbiology, 148, 2413-2426. University,Weigang Road 1, Nanjing, China.
b
[3]C.F. Song, B. Yang (2010). Mol Plant Microbe Shanghai Landscape Gardening Research Institute,
Interact, 23(7), 893-902. Longwu Road 899, Shanghai, China.
xuying2002@gmail.com
S2-P4 HrcT is a key component of the type III
secretion system in Xanthomonas and also In 2007 and 2008, 534 single-colony isolates of
regulates the expression of the key hrp X.oryzaepv. oryzae were collected in the south of China
transcriptional activator HrpX to determine their susceptibility to streptomycin. The test
results showed that four isolates (0.75% of the total) of
Zhiyang Liu,LifangZou, XiaoboXue, Lulu Cai, Wenxiu Ma, Li
X.oryzaepv. oryzae from the same county in Yunnan
Xiong, ZhiyuanJi, Gongyou Chen*
Province were highly resistant to streptomycin and that
School of Agriculture and Biology, and State Key the resistance mechanism could not be attributed to the
Laboratory of Microbial Metabolism, Shanghai Jiao occurrence of strA-strB genes or to the rpsLgene
Tong University, 800 Dongchuan Road, Shanghai, mutation previously determined to cause streptomycin
200240, China resistance in phytopathogenic bacteria[1].
gyouchen@sjtu.edu.cn
These four streptomycin-resistant isolates (YNA7-1,
The type III secretion system (T3SS), encoded by YNA10-2, YNA11-2, and YNA12-2) were examined via
hrp(hypersensitive response and pathogenicity) genes in PCR amplification for the presence of class 1, class 2,
Gram-negative phytopathogenic bacteria, delivers and class 3integrons and aadA1 and aadA2 genes,which
repertoires of T3SS effectors (T3SEs) into plant cells to confer resistance to streptomycin and spectinomycin.
trigger the hypersensitive response (HR) in nonhost or The class1integrase gene intI1and the aminoglycoside
resistant host plants and promote pathogenicity in adenylyltransferase gene aadA1 were identified in all
susceptible plants. The expression of hrp genes in four resistant isolates but not in 25 sensitive isolates.
Xanthomonas is regulated by two keyregulatory proteins, PCR amplificationsshowed that 7790-bp, 7162-bp,
HrpG and HrpX. However, the interactions between hrp 7790-bp, and 7240-bp resistance integronswith
gene products in directing secretion are largely unknown. transposition gene modules (tni module) in 3' conserved
Here we demonstrated that HrcT of X. oryzaepv. segments existed in YNA7-1, YNA10-2, YNA11-2, and
oryzicola(Xoc)functions as a T3S component and YNA12-2, respectively. Subsequent analysisof
positively regulates the expression of hrpX. Transcription sequences indicated thatthe integrons of YNA7-1 and
of hrcT occurs via two distinct promoters, one is with the YNA11-2 carried three gene cassettes in the
hrpB operon (T1) and the second(T3) within hrpB7. Via order|aacA3|arr3|aadA1|.The integron of YNA10-2
either T1 or T3 promoter, the defect in Hrp phenotype by carried only|arr3|aadA1| gene cassettes. The integron of
hrcT mutant was restored in the presence of hrcT only YNA12-2 lacked a 550-bp sequence including part of
from Xanthomonasspecies, but not other intI1but it still carried |aacA3|arr3|aadA1|gene cassettes.
phytopathogenic bacteria. An N-terminally truncated The analysis of inactive mutants and complementation
HrcT was able to bind the hrpX promoter and activate tests confirmed that the aacA3gene conferred resistance
the expression of hrpX, supporting that HrcT is a positive to tobramycin, kanamycin, gentamicin and netilmicin;
regulator of hrpX. A revised model showing the the arr3gene conferred resistance to rifampicin; and the
regulatory interactions between HrcT, HrpX and HrpG is aadA1gene conferred resistance to streptomycin and
proposed. spectinomycin.The resistance phenotypes of the four
Acknowledgement:We are grateful to Dr. Bing Yang isolates corresponded with their resistance gene cassettes,
(Iowa State University, USA) to provide us the plasmid except that YNA7-1 and YNA12-2 did not show
pHZWavrXa27 and to Dr. Chaozu He (Hainan rifampicin resistance. Sequence comparison revealed that
University, China) to kindly provide us the rice line no gene cassette array in GenBank was in the same order
54
ICPPB2014 Abstracts
as in the integrons of the four resistant isolates in this function of its T3SS. To validate these results, we are
study and theaadA1, which was identical in the four currently testing the effects of inhibitors on the activities
resistant isolates, showed 99% identity with aadA1 of more T3SS gene promoters,transcription of T3SS
sequences in GenBank.The result of a stability test genes, and bacterial virulence on rice. Further elucidation
showedthe resistance phenotype, theaadA1 gene, and the of molecular mechanismsby which the plant phenolic
intI1gene were completely stable in YNA7-1 and inhibitors regulate T3SS expression and functions in Xoo
YNA12-2 but unstable in YNA10-2 and YNA11-2.To is required in the future.
our knowledge, this is the first report of resistance
integron in a phytopathogenicbacteria[2]. Acknowledgement: This work was supported by the
grants from the Special Fund for Agro-Scientific
Acknowledgement: This study was sponsored by the Research in the Public Interest (201303015)and the
National Natural Science Foundation of China Research Growth Initiative of the University of
(31100100) and Agricultural Ministry of China Wisconsin-Milwaukee
(nyhyzx07-056).
S2-P7 Lon is involved in negative regulation of
References: the hrp gene expression via resolving HrpX in
[1]Y. Xu, Q.Q. Luo, M.G. Zhou (2013). PLoS One, Xanthomonasoryzae pv. oryzae
8(2):e55962.
S Tsugea, Yumi Ikawaa*, A Majima a, A Furutani b
[2]Y. Xu, X.F. Zhu, M.G. Zhou, et. Al(2010). J a
Phytopathol, 158(9): 601. Laboratory of Plant pathology, Graduate School of
Agriculture, Kyoto Prefectural University, Kyoto
S2-P6 Inhibition of type III secretion system of 606-8522, Japan
b
Xanthomonas oryzae pv. oryzae by plant Gene Research Center, Ibaraki University, Inashiki,
phenolic compounds and its derivatives 300-0393, Japan
y_kametani@kpu.ac.jp
Susu Fana, Fang Tiana, Huamin Chena, Chinghong Yangb,
Chenyang Hea* Like many other plant-pathogenic bacteria, Xanthomonas
a
State Key Laboratory for Biology of Plant Diseases and oryzae pv. oryzae possesses hrp (hypersensitive reaction
Insect Pests, Institute of Plant Protection, Chinese and pathogenicity) genes encoding proteins involved in
Academy of Agricultural Sciences, Beijing 100193, the construction of a type III secretion (T3S) apparatus,
China. through which bacterial effector proteins are directly
b
Department of Biological Sciences, University of secreted into plant cells. HrpG and HrpG-regulating
Wisconsin-Milwaukee, WI 53211, U.S.A HrpX are known as key regulators for the
hechenyang@caas.cn infection-specific hrp gene expression. Besides them,
several other regulators have been reported. It is likely
Increased resistance to antibiotics due to the that the hrp regulatory system has complicated networks
inappropriate use has been shown in many pathogenic withknown and unknown regulatory factors. To identify
bacteria. An alternative approach is to the novel hrp reguratory gene, we generated a mutant in
searchforcompounds that can target the virulence factors which lux operon was controlled by thehpa1 promoter,
rather than their viability of bacterial pathogens. The and then, a transposon was randomly inserted into the
type III secretion system (T3SS), an essential virulence genome of the mutant. A mutant was obtained in which
factor in many gram-negative bacteria, has been regarded the bioluminescence was increased under
as such a target. It has been reported that some small thehrp-inducing condition. Sequence analysis of the
molecule compounds were able to inhibit the expression mutant showed that the transposon was inserted in the
and function of T3SS. Xanthomonas oryzae pv. ATP-dependent serine protease gene (lon). Lon-deleted
oryzae(Xoo),the causingagent of bacterial blight of rice, mutant was regenerated from the wild type, and the
requires a T3SS for its virulence. In this study, a library expression of hrpG,hrpX and other hrp genes regulated
of plant phenolic compounds was screened by using by HrpX were compared with that of the wild type by
GFP-based reporter system combined with semi-quantitative RT-PCR and the GUS reporter assay.
high-throughput flow cytometry assay. The promoter The expression of hrpG,hrpXin the Lon mutant was not
activity ofthe harpin gene hpa1 was assayed in significantlydifferent from that inthe wild type, while the
hrp-inducing media (XOM2) in presence or absence of expression of other hrp genes was significantly increased
compounds. Results from the assays showed TS001 and in the mutant. Western blot analysis showed that the
TS006 significant inhibited the promoter activity of hpa1. accumulation of HrpX was increased in the Lon mutant
To find out whether these inhibitors affect the function of compared with that in the wild type, suggesting that Lon
T3SS, the ability to induce hypersensitive response (HR) was involved in negative regulation of hrp gene
in non-host tobacco leaves by Xoo strain PXO99A was expression by resolving HrpX in X.oryzae pv. oryzae.
analyzed. Pre-treatment of PXO99A with either TS001 or The secretion of XopR, a T3S effector,was compared
TS006 resulted in significantly attenuated HR, between the wild type and the Lon mutant in rice leaves
suggesting that the inhibitors effectively suppressed the using the Calmodulin-dependent adenylate cyclase
55
ICPPB2014 Abstracts
reporter assay. The accumulation of cAMP per bacterial [2]F.F. Wang,C.Y. Deng, Z. Cai, T. Wang, L. Wang,
cells became the maximum at 24 hours after inoculation X.Z. Wang, X.Y. Chen, R.X. Fang ,W.A. Qian (2013).
and decreased later in both leaves inoculated with the Environ Microbiol.
wild type and mutant. Compared with leaves inoculated
with the wild type, however, the decrease rate was S2-P9 The quorum sensing system of
slower in leaves with the mutant. The results suggest that Xanthomonas hortorum pv. pelargonii affects
Lon is involved in repression of hrp gene expression also virulence and movement in pelargonium plants
in planta, which may be important in the efficient Laura Chalupowicza*, Victoria Barela, Isaac Barashb, Michal
switching between hrp gene expression and other Reuvena, Orit Drora, Saul Burdmanc, Shulamit
virulence-related gene expression ManulisSassona
a
S2-P8 StoS and SreKRS positively regulate Department of Plant Pathology and Weed Research,
EPS, swarming, and stress resistance but ARO, The Volcani Center, Bet Dagan 50250, Israel
b
negatively regulate hrp genes in Xanthomonas Department of Molecular Biology and Ecology of Plants,
oryzae pv. oryzae Faculty of Life Sciences, Tel Aviv University, Tel Aviv,
Israel
c
Dehong Zheng*, Lifang Ruan Department of Plant Pathology and Microbiology,
State Key Laboratory of Agricultural Microbiology, Faculty of Agriculture, The Hebrew University, Rehovot,
College of Life Science and Technology, Huazhong Israel
Agricultural University, Wuhan 430070, PR China laura@volcani.agri.gov.il
Dehong1573@126.com
The plant pathogen Xanthomonas hortorum pv.
Xanthomonas oryzae pv. oryzae (Xoo) is a notorious rice pelargonii (Xhp)is the causal agent of bacterial blight in
pathogen that causes the destructive rice disease bacterial pelargonium; the most threatening bacterial disease of
blight. Successful bacterial infections and multiplication this ornamental worldwide. To gain an insight into the
require accurate signal transduction systems. mechanisms of virulence utilized by Xhp we have cloned
Two-component signal transduction systems (TCSs) are the quorum sensing system which is mediated by the
used by bacteria to sense and adapt to the environment. diffusible signal factor (DSF). Mutagenesis of rpfF
A genome-wide reverse genetic approach was used to (encoding the DSF synthase) and rpfC (encoding the
investigate TCSs in Xoo PXO99A. The stress sensor kinase of the two-component system RfpC/RpfG)
tolerance-related oxygen sensor (StoS)[1]and the salt showed significant reduction in incidence and severity of
response kinase, regulator, and sensor (SreKRS) [2]were the diseaseon pelargonium plants. Additionally,
found to positively regulate extracellular polysaccharide overproduction of rpfF prevented pathogenicity and
(EPS) production and swarming, which are very bacterial mobility in pelargonium plant. Confocal
important to Xanthomonas virulence. To study the signal laser-scanning microscopy images of inoculated plants
transduction circuit of these two TCSs, isobaric tags for with GFP-labeled strains showed that the pathogen
relative and absolute quantitation (iTRAQ) were homogeneously colonized the lumen of xylem vessels
analyzed. iTRAQ data indicated that EPS production and and after 21 days, reached the apex and colonized the
swarming were regulated by the modulation of intercellular spaces of the leaf’s mesophyll tissue. In
carbohydrate metabolisms and chemotaxis, respectively. contrast, the mutants were confined to the inoculation
Furthermore, the signaling circuits of StoS and SreKRS site, forming a discontinuous bacterial growth consisted
were found to overlap each other. iTRAQ data further of large aggregates. Biofilm formation in the presence of
suggested that StoS and SreKRS are master switches of plant extracts showed that the mutants in rpfF and rpfC,
stress resistance. Interestingly, StoS and SreKRS but not the wild type, formed aggregates. Expression
negatively regulate the expression of the hypersensitive levels of putative virulence genes, virK and virB
response and pathogenicity proteins, which are essential (encoding T4SS components), pelE1 (encoding a pectate
for Xanthomonas pathogenicity. The two antagonistic lyase) and gumM (encoding an extracellular
regulatory mechanisms resulted in similar virulence polysaccharide), were highly induced in the wild type at
levels in StoS and SreKRS mutants when compared with the first 48 h compared to the mutants. Results presented
the wild-type strain. indicate that QS is required for virulence, movement and
colonization of Xhp in pelargonium plants.
Acknowledgement: We are grateful to Dr. Ya-Wen He,
Dr. Jin He, and Dr. Gong-You Chen for providing the
experimental materials. This study was supported by
National Natural Science Foundation of China (Project
J1103510, http://www.nsfc.gov.cn/).
References:
[1]Y.Ikawa, A.Furutani, H.Ochiai, S.Tsuge(2014). Mol
Plant Microbe Interact.
56
ICPPB2014 Abstracts
S2-P10 TriP, a response regulator interacting School of Life Sciences & Biotechnology, Shanghai Jiao
with PdeR, regulated exopolysaccharides Tong University, No. 800 Dongchuan Road, Shanghai
secretion and virulence of Xanthomonas oryzae 200240, P. R. China.
pv. oryzae yawenhe@sjtu.edu.cn
Haiyun Li, Fang Tian, Huamin Chen, Chenyang He* The genus Xanthomonas is one of the most ubiquitous
State Key Laboratory for Biology of Plant Diseases and plant-associated pathogens and they can infect at least
Insect Pests, Institute of Plant Protection, Chinese 124 monocotyledonous and 268 dicotyledonous species,
Academy of Agricultural Sciences, Beijing 100193, including many economically important
China. crops.Xanthomonas oryzae pv. oryaze (Xoo),
hechenyang@caas.cn Xanthomonas campestris pv. campestris (Xcc),
Xanthomonas axonopodis pv. manihotis (Xam) have
The bacterial second messenger c-di-GMP has been been listed as three of the top 10 plant pathogenic
implicated in regulating a variety of cellular activities bacteria in molecular plant pathology.
including virulence of phytopathogens. Diguanylate
cyclases and phosphodiesterases are the enzymes to In our lab, we are using Xcc as a model strain to study
synthesizeand degrade c-di-GMP, respectively. We have Xanthomonas pathogenesis.Xcc produces a range of
previously identified a phosphodiesterase PdeR in virulence factors, including extracellular enzymes,
Xanthomonasoryzae pv. oryzae (Xoo), the causal agent extracellular polysaccharides, toxin, type III effectors,
of bacterial blight of rice. The function of PdeR was which are collectively essential for pathogenesis.
shown to be required for the full virulence of Xoo [1]. To DSF-dependent quorum sensing is one of the key
understand the regulatory mechanism of PdeR on the mechanisms for Xanthomonas to regulate virulence
virulence of Xoo, we performed yeast two-hybrid (Y2H) factor production. Previously, we have characterized
screen to identify its interacting partners. Among the DSF chemical structure, DSF-regulated biological
candidate interactors, we were particularly interested in functions, DSF signal transduction pathway and
PXO_04421, which is a response regulator containing regulatory network, and structural basis of DSF
REC and trans_reg_C domains, thus was named as TriP biosynthesis autoinduction. Currently, we are interested
(transcriptional regulator interacting with PdeR). The in (1) molecular mechanism of DSF-dependent sucrose
full-length of triP gene (triPFL) was cloned for additional uptake; (2) DSF biosynthetic pathway and mechanism.
experiments. The interaction between TriPFL and PdeR
were further confirmed by Y2H assays and GST Xanthomonas is an obligate aerobic pathogen. When Xcc
pull-down assays. In order to determine specific domains invade into plant and multiply within the vascular system,
required for the interaction between PdeR and TriP, we oxygen supply is limited. We previously characterized a
tested different truncated fragments of TriP and PdeR in two component system RavS/RavRto sense low-oxygen
Y2H assays. The results demonstratedthat the REC tension and to promote the production of exoenzyme to
domain of TriR, and the EAL and REC domains of PdeR degrade the plants’ cell. We are now interested in how
directly participated in the binding between the two RavS/RavR senses the low-oxygen tension signal.
proteins. Then, we generated a triP gene deletion mutant Anothercharacteristic featureof Xanthomonasis the
to test its virulence and related phenotypes. The results production of yellow, membrane-bound pigments called
showed that thetriP mutant caused less severe disease xanthomonadins. Xanthomonadins have been found to be
symptoms and shorter lesion lengths. The extracellular associated with bacterial survival, H2O2 resistance and
polysaccharide (EPS) production decreased about 30% in virulence. Poplawsky et al (1993-2000) showed that Xcc
the mutant, while the swimming and swarming motility produces a diffusible factor (DF) to regulate
did not change. These phenotypes were consistence with xanthomonadin production. We have recently purified
those of the pdeR mutant, suggesting they might function DF fromXccstrains 8004 and XC1andchemically
together in a protein complex to regulate EPS production characterized it as 3-hydroxybenzoic acid(3-HBA). We
and virulence of Xoo.Currently, we are trying to identify are now interested in (1) how xanthomonadin is
the genes that are regulated by TriP, and find out whether synthesized in Xcc; (2) how DF regulates xanthomonadin
c-di-GMP affects the function of TriP. production; (3) the Xcc-Plant interactions via small
Acknowledgement: This work was supported by the signaling molecules.
grants from NSFC (31370160) and BNSF (5142017). References:
References: [1]L. Zhou, T.W. Huang, S. Sun, J.Y. Wang, G. Chen,
[1]F.Yang,et al., (2012). Mol Plant Microbe A.R. Poplawsky, Y.W. He (2013).Mol Plant Microbe
Interact,25(10), 1361-9. Interact, 26(10), 1239.
[2]L. Zhou, J.Y. Wang, J. Wang, A. Poplawsky, S. Lin,
S2-P11 Molecular biology of Xanthomonas B. Zhu, C. Chang, T. Zhou, L.H. Zhang, Y.W. He
pathogenesis (2013).Molecular Microbiology, 87(1), 80.
Xingyu Wang, Jiayuan Wang, Ming Li, Lian Zhou, Yawen He*
57
ICPPB2014 Abstracts
[3]Y.W. He, J. Wu, L. Zhou, F. Yang, B.L. Jiang, J.L. [2]K.Ireton, N.W.Gunther4th,A.D. Grossman (1994). J.
Tang, L. Bai, Y. Xu, Z. Deng, L.H. Zhang (2011). Mol Bacteriol, 176, 5320–5329.
Plant Microbe Interact, 24(8), 948. [3]A.A.Bartosik, J.Mierzejewska,C.M. Thomas,
[4]Y.W. He, C. Boon, L. Zhou, L.H. Zhang (2009). G.Jagura-Burdzy(2009).Microbiology, 155, 1080–1092.
Molecular Microbiology, 71(6), 1464. [4]D.Jakimowicz,P. Zydek ,A.Kois,
[5] Y.W. He, L.H. Zhang (2008). FEMS Microbiology J.Zakrzewska-Czerwin ´ska , K.F.Chater(2007b). Mol.
Reviews, 32, 842. Microbiol., 65,625–641.
S2-P12 parB2 deficiency in S2-P13 Biofilm formation of
Ralstoniasolanacearumaffectsmorphology and Ralstoniasolanacaerum in intercellular spaces
motility and implication of ralfuranones in its biofilm
formation
XiaomanShea,b, ZifuHea*
a
Plant Protection Research Institute, Guangdong Yuka Moria*, Hideyuki Ohnishib, KanakoInouec, Kenichi
Academy of Agricultural Sciences, Guangzhou, China Ikedac, Hitoshi Nakayashikic, Shiho Ishikawaa, AkinoriKibaa,
b
Guangdong Provincial Key Laboratory of High KouheiOhnishid, Kenji Kaib, YasufumiHikichia
a
Technology for Plant Protection, Guangzhou, China Laboratory of Plant Biotechnology & Pathology, Kochi
hezf@gdppri.com University, 200 Monobe, Nankoku, Kochi, Japan
b
Graduate School of Life and Environmental Science,
The segregation of bacterial chromosomes is a complex Osaka Prefecture University, Sakai, Osaka, Japan
c
processengaging several proteins. Recent studies showed Graduate School of Agricultural Science, Kobe
that thepargenes directly involved in this process. University, Kobe, Hyogo, Japan
d
Depletion of par gene affects chromosome RIMG, Kochi University, Nankoku, Kochi, Japan
segregation,sporulationinBacillus sky0903@hotmail.co.jp
subtilis[1,2],cytokinesis,growth, cell morphology and
motility inCaulobactercrescentus[3,4]. In order to After invasion into roots, Ralstoniasolanacearum strain
investigate the function of the parB2 gene in OE1-1 (OE1-1) first colonizes in intercellular spaces[1].
Ralstoniasolanecarum, a parB2 mutant was constructed. However, the mechanisms of OE1-1 colonization in
Accordingto theupstreamanddownstream sequence of intercellular spaces remain poorly understood. It is
parB2gene in R.solanecarum, the PCR primers were difficult to analyze colonization of OE1-1 in intercellular
designed to amplifythe 500bp-fragments of spaces of roots, because OE1-1 cells do not
upstreamanddownstreamof parB2gene,respectively. The synchronically infect there. We thus analyzed behavior
upstreamanddownstreamfragments andchloramphenicol of GFP-labeled OE1-1cells in intercellular spaces with
acetyl transferase gene were cloned into suicide vector the model system using tomato leaves [1]. Observation
pK18mobsacB, resulting in pK18-parB2-cat. The vector under the fluorescence microscope showed aggregation
pK18-parB2-Cat was then introduced into R. of GFP-fluorescence in intercellular spaces. We then
solanecarum strain SSf-4(isolated from tomato). The observed OE1-1 cells in intercellular spaces under the
parB2 mutant, named SSf-4-m, was generated by scanning electron microscope. The observation showed
homologous recombination and selected by two-steps biofilm formation by OE1-1 cells surrounded by an
method.SSf-4-m was identified by PCR.Afterincubation extracellularmatrix on surfaces of tomato cells adjacent
at 30ćfor 2 days on triphenytetrazolium chloride (TZC) to intercellular spaces. Interestingly, incubation in
medium, the SSf-4-mshowed small, regular round, white intercellular fluids from tomato plants showed higher
colonies with pink center, while its wild-type biofilm formation of OE1-1, compared to incubation in
strainshowedlarge, irregular round, fluidal and white xylem fluids from tomato plants. Furthermore,
colonies with pinkcenter.Wealso investigated the incubation in the 1/4 M63 medium showed higher
swimming motility of SSf-4-m and SSf-4 on semisolid biofilm formation of OE1-1, compared to incubation in
motility agar. The wild-type strain was hyper the 1/4 M63 medium containing yeast extract and
motile,producing swimming haloes at least 2-fold larger polypepton. Biofilm formation is positively regulated by
than those ofparB2 mutant. Grow rate was no difference PhcA[2], which is activated in response to levels of the
between the wild-type and the parB2 mutant.Virulence bacterial density[3]. Then we compared secondary
assays,biofilm assayandDAPI staining assay are metabolites of OE1-1 with those of phcA-mutant using
underway. high performance liquid chromatography and liquid
chromatography-mass spectrometry, and isolated known
Acknowledgement:Thisstudy was funded bythe Science ralfuranones[4], ralfuranone A and ralfuranone B, and
and Technology Program of Guangzhou, new ralfuranones, ralfuranone J, ralfuranone K and
China(2013J4100070; 2013J4500032). ralfuranone L. The expression of ralA, encoding
furanonesynthetase[4], was positively regulated by PhcA.
References: The ralA mutant did not produce these ralfuranones. The
[1]S.Autret, R.Nair, J.Errington( 2001). Mol. Microbiol., ralA deletion led to decrease in biofilm formation of the
41, 743–755. bacteria incubated in both intercellular fluids from
58
ICPPB2014 Abstracts
tomato plants and the 1/4 M63 medium, compared to phcA.When inoculate the tomato plants
OE1-1. Application with each ralfuranone partially (Solanumlycopersicumcv. Moneymaker), prhN deletion
complimented biofilm formation of the ralA mutant. The mutant shows slightly weaker pathogenicity than that of
ralA mutant lost its virulence on tomato plants with wild type, which is obviously two days delay than that of
which were inoculated through the root-dipping. On the wild type. Same as its downstream target PrhG, PrhN is
other hand, petiole-inoculation with the mutant into dispensable for the bacterial growth in planta. With the
xylem vessels resulted in slightly delayed wilt of tomato Tn7T transposon based complementation analysis,
plants, compared to that with OE1-1. The transformation complemented PrhN can completely recover the hrp
of the mutant with the plasmid containing native ralA led expression and pathogenicity. Taken together,this newly
to complemented biofilm formation and virulence on identified positive regulator PrhNis essential for the
tomato plants. These results suggest that OE1-1 cells hrpexpression and pathogenicityofR.solanacearumon
form biofilm on tomato cells adjacent to intercellular tomato. PrhN can be integrated into the global regulation
spaces, and ralfuranones are required for biofilm network of R.solanacearum[5]. More experiments will be
formation of OE1-1, which is implicated in OE1-1 continued to reveal the regulation mechanism of PrhN on
virulence. target genes and pathogenicity.
References: Acknowledgement:This work was supported in part by
[1] Y. Hikichi, (2007). Plant Biotechnology, 24, 149. KAKENHI (Grant-in-Aid for Scientific Research) from
[2]F. Meng, et al. (2011). Journal of Bacteriology,193, the Japan Society for the Promotion of Science
2477. (16658020 to Y. H. and 17380031 to K. O.), in part by
[3]S.M. Brumbley,et al. (1990). Journal of Bacteriology, grants from the national natural science Foundation of
172, 5677. China (31200067)to YZand Fundamental Research
[4]B.Wackler, et al. (2011). Chemistry&Biology, 18, Foundation for the Central Universities (XDJK2013C156
354. to Y. Z. and 110201202002 to W. D.).
S2-P14 A newly identified positive regulator References:
PrhNis essential for the hrp expression and [1]A.C. Hayward (1991).Annu Rev Phytopathol, 29,
pathogenecity in Ralstonia solanacearum 67-87.
[2]N.Tamura, Y.Murata, T.Mukaihara(2005). Microbiol,
DoushengWua*, YongZhangb, AkinoriKibac, YasufumiHikichic,
151, 2873–2884.
KouheiOhnishid,Wei Dinga
a
[3]L.P. lener, P. Manfredi, M. Valls, S. Genin (2010). J
College of Plant Protection, Southwest University, Bacteriol, 192, 1011–1019.
BeiBei, Chongqing, China [4]Y. Zhang, L. Chen, T. Yoshimochi, A. Kiba, Y.
b
Research Center of Bioenergy and Bioremediation, Hikichi, K. Ohnishi (2013).Microbiol, 159, 1695-1704.
Southwest University, BeiBei, Chongqing, China [5]Y.Hikichi,et al. (2007).Plant biotechnol, 24(1),
c
Laboratory of Plant Pathology and Biotechnology, 149-154.
Kochi University, Nankoku, Kochi, Japan
d
Research Institute of Molecular Genetics, Kochi S2-P15 Swarming motility play the key role in
University, Nankoku, Kochi, Japan colonization and migration in Bacillus subtilis
swudousheng@163.com
Shengfeng Gao, Huijun Wu, Yan Zhang, Xuewen Gao*
The soil-borne phytopathogenic bacterium Department of Plant Pathology, College of Plant
Ralstoniasolanacearum is responsible for bacterial wilt Protection, Nanjing Agricultural University, Key
disease in over 200 plant species[1]. Genes encoding the Laboratory of Monitoring and Management of Crop
type III secretion system(T3SS) are indispensable for Diseases and Pest Insects, Ministry of Education,
pathogenicity and form the hrpregulon.T3SS is Nanjing, China
controlled by HrpB, which directly binds to the PIP gaoxw@njau.edu.cn
(plant-inducible promoter) box motif in the putative
promoter region of target genes [2]. The transcription of As typical representatives of plant growth-promoting
hrpB is directly activated by both HrpG and PrhG,which rhizobacteria (PGPR),Bacillus genus have been widely
are close paralogues and belong to the OmpR/PhoB studied and applied as efficient, stable biocontrol agents.
family of two-component response regulators [3,4]. By Root colonization is reported to be the essential character
transposon mutagenesis on R.solanacearumOE1-1, a for biocontrol activity of Bacillusagents[1], but the
new regulator Rsc1721 (hereafter named PrhN) was mechanisms of colonization is little known. The behavior
identified, which isMarR-typetranscription regulator. In of swarming is a regular action in Bacillus sp[2]. In this
this study, it isfound that prhN deletion mutant study, relationships between swarming motility and
substantialityreduces the expression of hrpregulon. PrhN rhizoplane colonization in Bacillus sp. were detected.
positively regulates hrp expression through PrhG-HrpB Three genes of Bacillus subtilis SWR01, swaA gene
cascade, but it is dispensable for PrhA-PrhIR/PrhJ directly related to the swarming[3], srfA being responsible
-HrpGsignal cascade and doesn’t affect the expression of for the synthesis of surfactin[4], hag involving in the
59
ICPPB2014 Abstracts
synthesis of the flagellar, were knocked out. The results HopA1, the precise function of HopA1 in P. cichorii is
from the growth curve indicated that the disruption of still remained elusive [2]. For functional validation of
these three genes did’t influence the growth of the hopA1 gene, we re-constructed pUCP18 vector with λ
SWR01. However, swarming test on the semi-solid phage red operon and sacB gene from pKOBEG and
plates had showed that the mutants WR01∆swrA, hopA1 of P. cichorii strain JBC1 [3]was marker
SWR01∆swrA∆srfAC, and SWR01∆hagalmost lost the exchanged by direct transformation of PCR product
ability of swarming, and SWR01∆srfAC partially lost containing kanamycin gene and flanking region of hopA1.
this character. The colonization test was carried out. The virulence of hopA1 defective mutant (ΔhopA1) was
Tomato seeds coated with SWR01 and it's 4 mutants, reduced on tomato in comparison with wild type and
were planted in a monoaxenic systerm for20days,then complemented strain with hopA1 (ΔhopA1::phopA1). In
base part and tip part of the root were took and used for addition, the bacterial population of ΔhopA1 in tomato
analysis of the density of the bacterial. The results had seedlings was significantly decreased in comparison with
showed that the population density of three mutants WT and ΔhopA1::phopA1.Moreover, the role of hopA1
whoseswarming motility had lost were dropped to 10% on host range was also investigated, which revealed that
of the SWR01, and the SWR01∆srfAC which swarming P. cichorii is hopA1 dependent to infect cabbage, tomato,
activity was partially lost only declined to the 30% of the soybean, hot pepper, and cucumber, but not for melon
SWR01. It could be concluded form this study that the and eggplant. In addition, the biofilm formation and
swarming motility of Bacillus subtilisplay the key role in swarming motility of ΔhopA1 was also significantly
its colonization and migration at tomato root surface. reduced in comparison with the WTand ΔhopA1::phopA1.
The results of this study indicate that hopA1 plays a
Acknowledgement:This work was supported by grants significant role not only on virulence and host range
from the Agro-scientific Research in the Public Interest specificity, but also the motility and biofilm forming
(20130315), the National Natural Science Foundation of ability, which influence on the virulence of P. cichorii.
China (31100056), the Special Fund for the Fundamental
Research Funds for the Central Universities Acknowledgement: This research was supported by the
(KYZ201404), the Doctoral Fund of Ministry of Cooperative Research Program for Agriculture Science
Education of China (20100097120011), and the National & Technology Development (PJ009794), Rural
High-tech R&D Program of China (2012AA101504). Development Administration, and by Basic Research
Laboratory Program through the National Research
References: Foundation of Korea funded by the Ministry of
[1]H. Zeriouh, A. de, Vicente, A. Pérez-García, D. Education, Science and Technology (2011-0020202).
Romero(2013). Environ Microbiol, doi:
10.1111/1462-2920.12271. References:
[2]M.B. Connelly, G.M. Young, A. Sloma (2004). J [1]S.M. Walkil, K.A. Oyinlola (2011).J. Appl. Biosci. 38:
Bacteriol, 186(13),4159-67. 2540.
[3]D.B. Kearns, F. Chu, R. Rudner, R. Losick (2004). [2]S.H. Kim, S.I, Kwon, D. Saha, N.C. Anyanwu,
Mol Microbiol,52, 357–369. W.Gassmann (2009). Plant Physiol. 150:1723.
[4]T.Stein(2005). Mol Microbiol, 56, 845-857. [3]S.M. Yu, Y.H. Lee (2012). Plant Dis 96: 142.
S2-16 hopA1gene of Pseudomonas S2-P17 GidA is a global regulator affected
cichoriiJBC1 reduced its virulence on plants, antibiotic production and quorum sensing in
biofilm formation, and swarming motility Pseudomonas fluorescens 2P24
Nguyen Bao Hunga, Rajalingam Nagendrana, HaKyoung Leea, Wei Zhang a, Zhao Zhao a, Liqun Zhanga,b*
a
Yong Hoon Leea,b* Department of Plant Pathology, China Agricultural
a
Division of Biotechnology, Chonbuk National University, Beijing 100193, China
b
University, 194-5 Ma-Dong, Iksan, Jeonbuk 570-752, Key Laboratory of Plant Pathology, Ministry of
Republic of Korea Agriculture, Beijing 100193, China
b
Advanced Institute of Environment and Bioscience, and zhanglq@cau.edu.cn
Plant Medical Research Center, Chonbuk National
University 194-5 Ma-Dong, Iksan, Jeonbuk 570-752, Pseudomonas fluorescens 2P24 is a soil-borne bacterium
Republic of Korea. that synthesizes and excretes multiple antimicrobial
Yonghoonlee@jbnu.ac.kr metabolites[1]. The polyketide compound
2,4-diacetylphloroglucinol (2,4-DAPG), synthesized by
Pseudomonas cichoriiconstitutes an economically the phlACBD locus, is its major biocontrol determinant[2].
important bacterial pathogenic strains, which are The PcoI/PcoR quorum-sensing (QS) system in strain
destructive to a wide range of vegetables and 2P24 is important for biofilm formation and plant root
ornamentals crops [1]. HopA1 is an effector protein of colonization [1]. A mutant defective in the
Pseudomonas cichorii which triggers hypersensitive glucose-inhibited division protein A (GidA) gene lost the
response in nonhost plants. In spite of many reports on production of 2,4-DAPG, its precursors
60
ICPPB2014 Abstracts
monoacetylphloroglucinol (MAPG) and phloroglucinol [7]W. Zhang, B. Zhang, X.G. Wu, L.Q. Zhang (2014).
(PG), and significantly decreased the production of QS Microbiology China, (2014). 41, 258.
signal molecule N-acyl-homoserine lactone (AHL). The
transcription of the 2,4-DAPG biosynthetic gene phlA S2-P18 Colonization of ‘Candidatus
was not affected but the translation of the phlA and phlD Liberibacter asiaticus’ in pollen, seed coat and
genes was reduced significantly. The phlD gene encodes endosperm of pummelo
a type III polyketide synthase, which is responsible for Yaqin Songa, Binghai Loua*, Xiaolong Zhaob, Xianjin Baib and
the synthesis of phloroglucinol (PG) from three Chongling Denga
molecules of malonyl-CoA[3]. The phlA, phlC, and phlB a
Guangxi Key Laboratory of Citrus Biology, Guangxi
genes are together required for conversion of PG to Citrus Research Institute, 40 Putuo Road, Qixing District,
monoacetylphloroglucinol (MAPG) and of MAPG to Guilin, Guangxi 541004, P. R. China
2,4-DAPG[4]. The gidA mutant was unable to produce b
Guangxi Academy of Agricultural Sciences, 174 Daxue
PG, but could convert PG to MAPG and MAPG to East Road, Xixiangtang, Nanning, Guangxi530007, P. R.
2,4-DAPG when the synthetic substrateswere added.This China
indicated that the activity of PhlD rather than PhlACB is Binghai.Lou@hotmail.com
defective [5]. Further genetic analysis indicated that the
post-transcriptional effect of GidA on 2,4-DAPG Citrus huanglongbing , previously also refered to as
biosynthesis is independent of the Gac/Rsm system [6], greening disease, was first reported in southern China in
awell-documented signal transduction pathway 1919 [1]. Since then the disease has been spread to 11
promoting the production of antifungal metabolites, southern provinces of China. ‘Candidatus Liberibacter
including 2,4-DAPG. Mutation of the gidA gene asiaticus’ has been proved to be associated with citrus
significantly decreased pcoI transcription and AHL huanglongbing in China and consequently considered as
production and further affected QS functions. The the most probable etiological agent of citrus
biofilm formation and the colonization on the wheat huanglongbing in China [2, 3]. In the autumn of 2011 in an
rhizosphere and tips in both the gnotobiotic and natural orchard of Guangxi Province of China, a few
soil were remarkably reduced in the gidA gene mutant HLB-infected ‘Shatianyou’ pummelo trees (Citrus
compared to the wild type and the complementary strain. maxima (Burm.) Merr. cv. Shatian Yu) with mature fruits
Although the gidA mutation in strain 2P24 did not affect and characteristic blotchy mottle symptoms blossomed
the bacterial growth and the swimming capacity in the abnormally.10 petal, 12 stamen, 12 pistil, 3 pollen, 20
rich medium (LB), it significantly affected the utilization seed hull, 20 seed coat and 20 endosperm samples were
of multiple carbon sources in the minimal medium, collected from these pummelo trees. Polymerase chain
including glucose, sucrose, fructose, glycerol, galactose, reaction (PCR) with primer set OI1/OI2c [4] was
arabinose, mannose, xylose and sorbitol [7]. Our performed to detect ‘Candidatus Liberibacter asiaticus’.
experiments suggest that GidA functions as a globle The results showed that positive PCR reactions could be
regulatory element that influenced the antibiotic observed in petal (9 out of 10 samples, 90%), stamen (11
production, PcoI/PcoR QS system, biofilm formation, out of 12 samples, 91.7%), pistil (12 out of 12 samples,
colonization ability and carbon source utilization in P. 100%), pollen (2 out of 3 samples, 66.7%), seed coat (18
fluorescens 2P24. out of 20 samples, 90%) and endosperm (15 out of 20
samples, 75%). None of seed hull samples was
Acknowledgement:This work was funded by the positive.A representative ≈1100-bp amplicon obtained
National Programs for High Technology Research and from the PCR in the 16S rDNA region of ‘Candidatus
Development of China (2011AA10A205) and the Liberibacter asiaticus’ was sequenced directly (GenBank
National Natural Science Foundation of China accession no. JN211032). BLAST search at the National
(31071725, 31272082) Center for Biotechnology Information showed that this
References: sequence shared the highest identity (99.9%, 1 divergent
[1]H.L.Wei, Y. Wang, L. Q. Zhang, W. H. Tang (2004). base in 1072) with each 16S rDNA sequence of several
Acta Phytopathologica Sinica, 34, 80. ‘Candidatus Liberibacter asiaticus’ isolates. These
[2]T. Tao, X. G. Wu, H. M. Duan, L. Q. Zhang (2010). results confirmed the ‘Candidatus Liberibacter asiaticus’
Microbiology, 156, 39. can colonize petal, stamen, pistil, pollen, seed coat and
[3]W. J. Zha, S.B. Rubin-Pitel, H. M. Zhao (2006). endosperm tissues of pummelo. To our knowledge, this
Journal of Biological Chemistry, 281, 32036. is the first report of the presence of ‘Candidatus
[4]M.G.Bangera, L.S. Thomashow (1999). Journal of Liberibacter asiaticus’ in pollen, seed coat and
bacteriology, 181, 3155. endosperm of pummelo in China. The high incident of
[5]W. Zhang, Z. Zhao, B. Zhang, X.G. et. al.(2014). detection of ‘Candidatus Liberibacter asiaticus’ in pollen
Appl. Environ. Microbiol., doi:10.1128/AEM.00455-14 and endosperm in this study suggests that there is a
[6]K. Lapouge, M. Schubert, F.H. Allain, D. Haas (2008). potential risk of spreading ‘Candidatus Liberibacter
Molecular Microbiology, 67, 241. asiaticus’ through the pollen and seed of
huanglongbing-infected pummelo trees.
61
ICPPB2014 Abstracts
Acknowledgement: Financial support was provided by family protein, multiple stress resistance protein BhsA,
Guangxi Natural Science Foundation regulatory protein PecM, and several proteins of
(2013GXNSFBA019110). unknown function.
References: Acknowledgement: The work was financially supported
[1]O. A. Reinking (1919). Philippine Agricultural by the Ministry of Science and Higher Education, Poland
Scientist, 8: 109. via research grant Iuventus Plus 2013 (IP2012 024172)
[2]X. Deng, W. Tang (1998). Journal of Zhejiang to R. C.
Agricultural University, 24: 5562.
[3] X. Deng, J. Chen, Z. Feng, Z. Shan, H. Guo, J. Zhu, References:
H. Li, E. L. Civerolo (2008). Plant Disease, 92: 513. [1]R.Czajkowski, M.C.M.Pérombelon, J.A.van Veen,
[4]S. Jagoueix, J. M. Bové, M. Garnier (1994). J.M.van der Wolf (2011). Plant Pathology, 60, 999.
International Journal of Systematic and Evolutionary [2]J.Laurila, V.Ahola, A.Lehtinen, T.Joutsjoki,
Microbiology, 44: 379. A.Hannukkala, A.Rahkonen, M.Pirhonen (2008).
European Journal of Plant Pathology, 122, 213.
S2-P19 Identification and characterization of [3]M.Sławiak, E.Łojkowska, J.M.van der Wolf (2009).
genes specifically up-regulated in Dickeya Plant Pathology, 58, 794.
solani at different growth temperatures [4]I.K.Toth, J.M.van der Wolf, G.Saddler, E.Łojkowska,
V.Hélias, M.Pirhonen, L.Tsror (Lahkim), J.G.
Natalia Kaczyńska*, Ewa Łojkowska, Robert Czajkowski
Elphinstone (2011). Plant Pathology, 60, 385.
Department of Biotechnology, Intercollegiate Faculty of [5]R.Czajkowski, G.J.Grabe, J.M. van der Wolf (2009).
Biotechnology UG & MUG, Gdansk, Poland European Journal of Plant Pathology, 125, 263.
natalia.kaczynska@biotech.ug.edu.pl
S2-P20 Pre detection method for sub species
Pectolytic bacteria Pectobacterium spp. and Dickeya spp. Pectobacterium confirmed in Potato (Solanum
that cause blackleg and soft rot disease are among the tuberosum) (Mont.)wilt disease
most economically important bacterial pathogens of a
large number of crops [1]. P. atrosepticum typically Bandulla Kelaniyangoda*, Salgadoe A.S.A
causes blackleg and soft rot on potato plants in temperate Department of Horticulture and Landscape Gardening,
climate, whereas Dickeya spp. are responsible for these Faculty of Agriculture and Plantation Management,
diseases in warm climate. However in last years, new Wayamaba University of Sri Lanka, Makandura,
species Dickeya solani has emerged in Europe and has Gonawila
been isolated in Poland, the Netherlands, Finland, kelaniyangoda@gmail.com
Norway, France, Germany, Sweden, Spain and Belgium
[2,3,4,5]
. D. solani is more virulent and aggressive than Potato (Solunum tuberosum L.) is an economically
other Dickeya spp. and P. atrosepticum isolated from important crop. This crop is native to South American
potato in Europe so far. Global warming leading to Andes Mountains which is now the third most important
climate change and is partly responsible for faster food crop in the world after rice and wheat in terms of
spreading of this pathogen through Europe. Temperature human consumption. It is a versatile, energy rich, highly
may act as a signal that activates expression of specific commercialized tuber crop due to which it has become
factors in plant pathogens during infection. staple food in many European and Asian countries. Sri
Lankan potato cultivation is undergoing critical threat in
The main aim of the project was to identify and production due to bacterial wilt.
characterize genes up-regulated in D. solani strain IFB
0099 at different growth temperatures (18, 28 and 37 °C). The research was focused to identify and confirm
In total, 7300 mutants of D. solani were generated by bacterial strain in to subspecies level. Infected sample
random transposon mutagenesis based on insertions of plants were drawn from farmer fields,Sri Lanka.
the mini-Tn5 transposon to the D. solani strain IFB 0099 Bacterial infection was confirmed with a series of oozing
genome. Out of these mutants, 49 showed tests. Clear oozing from each infected plant stems were
thermoregulated gene expression on minimal medium, observed verifying the cause of wilting to be a plant
indicating that the transposon had been inserted pathogenic bacteria.
downstream of a putatively thermoregulated promoter. Further studies were carried out for gram discrimination.
Those mutants were further screened with quantitative Isolated bacterial colonies from stem parts were tested
assays to evaluate the level of up-regulation. 24 mutants for KOH test and Gram staining [3]. All the samples were
showed an increased gene expression at 37 °C, and 5 – at positive for KOH test which the bacterial pathogen was
18 °C. Transposon integration sites were identified by to be gram negative.
direct genome sequencing of genomic DNA with primers
specific for the ends of mini-Tn5 transposon. Insertions Sample inoculums were contaminated on to carrot slices
were found in genes encoding and kept overnight for rotting. Clear soft rot symptoms
oligogalacturonate-specific porin kdgM, chitinase class I
62
ICPPB2014 Abstracts
on over every carrot slice strongly revealed the pathogen for spectrophotometric quantification of acylated
belongs to genus Pectobacterium spp. homoserine lactones (AHLs) using Chromobacterium
violaceum CV026 without the extraction of violacein.
Pectobacterim spp. is a plant pathogen with a wide host The method was also used successfully in quantifying
range, able to cause diseases in almost any plant tissue it natural AHLs from two plant pathogenic bacterial
invades. Previous studies were limited only to species species, Pantoea ananatis and Pectobacterium
level which was not sufficient for disease management carotovorum subsp. brasiliense (Pcb). This assay was
and problem study. Carrot test results positively for validated using synthetic C6 AHLs as standards. The
Pectobacterium carotovorum subsp. carotovorum (Pcc.), new method is more sensitive compared to the agar well
Pectobacterium atrosepticum (P. atrosepticum) and diffusion method, and elimination of the violacein
Pectobacterium chrysanthemi (P. chrysanthemi) [1]. pigment extraction step makes this assay cost-effective,
Therefore, potato could be infected by either one or more easier and rapid.
species above.
S2-P22 Identification and characterisation of
Growth habits and sensitivity for antibiotics could be an pili mediating attachment of Pantoea ananatis to
ideal approach for grouping the pathogen in to sub Eucalyptus leaf surfaces
species levels. The maximum growth temperature of
both Pcc and P. chrysanthemi ranged between 37 - 40 oC Tania WellerStuarta*, Ian Tothb, Jacques Therona, Teresa
while that of P. atrosepticum is 35oC, thus separating the Coutinhoa
a
isolated bacterium [2]. The bacterial isolations grown on Forestry and Agricultural Biotechnology Institute,
NA media successfully grew at 37 OC whereas in 35 OC University of Pretoria, Pretoria, 0002, South Africa
b
no colonies had developed. The results sorted out Pcc Plant Health Programme, The James Hutton Institute,
and P. chrysanthemi from all the suspected DD2 5DA, Scotland
Pectobacterium species. Furthermore, during the tania.weller@fabi.up.ac.za
sensitivity test for erythromycin all the isolated clearly
showed up positive results with no sensitivity at all. In Pantoea ananatis is both a common epiphyte and
addition to the above tests, all the isolates were tested for phytopathogen on a wide variety of plants, specifically
pathogenicity by using Pogostemon cablin. Wilting causing bacterial leaf blight and shoot dieback in
symptoms appeared 5-6 days after inoculation. Eucalyptus seedlings and cuttings in South Africa. This
has a major economic impact on the plant industry as
These all finding indicates that Pcc was the causal many nurseries and plantations are affected by bacterial
pathogenic bacteria for the wilting of Potato plants. blight each year. Currently, little is known about the
Future work on this study will focus on developing a mechanisms this pathogen employs to cause disease in
suitable Intergrated crop management package for the its host or how it attaches to host surfaces. It is known
control of Pcc in potato plants and molecular level that many phytobacterial pathogens use fimbriae and pili
studies of the pathogen. to initially attach to their hosts plants. It was, therefore,
hypothesised that a similar mechanism may be used for
References attachment in P. ananatis. By using a Tn5 cassette to
[1]J.J.Farra, J.J. Nunez, R.M. Davis,(2000). Plant disrupt the major pilin subunit of various pili known to
Diseases, 84, 665-667. occur in P. ananatis, the role of type I and type IV pili in
[2]A.Kelman, (1954). Phytopathology, 44, 693-705. attachment to Eucalyptus leaves was elucidated. Of these
[3]R.A. Lelliot, D.E. Stead,(1987). Plant Pathology, 65- pili only type IV was found to be necessary for the
78. successful attachment of P. ananatis to Eucalyptus leaf
S2-P21 A rapid assay for indirect measurement surfaces.
of acylated homoserine lactones (AHLs) using S2-P23 Metabolomic and transcriptomic
Chromobacterium violaceum in liquid systems analysis of the response of rice leaf tissue to
without violacein extraction staurosporinetreatment
Siphathele Sibandaa,b*, Rudi Pretoriousa,b, Lucy Molelekia,b,
Jeong Gu Kima*, Hyang Yeon Kimb, Mee youn Leeb, Sait Byul
Jacques Theronb, Teresa A. Coutinhoa,b
a
Parka,b, JooWon Suhc, In Ae Leec, Jinhua Chengc, Choong
Forestry and Agricultural Biotechnology Institute, Hwan Leeb
University of Pretoria, Pretoria 0002, South Africa a
Genomics Division, National Academy of Agricultural
b
Department of Microbiology and Plant Pathology, Science, Rural Development Administration, Suwon
University of Pretoria, Pretoria 0002, South Africa 441-857, Korea
Phathie.sibanda@fabi.up.ac.za b
Department of Bioscience and Biotechnology, Konkuk
Many bacteria exploit collective group efforts for University, Seoul, 143-701, Korea
c
establishment of virulence on target hosts through Department of Biological Science, Myongji University,
synthesis and accumulation of quorum sensing Yongin 449-728, Korea
autoinducers. In this study, we developed a rapid assay jkim5aug@korea.kr
63
ICPPB2014 Abstracts
Rice bacterial blight by Xanthomonas oryzae pv. oryzae These findings have established the role of
(Xoo) is one of the most severe diseases of rice in many xanthomonadins in maintaining the ecological fitness
countries. We found that staurosporine isolated from and virulence of Xanthomonas species.
Streptomycessp. protect or enhance the rice leaf tissue
from the disease. To evaluate the difference of rice leaf A diffusible factor (DF) was found to be implicated in
metabolites by staurosporine and understand the the regulation of production of xanthomonadin and
mechanism protecting rice leaf against Xoo, we extracellular polysaccharide (EPS) in Xcc strain B24. It
examined the metabolites of four treatments; control was originally thought that DF of Xcc might be a
(without Xoo and staurosporine), Xoo, staurosporine and butyrolactone, and thus operate as a dedicated signal
staurosporine with Xoo treated rice leaf. After 4 day molecule modulating gene expression.Recently, DF was
treatment, extracts were analyzed by LC-MS and purified from Xcc strains 8004 and XC1 and chemically
GC-MS. In staurosporine-treated rice tissues,increase of characterized as 3-hydroxybenzoic acid
class of flavonoids and amino acids were observed. (3-HBA).Genetic and biochemical analysis showed that
Some genes such as signal transduction, resistance 3-HBAwas associated withbacterial survival, cell
protein homologues, and chorismate mutase were viability, H2O2 resistance, and systemic infections.
enhanced by the treatment, where several genes xanB2 (Xcc4014 in Xcc strain ATCC33913) is required
involving peroxidases and proteinase inhibitors were for DF biosynthesis [1].
down regulated. The diffusible factor (DF) synthase XanB2, originally
Acknowledgement: This work was supported by a grant identified in Xcc, is a unique bifunctional chorismatase
from the Next-Generation BioGreen 21Program that hydrolyzes chorismate, the end product of the
(No.PJ009579), Rural Development Administration, shikimate pathway, to produce 3-hydrobenzoic acid
Republic of Korea. (3-HBA) and 4-HBA. 3-HBA and 4-HBA are
respectively associated with the yellow pigment
References: xanthomonadin biosynthesis and antioxidant activity in
[1]H.J.Chaeet al.(2000). Pharmacol. Res., 42, 373. Xcc. XanB2 is a structurally novel enzyme with three
[2]B.M.Leeet al. (2005). Nucl. Acids Res., 33, 577. putative domains. It catalyzes 3-HBA and 4-HBA
[3]H.J. Parket al. (2006). J. Agric. Food Chem., 54, biosynthesis via a unique mechanism with the C-terminal
3041. YjgF-like domain conferring activity for 3-HBA
[4]C.S.Limet al. (2010). J. Microbiol. Biotechnol., 20, biosynthesis and the N-terminal FGFG motif-containing
494. domain responsible for 4-HBA biosynthesis. XanB2
[5]S.B. Parket al. (2012). J. Microbiol. Biotechnol., 40, homologs are well conserved in the bacterial species
39. within Xanthomonas, Xylella, Xylophilus,
Pseudoxanthomonas, Rhodanobacter, Frateuria,
S2-P24 Xanthomonadins biosynthesis and Herminiimonas, and Variovorax, suggesting that XanB2
regulation in the phytopathogen Xanthomonas may be a conserved metabolic link between the
campestris pv. campestris. shikimate pathway and xanthomonadin biosynthetic
Lian Zhou, Yawen He* pathways in diverse bacteria [2, 3].
School of Life Sciences & Biotechnology, Shanghai Jiao References:
Tong University, No. 800 Dongchuan Road, Shanghai [1] Y.W. He, J. Wu, L. Zhou, F. Yang, B.L. Jiang, J.L.
200240, P. R. China. Tang, L. Bai, Y. Xu, Z. Deng, L.H. Zhang (2011).Mol
yawenhe@sjtu.edu.cn Plant Microbe Interact, 24(8),948.
One of the characteristic features of the genus [2] L. Zhou, T.W. Huang, S. Sun, J.Y. Wang, G. Chen,
Xanthomonas is the production of yellow, A.R. Poplawsky, Y.W. He (2013).Mol Plant Microbe
membrane-bound pigments called xanthomonadins. The Interact,26(10), 1239.
chemical structure of xanthomonadin I, the major [3] L. Zhou, J.Y. Wang, J. Wang, A. Poplawsky, S. Lin,
pigment formed by Xanthomonas juglandis XJ103, has B. Zhu, C. Chang, T. Zhou, L.H. Zhang, Y.W. He
beencharacterized as (2013).Molecular Microbiology, 87(1), 80.
17-(4-bromo-3-methoxyphenyl)-17-bromo-heptadeca-2,4
,6,8,10,12,14,16-octaenoic acid. Xanthomonadins are
found to function in protection of bacteria against
photobiological damages and are needed for epiphytic
survival and host infection.In addition, xanthomonadins
were found to protect egg-phophatidylcholine lipsomes
against peroxidation damage. Our recent results showed
that xanthomonadin-deficient Xanthomonas campestris
pv. campestris (Xcc) strains were less virulent and more
sensitive to exogenous H2O2 than the wild-type strain.
64
ICPPB2014 Abstracts
S2-A1 The Xanthomonas oryzae pv. oryzae Liyan Yanga, Lin Wanga,b, Lichao Yanga, Le Zhoua, Yongliang
PilZ-domain proteins differentially function in Gana, and Bole Jianga,c*
a
cyclic di-GMP binding and regulation of College of Life Science and Technology, Guangxi
bacterial virulence and motility. University, 100 Daxue Road, Nanning, 530004, P. R.
China
Fenghuan Yanga, Fang Tiana, Xiaotong Lia, Huamin Chena, b
College of Biotechnology, Guilin Medical University,
William Hutchinb, Chinghong Yangb, Chenyang Hea*
a
109 North 2nd Huan Cheng Road, Guilin, 541004, P. R.
State Key Laboratory for Biology of Plant Diseases and China
Insect Pests, Institute of Plant Protection, Chinese c
State Key Laboratory for Conservation and Utilization
Academy of Agricultural Sciences, Beijing 100193, of Subtropical Agro-bioresources, 100 Daxue Road,
China. Nanning, 530004,P. R. China
b
Department of Biological Sciences, University of jbl1971@gxu.edu.cn
Wisconsin-Milwaukee, WI 53211, U.S.A
cyhe@caas.net.cn In plant pathogenic bacteria, type III secretion system
(T3SS) encoded by hrp (hypersensitive reaction and
The PilZ-domain proteins have been shown to be one of pathogenicity) cluster plays a crucial role in interaction
major types of receptors/effectors mediated in cyclic with the host plants. In Xanthomonas campestris pv.
di-GMP signaling transduction pathways in several campestris (Xcc), hrpG and hrpX play a pivotal role in
pathogenic bacteria. Here, the roles of three PilZ-domain the regulation of hrp genes.In both plants and inducing
proteins (PXO_00049, PXO_02374 and PXO_02715) in medium, HrpG activates the transcription of hrpX and
cyclic di-GMP binding and regulation of virulence and HrpX subsequently activates the transcription ofhrp
motility were comparatively characterized in genes.
Xanthomonas oryzae pv. oryzae (Xoo), the causal agent
of bacterial blight of rice. In silico analysis revealed that RNA polymerases of bacteria are essential components
c-di-GMP binding motifs in the PilZ-domains were of the transcriptional apparatus. The transcription
conserved in PXO_00049 and PXO_02374, but were initiation directed by RNA polymerase requires different
degenerate in PXO_02715. Isothermal titration sigma factors to recognize specific promoter sequences.
calorimetry (ITC) assays showed PXO_00049 and Sigma factors play important roles in transcription. So
PXO_02374, but PXO_02715 proteins bound to clarifying the relationship between HrpX/hrpX and
c-di-GMP efficientlyin vitro. Site-directed mutagenesis sigma factors is remarkable for investigating the hrp
of the conserved residues indicated that R 141 in regulation and dissecting the pathogenesis of this
PXO_00049 and R10 in PXO_02374 were crucial for phytopathogen.
c-di-GMP binding. Gene deletion analysis demonstrated
that ∆PXO_00049 exhibited increased virulence and Fourteen sigma factors were annotated in Xcc 8004,
reduced sliding motility, ∆PXO_02374 showed enhanced including a housekeeping gene. In this work, the deletion
activity in both virulence and sliding motility, and mutants of these sigma factors were constructed. The
∆PXO_02715 displayed attenuated virulence on rice and phenotypes, pathogenicity and HR reaction of these
increased sliding motility. In trans expression of the full mutants were examined. As a result, these mutants have
length ORF of each gene in the relevant mutants led to no influence on extracellular amylase, extracellular
restoration of the phenotype to wildtype levels. cellulose, extracellular protease, exopolysaccharide,
Yeast-two hybrid (Y2H) assays indicated that motility and biofilm. These mutants also have no
PXO_2715 interacted with the EAL, but not REC, PAS, significant effect on virulence and HR reaction, except
and GGDEF domains of Filp, which has been identified for XC2974. RT-PCR and GUS assay showed that
as a c-di-GMP receptor of Xoo.Subcellular localization XC2974 activateshrpX in inducing medium, while
analysis showed PXO_00049 localized to bacterial poles represseshrpX in plant. General stress response assay
and middle, PXO_02374 showed a predominantlybipolar revealed that the mutant of XC2974 is sensitive to Cd 2+,
distribution, and PXO_02715 displayed no Cu2+, osmotic pressureand alkali pressure.
polarlocalizationin the cell. Thus, we concluded that S2-A3 Identification of T2SS mutants from
PilZ-domain proteins differentially function in c-di-GMP Acidovorax citrulli based on a Tn5 random
binding and regulation of virulence and motility in Xoo. insertion mutant library
Acknowledgement: This work was supported by the Xiaojing Fan* Xueqing Cai, Fangping Hu
grants from National Science Foundation of China College of Plant Protection, Fujian Agriculture and
(31370160) and the Research Growth Initiative of the Forestry University,Fuzhou, Fujian, 350002, China
University of Wisconsin-Milwaukee. fanxiaojing01@126.com
S2-A2 Functional characterization of the sigma Bacterial fruit blotch of cucurbitsis a serious economic
factors in Xanthomonascampestris pv. threat to seed and fruit production worldwide. The causal
campestris agent is a Gram-negative bacterium Acidovorax
citrulli(formerly A. avenaesubsp. citrulli). A Tn5 random
65
ICPPB2014 Abstracts
insertion mutant library has been constructed in our lab References:
by using A. citrulli 13 as wild type strain. Here, we [1]M. Moreau, N. Orange, M.G.J. Feuilloley (2008).
reported four mutants M203, M621, M564 and M928 Biotechnology Advances, 26, 610.
with weaken extracellular cellulase activity. The plasmid [2]M. Moisan, J. Barbeau, M.C. Crevier, J. Pelletier, N.
rescue experiments revealed that the flanking sequences Philip, B. Saoudi (2002). Pure and Applied Chemistry,
were corresponded to type II secretion system gene gspD, 74, 349.
gspM and gspG.The mutant M564 defect in gspD [3]R.E. Baier, J.M. Carter, S.E. Sorenson, A.E. Meyer,
completely abolished its ability to produce disease B.D. McGowan, S.A. Kasprzak (1992). Journal of Oral
symptom in host plant and to induce hypersensitive Implantology, 18 (3), 236.
response in nonhost plant tobacco. The mutants M621
defect in gspM and 928 defect in gspG reduced their S2-A5 Preliminary studies on RaxST, a
virulence but retained the ability to produce sulfotransferase from Xanthomonas oryzae pv.
watersoaking on watermelon tissue. However, the mutant oryzae
203 defect in gspD displayed the same virulence on Zhenzhen Li, Teng Xu, Wei Guo, Meihao Sun*
watermelon cotyledons and fruit rind as the wild-type. College of Chemistry and Life Sciences, Zhejiang
S2-A4 Viability of phytopathogenic bacteria Normal University, 321004, Jinhua, China
after low-temperature plasma treatment mhsun@zjnu.cn.
Pavel Berana*, Marta Zemanovaa, Pavel Krizb, Ivan Mraza

Xanthomonas oryzae pv. oryzae (Xoo), a gram-negative
a
Faculty of Agriculture, University of South Bohemia, pathogens, causes rice bacterial blight, which will
Studentska 13, 370 05 Ceske Budejovice, Czech Republic dramatically decrease the rice yield[1]. The interactions
b
Faculty of Education, University of South Bohemia, with rice are critical for its growth, virulence and
Jeronymova 10, 371 15 Ceske Budejovice, Czech pathogenicity. Prokaryotic post-translated modification
Republic of tyrosine sulfation is rare. RaxST had been reported to
pavel.beran@centrum.cz catalyze sulfation of tyrosine residue in a synthetic
peptide (AENLSYNFVEGDYVRTP, SP) identified in
Research of the low-temperature plasma (LTP) became culture media of Xoo. Based on hydrophobic analysis,
very popular in recent years [1]. It is being used mostly there is a 28-amino acid hydrophobic segment located at
in the industry [2]. In biology, the LTP is mostly used for the N-terminus of RaxST, which may promote the
sterilization and disinfection of hospital instruments [3]. association of RaxST to the cell membrane, and therefore
In this work we used own designed Gliding Arc LTP may affect its purification and activity assay. Expression
machine for killing of following phytopathogenic vectors for the full length (RaxSTf) and truncated RaxST
bacteria: Agrobacterium tumefaciens, (RaxSTt) were constructed, and corresponding proteins
Clavibactermichiganensis subsp. sepedonicus, were expressed with BL21(DE3) and purified to
Curtobacteriumalbidum, Erwiniaamylovora, homogenous with MBP tag. Kanamycin resistant Xoo
Pseudomonasviridiflava, Rahnellaaquatilis and mutant, which expresses C terminal polyhistidine tagged
Xanthomonasvesicatoria. Resazurin based reagent, RaxST (RaxSTn) driven by a strong promoter was
PrestoBlue® (Life technologies, USA), was used for obtained by homologous recombination. RaxSTn was
visualization and quantification of the viable bacteria. expressed in Xoo and purified with Ni-NTA column.
The most susceptible bacteria for the LTP treatment were Activities of RaxSTn, RaxSTf and RaxSTt were assayed
E.amylovora and R. aquatilis (both Enterobacteriaceae). with SP and co-substrate 3’-phosphoadenosine
In this case the concentration of viable bacteria 5’-phosphosulfate (PAPS) using a continuous
decreased by 97,27% and 96,14% respectively after 100 spectrophotometric method. RaxSTn and RaxSTt
s of LTP treatment. The concentration of viable cells of showed sulfation activity towards SP. RaxSTf was found
A. tumefaciens and P. viridiflava decreased by 95,9 % hydrolyzing PAPS very quickly, which made the assay
and 95,42 % respectively after 160 s of the treatment. X. impossible. The full characterization and studies on its
vesicatoria was the less susceptible of Gram-negative catalytic mechanism need to be done further.
bacteria. Its concentration was decreased by 86 % after
80 s of LTP treatment. The LTP was nearly ineffective Acknowledgement: This work is supported by NSFC
for Gram-positive bacteria used in this study. Although (31070055).
the LTP is difficult to study and the results are often Reference:
unstable, we suggest its further research as a cheap [1]W.Guo, L.L.Cai, H.S.Zou, X.L.Liu, L.F.Zou, et al.
alternative for phytopathogenic bacteria treatment. (2012). Applied and Environmental Microbiology, 78,
Acknowledgement: This work was supported by Czech 5672–5681.
Ministry of Education, Youth and Sports, grant No. [2]S.W.Han, S.W.Lee, O.Bahar, B.Schwessinger,
CZ.1.07/2.3.00/30.0049 and Grant Agency of University M.R.Robinson, et al. (2012). Nature communications, 3,
of South Bohemia, grant No. 102/2013/S. 1153.
66
ICPPB2014 Abstracts
S2-A6 Role of bacterial indole-3-acetic acid in regulate a wide range of functions including host
rice-pathogen interactions colonization, adherence to surfaces, biofilm formation,
motility and bacterial virulence[1][2]. Cyclic di-GMP is
Zhe Dai*,Shiping Wang
synthesized from two GTP molecules by diguanylate
National Key Laboratory of Crop Genetic Improvement, cyclases(DGCs) that often have a GGDEF domain and
National Center of Plant Gene Research (Wuhan), degraded by phosphodiesterases (PDEs) with either an
Huazhong Agricultural University, Wuhan 430070, EAL or an HD-GYP domain [3].The three domains are
China. broadly existed in bacterial genomes.In addition to
dzhe@webmail.hzau.edu.cn proteins with only GGDEF or EAL domain, some
Xanthomonasoryzaepv. Oryzae (Xoo) causes bacterial proteins contain both GGDEF and EAL domains
blight disease, which is a serious problem affecting rice arranged in tandem. One of the two domains is often
production. Indole-3-acetic acid (IAA),which is a major catalytically inactive[2].Only a few proteins have been
form of auxin in plant, controls nearly every aspect of reported to have dual enzymatic activities[4].There are
plant growth and development. But it is also reported as also other situations where both domains are
a virulence factor in some plant-pathogen enzymatically inactive but instead as c-di-GMP
interactions[1,2].Some Xoostrains have been proved to effectors[5].Xanthomonas oryzae pv.oryzicola (Xoc)
have capacity to synthesis IAA[3]indicating that Xoomay causes bacterial leaf streak in rice,which is an important
use IAA as a virulence factor for infecting rice. In this disease in subtropical Asia.BLAST researches in Xoc
study, we generated in-frame gene deletion mutants of BLS256 genome revealed that 11 genes encode
ntAand ntB from the Xoostrain PXO99A. The two genes GGDEF-EAL domain proteins.However, the functions of
were predicted to participate in IAA synthesis. We these multi-domain proteins remain largely unknown. In
quantified IAA accumulation in the liquid medium used this study, we constructed gene-deletion mutant strains
for culturing these strains. TheΔntB mutant showed for all these 11 genes, which were confirmed by
distinctly reduction of IAA and reducedvirulenceon Southern blot analyses.No obvious alterations in biofilm
susceptiblerice varietyMudanjiang_8(MDJ8) as formation,EPS production and secretion of extracellular
compared to the ΔntB-/pHM1::ΔntB+and wild-type proteases were observed among these mutants.
PXO99A,suggesting that ntB may participate in IAA Swimming motility was significantly reduced in Δ11605
synthesis of Xoo and the ability ofproducing IAA may andΔ11335 mutants. TheΔ11335/11605 double mutant
influence PXO99A’s virulence to rice. Furthermore, we exhibited a similar swimming ability to the single
examined expression levels of rice IAA synthesis mutants,indicating that XOC_11335 and XOC 11605
genesAAO3, NIT1 and cell wall-loosening genes may regulate swimmingin the same pathway. Site
EXPA1andEXPA5 after inoculation of mutated Xoo. mutations in the EAL and GGDEF domains of
These genes all showed reduced expression levels. These XOC_11335 lost the ability to restore swimming motility
results suggested Xoo may use its own IAA to hi-jack of Δ11335, suggesting that the two domains might be
rice in order to access rice easily in early stage of essential for protein function. The single mutants
infection. Δ11335and Δ11605have a similar virulence as the
wild-type, but virulence of the Δ11335/11605 mutant
References: was attenuated. Through colorimetric assays,we
[1]D. Duca, J. Lorv, C.L. Patten, D. Rose, B.R. Glick demonstrated thatthe purified XOC_11335 may have a
(2014). Antonie van Leenwenhoek, in print. phosphodiesterase activity. The biochemical activities
[2]A.M. Mutka, S. Fawley, T. Tsao, B.N. Kunkel (2013). and physiological functions of these multi-domain
Plant J, 74, 746-754. enzymes need to be further studied.
[3]J. Fu, H. Liu, Y. Li, H. Yu, X. Li, J. Xiao, S. Wang
(2011). Plant Physiol, 155, 589-602. References:
[1]H.Sondermann,N.J.Shikuma,F.H.Yildiz(2012).Curr
S2-A7 Functional analyses of c-di-GMP Opin Microbiol,15(2),140-146.
metabolism related genes in Xanthomonas [2]Ute Römling, Michael Y. Galperin, Mark
oryzae pv.oryzicola Gomelsky(2013). Microbiology and molecular biology
reviews,77(1)
Wendi Jiang, Jun Yang, Chao Wei, Yuanbao Zhang, Wenxian
[3]R.Hengge(2009). Nature Rev, 7, 263-273.
Sun*
[4]Binod K. Bharati,Indra Mani Sharma,Sanjay Kasetty,
Department of Plant Pathology and the Ministry of Manish Kumar,Raju Mukherjee,Dipankar Chatterj(2012).
Agriculture Key Laboratory for Plant Pathology, China Microbiology, 158,1415–1427.
Agricultural University, Beijing, China [5]P.D.Newell, R.D.Monds, G.A. O'Toole, (2009). Proc.
08042@cau.edu.cn Natl. Acad. Sci. U.S.A,106,3461-3466.
Cyclic diguanylate (c-di-GMP), first discovered as an
allosteric activator of cellulose synthesis in
Gluconacetobacter xylinus, has been recognized as a
universal second messenger in bacteria that acts to
67
ICPPB2014 Abstracts
S2-A8 FdoRXoc is involved in pathogenesis in respectively [1,2]. Carbon metabolism is one of the most
rice basic metabolisms in Xanthomonas oryzae. The
acquisition of carbohydrates, which is an important
Xiaobo Xuea, Lulu Caia, Wenxiu Maa, Yujing Suna,
aspect of rice-Xanthomonas oryzae interaction, is
Gongyou Chena,b
a
essential for pathogen to grow, reproduce, and establish a
School of Agriculture and Biology, Shanghai Jiao Tong successful infection in host rice. Inorderto identify
University/Key Laboratory of Urban (South) by Ministry virulence-related genes of Xoc (RS105 strain), we
of Agriculture, 800 Dongchuan Road, Shanghai, 200240, previously generated a library of Tn5 insertion mutants
China [1,2]
. In these mutants, 110 candidate genes showed
b
State Key Laboratory of Microbial Metabolism, School altered pathogenicity or virulence compared with the
of Life Science & Biotechnology, Shanghai Jiao Tong wild-type RS105 strain. Among them, ten candidate
University, Shanghai 200240, China genes, such as XOC_0442 (glucose-6-phosphate
gyouchen@sjtu.edu.cn 1-dehydrogenase, zwf), XOC_0592 (isocitrate
The roles of FAD (flavin adenine dehydrogenase NADP-dependent, icdH), XOC_0872
dinucleotide)-dependent oxidoreductases in the (phosphoenolpyruvate carboxylase, ppc), XOC_2172
pathogenicity and physiology of Xanthomonads are (glucose-6-phosphate-isomerase, pgi), XOC_2261
largely unknown. Here we report that a (phosphoenolpyruvate synthase, ppsA), XOC_2607
genome-annotated halogenase of the rice pathogen X. (glucose-6-phosphate 1-dehydrogenase, zwf), XOC_3327
oryzae pv. oryzicola (Xoc) is a new member of the (glucose kinase), XOC_3585 (fructose-bisphosphate
FAD-dependent oxidoreductase family. The gene aldolase class-I, fbaB˅[2], XOC_3589 (phosphoglycerate
XOC_1970 (designated fdoR) encodes a 623 amino acid kinase, pgk) and XOC3841 (phosphohexose mutases,
protein and has low similarity to orthologs in other xanA), are located in different locations of glycolysis,
Xanthomonas spp., suggesting that this gene is unique to Entner-Doudoroff (ED), pentose phosphate pathway
Xoc. A mutation in fdoR attenuated Xoc virulence in (PPP), tricarboxylic acid (TCA) cycle or gluconeogenic
rice, delayed the hypersensitive response (HR) in pathway, and played an important role in the process of
tobacco, reduced the production of extracellular carbohydrate metabolism. Compared with the wild-type
polysaccharides (EPS), and attenuated bacterial tolerance RS105 strain, all above carbon metabolism genes have
to reactive oxygen species (ROS). These deficiencies significantly reduced pathogenicity in host rice, except
were restored to the mutant when fdoR was introduced in XOC_3327, and they are more or less involved in various
trans. The expression of fdoR was positively regulated biological function of Xanthomonas oryzae, such as
by HrpG and HrpX and negatively by HrpD6. Both carbohydrate utilization, extracellular polysaccharide
HrpX and HrpD6 bound to an imperfect PIP-box motif (EPS) synthesis, cell motility. In addition, XOC_3585
(TTCGC) in the fdoR promoter region. These results and XOC_3841, are negatively regulated by HrpX and
suggest that FdoR, a potential FAD-dependent HrpG, and have certain relationship with the transcript
oxidoreductase, is regulated by HrpX and HrpD6 and expression of hrp genes. Intriguingly, it is worth
functions in carbon utilization and bacterial pathogenesis mentioning that the mutation in pgi (XOC_2172) resulted
in plants. in the reduction of diffusible signal factor (DSF)
production, and the alteration of key genes, such as rpfF,
Acknowledgement: This work was supported by the rpfG and clp in DSF signaling pathway. However, the
State Key Basic Research and Development Project of functions of genes which involved in carbon metabolic
China (2012CB114003), the Special Fund for pathways have not been well studied in Xoo. It is
Agro-Scientific Research in the Public Interest of China reported that PXO_00687
(201303015-02) and the National Transgenic Major (glucose-6-phosphate-isomerase, pgi) and PXO_03531
Program (2013ZX08001-002). (ketoglutarate transport protein, kgtP) [3] are essential for
the growth and virulence of Xoo. Although metabolic
S2-A9 The function of carbon metabolism pathways are generally not considered to be virulence
genes in Xanthomonas oryzae factors, elucidation of the mechanism to acquire and
Wei Guoa*, Lifang Zoub, Meihao Suna, Yuan Fanga, Xia Liua, metabolize carbohydrates is critically important for fully
Gongyou Chenb, Jianzhong Liua understanding of the molecular mechanism of
a
College of Chemistry and Life Sciences, Zhejiang rice-Xanthomonas oryzae interaction. Thus, this study
Normal University, 321004, Jinhua, China may implicate carbon metabolism genes as potential drug
b
College of Agriculture and Biology, Shanghai Jiao Tong targets for antibacterial biological control.
University, 200240, Shanghai, China Acknowledgement: This work was supported by the
weiguo817@gmail.com. National Natural Science Foundation of China
Xanthomonas oryzae pv. oryzicola (Xoc) and (31301633), and the research project of Department of
Xanthomonasoryzae pv. oryzae (Xoo) are two pathovars Education of Zhejiang Province (Y201328481).
in Xanthomonas oryzae, causing bacterial leaf streak Reference:
(BLS) and bacterial blight (BB) of rice (Oryza sativa),
68
ICPPB2014 Abstracts
[1]H.S. Zou, L. Yuan, W. Guo, Y.R. Li, Y.Z. Che, et al. interaction between FJAT-1458 and tomato plant were
(2011). Curr Microbiol, 62, 908–916. also studied. The nutrient competition experiments
[2]W. Guo, L.F. Zou, Y.R. Li, Y.P. Cui, Z.Y. Ji, et al. showed that the utilization abilities of carbon and
(2012). PLoS ONE, 7, e31855. nitrogen source of FJAT-1458 were poorer than virulent
[3]W. Guo, L.L. Cai, H.S. Zou, X.L. Liu, L.F. Zou, et al. R. solanacearum FJAT-91, when they were mixed
(2012). Applied and Environmental Microbiology, 78, cultured in SPA media with different C/N ratios. When
5672–5681. the content of carbon source was <20%, FJAT-1458
could not grow but FJAT-91 could grow. FJAT-1458
S2-A10 Immune resistance mechanism of could breed when the content of carbon source
‘plant vaccine’ against tomato bacterial wilt was >40%, but the amount of its growth was lower than
disease that of FJAT-91. Both of the two R. solanacearum
Bo Liu*, Xuefang Zheng, Yujing Zhu strains could not reproduce when the content of nitrogen
Agricultural Bio-Resources Research Institute, Fujian source were 0, and the growth amount of FJAT-1458
Academy of Agricultural Sciences, Fuzhou 350003, was less than FJAT-91 while the nitrogen source content
China was >20%.
fzliubo@163.com The experiments on competition of infection site showed
The bacterial wilt of tomato is a serious soil-borne that the pre-inoculation of ‘plant vaccine’ strain
disease, caused by Ralstonia solanacearum all over the FJAT-1458 could prevent the infection of virulent strains
world. None of effective methods with chemical FJAT-91 by occupying the ecological sites. Tomato
pesticide and resistant varieties has been reported against plants with pre-inoculation of FJAT-1458 at 3 d before
the disease. After years of researches, we found that R. FJAT-91 inoculation resulted in 0 of disease incidence
solanacearum possessed significant pathogenic after 15 d. The disease incidence of tomato plants were
differentiation, and the avirulent strains could infect host 24.67% after 15 d with inoculation of the two R.
plant without killing the plant. Therefore, the avirulent solanacearum strains at the same time, while it was 45%
strains are used to produce ‘plant vaccine’ against tomato with pre-inoculation of FJAT-91 at 3 d before
bacterial wilt disease. This study focused on "immune FJAT-1458 inoculation.
resistance mechanism of ‘plant vaccine’ against tomato The experiments on metabolic mechanism found that the
bacterial wilt disease". inoculation of FJAT-1458 and FJAT-91 in different
An avirulent mutant library of R. solanacearum was orders could induce the alternation of variety and content
generated through spontaneous mutagenesis, of tomato metabolite. The top ten relative contents of
60
Co-radiated mutagenesis and EZ-Tn5 transponson metabolites in all treatments were dibutyl phthalate
mutagenesis. Sixty-four avirulent mutants were gained (75.83%), stigmasterol (49.30%), n-Hexadecanoic acid
and proved to be avirulent R. solanacearum strains using (33.16%), myo-Inositol,
inoculation bioassay with tomato potted seedlings, when 1,2,3,4,5,6-hexakis-O-(trimethylsilyl)- (23.2%),
none of wilt symptoms were observed after 15 days. The hexanedioic acid, bis(2-ethylhexyl) ester (15.99%),
chromatographic behaviors of the avirulentR. benzaldehyde, 3,4-dimethyl- (13.93%), octadecanoic
solanacearumstrains were characterized by using acid (12.40%), pyrrolo [1,2-a] pyrazine-1,4-dione,
bacterial chromatography, which could be divided into 3 hexahydro-3-(phenylmethyl)- (11.79%),
types, single-peak, double-peak and triple-peak. Among 2,4-dimethyl-benzaldehyde (11.61%) and pyridine
which, 8 strains were single-peak, 35 strains were (10.91%).
double-peak and the other 21 were triple-peak, and then The inoculation of FJAT-91 alone could induce the
a chromatographic titer index (CTI) was built up based relative content of dibutyl phthalate and n-Hexadecanoic
on the chromatographic behavior. Twenty-four avirulent acid decrease gradually to 0. However, these two tomato
mutants got CTI>90%, and spontaneous mutant metabolites were maintain at considerable contents in the
FJAT-1458, three 60Co-radiated mutants and four treatments of inoculation of FJAT-1458 alone,
EZ-Tn5 transponson mutants achieved CTI=100%. The simultaneous inoculation of the both strains and control.
relationship between CTI and control efficiency against The results indicated that these two metabolites
bacterial wilt disease of the avirulent mutants were correlated to the tomato immune resistant. The principal
analyzed, and the result found that their correlation were component analysis showed that there were certain
extremely significant (P>0.01). The avirulent strain differences among metabolic profilings of tomato plants
FJAT-1458 both with highest CTI and control efficiency in different treatments, and it could be distinguished by
was selected as "plant vaccine" strain. the first and second principal components.
Moreover, the nutrition competition and infecting The experiments on cellultrastructure showed that the
competition of FJAT-1458 with virulent R. infections of FJAT-1458 and FJAT-91 could both induce
solanacearum were investigated. The the ultrastructures of tomato tissues to change. The
metabolicmechanism and cytological behavior of the avirulent strain FJAT-1458 could infect tomato plant
69
ICPPB2014 Abstracts
without causing obvious destructive effect on plant cell Cucumber angular leaf spot caused by Pseudomonas
structure. On the contrary, the virulent strain FJAT-91 syringaepv.lachrymans is distributed worldwidely and
could infect tomato plant and induce a a series of inflicts different degrees of damage, which can also
cytopathological changes, including swelling of induce bacterial spot of melon leaves. Previous studies
mitochondria cells, degeneration of cytoplasm, nuclear demonstrated that the pathogens of bacterial angular leaf
heterochromatin and collapse of host cell, which finally spot on cucumber and melon were both P.
resulted in the death of host plant. The initial stage of syringaepv.lachrymans, but it was found in our lab that
FJAT-91 infection did not cause obvious there existed certain differences in the pathogenicity and
cytopathological change of host plant cell, but it molecular biology between P. syringaepv. lachrymans
generated quite strong destructive effect on root cell strains from cucumber and muskmelon. In this study, the
ultrasturctures from the 2nd disease stages, such as pathogenicities of cucumber strains and muskmelon
plasmamembrane, cellnucleus and organelle. strains from cucumber and muskmelon plants were
determined and compared; and then the molecular
S2-A11 Identification of bacterial strains biological differences were researched on several
caused citrus Huanglongbing in the northern house-keeping genes; at last, specific primers were
part of Vietnam designed to distinguish between the isolates from
Lê Mai Nhất1, Ngô Vĩnh Viễn1, Nguyễn Văn Viết2, Nguyễn Thị different hosts. In conclusion, we proposed that P.
Bích Ngọc1 syringaepv. lachrymans strains from muskmelon as a
1
Plant protection research institute, 2Viet Nam Academy novel pathovar named as Pseudomonas syringaepv.
of Agricultural Sciences melonispathovarnov.
S2-A13 Molecular mechanism of positive
Citrus greening was first described in 1929 and first regulation of virulence by the RNA binding
reported in China 1943. Likubin has seriously affected protein CsrA/RsmAin Erwinia amylovora
Taiwan since 1951. The Africa variation was first
reported in 1947 in South Africa, where it is still Veronica Ancona,Youfu Zhao*
widespread. The 81 representative HLB mẫu bệnhs were Crop Sciences Department, University of Illinois at
selected from 175 disease samples collected from HLB Urbana-Champaign, Urbana, IL 61801, USA; Email:
disease citrus trees grown in some province main zhao888@illinois.edu
citrus-producing of northern Vietnam. After indexing
and eliminating the citrus viruses, the selected HLB Extensive genetic studies have demonstrated that a
mẫu bệnhs, free from the virus, were use for functional hypersensitive response and pathogenicity
identification of HLB strains base on pathogenicity and (hrp) - type III secretion system (T3SS) and its
virulence test with the following differential citrus associated effectors, as well as production of the
cultivar: cam canh (Citrus reticulata), cam Xadoai (C. exopolysaccharide amylovoran are primary determinants
sinensis), buoidien (C. grandis) and chanh Eureka (C. in E. amylovora to cause fire blight disease[1, 2].We have
limon). Two strains of HLB were identified. Strain I reported that the global GrrS/GrrA two-component
showed pathogenicity on mandarin and sweet orange by phosphorelay system negatively regulates motility,
inducing typical HLB symptoms (46 isolates). Strain II amylovoran production and expression of T3SS genes in
showed high virulence on all differential cultivars and E. amylovora [2, 3].Furthermore, we have demonstrated
multiplied fast in all cultivars (35 isolates). that negative regulation of virulence factors by
GrrA/GrrS acts through csrB/rsmB small non-coding
The first time identification the pathogenicity strain I & regulatory RNA, which binds to translational regulator
II and distribution of citrus HLB with to popularity in the CsrA/RsmA and neutralizes its positive effect on T3SS
Hanoi (66.67% of strain I, 33.33% strain II), Hung Yen gene expression, flagellar formation and amylovoran
(33.33% strain I, 66.67% strain II), Quang Ninh (50.0% production [3, 4]. Mutation studies showed that csrB/rsmB
strain I, 50.0% strain II), Bac giang (66.67% strain I, mutant was hypermotile, produced higher amount of
33.33% strain II), Ha Giang (60% strain I, 40% strain amylovoran, and had increased expression of T3SS
II), Hoabinh (53.84% strain I; 46.15% strain II), Nghe an genes in vitro. In contrast, csrA/rsmA mutant exhibited
(58.82% strain I; 41.18% strain II) and Thua Thien Hue complete opposite phenotypes, including positive
(40% strain I; 60% strain II). regulation of motility and expression of T3SS genes. In
addition, csrA/rsmA mutant did not induce hypersensitive
S2-A12 Molecular comparation of response on non-host tobacco plants or caused disease on
Pseudomonas syringae pv. Lachrymans strains immature pear fruit and apple shoots, indicating that
from cucumber and muskmelon CsrA/RsmA is a positive regulator of virulence factors [4].
BaishiHu However, the molecular mechanism as how the
Nanjing Agricultural University,Nanjing,China RNA-binding protein CsrA/RsmA positively regulates
hbs@njau.edu.cn various virulence traits in E. amylovora is poorly
understood. In the present study, wewill report our
novelfindings, whichprovide conclusive evidence about
70
ICPPB2014 Abstracts
the molecular mechanism of CsrA positive regulation of kinases, and which also directly interacts with and is
virulence traits in E. amylovora. required for ZAR1 activation.
References: S3-K2 Roles of PBL family kinases in
[1]Ancona, V., Li, W., and Zhao, Y. F. 2014. Alternative plant-bacterial interactions
sigma factor RpoN and its modulation protein YhbH are
Jianmin Zhou*, Guoxun Wang, Feng Feng
indispensable for Erwinia amylovora virulence. Mol.
Plant Pathol. 15:58-66. Institute of Genetics and Developmental Biology,
[2]Zhao, Y. F., Wang, D., Nakka, S., Sundin, G. W., and Chinese Academy of Sciences
Korban, S. S. 2009. Systems-level analysis of jmzhou@genetics.ac.cn
two-component signal transduction systems in Erwinia Receptor-Like Cytoplasmic Kinases (RLCKs) are
amylovora: Role in virulence, regulation of amylovoran important components of plant receptor complexes that
biosynthesis and swarming motility. BMC Genomics regulate diverse signaling processes. The PBS1-Like
10:245. (PBL) protein kinases constitute the largest family of
[3]Li, W., Ancona, V., and Zhao, Y. F. 2014. RLCKs. The expansion of this protein family appears to
Co-regulation of polysaccharide production, motility, and be linked to plants’ adaptation to pathogenic microbes.
expression of type III secretion genes by EnvZ/OmpR and Previous studies of ours and others have shown that
GrrS/GrrA systems in Erwinia amylovora. Mol. Gen. several Arabidopsis members of this family, including
Genomics 289:63-75. BIK1 and PBL1, play a key role in PAMP-Triggered
[4]Ancona, V., and Zhao, Y. F. 2014. The GrrSA-Csr Immunity (PTI) by interacting with multiple
global regulatory system plays a critical role in Erwinia Pattern-Recognition Receptors. They regulate
amylovora virulence. Acta Hortic. (in press) downstream immune responses by phosphorylating a
S3-K1 Dissecting the function &evolution of number of proteins. For example, BIK1 and PBL1
the Pseudomonas syringae HopZ effectors regulate PAMP-induced oxidative burst and contribute to
andthe plant immune system stomatal defenses against bacterial infection by directly
phosphorylating the NADPH oxidase RbohD. We are
David S. Guttmana, b*, Jennifer D. Lewisa, c, Amy Huei-Yi Leea, actively characterizing additional substrates of BIK1 and
Darrell Desveauxa,b understanding their role in PTI. We and others have also
a
Department of Cell & Systems Biology, University of shown that several bacterial pathogen effectors target
Toronto, Toronto, Canada various PBL kinases for virulence. Some members of the
b
Centre for the Analysis of Genome Evolution & PBL family, including PBS1, RIPK, and PBL2, however,
Function, University of Toronto, Toronto, Canada are known to mediate Effector-Triggered Immunity (ETI)
c
Plant Gene Expression Center, US Department of by directly interacting with pathogen effectors. We are
Agriculture, Albany California, U.S.A. systematically characterizing roles of additional PBL
david.guttman@utoronto.ca kinases in PTI and ETI. We will present our progress and
discuss implications of our findings in plant-pathogen
The YopJ/HopZ family of type III secretedeffector co-evolution.
proteins isevolutionarily diverse and widely distributed
among both plant and animal pathogens. We have Acknowledgement: This work was supported by
previously shown that the family diversified in the plant Chinese Natural Science Foundation (31230007) and
pathogenic bacterium Pseudomonas syringaevia both Chinese Ministry of Science and Technology
mutational processes during vertical descent from the (2011CB100700).
ancestral P. syringae, as well as through horizontal
transfer from ecologically similar pathogens into five S3-K3 Pseudomonas syringae pathogenesis in
distinct allele groups. We also have shown that the most microbe-colonized and microbe-free
ancestral allele (HopZ1a) is consistently recognized by Arabidopsis plants
the plant resistance protein, ZAR1, and that this Shengyang He*
interaction induces ETI. Here we discuss genetic screens Department of Energy Plant Research Laboratory,
and heterologous assays to identify virulence targets of Howard Hughes Medical Institute, Gordon-Betty Moore
HopZ1. We first show that HopZ1a interacts with the Foundation, Michigan State University, East Lansing,
plant microtubule network, and demonstrate that it is an MI, USA
acetyltransferase that acetylates itself and tubulin. hes@msu.edu
Furthermore, HopZ1a requires its acetyltransferase
activity to disrupt the Arabidopsis microtubule network We have been using the Arabidopsis
and the secretory pathway as well as to suppress cell thaliana-Pseudomonas syringaepv.tomato (Pst)
wall-mediated defense. We also demonstrate that DC3000pathosystem to study general principles that
HopZ1a directly interacts with and acetylates a underlie plant susceptibility to bacterial pathogens in
previously uncharacterized protein kinase (ZED1), which microbe-colonized plants.Pst DC3000 is representative
is encoded within a tandemly arrayed family of related of a large number of bacterial pathogens that infect the
71
ICPPB2014 Abstracts
above-ground parts (phyllosphere) of plants. During XopPXoo. Silencing of OsPUB44 suppressed
infection, this pathogen produces a battery of virulence peptidoglycan- and chitin- triggered immunity and X.
factors to engage multiple host cell types (e.g., stomatal oryzae resistance, indicating that OsPUB44 positively
and mesophyll cells) and diverse host physical and regulates immune responses. Thus, it is likely that
chemical barriers. Its type III secretion system (T3SS) XopPXoo suppresses immune responses by inhibiting the
delivers about 30 “effector” proteins into the plant cell, OsPUB44 ligase activity by direct interaction with the
whereas the phytotoxin coronatine mimicsthe active unique U-box domain.
form of plant hormone jasmonate. Study of the molecular References:
action of T3SS effectors and coronatine demonstratesthe [1]K. Yamaguchi, K. Yamada, K. Ishikawa, S.
great utility of Pst DC3000 pathogenesis as a probe in Yoshimura, N. Hayashi, K. Uchihashi, N. Ishihama, M.
the discovery ofcomponents of the plant immune system Kishi-Kaboshi, A. Takahashi, S. Tsuge, H. Ochiai, Y.
and the elucidation of the jasmonatesignaling mechanism Tada, K. Shimamoto, H. Yoshioka , and T. Kawasaki
in plants. Recently, we have initiated studies to (2013). Cell Host Microbe., 13:347.
understand the effects of phyllosphere microbiotaon [2]K. Yamaguchi, K. Yamada, and T. Kawasaki (2013).
bacterial pathogenesis and plant immune responses by Plant Signal. Behav.,8: e25662.
establishing an experimental set-up for growing
microbe-free plants in soil. This set-up begins to reveala S3-O1 The Xanthomonas secreted effector
potentially fundamental role of microbiota in training the AvrRxo1 and its chaperone Arc1 act as a
plant immune system and plant abiotic stress responses. toxin-antitoxin system in bacteria
Jan E. Leacha*, Lindsay Tripletta, LoicDeblaisa, John Longa,
S3-K4 Biological function of Xanthomonas
BingyuZhaob
effectors in suppression of plant immunity
a
Tsutomu Kawasaki*
Department of Bioagricultural Sciences and Pest
Management, Colorado State University, Fort Collins,
Graduate School of Agriculture, Kinki University, Colorado, USA
b
3327-204 Nakamachi, Nara, Japan Department of Horticulture, Virginia Technique,
t-kawasaki@nara.kindai.ac.jp Blacksburg, VA, USA
Jan.Leach@colostate.edu
Pathogens deliver effector proteins into host cell to
suppress host immunity, although how the effectors The genomes of bacterial plant pathogens including
function in host cells is largely unknown. Xoo1488 and Xanthomonasoryzaepathovaroryzicola (Xoc),
XopPXoo are the effectors of Xanthomonas oryzae pv. Xanthomonascampestris, Burkholderiaandropogonis,
oryzae, which causes bacterial blight of rice, one of the and Acidovoraxavenaeare predicted to encode the type
most importannt rice disease. Expression of Xoo1488 or III secreted effector AvrRxo1 and its putative chaperone,
XopPXoo in rice strongly suppressed peptidoglycan- and Arc1. AvrRxo1 triggers a resistance response in rice or
chitin- triggered immunity and resistance to X. oryzae. maize expressing the resistance protein Rxo1 [1]. The Xoc
Searching for host proteins that interact with Xoo1488, AvrRxo1:Arc1 complex has a structure with strong
we identified the rice receptor-like cytoplasmic kinase, similarities to the Zeta-Epsilon family of toxin-antitoxin
OsRLCK185[1]. Silencing OsRLCK185 suppressed (TA) modules from diverse bacteria [2]. TA modules are
peptidoglycan- and chitin-induced immune responses, ubiquitous bacterial self-killing systems thought to
including MAP kinase activation and defense-gene function in population control or maintenance of mobile
expression. OsRLCK185 associates with, and is directly DNA. In this study, we demonstrate that AvrRxo1 and
phosphorylated by, OsCERK1, an receptor-like kinase Arc1 function similarly to a TA system in bacteria.
involving in recognition of peptidoglycan ans chitin. When expressed in E. coli, AvrRxo1 from Xoc strongly
Additionally, OsCERK1-mediated phosphorylation of suppresses bacterial growth and colony size in the
OsRLCK185 is suppressed by Xoo1488, resulting in the absence of Arc1. This bacteriostatic effect is dependent
inhibition of chitin-induced MAP kinase activation. on the ATPase and predicted substrate-binding residues
These data support a role for OsRLCK185 as an essential of AvrRxo1, sites corresponding to catalytic residues of
immediate downstream signaling partner of OsCERK1 in Zeta toxin. Expression of AvrRxo1 is most toxic for
mediating chitin- and peptidoglycan-induced plant low-density, rapidly-growing E. coli cells, and also
immunity [1, 2]. causes filamentation in E. coli, observations consistent
with a target in the cell-wall synthesis pathway. The
We also found that XopPXoo targets OsPUB44, a rice effects of AvrRxo1 expression in X. oryzae and in
U-box ubiquiitin E3 ligase that possesses a unique U-box gram-positive bacteria will also be presented. Together,
domain with E3 ligase activity. XopP Xoo directly these results indicate that the AvrRxo1 target is
interacted with the U-box and inhibited the ligase ubiquitous to prokaryotes and eukaryotes, and that
activity, resulting in the in vivo accumulation of AvrRxo1:Arc1 likely evolved from an ancient
OsPUB44. Three amino acid residues specific for the toxin-antitoxin system.
OsPUB44 U-box are responsible for interaction with
72
ICPPB2014 Abstracts
References: Scholar of Shandong Province. We thank for Professor
[1]B.Y. Zhao, X. Lin, J. Poland, H. Trick, J.E. Leach, S. GongyouChen for providing Xoc strains as well as
Hulbert. (2005). Proc. Natl. Acad. Sci,102:15383-15388. Professor Bing Yang for pHM1 vector.
[2]C. Zhou,Q. Han, S. Wu, Y. Liu, Z. Yang, J. Miao, L.
Triplett, Q. Cheng, J. Tokuhisa, L. Deblais, H. Robinson, S3-O3 The last half-repeat of transcription
J.E. Leach, J. Li,B. Zhao.Nicotianabenthamiana. activator-like effector is dispensable and
thereby TALE-based technology can be
S3-O2 Domain dissection of AvrRxo1 for simplified
suppressor, avirulence and toxicity functions
Chongke Zheng, Chunlian Wang1, Xiaoping Zhang, Fujun
Haifeng Liu, Qingle Chang, Wenjie Feng,Baoguang Zhang, Wang, Tengfei Qin, Kaijun Zhao*
Tao Wu, Ning Li, Xinhua Ding*, Zhaohui Chu National Key Facility for Crop Gene Resources and
State Key Laboratory of Crop Biology, Shandong Genetic Improvement (NFCRI), Institute of Crop Science,
Provincial Key Laboratory of Agricultural Microbiology, Chinese Academy of Agriculture Sciences (CAAS),
Shandong Agricultural University, Tai an, 271018, Beijing 100081, P.R. China
Shandong, PR China zhaokaijun@caas.cn
xhding@sdau.edu.cn
Transcription activator-like effectors (TALEs) are a class
AvrRxo1, a type III effector from Xanthomonas of proteins identified in many plant pathogenic
oryzaepv. Oryzicola(Xoc), which causes bacterial leaf Xanthomonas spp.[1]. Natural TALEs have a conserved
streak (BLS) in rice, can be recognised by non-host architecture: an N-terminus required for the type-III
resistance protein Rxo1 and triggers a hypersensitive secretion system (TTSS) secretion, a central repeat
response (HR) in maize. Little is known regarding the region consisting of varying number of near-perfect
virulence function of AvrRxo1. In this study, we 34-amino-acid repeats (34-aa repeats), and a C-terminus
determined that AvrRxo1 is able to suppress the HR containing nuclear localization signals and an acidic
caused by the non-host resistance recognition of transcription activation domain (AD) [1]. To activate
Xanthomonas oryzaepv. Oryzae(Xoo) by Nicotiana expression of host genes that contribute to pathogen
benthamiana and is toxic, inducing cell death from growth, pathogenic Xanthomonas bacteria inject their
transient expression in N. benthamiana, as well as in TALEs into plant cells through the TTSS, and the
yeast. Among the five AvrRxo1 alleles from different TALEs bind to target gene promoters by the central
Xoc strains, we concluded that the toxin function is 34-aa repeats[1, 2]. Based on the recognition codes
abolished by a single amino acid substitution at residue between the 34-aa repeats and the targeted nucleotides[3,
4]
344 of two AvrRxo1. A series of truncations from the , the central repeat region or DNA-binding domain of a
carboxyl terminus (C-terminus) indicated that the TALE can be designed and modularly assembled for
complete C-terminus of AvrRxo1 plays important precise and predicted gene activation[5]. Moreover,
functional roles as a suppressor or cytotoxic protein. The chimeric proteins called TALE nucleases (TALENs)
C-terminus was also required for avirulence function, but have been developed by replacing the AD of a TALE
the last two residues were not necessary. The amino with the non-specific DNA nuclease FokI for
terminus (N-terminus) was unessential for toxicity. And site-specific genome editing[6, 7]. Since DNA-binding
the N-terminus was also observed to compete with the domains targeting virtually any user-selected DNA
nuclear localisation sequence(NLS) motif to anchor the sequence in a genome can be designed and modularly
AvrRxo1 to the plasma membrane. Point mutation assembled, custom designer TALE (dTALE) and
experiments indicated that the ATP/GTP binding site TALENs have rapidly emerged as powerful tools[8].
motif A is required for all three functions of AvrRxo1, Amazingly, every natural TALE invariantly has a
and NLS is required for avirulence and suppression of truncated last half-repeat (LHR) at the end of the 34-aa
nonhost resistance. The putative thiol protease site is repeats. Consequently, all the reported dTALEs and
only required for cytotoxin function. These results TALENs harbored their LHRs too. Our recent study has
demonstrate that AvrRxo1 may play a role in the shownthat the LHRs indTALEs are dispensable for the
complex interaction with host proteins after delivery into function of gene activation by bothtransient expression
plant cells. assays in Nicotiana benthamiana and gene-specific
targeting in rice genome. Moreover, the activation
Acknowledgement: This work was supported by strengths of dTALEs lacking the LHR were comparable
National Natural Science Foundation of China (Grant to those of dTALEs harboring the LHR. In light of this
No.30900050) and Ph.D. Programs Foundation of finding, we demonstrated that dTALEs can be
Ministry of Education of China (Grant No. constructed through two simple steps. Our results not
20093702120013). X.D. was granted from Shandong only provide new insights into the origin of natural
Province Science Foundation for Youths TALEs, but also facilitate simplification in design and
˄BS2010NY017˅ and Foundation for the Author of assembly of TALE-based tools such as dTALEs and
National Excellent Doctoral Dissertation of PR China TALENs.
(Grant No. 201132). Z.C. was granted from Taishan
73
ICPPB2014 Abstracts
Acknowledgement: This work was supported by the expression from the X11-5A genetic background could
National Natural Science Foundation of China affect the range of effectors that trigger resistance.
(31171812 and the National Program of Transgenic Together, these results point to a novel mechanism of
Plants of China (2014ZX0801001B). resistance triggered by the central repeat region of
diverse TAL effectors.
References:
[1]J.Boch, U.Bonas (2010). Ann. Rev. Phytopathol. 48, Acknowledgements: This work was funded by
419. USDA-NIFA grants (#2011-67012-30570 and
[2]B.Yang, A.Sugio, F.F.White (2006). Proc. Natl Acad. 2014-67013-21564) to L.T. and J.E.L.; V.V. was funded
Sci. USA, 103, 10503. by a Marie Curie Fellowship.
[3]J.Boch, H. Scholze, S. Schornack, A. Landgraf, S.
S3-O5 Developing bacterial disease-resistant
Hahn, et al. (2009). Science, 326, 1509.
bananas using genetic engineering
[4]M.J.Moscou, A.J.Bogdanove (2009). Science, 326,
1501. Leena Tripathia*, J.N. Tripathia, K. Mburua, A. Kiggundua, W.K.
[5]R.Morbitzer, P. Romer, J. Boch, T.Lahaye (2010). Tushemereirweb
a
Proc. Natl Acad. Sci. USA, 107, 21617-21622. International Institute of Tropical Agriculture, Nairobi,
[6]M.Christian, T. Cermak, E.L. Doyle, C. Schmidt, Kenya
b
F.Zhang, et al. (2010). Genetics, 186, 757-761. National Agriculture Research Laboratories, Kawanda,
[7]T.Li, S. Huang, W.Z.Jiang, D. Wright, M.H. Spalding, Uganda
D.P.Weeks B.Yang(2011). Nucleic Acids Res. 39, L.Tripathi@cgiar.org
359-372.
[8]A.Richter, J.Boch (2013). Nat. Methods, 10, 207-208. Banana is major staple crop in east Africa produced
mostly by smallholder subsistence farmers. Uganda is
S3-O4 Activation-independent resistance to the world’s second leading grower with a total annual
Xanthomonas oryzae TAL effectors in rice production of about 10.5 million tons. It is Africa’s
biggest producer and consumer of bananas. Banana
Lindsay Tripletta, Valerie Verdiera,b, Mariko Alexanderc, Adam
Xanthomonaswilt (BXW) caused by
Bogdanovec, Jan Leacha*
a Xanthomonascampestrispv. musacearum (Xcm)is
Department of Bioagricultural Sciences and Pest
threatening banana production and the livelihoods of
Management, Colorado State University, Fort Collins,
these smallholder growers, and solutions have to be
Colorado, USA
b found fast before it could destabilize food security in the
Institute de Recherche pour le Développement, UMR
region [1]. The economic impact of the disease is
RPB, Montpellier, France
c potentially disastrous, because it destroys whole plants
Department of Plant Biology and Plant-Microbe
leading to complete yield loss, and the farmers do not
Biology, Cornell University, Ithaca, New York, USA
have the option of relocating to new planting sites that
Jan.Leach@colostate.edu
are infection free. The disease has caused estimated
Strains of the rice pathogen Xanthomonas oryzae express economic losses of about $2-8 billion over the last
between eight and 26 secreted Transcriptional decade and significant reductions in production have
Activator-Like (TAL) effectors that activate host resulted in major price increases.
susceptibility genes to favor bacterial growth. Known
As disease continues to spread, demand grows for new
mechanisms of rice gene-for-gene resistance against
improved varieties. Currently there are no commercial
TAL effectors depend on TAL gene activation activity;
chemicals, biocontrol agents or resistant cultivars
these include resistance (R) genes transcriptionally
available to control the pathogen. BXW can be managed
activated by a specific TAL effector, or promoter
by following cultural practices; however, the adoption of
mutations preventing TAL effector function. We used a
these practices has been inconsistent as these techniques
TAL effector-free X. oryzae strain, X11-5A, to determine
are labor intensive. Given the rapid spread and
the effects of individual TAL effectors on various rice
devastation of BXW across the continent, genetic
cultivars. In one variety, expression of any of 10 TAL
transformation through the use of modern biotechnology
effectors from diverse X. oryzae strains and pathovars
tools offers an effective, fast, safe, and viable way to
triggered resistance to X11-5A, with eight of the
develop resistant varieties.
effectors abolishing symptoms. A truncated TAL effector
lacking the transcriptional activation domain also In the absence of natural host plant resistance among
triggered resistance, but resistance was not triggered by a banana cultivars, researchers have developed transgenic
TAL effector lacking the central repeat domain, nor by bananasconstitutively expressing the Hypersensitive
two TAL effectors from other Xanthomonas species. The Response Assisting Protein (Hrap) or Plant
rice variety was not resistant to most X. oryzae strains FerredoxinLike Protein (Pflp) genes originated from
that natively express TAL effectors, although resistance sweet pepper. The transgenic banana plants have
was observed against all tested strains of X. oryzae pv. exhibited strong resistance to BXW in the laboratory and
oryzicola from Africa. This suggests that plasmid greenhouse tests [2, 3]. The best 65 resistant lines were
74
ICPPB2014 Abstracts
planted in a confined field trial at the National gyouchen@sjtu.edu.cn
Agricultural Research Laboratory, Kawanda, Uganda,
for further evaluation. Majority of transgenic lines had The closely-related plant pathogens
significantly higher resistance in comparison to control Xanthomonasoryzaepv.oryzicola(Xoc) and X. oryzaepv.
non-transgenic plants. Eleven transgenic lines infused oryzae(Xoo) cause bacterial leaf streak (BLS) and
with wilt-resistance genes had shown 100% resistance bacterial leaf blight (BLB) in rice, respectively. Unlike
against Xcm under confined field trials and retained the Xoo endogenous avirulence-resistance (avr-R) gene
resistance even in the ratoon crop, which confirmed that interactions have not been identified in Xoc-rice
this technology can provide solution to farmers for pathosystem, though both Xoc and Xoo possess
controlling BXW. Aside from full resistance to BXW, transcription activator-like effectors (TALEs), which are
the transformed lines also showed flowering and yield known to modulate R or S genes in rice. In this report,
characteristics comparable to non-transgenic varieties. avrXa7, avrXa10 and avrXa27 from Xoo were
The best 6-8lines will be further tested in multi-location transferred into YNB0-17 and RS105, a hypovirulent
trials across the country to capture the different strain and ahypervirulentone of Xoc, respectively. When
environment effect on disease resistance for these lines. YNB0-17 containing avrXa7, avrXa10 or avrXa27 was
It is well known that pathogens can evolve and inoculated to rice, hypersensitive responses (HRs) were
“breakdown” disease resistance. To delay or avoid this elicited in rice cultivars containing the R genes Xa7,
outcome, we are also stacking these two genes together Xa10 and Xa27, respectively. By contrast, RS105
in the same line to enhance durable resistance. expressing avrXa27 elicited an HR in a rice cultivar
containing Xa27, but the expression of
The information presented here provides proof of avrXa7andavrXa10 in RS105 did not result in HRs in
concept for control of BXW through Hrap and rice cultivars containing Xa7 and Xa10, correspondingly.
Pflp-mediated resistance and the first field based Southern blot analysis demonstrated that YNB0-17
evidence for transgenic control of a bacterial disease in possesses only about 9 putative TALE genes, whereas
banana and progress towards development and release of the hypervirulent RS105 contains at least 20. Although
transgenic bananas resistant to BXW. Such resistant YNB0-17 containsan intact type III secretion system
varieties would boost the available arsenal to fight this (T3SS), its genome is lacking the T3SS effector genes
disease epidemic and save livelihoods in Africa. avrRxo1 and xopO, which are present in RS105. The
introduction of avrRxo1 and xopO into YNB0-17 did not
Acknowledgement: We thank Academia Sinca, Taiwan suppress avrXa7- or avrXa10-triggered immunity in rice.
for providing the Hrap and Pflpgenes and African However, the transference of individual tale genes from
Agricultural Technology Foundation (AATF) for RS105 into YNB0-17 led to the identification of tal6 that
negotiating a royalty-free license for these genes from suppressed avrXa7-Xa7 mediated defense. Two potential
the patent holder. This research was supportedby TAL6-targeted genesofrice Nipponbare could be
USAID. activated by designed TALEs that function as TAL6.
References: Thus, YNB0-17 may be a useful recipient for
[1]L. Tripathi,M. Mwangi, S. Abele, V. Aritua,W.K. discovering such the suppressors. This is the first report
Tushemereirwe,R. Bandyopadhyay (2009). Plant that co-evolutionally generated tale genes in Xoc
Disease 93, 440. suppress gene-for-gene defense against BLB, which may
[2]L.Tripathi, H. Mwaka, J.N. Tripathi, W.K. explain the lack of BLS resistant cultivars.
Tushemereirwe (2010).Mol. Plant Pathol.11, 721. S3-O7 Nonpathogenic xanthomonads: a new
[3]B. Namukwaya, L. Tripathi, J.N. Tripathi,G. aspect in Xanthomonas phylogeny
Arinaitwe, S.B. Mukasa, W.K. Tushemereirwe(2012).
Transgenic Res., 12, 855. B Cottyn*, E Gavrila, C Van Malderghem, M Maes
Plant Sciences Unit – Crop Protection, Institute for
S3-O6 AvrXa7-Xa7 Mediated Defense in Rice Agricultural and Fisheries Research (ILVO), Burg.
Can Be Suppressed by A Transcriptional VanGansberghelaan 96, Merelbeke, Belgium
Activator-like Effector TAL6from Xanthomonas bart.cottyn@ilvo.vlaanderen.be
oryzaepv. oryzicola
Xanthomonas is traditionally known as a genus of
Lulu Caia, ZhiyuanJia, Li Xionga, LifangZoua,YurongLia,
bacterial plant pathogens. International quarantaine
WenxiuMaa, Liang Liua, Muhammad Zakriaa, Guanghai Jib,
regulations are implemented for several Xanthomonas
Gongyou Chena*
a species and pathovars. While Xanthomonas plant
School of Agriculture and Biology, Shanghai Jiao Tong pathogens are well characterized, little is understood
University/State Key Laboratory of Microbial about the ecology of nonpathogenic xanthomonads living
Metabolism, Shanghai, 200240, Chin in close association with plants but causing no apparent
b
Key Laboratory for Plant Pathology of Yunnan disease symptoms on the host. In the past, these strains
Province, College of Plant Protection, Yunnan were largely overlooked and their relatedness to
Agricultural University, Kunming, 650201, China described Xanthomonas species was often unknown [1].
75
ICPPB2014 Abstracts
Today, it is possible to classify unknown Xanthomonas [3]J. Vandroemme, B. Cottyn, J.F. Pothier, V. Pflüger, B.
strains in a phylogenetic tree of Xanthomonas based on Duffy, M. Maes (2013). Plant Pathology, 62, 1123.
comparison of gyrB sequences [2].
S3-O8 Resistant reaction of citron C-05 to the
Our aim was to define the phylogenetic position of pathogen of citrus canker disease
environmental and previously unclassified
Liping Liu, Jiawen Yan, Ziniu Deng*, Dazhi Li
xanthomonads, including nonpathogenic strains and
poorly characterized pathovars, based on comparison of Horticulture and Landscape College and National
gyrB sequences and MLSA of six housekeeping genes. Center for Citrus Improvement, Hunan Agricultural
University, Changsha 410128, Hunan, China
In gyrB sequence analysis, which was concordant with deng7009@163.com
the MLSA results, these strains showed a wide
phylogenetic diversity. Some strains were allocated to Citrus canker is a worldwide quarantine disease that has
existing groups, others fitted within previously identified brought great damage to citrus industry. With successive
new lineages [2], and still others formed new entities. The five years screening in the field, we have found an active
nonpathogenic Xanthomonas strains were distinct from resistant germplasm, citron C-05[1]. The growth of
the pathogenic species or pathovars that cause diseases Xanthomonas axonopodis pv. citrus (Xac)was inhibited
on the plants from which they were isolated. Many of in the mesophyll tissue of citron C-05 inoculated with
them were identified as belonging to X. arboricola, X. enhanced green fluorescent protein (EGFP)-labelled Xac,
pisi, X. hortorum, or X. sacchari but came from different while was stimulated in the highly susceptible variety
hosts and were not concordant with the known ‘Bingtang’ sweet orange, according to the fluorescent
pathogenicity of those species. Specifically X. arboricola intensity observation with confocal laser scanning
is a not well-defined species harboring a variety of microscope [2]. For better understanding the resistant
non-pathogenic xanthomonads from diverse origins [3]. mechanism of citron C-05, RNA-seq has been performed
Still other strains, isolated from a range of hosts, grouped to find the differential expressed genes in the
together forming new clades that may represent new transcriptional level after inoculated with Xac between
species or subspecies. citron C-05 and ‘Bingtang’ sweet orange. The results
showed that the LYP2 and CERK1, which belong to the
Plant health and seed certifications are mandatory to pattern recognition receptor (PRR) genes, have been
prevent the introduction, spread and establishment of detected up regulated in the resistant citron C-05 while
quarantine organisms. Misidentification of down regulated in the susceptible ‘Bingtang’ sweet
nonpathogenic xanthomonads as regulated organisms can orange within 2-3 days after needle-prick inoculation.
have serious economic consequences. In the past, the Subsequently, quantitative RT-PCR analysis was used to
association of nonpathogenic xanthomonads with plant identify the RNA-seq results. The relative expression
material may have resulted in unnecessary destruction of levels of LYP2 decreased 2.9-fold on the 2nd day after
economically valuable crops. We suggest that in all cases inoculation in ‘Bingtang’sweet orange, while increased
when xanthomonads are found, a gyrB sequence is 1.7-fold in citron C-05; CERK1 decreased 2.6-fold on the
determined and verified with available Xanthomonas 3rd day after inoculation in the succeptible genotype,
barcode sequences in databases such as Q-bank while increased 1.2-fold in the resistant one. It seems that
(www.q-bank.eu), and particularly the diverse LYP2 and CERK1 might play positive roles in resistance
nonpathogenic xanthomonads need the attention of plant in citron C-05. Through bioinformatics analysis, LYP2
protection organizations, plant quarantine bureaus and was found that contains two LysM motifs and the
seed health units. CERK1, tyrosine kinase-containing protein, contains
only one LysM motif. With all the results we have got,
Acknowledgements:We wish to thank Casiana Vera the CERK1 and LYP2 genes’ expression patterns in
Cruz (IRRI), Olivier Pruvost (CIRAD), Silue Drissa citron C-05 were similar to those reported in Arabidopsis
(AfricaRice), Valérie Verdier (IRD), Nursen Ustun thaliana [3] and Oryza sativa[4] as PRRs in innate
(Izmir Plant Protection Research Institute), Joanna immunity.
Pulawska (Research Institute of Horticulture), Aleksa
Obradovic (University of Belgrade), Nicola Sante References:
Iacobellis (Universita degli Studi della Basilicata), [1]Z.N. Deng, L. Xu, D.Z. Li, G.Y. Long, L.P. Liu, G.P.
Geert Haesaert (UGent), and Paul De Vos (BCCM/LMG) Shu and F. Fang (2010). Plant Breeding, 129, 341.
for providing Xanthomonas strains. [2]L.P. Liu, Z.N. Deng, J.W. Qu, J.W. Yan, V. Catara,
D.Z. Li, G.Y. Long and N. Li (2012). Current
References: Microbiology, 65, 304.
[1]L. Vauterin, P. Yang, A. Alvarez, Y. Takikawa, D.A. [3]R. Willmann, H.M. Lajunen, G. Erbs, M-A. Newman,
Roth, A.K.Vidaver, R.E. Stall, K. Kersters, J. Swings D. Kolb, K. Tsuda, F. Katagiri, J. Fliegmann, J-J. Bono,
(1996). Syst. Appl. Microbiol., 19, 96. J.V. Cullimore, A.K. Jehle, F. Götz, A. Kulik, A.
[2]N. Parkinson, C. Cowie, J. Heeney, D. Stead (2009). Molinaro, V. Lipka, A.A. Gust, and T. Nürnberger
Int.J.Syst.Evol.Microbiol., 59, 264. (2011). PNAS, 108, 19824.
76
ICPPB2014 Abstracts
[4]B. Liu,J-F. Li, Y. Ao,J.W. Qu, Z.Q. Li, J.B. Su, Y. sequencing
Zhang, J. Liu, D.R. Feng, K.B. Qi, Y.M. He, J.F. Wang,
Ye tao
and H-B. Wang (2012). Plant Cell, 24, 3406.
Shanghai Majorbio Pharm Technology Co.Ltd.,
S3-O9 Tolerance mechanisms of potato plants NO.3399, Kangxin Road , Shanghai, China
against Pectobacterium carotovarum subsp ye.tao@majorbio.com
brasiliense
Currently PacBio RS II system can produce reads with
Mosina G a,b, Tanui C a,b ,Coutinho T a,b, Moleleki L a,b* average lengths of 4,200 to 8,500 bp and the longest
a
Department of Microbiology and Plant Pathology, reads is over 30 kbp. Long reads and cost-effective
University of Pretoria, Lunnon road, Hillcrest, South sequencing technologies can accelerate investigations of
Africa species lack of reference genome, especially for microbe
b
Forestry, Agriculture and Biotechnology Institute, with small and moderate genome size. Since early 2013,
University of Pretoria, South Africa we have used PacBio data to do de novo assembly of
lucy.moleleki@up.ac.za bacteria and fungi genome. More than thirty bacteria
were assembled into circle status with zero internal gap,
Pectobacterium carotovorum subsp brasiliense (Pcb) is a and two fungi genomes were assembled at the
newly identified member of the potato soft rot chromosome level.
enterobacteriaceae (SRE) causing major losses to
growers in South Africa and other regions. Several Here we present the customized hybrid assembly method
potato cultivars were evaluated for resistance against Pcb. to get complete and perfect bacteria genome. First
One of these cultivars, Solunum tuberosumcv BP1, saturated next generation seuqncing (NGS) data such as
consistently showed no blackleg disease symptoms Hiseq2500 and Miseq pair-end reads was used to contig
throughout the duration of the study (21 dpi) in all and scaffold construction. Second high quality long reads
replicated experiments. We also observed clear was introduced to do cyclized genome scaffolding. In
phenotypic differences between tolerant and susceptible order to improve the genome quality NGS data was
cultivars. Consequently, a comparison of Pcb finally used to correct small polymorphisms in previous
colonisation patterns in these cultivars was undertaken. dataset.
In the susceptible cultivar, Pcb cells colonised the xylem
tissue forming ‘biofilm-like’ aggregates that led to We also demonstrate a novel strategy for fungi
occlusion of some of the vessels [1]. On the contrary, in chromosome level genome assembly. BAC library is
the tolerant cultivar, Pcb appeared as free swimming constructed at 10X coverage approximately for each
planktonic cells with no specific tissue localisation. We sequencing sample and every 100 BACs are pooled into
hypothesised that Pcb biofilm formation in stems of one tube. Then we use NGS technology to sequence
susceptible potato plant stems is regulated by quorum BAC-pools and PacBio to do whole genome sequencing.
sensing and the possible lack of biofilms in the tolerant Assemble process is performed by MajorBio innovative
cultivar could be an indication of interference thereof. A bioinformatical pipeline. The accuracy of the genome is
quorum sensing defective mutant (PcbΔExpI-peGFP) above 99.9% according to the sanger sequencing results
was thus inoculated into stems of both the tolerant and (100 fragments were selected randomly). These data
susceptible cultivars. Unexpectedly, no differences were show that combining NGS and PacBio technology,
observed in colonization patterns of the mutant strain in BAC-based strategy is a promising choice for fungi
the two cultivars. Furthermore, leaf infiltrations assays researchers who need a extremely high quality genome.
were conducted to compare resistance to Pcb in the S3-O11 Insights into the molecular interactions
tolerant cultivar compared to other susceptible cultivars. between Clavibacter michiganensis subsp.
Interestingly, all susceptible potato plant leaves became michiganensis and tomato
completely water soaked and collapse of tissue was
observed within 48 hours post inoculation. However no Shulamit Manulis-Sassona*,Laura Chalupowicza, Karl.-Heinz
such symptoms were observed for the tolerant cultivar. Gartemannb, Guido Sessac, Isaac Barashc*
a
Department of Plant Pathology and Weed Research,
Acknowledgement: The NRF Thuthuka, Potatoes South ARO, The Volcani Center, Bet Dagan, Israel.
Africa (PSA) and THRIP are acknowledged for funding b
Department of Microbiology/Genetechnology,
this project, and the The British Society of Plant University of Bielefeld, Bielefeld, Germany.
Pathology (BSPP) Travel fund. c
Department of Molecular Biology and Ecology of Plants,
References: Tel Aviv University, Tel-Aviv, Israel.
shulam@volcani.agri.gov.il
[1]G.K.Kubheka, N. Moleleki, T. Coutinho,
L.N.Moleleki (2013). Phytopathology, 103(12), 1269. Clavibacter michiganensis subsp. michiganensis (Cmm)
is a gram-positive actinomycete, causing bacterial wilt
S3-O10 Complete and cost-effective microbe and canker disease in tomato. The genome of Cmm strain
genome assembly by PacBio single molecule NCPPB382 consists of a circular chromosome (3.3 Mb)
77
ICPPB2014 Abstracts
with high G+C content (72.6%) and two circular the avirulence strain DG34 that expresses avrRpm1
plasmids, pCM1 and pCM2 harboring virulence genes, (recognized by the resistance protein RPM1) to induce
celA and pat-1, respectively. The loss of either plasmid ETI, and HrcC- that lacks the type three secretion system
reduced virulence, while curing the bacterium of both to activate PTI. We found that plants infected with
plasmids results in a non-virulent endophytic strain. A different strains displayed dynamic differences in the
chromosomal pathogenicity island (chp/tomA PAI) of accumulation of the defense signaling molecule salicylic
129 kb with a low G+C content, harboring several serine acid, expression of the defense marker gene PR1, cell
proteases, was shown to be necessary for pathogenicity death formation, and accumulation/localization of the
and colonization. Colonization patterns of a GFP labeled reactive oxygen species, H2O2. The differences between
Cmm strains revealed that the pathogen extensively PTI, ETS, and ETI are dependent on the doses of the
colonizes the lumen of xylem vessels, preferentially strains used. These data support the quantitative nature of
attaches to the spiral secondary wall. Acropetal PTI, ETS, and ETI and they also reveal qualitative
movement of Cmm in tomato resulted in an extensive differences between PTI, ETS, and ETI. Interestingly, we
systemic colonization of the whole plant, while observed the induction of large cells in the infected
strains(lacking the plasmids or the PAI) remained leaves, most obviously with HrcC- at later infection
confined to the area surrounding the inoculation site. stages. The enlarged cells have increased DNA content,
Transcriptional analysis revealed that celA and pat-1 suggesting a possible activation of endoreplication.
were significantly induced in Cmm at initial 12-72 h, Consistent with strong induction of abnormal cell growth
whereas the serine proteases chpC and ppaA, residing on by HrcC-, we found that the PTI elicitor flg22 also
thePAI, were highly expressed at 96 h after inoculation. activates abnormal cell growth, depending on a
Chromosomal genes involved in cell wall functional flg22-receptor FLS2. Thus, our study has
degradation(i.e., pelA1, celB, xysA and xysB), was also revealed a comprehensive picture of dynamic changes of
induced at early stages of infection. Different pattern of defense phenotypes and cell fate determination during
pathogenicity and gene expression was observed Arabidopsis-P. syringae interactions, contributing to a
duringblisters formation on tomato leaves.These findings better understanding of plant defense mechanisms.
suggest that virulence factors located on the chp/tomA
PAI or the plasmids are required for effective movement, S3-O13 Climate changes and rice bacterial
colonization and symptoms developmentin tomato. blight: an approach to enhance rice tolerance to
abiotic and biotic stresses
S3-O12 Dynamics of defense responses and
Gerbert Sylvestre C. Dossaa,b, Amelia Henryc, Rolando
cell fate change during
Torresc, Arvind Kumara, Ricardo Olivaa, Edgar Maissb,
Arabidopsis-Pseudomonas syringae
Kerstin Wydrab,d, Casiana M. Vera Cruza*
interactions a
Plant Breeding, Genetics and Biotechnology,
a b a b a*
SafaeHamdoun , ZheLiu , ManroopGill , Nan Yao , Hua Lu International Rice Research Institute, DAPO Box 7777,
a
Department of Biological Sciences, University of Metro Manila, Philippines
b
Maryland Baltimore County, 1000 Hilltop Circle, Institute of Plant Diseases and Plant Protection, Leibniz
Baltimore, MD 21250, USA. Universität Hannover, Herrenhäuser Straße 2, 30419
b
State Key Laboratory of Biocontrol, Guangdong Key Hannover, Germany.
c
Laboratory of Plant Resources, School of Life Sciences, Crops and Environmental Sciences Division,
Sun Yat-Sen University, Guangzhou 510275, P.R. China International Rice Research Institute, DAPO Box 7777,
hualu@umbc.edu Metro Manila, Philippines
d
Erfurt University of Applied Sciences, Altonaer Str. 25,
Plant-pathogen interactions involve sophisticated action 99085 Erfurt; Germany
and counteraction strategies from both parties. Plants can c.veracruz@irri.org
recognize pathogen derived molecules, such as
conserved pathogen associated molecular patterns Environmental changes, such as water shortage and high
(PAMPs) and effector proteins, and subsequently temperature negatively affect crop growth, yield and
activate PAMP-triggered immunity (PTI) and response to biotic stress. Drought and high temperature
effector-triggered immunity (ETI), respectively. in the future will considerably influence response of rice
However, pathogens can evade such recognitions and resistance (R) gene to bacterial blight (BB) caused by
suppress host immunity with effectors, causing Xanthomonas oryzae pv. oryzae (Xoo). Yield loss due to
effector-triggered susceptibility (ETS). The differences drought and BB can be estimated to reach 100% and
among PTI, ETS, and ETI have not been completely 50%, respectively. To understand the interaction between
understood. Toward a better understanding of PTI, ETS, rice, drought, high temperature and bacterial blight,
and ETI, we systematically examined various comparative analysis of single and double stress
defense-related phenotypes of Arabidopsis infected with responses by greenhouse, field study and time course
different Pseudomonas syringaepv.maculicolaES4326 transcriptome analysis were conducted. Sixteen rice
strains, using the virulence strain DG3 to induce ETS, genotypes (drought QTLs, Xa-genes and Xa-genes
combined with drought QTLs) were screened for BB
78
ICPPB2014 Abstracts
a
resistance under drought and irrigated conditions. In The New Zealand Institute for Plant & Food Research,
general, disease severity was less in the drought Private Bag 4704, Christchurch 8140, New Zealand
b
treatment compared to irrigated conditions. Genotypes The Bio-Protection Research Centre, PO Box 85084,
with the Xa-gene and drought QTLs showed resistance to Lincoln University 7647, Canterbury, New Zealand
c
Xoo race 1 (PXO61, avrXa4) under BB stress alone, The New Zealand Institute for Plant & Food Research,
suggesting that these genotypes may have the Xa4 gene Private Bag 1401, Havelock North 4157, New Zealand
d
except a line IR87705-6-9-B with broad spectrum The New Zealand Institute for Plant & Food Research,
resistance to 10 Xoo races. Under dual stress of drought Cronin Road RD 1, Pukekohe 2676, New Zealand
and BB, drought QTL genotypes were susceptible to BB, andrew.pitman@lincoln.ac.nz
and genotypes with droughtQTLs and the Xa4 gene
showed more effective disease resistance compared to Candidatus Liberibacter solanacearum (cLso) was
drought QTLs genotypes. Bacterial blight NILs were discovered in capsicum (Capsicum annum) and tomato
resistant to BB under drought, except when only Xa4 (Solanum lycopersicum) plants showing decline and
was present, in which case a disease increase with yield loss in New Zealand in 2008 [1]. Since then, the
PXO61 (avrXa4 strain) was observed. Strain comparison bacterium has emerged globally as an economically
revealed significantly higher levels of virulence from important pathogen of a variety of crops [e.g. 2, 3]. cLso
PXO61 than PXO86. Our results also showed significant is transmitted by Bactericera cockerelli (Sulc),
difference between disease severity at 14 and 21 days commonly referred to as the tomato potato psyllid (TPP),
post-inoculation with PXO61 across rice lines. which feeds on the phloem of solanaceous plants [4]. In
potato (Solanum tuberosum),TPP feeding and subsequent
Evaluation of the response of 5 out of the 16 genotypes cLso infection is associated with zebra chip, a disease
to bacterial blight under different soil moisture (SM) characterized by dark flecking throughout affected potato
conditions showed BB resistance NIL IRBB4 less tubers that subsequently produces unpalatable crisps or
effective under 50% SM compared to 70% SM. Under French fries upon frying [5, 6]. Zebra chip and its
drought stress, leaf water potential and plant canopy associated management has cost on average
temperature did not influence rice bacterial blight approximately 7% of farm gate value and about 2% of
progression across genotypes, and droughtQTL the overall value chain for potatoes annually in New
genotypes with no Xa-gene showed susceptibility under Zealand since the first outbreak - around NZD60 million
both treatments. These results suggest that the over six years (Potatoes New Zealand, personal
effectiveness of resistant genotypes seen in well-watered communication).
conditions also remains under drought stress. Time
course transcriptome profiling of IR24 (no effective R The epidemiological importance of TPP in the spread of
gene) and IRBB67 (Xa4+Xa7) inoculated with PXO145 zebra chip has focused management strategies on control
(avrXa4, avrXa7) under high (35/31°C) and low of the insect, primarily through regular applications of
(29/21°C) temperature at different time points (3, 24 and insecticides. Yet, the significance of tuber-borne
120 h post-inoculation, hpi) showed 2-fold change inoculum of cLso in zebra chip and its impact on potato
expression patterns in 4608 genes. Interestingly, the production remains controversial. In this study, we
temperature effect was observed on expression of genes describe the results of field and shadehouse studies
from the nodulin-family in IR24 at 120 hpi. conducted over a period of four years that demonstrate
the effects of tuber-borne inoculum on potato production.
Our results suggest that effectiveness of rice with the In particular, we reveal the yield and quality
single Xa gene (Xa4) is affected by high temperature and consequences associated with tuber-borne cLso inoculum
drought, and improving rice tolerance to stress may and the differential responses of potato cultivars to this
require targeting a combination of biotic and abiotic pathogen. Our data is incorporated into our latest model
stress resistance/tolerance traits. Furthermore, IRBB67 for the interactions between cLso, TPP and potato and
was observed to be the most resistant variety to both how growers might more effectively manage the zebra
stresses (BB/high temperature, BB/drought), chip complex.
demonstrating that a combination of Xa4+Xa7 with
drought QTLs in rice varieties will be suitable under the Acknowledgement: The research was funded by The
future climate situations. New Zealand Institute for Plant & Food Research
S3-O14 The differentential responses of potato References:

cultivars to tuber inoculum of Candidatus [1]L. W. Liefting et al. (2009). Plant Disease, 93, 208.
Liberibacter solanacearum and their [2]L. W. Liefting et al. (2008). Plant Disease, 92, 1588.
epidemiological significance [3]J. E. Munyaneza et al. (2010). 94, 639.
[4]A. K. Hansen et al. (2008) Applied & Environmental
Pitman Andrewa,b*, Thompson Sa, Butler Ra, Taylor Nc, Wright Microbiology, 74,5862.
Pd, Shah Fa, Berry Na, Read Sa, Dohmen Vereijssen Ja, Walker [5]L. W. Liefting et al. (2008). Plant Disease, 92, 1474.
Ma, Beard Sa, Jorgensen Na [6]G. A. Secoret al. (2009). Plant Disease, 93, 574.
79
ICPPB2014 Abstracts
S3-P1 Pathogen of kiwifruit bacterial canker Bacterial fruit blotch (BFB) is a threatening disease of
originally isolated from threenon-kiwifruit hosts cucurbits, caused by the Gram-negative bacterium
in China Acidovoraxcitrulli. The disease gained importance after
devastating outbreaks in watermelon fields in the US
Rong Hea, Pu Liua, Jiayong Hua, Bing Jiaa,Lorenzo Gallipolib,
during the 1980s'. Recently, serious economic losses due
Angelo Mazzagliab, Giorgio M. Balestrab, Liwu Zhua*
a to BFB have been reported for other cucurbits in many
The Key Lab of Pomology, College of Horticulture, parts of the world. Today, there are not efficient means to
Anhui Agricultural University, Hefei, People’s Republic cope with BFB, which represents a serious threat to the
of China, bDepartment of Science and Technologies for cucurbit industry.According to host range, and
Agriculture, Forestry, Nature and Energy (DAFNE), biochemical and genetic features, at least two groups exist
University of Tuscia, Viterbo, Italy. within this species: group I includes strains that were
zhuliwu@ahau.edu.cn mainly isolated from non-watermelon hosts, while group
Kiwifruit bacterial canker (KBC), as incited by II includes watermelon strains. As many Gram-negative
Pseudomonas syringae pv. actinidiae (Psa), may cause plant pathogenic bacteria, A. citrullirequires a type III
severe economic losses to kiwifruit (Actinidia deliciosa secretion system (T3SS) for pathogenicity. The T3SS
and A. chinensis). At present, worldwide kiwifruit injects effector proteins directly into the cytosol of the
production is affected by a wide outbreak of this plant cells, which collectively allows the pathogen
bacterial canker. Previously studies indicated that Psa manipulating the host cellular activities to its own benefit.
strains have only been isolated from Actinidia species, Due to the important role of these effectors in
and little was known regarding its interhosts. To identify pathogenicity, we hypothesized that the observed group
the potential interhosts of Psa, leaves with suspicious host preferential association is, at least partially,
symptoms in several plants, including Setaria viridis (L.) influenced by their effector repertoire. In this study we
Beauv, Alternanthera philoxeroides (Mart.) Griseb. and cloned and sequenced the effector genes from 22 A.
Paulownia tomentosa (Thunb.) Steud, near or under citrulli strains isolated from different host plants and
Psa-infected kiwifruit plants were collected for pathogen geographic locations. Comparative analyses of the
isolation. Next, several in vitro healthy leaves of each effector genes revealed that these genes cluster according
plant above and in situ branches of potted kiwifruit were to the group I/II classification. Moreover, our analyses,
used for testing the pathogenicity of each isolate from the combined with additional experimental evidence, lead to
field-diseased leaves or each re-isolate from the the identification of a third group of A. citrulli strains.
inoculated leaves of the three non-kiwifruit plants, Currently, we are investigating selected effectors to assess
respectively. The in vitro leaf inoculation demonstrated their contribution to virulence and host preferential
that each of these isolates made the healthy leaves of its association.
original host show the same symptoms as the initial S3-P3 Characterization of factor(s) responsible
diseased leaves, and all the re-isolates caused disease in for antagonism ofPseudomonas sp. P482
potted kiwifruit by in situ branch inoculation. The against pathogens of potato
pathogens isolated from diseased leaves with suspicious
symptoms on the three plants were all identified as Psa Adam Ossowicki*, D. Krzyżanowska, S. Jafra
by PCR with specific primers (primers ACT1/ACT2; Laboratory of Biological Plant Protection,
PsaF1/PsaR2). This demonstrated that the kiwifruit plant Intercollegiate Faculty of Biotechnology UG and MUG
is not a unique host for Psa and suggests that Psa may adam.ossowicki@ug.edu.pl
originate from other pathovars of P. syringae.
Pseudomonas genus gathers the species inhabiting many
S3-P2 Divergence of Acidovorax citrulli into different environments, from marine waters and soil to
three lineages based on type III secreted effector human body. This genus is characterised by high
sequence analysis variability of pan-genome, which probably enables
colonization of diverse habitats. What is more,
Noam Eckshtain Levia*, R. Walcottb, J. Sikorskic,
1 Pseudomonas produces wide range of secondary
S. Burdmana
metabolites, in many cases production of which is
Department of Plant Pathology and Microbiology, The species specific [1]. Pseudomonas sp. P482 is rhizosphere
Robert H. Smith Faculty of Agriculture, Food and bacterium isolated from roots of tomato [2]. It secretes
Environment, The Hebrew University of Jerusalem, unidentified antimicrobial compound(s) acting against
Rehovot 76100, Israel selected bacterial and fungal plant pathogens.
2
Department of Plant Pathology, The University of
Georgia, 4315 Miller Plant Sciences, Athens, GA 30602, Aim of this study is to analyse the compound(s)
USA responsible for antimicrobial activity of Pseudomonas sp.
3
Leibniz Institute DSMZ-German Collection of Different growth conditions including temperature, pH,
Microorganisms and Cell Cultures (DSMZ), type of carbon source and complexity of media were
Braunschweig, Germany tested to find optimal requirements of Pseudomonas sp.
noam.levi2@mail.huji.ac.il P482 for production of antimicrobial secondary
80
ICPPB2014 Abstracts
metabolites. Obtained bacteria cultures were centrifuged including Xa1, Xa2, Xa3, Xa4, xa5, Xa7, xa8, Xa10,
and filtered to separate whole cells and liquid fraction Xa11, Xa13, Xa14, andXa21), and five Taiwan rice
(supernatant) containing extracellular compounds. cultivars (Taichung Native 1, Taichung Shen 10, Taiken
Organic solvents of different polarity were used to 9, Taichung 192, and Tainan 11). The results showed
extract active metabolites. Pathogen growth inhibition that IRBB5, IRBB21, IRBB4 and IRBB7 were
test was performed to verify the presence of incompatible to 95%, 93%, 77% and 48% of the isolates,
antimicrobial compound(s) in acquired extracts. indicating that xa5, Xa21, Xa4 and Xa7 can recognize
Afterwards, active organic extracts were separated using most of the Xoo strains in Taiwan and elicit resistance.
reverse phase thin layer chromatography (TLC). The The Xoo strains can be separated into high- and
presence of genes involved in production of low-virulent groups; they can also be divided into 20
antimicrobial compounds previously described for pathotypes. Combining phenotypic data with geographic
Pseudomonas spp. was analysed by PCR. Random and temporal information, diverse pathotypes were found
mini-Tn5 transposon mutagenesis was conducted on after 2000, which might be related to the population of
P482, and transposon mutants were screened for loss of rice cultivars in the field. In molecular marker analysis,
antimicrobial activity. repetitive-element PCR (rep-PCR)was conducted by
using IS1112, IS476, and REP element-based primers.
The culture supernatant extract was separated using Phylogenic analysis revealed correlation between
reverse phase TLC and retention factor (Rf) of collection year and location. In Taiwan, KH139 is the
antimicrobial compound(s) was establish by overlaying only commercial cultivar exhibiting tolerance to Xoo.
the TLC plate with agar-solidified culture of the Our results can provide useful information forresistance
pathogen. PCR analysis showed no presence of genes breeding and the development of disease management
involved in the synthesis of common Pseudomonas spp. strategies.
antimicrobials. Four transposon mutants lacking
antimicrobial activity are under investigation. Acknowledgement: We thank Jui-Ya Lai, Chun-Yi Lin,
Yu-Chia Chen, Jain-Fu Wu, and Pin-Ru Chen for
The method for extraction of active compound from participating in field trials.
culture supernatant of P482 was established. Currently
efforts are undertaken to purify and identify compound(s) References:
and to investigate metabolic pathways defected in [1]D. Mishra, M.R. Vishnupriya, M.G. Anil, K.Konda,
transposon mutants lacking antimicrobial activity. Y.Raj, R.V.Sonti, (2013). PLoS One, 8(11):e81996.
[2]M.Ryba-White, N.Sakthivel, C.Yun, F.White, J.E.
References: Leach (2005). DNA Seq, 16(1):75-79.
[1]H.Gross, J.E. Loper(2009). Natural Product Reports, [3]C.W. Chen, S.H. Hsu (2009). Bacterial diseases of
26(11), 1408–46. doi:10.1039/b817075b. rice in Taiwan. Proceeding of Sympodium on
[2]D.M.Krzyzanowska, M.Potrykus , M.Golanowska, Achivement and Perspective of Rice Protection in
K.Polonis , A.Gwizdek-Wisniewska, , E.Lojkowska, Taiwan:160.
S.Jafra(2012). Journal of Plant Pathology, 94, 367–378. [4]Y.M. Liao, J.Z. Chaing (1982). Journal of Agricultural
S3-P4 Genotypic and Pathotypic diversity of Research of China,31(4): 321-333.
Xanthomonas oryzae pv. oryzae in Taiwan S3-P5 Diversity of Xanthomonas arboricola pv.
Hengan Lina*, J Y Tzeng b, S Z Huanga, C C Kuoc, C M Huanga, juglandis population in Poland
Y CShi a, W L Denga, C L Chunga
a
Joanna Pulawskaa*, M Kałużnaa, MWaleronb, P Sobiczewskia
Dept. Plant Pathology and Microbiology, National a
Research Institute of Horticulture, Pomology Division,
Taiwan University, Taipei, Taiwan Pomologiczna 18, 96-100 Skierniewice, Poland
b
Dept. Plant Pathology, National Chung Hsing b
Department of Biotechnology, Intercollegiate Faculty of
University, Taichung, Taiwan Biotechnology, University of Gdansk -Medical
c
Taichung District Agricultural Research and Extension University of Gdansk, Kladki 24, 80-822 Gdansk, Poland
Station, Council of Agriculture, Taiwan joanna.pulawska@inhort.pl
r02633002@ntu.edu.tw
Isolations from symptomatic leaves and fruits from
Rice bacterial leaf blight is caused by Xanthomonas walnut trees exhibiting bacterial blight were collected
oryzae pv. oryzae (Xoo), which seriously decreases rice from 6 locations in Poland. These isolationsresulted in 18
yield in Taiwan. Since 1970, studies about Xoo isolation, bacterial isolates with colony morphologies resembling
inoculation and pathotypic analysis have been started. In that ofXanthomonasarboricolapv.juglandis. PCR of the
order to reveal the population structure and pathotypes of DNA of the isolates with X1 and X2 primers specific for
Xoostrains, field inoculation experiment and molecular genus Xanthomonasrevealed positive results. In
marker analysis were conducted. The 88 Xoo strains pathogenicity tests on unripe walnut fruits, all of the
were collected during 1986-2011 from different counties. isolates caused typical black necrotic lesions covering
In 2012-2013, we inoculated 88 Xoo strains on IR24, 12 almost the entire pericarp. Results of selected phenotypic
IRRI near isogenic lines (containing different R genes,
81
ICPPB2014 Abstracts
characteristics were the same as described for type strain (repressor of ga1-3), one of five DELLA proteins that
of X. arboricolapv. juglandis. Results of genetic analyses repress GA signaling and promote plant tolerance under
(PCR MP, ERIC-, BOX-PCR, and MLSA) indicated biotic and abiotic stresses. The EAR motif-containing
similarity between the studied isolates and the reference region of XopDXcc8004 interacts with the DELLA domain
strain of X. a.pv. juglandis CFBP 7179;however, strain of RGA and interferes with the GA-induced binding of
I-391 from Portugal and strain LMG 746 from the United GID1, a GA receptor, to RGA. Furthermore, the EAR
Kingdom were different. MLSA analysis of partial motif was previously found to be present in a number of
sequences of the fyuA, gyrB and rpoD genes of isolates plant transcriptional regulators[3]. Thus, our data suggest
and pathotype strains of other pathovars ofX. that bacterial pathogens might have developed effectors,
arboricolashowed that the X. a.pv. juglandis population which probably mimic host components, to initiate
consists of different phylogenetic lineages. An disease tolerance and enhance their own survival.
incongruence among MLSA gene phylogenies and traces
of intergenic recombination events were observed. These Acknowledgement: This work is supported by the
data suggest that the sequence analysis of only one Ministry of Science and Technology of China (grant No.
housekeeping gene is not sufficient for proper X. 2012CB722206) and the Department of Science and
arboricolapathovar identification. Technology of Hainan Province (grant No.
ZDZX2013023).
S3-P6 The Xanthomonas campestris effector
protein XopDXcc8004 triggers plant disease References:
tolerance by targeting DELLA proteins [1]R. Medzhitov, D.S. Schneider, M.P. Soares (2012).
Science, 335, 936.
Leitao Tana,b,c, Wei Rongb, Hongli Luob, Yinhua Chena,b, [2]J.D. Jones, J.L. Dangl(2006). Nature, 444, 323.
Chaozu Hea,b* [3]S. Kagale, K. Rozwadowski (2011). Epigenetics, 6,
a
Hainan Key Laboratory of Sustainable Utilization of 141.
Tropical Bioresources, Hainan University, Haikou,
Hainan 570228, China S3-P7 In silico characterization and functional
b
State Key Laboratory of Plant Genomics, Institute of analysis of vgrGs in Acidovoraxavenaesubsp.
Microbiology, Chinese Academy of Sciences, Beijing avenae strain RS-1
100101, China Zhouqi Cui, Zhongyun Tao, Guohua Liang, Bin Li*
c
University of Chinese Academy of Sciences, Beijing State Key Laboratory of Rice Biology, Institute of
100039, China Biotechnology, Zhejiang University, 310058, Hangzhou,
czhe@hainu.edu.cn China
Plants are constantly exposed to a battery of potential libin0571@zju.edu.cn
pathogens, including viruses, fungi, bacteria, parasites Acidovoraxavenaesubsp. avenae (Aaa) strain RS-1,
and insects. Unlike animals, which move to escape which is a widely distributed seed-borne pathogen of rice
environmental challenges, plants are sessile organisms equipped with both a type VI secretion system (T6SS).
and tend to protect themselves from potential pathogens In this study,we evaluated the roles played by T6SS
through either resistance mechanisms, which prevent or effector proteins, valine glycine repeat G protein family
limit pathogen infection and growth, or tolerance, which members in Aaa strain RS-1 pathogenesis by
alleviates the host fitness costs from pathogens without determining the identitying and phylogenetic evolution
limiting infection[1]. During plant-pathogen interactions, of the 12 putative VgrGs and generating 2 deletion
plants have evolved specific mechanisms to mount mutants of the their genes. In addition to the 8 core
resistance towards most pathogens. These processes are VgrGs were in silicocharacterized by conserved domain,
referred to as pathogen-associated molecular pattern average G/C contents and second structure prediction,
(PAMP)-triggered immunity (PTI) and effector-triggered our data clearly demonstrated that VgrG also influenced
immunity (ETI). In turn, pathogens have evolved bacterial growth, biofilm formation, membrane structure
so-called type III effectors that are injected into the host integrity, and bacterial virulence as well as the
cell to suppress PTI and ETI[2]. However, very little is expression of 14 T6SS genes, 8 vgrG genes, hcp gene,
known about whether disease tolerance, which sustains upstream and downstream genes. Surprisingly,
host fitness with a given pathogen burden, is regulated kanamycin affects these functions in particular
by effectors. In this work, we examined the effects of the pathogenicity of the 2 vgrG mutants to rice. Overall, this
Xanthomonas type III secretion effector protein result will prove a new clue for understanding the role of
XopDXcc8004 on plant disease defenses by constructing T6SS in pathogenicity of Aaa strain RS-1.
knockout and complemented Xanthomonas strains and
performing inoculation studies in radish and Arabidopsis Acknowledgments:This project was supported by
plants. We found that XopDXcc8004 suppresses disease Zhejiang Provincial Natural Science Foundation of
symptoms without changing bacterial titers in infected China (R13C140001),National Natural Science
leaves. In Arabidopsis, XopDXcc8004 delays the hormone Foundation of China (31371904), the Fundamental
gibberellin acid (GA)-mediated degradation of RGA Research Funds for the Central Universities, the
82
ICPPB2014 Abstracts
Agricultural Ministry of China (nyhyzx 201303015; evade the ancient flagellin detection system in rice that
201003015; 201003066), and Key Subject Construction retains recognition capacity for other bacterial pathogens.
Program of Zhejiang for Modern Agricultural
Biotechnology and Crop Disease Control Acknowledgement:The work is supported by National
(2010DS700124-KF1101; -KF1203; - KF1309). Natural Science Foundation of China (30971893) and the
973 program 2011CB100700 to W. S.
S3-P8 Rice FLS2-mediated perception of
bacterial flagellins is evaded by Xanthomonas S3-P9 Biological control of bacterial canker of
oryzae pv. oryzae and oryzicola tomato with Streptomyces setonii Z-L-22
Sai Zhao, Weihong Zhang, Na Zhang, Lirong Zhang,
Shanzhi Wanga, Zhe Suna, Huiqin Wanga, Lijuan Liua, Fen Lua,
Wenxiang Yang*, Daqun Liu
Jun Yanga, b, Min Zhangc, Shiyong Zhangb, Zejian Guoa,
Andrew F. Bentd, Wenxian Suna*
College of Plant protection,, Agricultural University of
a
Department of Plant Pathology, Key Laboratory of Hebei, Biological Control Center of Plant Diseases and
Plant Pathology, Ministry of Agriculture, China Plant Pests of Hebei Province, National Engineering
Agricultural University, Beijing 100193, China; Research Center for Agriculture in Northern
b
Rice Research Institute, Shandong Academy of Mountainous Areas, Baoding Hebei, China. 071001.
Agricultural Science, Jinan, Shandong Province, China; wenxiangyang2003@163.com
c
College of Bioscience and Biotechnology, Hunan Bacterial canker of tomato (Lycopersicon esculentum
Agricultural University, Changsha, Hunan Province, Mill.), caused by Clavibacter michiganensis subsp.
China; michiganensis (Cmm), is one of the most severe diseases
d
Department of Plant Pathology, University of Wisconsin, on tomato crops. Since its discovery ina Michigan
Madison, Wisconsin 53706 greenhouse of America in 1909[1], bacterial canker of
08042@cau.edu.cn tomato occurred frequently and spread to all tomato
Bacterial flagellins are often recognized by the receptor growing regions of the world. Epidemic of the disease is
kinase FLAGELLIN SENSITIVE2 (FLS2) and thus increasing in recent years, thus being considered as a
activate MAMP-triggered immunity in dicot plants. quarantine pathogen in China[1-2]. Cmm could be
However, the perception of bacterial flagellins in disseminated through seeds,transplants, infested debris
monocot rice and biological consequences remain poorly and soil, thus being the primary inoculum source. No
understood. We demonstrated that ectopically expressed effective ways tocontrol the disease are available
OsFLS2 senses the commonly studied Pseudomonas currently both in China and abroad.
aeruginosa flagellin peptide flg22 and in vitro purified Our laboratory screened out one bacterial strain which
Acidovorax avenae (Aa) flagellin in an expression have strong antagonism effect on bacterial canker of
level-dependent manner in transgenic Arabidopsis plants. tomato from soil of growing tomatoes named as Z-L-22,
However, these transgenic plants can not recognize identified asStreptomyces setonii[3].The bio-control
purified flagellins or derivative flg22Xo peptides of bacterium showed a strong antagonism ability of
Xanthomonas oryzae pv. oryzae (Xoo) or X. o. pv. bacterial canker of tomato with inhibition zone over
oryzicola (Xoc), two important rice bacterial pathogens. 4.5cm, and show a excellent generational stability[4]. The
The flg22 peptide and purified Aa flagellin, but not preparation of Z-L-22 fermentation was used to prevent
Xoo/Xoc flagellins induced ROS burst, PR gene and control this bacterial strain of Bacterial canker of
expression and MAPK activation in rice cultured cells. tomato by soaking of seeds, root-irrigation and mixed
Pretreatment of rice leaves with Aa flagellin, but not with soil with Z-L-22ingreenhouse. The results shows that the
Xoo or Xoc flagellins, triggered strong resistance to the control effect of root-irrigation with fermented liquid
infection of Xoo strain PXO99A. Domain swaps between contenting Z-L-22 microbial is the best method.
Xoo and Aa flagellins revealed that rice specifically Five-fold of the fermented liquid was used in the field by
recognizes the flg22 region of Aa flagellin. Seedling root-irrigation for the early treatment in three times
growth inhibition assays using the purified site-mutated interval of 10 days. Disease control effect can reach up to
flagellin variants in the flg22 region indicates the Asn around 70%, and this method can cure the diseased plant
residue at position 39th and the Ala residue at position at the early stage, and is better than the control effect of
48th of Xoo flagellin specifically result in escaping contrast agent streptomycin sulfate. At the same time, for
recognition by OsFLS2, but not by FLS2. In addition, the modification of bio-control bacteria preparation type,
RbfC was demonstrated to be involved in the granules and tablets were developed, and those made
post-translational modification of flagellin in Xoc, while it is easy and convenient in using, storage and
altered modification of flagellin caused by rbfC deletion transportation. The resoults laid a foundation for the
in Xoc had little effect on its motility. Virulence of Xoo further application of this bacterial strain.
and Xoc to rice was not significantly altered when fliC
genes were deleted in these bacteria and rbfC was Acknowledgement:Results transformation project in
deleted from Xoc. The results suggest that Xoo and Xoc Hebei Province δ12820307Dε
83
ICPPB2014 Abstracts
References: been enforced and the restricted used of the two
[1]M.L. Gleason, R.D. Gitaitis, M.D. Ricker (1993). antibiotics (streptomycin, kasugamycin) allowed in New
Plant Disease, 77,1069-1076. Zealand, an elicitor and a number of copper products, the
[2]Laixin. Luo, Tingchang. Zhao, Jianqiang. Li , et al economic impact of the disease has been significantly
(2004). Scientia Agricultura Sinica, 37(8),1144-1150. reduced. The most promising research avenues for long
[3]Yan. Zhang, Weihong. Zhang, Songhong. Wang, et al term control of this pathogen will be introduced during
(2009). Acta Microbiologica Sinica ,49(7), 889- 895. the presentation.
[4]Weihong. Zhang, Wenxiang. Yang, Qinfang. Meng, et
al (2005). Acta Phytopatholog Ica Sinica, 35(5), Acknowledgement: Work in the first author’s laboratory
459-462. is supported by Zespri Group Limited, Kiwi Vine Health
Ltd and Plant & Food Research.
S3-P10 Aetiology, Epidemiology and Control
Methods of Bacterial Canker of Kiwifruit caused References:
by Pseudomonas syringae pv. actinidiae [1] J. L. Vanneste, J. Yu, D. A. Cornish, D. J. Tanner, R.
Windner, J. R. Chapman, R. K. Taylor, J. Mackay and S.
Joël Vannestea, J Yu a, D.A.Cornish a, D.E Pattemore a, F. Dowlut (2013). Plant Disease, 97, 708.
Spinelli b, L.Forientinib, A.Cuntyc [2] H. C. McCann, E. H. Rikkerink, F. Bertels, M. Fiers,
a
The New Zealand Institute for Plant & Food Research A. Lu, J. Rees-George, M. T. Andersen, A. P. Gleave, B.
Limited, Ruakura Research Centre, Private Bag 3123, Haubold, M. W. Wohlers, D. S. Guttman, P. W. Wang, C.
Hamilton 3240, New Zealand. Straub, J.L. Vanneste, P. B. Rainey and M. D. Templeton
b
Università di Bologna, Dipartimento di Scienze Agrarie, (2013). PLoS Pathogen, 9 e1003503.
viale Fanin 46, 40127, Bologna, Italy [3] J. L. Vanneste (2013). New Zealand Plant Protection,
c
INRA, UMR1345 Institut de Recherche en Horticulture 66, 170.
et Semences, Beaucouzé, F-49071 Beaucouzé, France
Joel.Vanneste@plantandfood.co.nz S3-P11 Genetic and pathogenetic diversity of
rice bacterial blight pathogen, Xanthomonas
Since 2009, Pseudomonas syringae pv. actinidiae (Psa), oryzaepv.oryzaepopulation in northeast China
the causal agent of bacterial canker of kiwifruit has
Jichun Wanga*, Jiahuan Zhangb, Wenping Liua, Xian Wua,
become a global and economically important pathogen.
Chunwei Wanga
Today most kiwifruit producing countries have been a
affected by this disease. Based on molecular, Insinuate of Plant Protection, Jilin Academy of
biochemical and pathogenic differences, at least four Agricultural Sciences, 130033,Changchun, China
b
different biovars of Psa have been distinguished [1]. The College of Agriculture, Jilin Agricultural University,
biovar responsible for the recent global outbreak is 130118,Changchun, China
biovar 3. Several strains of this biovar have been fully wangjichun@cjaas.com
sequenced; the set of effector genes they carry set them The bacterial leaf blight (BB) of rice, caused by
apart from strains of other biovars [2]. Biovars 1, 2, and Xanthomonas oryzae pv.oryzae˄Xoo˅, is one of the most
3 are able to move systematically in the plant causing severe diseases which damage rice production. The BB
vine death while biovar 4 causes only leaf spots [1]. has particle appeared in northeast China, and it could
Additional differences between biovar 4 and the other become a potential mainly disease. Pathogen population
biovars of Psa at the biochemical and molecular level analysis could provide a better understanding of the
suggest that biovar 4 should actually be a novel and genetic diversity; it could help to choose appropriate
different pathovar of Pseudomonas syringae. isolates for screening disease resistance materials, and
The ability of Psa to survive in the field as an epiphyte aid in the development strategies to breed for durable
on asymptomatic kiwifruit plants leads to multiple and resistance to BB. In this study, 23 strains of XOO were
prolonged periods of infection [3]. The pathogen enters isolated and marked with IS1113 primers, 5 genetic
the plant via wounds and natural openings, including families were divided at 0.83 genetic distances.
flowers, and can be transmitted by pollinating insects [3]. Interactions between the 23 XOO strains and 6
A comparison between the spread of the disease in Italy, near-isogenic rice lines (NSL) difficulties were carried
Asia and New Zealand illustrates how climatic out, and the results demonstrated that these strains were
conditions determine the speed with wich the disease belonging to 9 races. Inoculation between the 23 XOO
spreads [3]. This has been the basis of a prediction model strains and 40 rice cultivars were carried out, the results
which is being used by New Zealand kiwifruit growers. showed more of the rice cultivars against XOO strains
The survival of Psa outside its host plant (soil, compost, were susceptible; also, the characteristics of XOO strains
water, orchard structures, etc) has been determined but were complex in pathogenetic and genetic diversities.
its life cycle is not completely understood [ 3]. Acknowledgement: The research was supported by
Methods of control are still relatively limited. However, grants from Special Fund for Agro-scientific Research in
two years after a new cultivar of Actinidia chinensis has the Public Interest˄201303015˅, and National Natural
been introduced, some rigorous hygiene measures have Science Foundation of China (31371907).
84
ICPPB2014 Abstracts
S3-P12 Silicon induced resistance against Overall continuous silicone application consistently gave
Xanthomonascampestrispv. musacearumin a higher level of resistance in the cultivars tested,
bananas followed by instances where silicon treatment was
terminated at the point of inoculation. The resistance was
Kenneth Mburua,b*, R.O. Oduorb, A.J. Mgutub, L. Tripathia
a
comparatively lower when application commenced upon
International Institute of Tropical Agriculture, c/o ILRI, inoculation of the plantlets with the pathogen suggesting
P.O Box 30709, Nairobi, Kenya that silicon induced pathogen resistance is higher when
b
Department of Biochemistry and Biotechnology, silicon application commenced prior to inoculation
Kenyatta University, P.O, Box 43844, Nairobi, Kenya probably to allow for accumulation and also activation of
K.Mburu@cgiar.org plant defense pathways. These preliminary findings
Banana (Musa)is an important food crop especially in the suggest that exogenous application of silicone provides
tropical regions where it is mainly used as a source of resistance againstXcm in bananas. We are analyzing the
calories and consequently has the potential to molecular changes specifically looking at the defense
contributesignificantly tofood security in the developing genes that might also contribute to the silicon-induced
countries. BananaXanthomonaswilt disease (BXW), resistance to the pathogen.
caused by the Xanthomonas campestris pv. References:
Musacearum(Xcm), is one of the most destructive [1]L. Tripathi, M. Mwangi, S. Abele,V. Aritua, W.K.
disease afflicting banana production in east and central Tushemereirwe,R. Bandyopadhyay (2009). Plant Disease,
Africa [1]. The disease was first reported in Ethiopia and 93, 440.
outside of Ethiopia it has been reported in Uganda in [2]L. Tripathi, H. Mwaka, J.N Tripathi and W.K.
2001 and other east African countries such as Kenya, Tushemereirwe (2010).Mol. Plant Pathol. 11: 721–731.
Rwanda, Tanzania, Burundi, and DRCongo.The disease [3]B. Namukwaya, L. Tripathi, J.N. Tripathi,G.
causes premature ripening of the fruits, wilting of the Arinaitwe, S.B. Mukasa, W.K. Tushemereirwe(2012).
leaves, leading to complete yield loss of banana. There Transgenic Res., 12, 855.
are no resistant cultivars so far reported and neither have [4]J.N. Tripathi, J. Lorenzen, O. Bahar, P. Ronald, L.
there been reports of biocontrol or chemicals agent that Tripathi (2014). J Plant Biotechnol.doi:
are effective against the pathogen. However,development 10.1111/pbi.12170
of transgenic bananas resistant to BXW has been [5]K. Wydra, V. Rodrigue.(2007).Physiolog.Mol. Plant
reported [2,3,4]. Neverthelessthere is an increasing need to Pathol. 70: 120-126.
find alternative short term approaches to control of BXW [6]F. Fauteux, F. Chain, F. Belzile, J. Menzies, R.R.
asthe disease is rapidly spreading. Be´langer(2006). Proc. Nat. Acad. Sci. USA 103:
Siliconis the second most abundant element in the soil 17554–17559.
after oxygen and has been implicated in severalfunctions [7]J.F. Ma, N. Yamaji (2006). Trend. Plant Sci. 11:
including enhanced agronomic traits, resistance to 392–397.
disease and pathogens and structural support.Disease [8]D. Kunzheng , Gaoa , S. Luoa, R. Zenga, (2007).
resistance induced by silicon has been observed in many Physiol.Plantar. 134: 324–333.
plant species including tomatoes rice, cucumber and S3-P13 Bacillus sp. strain 37-1 suppresses
wheat [5,6,7,8]. The mechanism of action are not very clear black rot of crucifers via priming of induced
with some reports suggesting that silicon accumulation in defense responses
the respective plant tissues provides a physical barrier
that impeded pathogen penetration. However, recent Chiahua Lin, YuntingOu, Chaoying Chen*
studies also reported an activation of defense Department of Plant Pathology and Microbiology,
genes/pathways upon infection of silicon treated plants National Taiwan University, Taipei, Taiwan, R.O.C.*
thereby implying that silicon mediated resistance is cychen@ntu.edu.tw
enhanced through both mechanical and biochemical
defense reactions. Black rot, caused by Xanthomonascampestrispv.
campestris (Xcc), is one of the most destructive diseases
The objective of this study is to evaluate the potential use of crucifers worldwide. In this study, potential biocontrol
of silicon in response to Xcm infectionin strains of Bacillus spp. were screened on cabbage black
bananas.Various concentration of silicon ranging from rot by drench application and an assessment on the
0mg -1000mg per week were applied for a period of one external and internal symptoms. Among them, Bacillus
month before artificially inoculating the plants with the sp. strain 37-1 exhibited the best protection against Xcc.
Xcm culture and the silicon treated plantlets were A different dynamic population ofXcc and earlier callose
evaluated for disease symptoms there afterwards. deposition in the leaves of cabbage seedlings
Exogenous siliconapplication at different concentrations pre-drenched with strain 37-1 were observed while
was able to increase resistance by 40% to 73.33%. In compared with that in the control leaves; thus, a priming
addition the extent of siliconinduced pathogen resistance effect on plant defenses conducted by strain 37-1 was
across the cultivars tested varied from 55.5%- 73.88%. implicated. Furthermore, reduction of Xcc population,
85
ICPPB2014 Abstracts
primed callose deposition and earlier host cell death c-di-GMP synthesis is responsive to cGMP. This novel
phenomena were demonstrated in Arabidopsis cGMP effector thus represents a direct link between
pre-drenched with strain 37-1, verifying that a cGMP and c-di-GMP signaling pathways.
mechanism of inducing systemic resistance in different
plants could be driven by this biocontrol candidate. Acknowledgement: Supported by NSC grant, Taiwan.
S3-A1 Novel Function of cGMP in Bacterial References:

Pathogenicity [1]S.Q. An, K.H. Chin, M. Febrer, Y. McCarthy, J.G.
Yang, et al. Chou S-H., Ryan R. (2013). EMBO J, 32:
Shan Ho Choua*, KoHsin Chinb, J Maxwell Dowc, Robert P 2430-2438.
Ryand [2]M. Gomelsky, M.Y. Galperin (2013). EMBO J, 32:
a
Institute of Biochemistry, National ChungHsing 2421-2423.
University, Taichung, 40227, Taiwan. [3]U. Hofer (2013). Nature Review in Microbiology, 11:
b
Agricultural Biotechnology Center, Institute 596.
ofBiochemistry, National Chung Hsing University,
Taichung, Taiwan S3-A2 A highly-conserved single-stranded
c
Department of Microbiology, Biosciences, Institute, DNA-binding protein (SsbX) of Xanthomonas
University College Cork, Cork, Ireland targets an actin-depolymerizing factor for
d
Division of Molecular Microbiology, College of Life triggering plant defense
Sciences, University, of Dundee, Dundee, UK Yujing Sun,Wenxiu Ma, Lulu Cai, Liang Liu, LifangZou,
shchou@nchu.edu.tw Gongyou Chen*
a
Cyclic-nucleotides are secondary messengers playing School of Agriculture and Biology, Shanghai Jiao Tong
important roles in the cell signal transduction systems. University, 800 Dongchuan Road, Shanghai, 200240,
cAMP has been found to play important roles in every China
living kingdom, while cGMP is found to be present gyouchen@sjtu.edu.cn
mainly in eukaryotic cells, responsible for vision, muscle Previously we reported that a highly-conserved
contraction, sleep, memory etc. Until now, the single-stranded DNA-binding protein (SsbX) of
involvement of cGMP in bacterial signaling has been at Xanthomonasspecies, secreted by the type-III secretion
best controversial. But the universe of bacterial cyclic system (T3SS), acts as harpin-like proteins to elicit
nucleotide messengers has been rapidly expanded hypersensitive response (HR) in nonhost tobacco [1]. In
recently after the discovery of novel this study, wecloned ssbXoc gene from X. oryzaepv.
cyclic-di-nucleotides, such as c-di-GMP and c-di-AMP. oryzicola (Xoc) that causes bacterial leaf streak in rice,
c-di-GMPhas been shown to control a variety of bacterial into tobacco (cv.Xanthi) via Agrobacterium-mediated
cellular processes, includingmotility, pilus expression, transformation. HRs occurred earlier in ssbXoctransgenic
biofilm formation. This second messenger generally tobacco than the wild-type and the empty vector (EV)
controls the transition from motile to sessile growth plants when SsbXoc and Hpa1 (a harpin protein of Xoc)
mode. c-di-AMP has been linked to the bacterial growth were infiltrated. The micro-HR, and more callose
in low-potassium conditions, to the sensing of DNA deposition and reactive oxygen spcies (ROS)
integrity, and to the cell wall homeostasis in multiple accumulation were also observed in ssbXoctobacco. In
species etc.In 2011, unambiguous evidence has been addition, ssbXoctransgenic tobacco plants were more
presented to provide that the -proteobacterium R. resistant to Pseudomonas syringaepv.tomatoDC3000
centenum synthesizes cGMP and uses it for regulation of infection, comparing to the wild-type and EV plants.
a developmental process (cyst formation) via a Interestingly, the expression of HR-makered genes
cGMP-dependent transcription factor. Thus, first cAMP, (HIN1 and HSR203J) and pathogenesis-related protein
then c-di-GMP, later c-di-AMP and now cGMP, the genes (PR1a, PR1b andSGT1) were significantly higher
family of bacterial cyclic mono- and dinucleotide second in ssbXoctobacco than in the wild-type and EV plants. To
messengers has grown. Bacteria can find the use of them reveal how SsbXoc triggers plant immunity, we performed
all! There is little doubt that the number and diversity of a yeast two-hybrid system (Y2H) to investigate
biological processes regulated by cGMP will increase as SsbXoc-interacting proteins in both rice and tobacco. Thus,
this molecule continues to be discovered in new bacterial SsbXoc was used as a bait in a vector pGBKT-7 to screen
species. But how do they interconnect? tobacco and rice cDNA libraries constructed in a vector
Here I will address the roles of cyclic GMP signaling in pGADT-SfiI where the SfiI sites were added in
Xanthomonas campestris pv. campestris, the causal pGADT-7 vector. Intriguingly, an actin-depolymerizing
agent of black rot disease of cruciferous plants. I shall factor proteinwas preyed from both rice (Nipponbare)
discuss the structure and function of the first cGMP and tobacco (N. benthamiana), hereby designated
receptor complex. I will further show that the regulatory OsADF2 and NbADF2. These two proteins are highly
effects of cyclic GMP are exerted in part by a conserved with 78% identities in protein sequences, but
diguanylate cyclase (DGC) domain whose activity in OsADF2 is 0.3 kDa larger that NbADF2 in molecular
86
ICPPB2014 Abstracts
weight. Both proteins consist of a PIP2 domain, a F-actin N-terminal sequence AB. The HR molecular marker
motif and a phosphorylation site. Recently, it has been genes hsr203J and hsr515 were expressed in transgenic
reported that the ADF2 protein is involved in plant plants transformed with N21. Genes pal, PR-1a, Chia5
immunity[2]. Our BiFC assay results demonstrated that and ABH1, which are involved in resistance defense,
the interaction of SsbXoc with OsADF2 or NbADF2 were also expressed in transgenic tobacco plants. The
occurred in plant plasma membrane. Mutation in both results confirmed that the gene fragment N21, which was
SsbXoc and ADF2, investigated by Y2H, indicated that transferred into tobacco plants, performed its biological
the amino acids 46 to 50 of SsbXoc were not only functions. Given these results, we concluded that the
essential for recognitionby the PIP2 domain of OsADF2 expression of N21 in transgenic tobacco plants induces
and NbADF2, but for HR induction in tobacco. Besides expression of defense-related genes and micro-HR, and
these, the silienced and overexpressed plants for confers nonspecific resistance to pathogens. The CC
OsADF2 and NbADF2 are undertaking. region plays an important role in harpin resistance, and
will provide an insight for harpin and plant receptor
Reference: structural interaction.
[1]Y.R.Li, W.X.Ma, Y.Z.Che, L.F.Zou, M.Zakria, et al.
(2013).PLoS ONE 8(2). Acknowledgements: This work was supported by grants
[2] K.L. Farquharson, (2014). Plant Cell 26: 3. from National Natural Science Foundation of China (No.
31101395) and the Yangzhou University Scientific
S3-A3 Expression of the hpa1Xoo-N21 Research Foundation for Advanced Talents of China (No.
containing coiled-coil region in transgenic 0274983014811).
tobacco enhances pathogen resistance
S3-A4 The type III effector AvrXccB
Zhaolin Ji*, Jian Li, Xin Hao, Liufei Shi, Yunhui Tong
inXanthomonas campestris pv.
College of Horticulture and Plant Protection, Yangzhou campestrissuppresses plant innate immunity in
University, Yangzhou 225009, People’s Republic of Arabidopsis thaliana
China
zhlji@yzu.edu.cn LijuanLiu, Shuai Li, Yanping Wang, Wenxian Sun*
Department of Plant Pathology and the Ministry of
Harpins are a class of helper proteins secreted by the Agriculture Key Laboratory for Plant Pathology, China
type III secretion systems of many Gram-negative Agricultural University, Beijing, China,
phytopathogenic bacteria and a class of non-specific melody_alpha@163.com
elicitors that elicit a hypersensitive response (HR) in
nonhost tobacco. The Hpa1Xoo (harpin) N-terminal Xanthomonascampestrispv. campestris (Xcc) is a
coiled-coil (CC) of the rice blight bacterial pathogen Gram-negative bacterium that causes black rot, the most
Xanthomonas oryzae pv. oryzae (Xoo) can elicit HR in important disease of vegetable brassica crops worldwide.
tobacco leaves, and is an important functional and It is well known that the type III effector inventory plays
structural unit. The gene fragment N21 (63 bp), which an essential role in virulence and pathogenicity of the
encodes peptide N21 containing the Hpa1Xoo N-terminal pathogen. However, little is known about the function(s)
CC region of Xoo, was transformed into the binary of a certain effectorAvrXccB. Here, we studied the
vector pBI121. The resulting transgenic construct was virulence function of a putative type III effector
transferred into Agrobacterium tumefaciens EHA105 by AvrXccB in Xcc. Secretion assays demonstrated that
the freeze-thaw method. Transformation was conducted AvrXccB was secreted into the SMMXC minimal
by infection of tobacco leaf discs with recombinant A. medium in atype III secretion system-dependent manner
tumefaciens, and transgenic tobacco plants were obtained inXcc. The GFP-labelled AvrXccB was localized onto
by screening with kanamycin. Genomic integration and the plasma membrane in the transgenic Arabidopsis
expression of the transferred gene sequence N21 was plants probably through N-myristoylation, and the
determined by PCR, reverse transcriptase PCR, PCR conserved glycine residue(G2) at amino-terminus of the
products sequencing, and enzyme-linked immunoassay. protein was essential for its localization. We also
Soluble proteins extracted from plants transformed with developed the transgenic Arabidopsis thaliana plants
N21 could elicit HR on tobacco leaves, indicating that expressing AvrXccB, AvrXccB mutantvariants
the peptide expressed in transgenic tobacco plants is AvrXccBH182A and AvrXccBC239A (His to Ala at position
bioactive. The transgenic plants grew normally, without 182 or Cys to Ala at position 239)in the catalytic domain,
macroscopical HR. When stained with trypan blue, as well as AvrXccBG2A under control of the
leaves from plants transformed with N21 showed dexamethasone (DEX)-inducible promoter.
micro-HR, as the same with hpa1Xoo and its N-terminal Chemical-induced expression of AvrXccB suppressed
sequence AB. Disease bioassays showed that the tobacco callose deposition and the burst of reactive oxygen
plants transformed with N21 gene enhanced resistance to species (ROS) triggered by flg22 in Arabidopsis.
tobacco mosaic virus (TMV), Phytophthora capsici and AvrXccB can also promote in-planta bacterial growth of
Pectobacterium carotovora subsp. carotovora, similarly Peudomomassyringaepv. tomato DC3000 (PstDC3000)
as those transformed with the whole hpa1Xoo and its and Xanthomonascampestrispv. campestris B186
87
ICPPB2014 Abstracts
(XccB186) in the transgenic Arabidopsis plants. program 2011CB100700, the transgenic crop project
However, the mutant variants AvrXccBH182A, 2012ZX08009003, National Natural Science Foundation
AvrXccBC239A and AvrXccBG2A compromised to of China (31272007) to W. S.
suppress callose deposition, ROS production and
promote bacterial growth. These results indicated that the References:
type III effector AvrXccB of Xcc can suppress [1]J.D. Jones, J.L. Dangl(2006). Nature, 444, 323–329.
PAMP-triggered immunity in Arabidopsis thaliana, and [2]T. Boller, G. Felix(2009). Annu. Rev. Plant Biol, 60,
that the putative N-myristoylation motif and the 379–406.
conserved catalytic triad are essential for its virulence [3]G.Kunze, C.Zipfel, S.Robatzek, K.Niehaus, T.Boller,
function. G.Fexix(2004). The Plant Cell Online,16,3496-3507.
[4]S.Lacombe, A.Rougon-Cardoso, E.Sherwood,
S3-A5 Enhancement of innate immune system N.Peeters, D.Dahlbeck, H.P.van Esse, M.Smoker,
in monocot rice by transferring G.Rallapalli, B.P.H.J.Thomma, B.Staskawicz,
Brassicaceae-specific elongation factor EF-Tu J.D.G.Jones, C.Zipfel(2010). Nature
receptor biotechnology,28,365-369.
Fen Lua, Huiqin Wanga, Shanzhi Wanga , Jiyang Wanga, Jun S3-A6 A Ralstonia solanacearum effector
Yangb, Shiyong Zhangb,Wenxian Suna* inhibits plant hypersensitive response and ROS
a
Department of Plant Pathology and the Ministry of burst by binding to host catalase
Agriculture Key Laboratory for Plant Pathology, China
Yunhao Suna, Mengying Denga, Guangyi Daib, Bei Fua, Nan
Agricultural University, Beijing, China,
b Yaob and Yongjun Lua*
Rice Research Institute, Shandong Academy of a
Agricultural Sciences, Jinan, Shandong Province , China Molecular and Cellular Microbiology Laboratory,
08042@cau.edu.cn School of LifeSciences, Sun Yat-sen University,
Guangzhou, 510275,China
b
Pattern-recognition receptors (PRRs) on the cell surfaces Plant Cell Structure and Function Laboratory, School
in plants surveil microbes through perception of of LifeSciences, Sun Yat-sen University, Guangzhou,
conserved microbe-associated molecular patterns 510275,China
(MAMPs) [1,2]. Elongation factor Tu receptor (EFR), as a luyj@mail.sysu.edu.cn
pattern recognition receptor in cruciferous plants, senses
bacterial elongation factor Tu (EF-Tu) and subsequently Ralstonia solanacearum, one of the most destructive
activates plant immunity[3]. Arabidopsis EFR confers plant bacterial pathogens, delivers a large amount of
broad-spectrum bacterial resistance in the EFR effector proteins via type III secretion system for
transgenic dicot Nicotiana benthamiana and tomato pathogenesis. However, the biochemical functions of
plants[4]. However, it is still unknown whether EFR can most of these proteins are not understood.
also recognize bacterial EF-Tu and enhance bacterial Bioinformatics analysis predicted that the R.
disease resistance in monocot plants. In this study, we solanacearum GMI1000 has more than 74 type III
generated transgenic rice pants and cell suspensions with effectors, 28 of them have been confirmed to be secreted.
constitutive expression of AtEFR by placing AtEFR In this research, we successfully cloned and expressed 40
under the control of CAMV 35S promoter. Subsequent of the T3SS effector genes in budding yeast
reactive oxygen species assays showed that elf18 induces Sacharomyces cerevisiae, respectively, an alternative
oxidative burst in AtEFR transgenic rice suspension cells, model for pathogenic bacterial effector research due to
but not in the wild-type cell cultures. Second, elf18 the conserved metabolic pathway between yeast and
treatment induced expression of OsPR10, one marker other eukaryotic hosts. Fifteen of them can cause yeast
gene in defense signaling pathway, in growth defeat. Interestingly, several effectors inhibited
AtEFR-overexpressing transgenic rice dramatically. yeast cell growth strongly, indicating an interference in
Furthermore, pretreatment with elf18 resulted in yeast essential signal pathway.
enhanced resistance to virulent bacterial pathogen The effector proteinRsc2359, which inhibits yeast
Xanthomonas oryzae pv. oryzae PXO99A in the growth obviously, was chosen for further study. Rsc2359
transgenic rice plants. These transgenic plants also is 739aa in length and is predicted to contain several
exhibited a significantly enhanced resistance to eukaryotic-like domains, including protein binding,
Acidovorax avenae subsp. avenae, the casual agent of growth arrest and DNA damage-inducible protein
rice bacterial brown stripe. Taken together, the results (GADD45), molybdenum carrier protein and cell
indicated that EFR derived from cruciferous plants can cycle-related domains. The results of domain-truncating
perceive EF-Tu and confer bacterial disease resistance in and point mutation tests demonstrate that the D584 in
EFR transgenic monocot rice. The study suggested that protein binding domain, the C-terminal and N-terminal
PRR-mediated immunity can be manipulated across two are essential for Rsc2359 to inhibit yeast growth. The
different classes, dicots and monocots. leaf of tobacco infected byΔrsc2359 strain produces
Acknowledgement: The work was supported by the 973 remarkably more ROS and show more obvious HR
88
ICPPB2014 Abstracts
response compared to wild type strain, strongly assays. These results suggest that GspL, an inner
indicating the role of Rsc2359 in inhibiting the ROS membrane protein, is involved in multiple partnerships.
burst of host during infection. The result of subcellular The result represents the first approach to identify
localization experiment show that Rsc2359 is located in existence of heteromeric complex containing GspL-GspE
peroxisome in Arabidopsis thaliana col-0 cells. By yeast and GspL-GspM proteins in R. solanacearum.
two-hybrid method and pull-down experiment, we found Interestingly, we observed that GspG, a major component
that Rsc2359 interact with plant catalases ˈ the of the type II pseudopilus in Pseudomonas aeruginosa,
marker enzymes of peroxisome that is important for ROS interacted with GspE in yeast two-hybrid system. The
removing. Interestingly, the N-terminal and C-terminal interaction between GspG and GspE had only been
of Rsc2359 are not indispensable for Rsc2359 to interact inferred from genetic studies previously.
with catalases and locate to peroxisome, suggesting that
the location of Rsc2359 to peroxisome is probably S4-K1 Exploration of the virulence mechanism
mediated by catalase(s) or other unknown factor(s). The of Xanthomonas citri and its application in
biochemical function of Rsc2359 is being investigated. control of citrus canker
Nian Wanga*, Maxuel O Andradea, Yang Hub, Hongge Jiaa,
Acknowledgement: We thank Pro. Haihong Wang for
Junli Zhangc, Ting Lied, Bing Yangd, Frank F Whitec, Jeffrey B
providing the GMI1000 strain and the plasmid
Jonesb, Chuck S Farahe
pk18mobsacB for R. solanacearum gene knockout, and a
Dr.Yin Li for providing seeding of Arabidopsis thaliana Citrus Research and Education Center, Department of
Col-0. Microbiology and Cell Science, University of Florida,
Lake Alfred, FL, 33850 USA
b
References: Department of Plant Pathology, University of Florida,
[1]M. Salanoubat, S. Genin (2002). Nature, 415, Gainesville, FL 32611 USA
c
497-502. Department of Plant Pathology, Kansas State University,
[2]M. Poueymiro, S. Genin(2009). Current Opinion in Manhattan, KS 66506 USA
d
Microbiology, 12, 44–52. Department of Genetics, Development, and Cell Biology,
[3]T. Mukaihara, N. Tamura (2010). Molecular Iowa State University, Ames, IA 50011, USA
e
Plant-Microbe Interactions, 23, 251-262. Department
[4]M. Solé, C. Popa (2012). Molecular Plant-Microbe ofBiochemistry,InstituteofChemistry,UniversityofSãoPaulo,Sa
Interactions, 25, 941-953. õPaulo,SãoPaulo,Brazil
nianwang@ufl.edu
S3-A7 Direct Interactions of the GspL, GspM
and GspE Proteins of the Type II Secretory Citrus canker, caused by Xanthomonas citri subsp. citri
System in Ralstonia solanacearum (Xcc), is a devastating disease of most commercial citrus
varieties causing huge economic losses worldwide.
Zheng Zhang, Jingsheng Xu, Yang Zhang, Jin Xu, Liyuan He,
Currently, copper bactericides, which are the major
Jie Feng
management practice to control citrus canker, pose
State Key Laboratory for Biology of Plant Diseases and problems including Xcc acquiring copper resistance,
Insect Pests, Institute of Plant Protection, Chinese phytotoxicity when copper accumulates in the soil, and
Academy of Agricultural Sciences, Beijing, 100193, P. R. environmental pollution. We intend to develop novel
China approaches to control citrus canker by exploration of the
jingshengxu@126.com virulence mechanism of Xcc. Type III secretion system
Type II secretion (T2S) apparatus is utilized by a wide (T3SS) and type III effectors are required for the
variety of pathogenic bacteria to secrete toxins or pathogenicity of Xcc. PthA4, a transcription activator
hydrolytic enzymes across outer membrane. Deficiency like (TAL) effector in Xcc, delivered via the type III
in any of the apparatus protein components may lead to secretion system, is required for pustule formation. Here,
an accumulation of secretory proteins in periplasm and a we show that Xcc induces two host genes, CsLOB1 and
severe damage to the bacterial virulence. In Ralstonia CsSWEET1, in a TAL effector-dependent manner.
solanacearum GMI 1000 strain, 12 GSP proteins are CsLOB1 is a member of the Lateral Organ Boundaries
necessary for building the type II apparatus. We tried a (LOB) gene family of transcription factors. We show that
systematic two-hybrid analysis to identify interactions the pathogenicity gene pthA of Xcc activates the disease
between different GSP proteins. Firstly, all of 12 gsp susceptibility gene CsLOB1 of citrus by binding to its
genes were cloned by designing optimal PCR reaction EBE in the promoter region. We will discuss our recent
system to help the amplification of the GC-rich R. progress to control citrus canker by modifying the EBE
solanacearum DNA. Secondly, the bait and prey vectors of CsLOB1. Additionally, we will present our current
expressing 12 GSP proteins were constructed. The progress on regulation of T3SS genes and whether we
GspL-GspE and GspL-GspM complex were can interfere with their induction. Specifically, we will
demonstrated by two methods: (i) interactions in the present our results on RsmA, a post-transcriptional
yeast two-hybrid system; (ii) in vitro pull- down binding regulator. Our results indicate that RsmA activates T3SS
89
ICPPB2014 Abstracts
genes by stabilizing the 5’ UTR of hrpG, which encodes References:
the T3SS master regulator in Xcc. [1]J.R. Lamichhane, et al. (2014). Advances in
Agronomy, 126: 231-291.
S4-K2 From the ecology of Pseudomonas
syringae to probable scenarios of future disease [2]O. Berge, et al. A user’s guide to a data base of the
emergence diversity of Pseudomonassyringae and its application
to classifying strains in this phylogenetic complex.
Cindy E. Morrisa*, Claudia Bartolia,b, Jay Ram Lamichhanea,b, (under review)
Caroline L Monteila, Odile Bergea [3]C.L. Monteil, et al. (2013). New Phytologist,
a
INRA, Avignon Research Center, Plant Pathology 199 :800-811.
Research Unit, Montfavet, France
b [4]C. Bartoli, et al. A framework to gage the epidemic
Dept. of Science and Technology for Agriculture,
potential of plant pathogens in environmental reservoirs:
Forestry, Nature and Energy, Tuscia University, Viterbo,
the example of kiwifruit canker (under review)
Italy
cindy.morris@avignon.inra.fr [5]C.E. Morris, et al. (2013). Annu. Rev. Phytopath.
51:85-104.
Since the beginning of this century, for woody crops
alone there have been over 50 reports of new diseases or S4-K3 The essential nature of type and
new outbreaks of diseases caused by Pseudomonas pathotype strains of plant pathogenic bacteria
syringae. These have occurred in at least 25 countries Carolee T. Bull*
and have concerned over 20 different plant species [1]. United States Department of Agriculture, Agricultural
This and other series of outbreaks beg the question of the Research Service, Crop Improvement and Protection
origin of new plant diseases, and in particular when Unit, 1636 E. Alisal St, Salinas, CA 93905, USA
previously unknown variants of a pathogen are involved Carolee.Bull@ARS.USDA.GOV
such as in the case of canker of kiwifruit and bleeding
canker of European horse chestnut. Increasing efforts Typification is a fundamental concept in taxonomyand is
are being dedicated to understanding the specific essential toall biological disciplines.A type specimen is
mechanisms underlying the history of such emergences. one with which a name of a particular taxon is associated.
A next important step in apprehending disease Typification of bacteria is prescribed in the
emergence is to attempt to anticipate the probable nature Bacteriological Code [1] (the Code) and the Standards for
of future epidemics. Naming Plant Pathogenic Bacteria [2] (the Standards).
Forphytobacteriology the type of a family is a genus, the
The metapopulation of P. syringae constitutes a myriad type of a genus is a species, the type of a species is a
of genetic lineages, many of which have been found in strain and the pathotype of a pathovar is a strain.Because
‘natural’ environments and most of which have never classification, nomenclature, and identification are
been reported to be in association with plants – diseased interdependent and interrelated, imperatives of one
or otherwise [2]. Yet many of these lines of P. syringae branch of taxonomy are relevant to the others. Thus,
are clearly armed to be pathogens based on their genomic although typification is required by the Code and the
profiles of effectors and their aptitude to incite symptoms Standards, typification is also essential in classification
under conditions of artificial inoculation [3, 4]. and identification of previously described and named
Furthermore, the genomes of the various genetic lines in pathogens. Types and pathotypesprovide the fundamental
the P. syringae metapopulation represent a surprising framework and “fixed points for comparison” in
variety of combinations of Type 3 Secretion System classification and identification as well as
configurations and of relative abundances of genes for nomenclature.Although type and pathotype strains are
effectors and non-effector virulence factors (toxins, etc.), essential to the understanding the taxonomy and diversity
illustrating that there are multiple profiles of traits that of plant pathogenic bacteria, a few problems have arisen
confer evolutionary success of this bacterium [2]. This due to the lack of understanding of the essential nature of
raises questions about the essential traits that are these strains and poor understanding of the relationship
requisite for a strain to be pathogenic and how these between the Code and the Standards by researchers,
traits are maintained by the bacterium across its varied reviewers and editors[3,4].Pathotype strains with identical
habitats. By analyzing the vast repertory of information specific and pathovar epithets also serve as the type
we have garnered on the ecology of P. syringae[5] – as a strains for the species. For example, the pathotype of
saprophyte, a commensal and a pathogen - and Pseudomonas syringaepv. syringae van Hall 1902 strain
knowledge of traits seemingly involved in pathogenicity NCPPB 281is also the type strain of P. syringae. This is
across a broad spectrum of diversity of this species not universally true due to misunderstandings about the
complex, we are building a framework to construct relationship between the Code and the Standards. For
probable scenarios of future disease emergence and to example, Xanthomonascampestrispv.hederaewas
develop the diagnostic targets to anticipate such elevated to X. hortorum with the type strain of this
outbreaks and mitigate their negative impacts. species serving as the pathotype of X. hortorumpv.
herderae[4,5].In other examples pathotype swere
90
ICPPB2014 Abstracts
transferred to new species but no formal proposal of the bacterial diseases require to deep investigate pathways
pathovarwas made for that species. In relatively few but and circuits of dissemination, as well as evolutionary
important instances suitable type and pathotypesare not mechanisms involved in bacterial adaptation to a new
available either because the strains upon examination do host species or to a new resistant host. Whereas research
not match the original description or because has mostly focused on molecular plant-bacteria
pathogenicity has been lost. For several species, it is not interactions, there is a huge need to fill the gap regarding
known if the type strain is pathogenic.In addition to the bacterial ecology, pathogen evolutionary potential, and
relatively few technical problems,underutilization of type population dynamics allowing adaptation to host. To this
and pathotype strains continues to result in lost aspect, Ralstonia solanacearum, causing bacterial wilts
knowledge and opportunities. However, DNA sequences on a huge range of species (more than 54 botanical
of genes useful for classification, population biology, families) over the tropical and subtropical belt, is a
evolutionary biology, community ecology and fascinating model. This species complex (RSSC) is
identification are available for many type and pathotype composed of four phylotypes of different geographical
strains of plant pathogenic bacteria[6,7]. Consequently, origins (phylotype I from Asia, phylotype II from
these strains can easily be integrated into studies America, phylotype III from Africa, phylotype IV from
evaluating relationships among organisms as the cost of Indonesia), within which have regularly appeared
including types and pathotypes in research is now emerging lineages of virulence variants.
negligible. Misidentifications and ambiguities in Notably,breeding for Solanaceae resistance to R.
relationships among organisms will be avoided in the solanacearum has been hindered for decades by the
future with the greater inclusion of type and pathotype scarcity of high level resistance sources, strong genotype
strains. x environment interactions, and the huge genomic and
phenotypic plasticity of the pathogen. Recently, the
Acknowledgements:Conversations with members of the R.solanacearum x Solanaceae interactions were
International Society of Plant Pathology Committee on formalized into six virulence types, named pathoprofiles.
the Taxonomy of Plant Pathogenic Bacteria, for which
the author is the convener, contributed to these ideas. The evolutionary dynamics within the R.solanacearum
species complex (RSSC) was investigated using
References: multi-locus sequence analysis (MLSA) on a worldwide
[1]Lapage, et al. (1992).American Society for collection. Recombination was found ubiquitous within
Microbiology, Washington, D.C. the RSSC, but with contrasting recombination rates and
[2]Young,etal demographic histories across phylotypes. Phylotype I
(2001).http://www.isppweb.org/about_tppb_naming.asp. (and, to a lesser extent, phylotype III) is highly
[3]Young et al. (2001).Phytopathology, 91:617. recombinogenic, and carries molecular signatures of a
[4]Bull et al. (2008). Journal of Plant Pathology, 90:403. recent and rapid demographic expansion. Taken together,
[5]Vauterin et al. these findings strongly suggest that phylotypes display
[6]Almieda et al. (2010). Phytopathology, 100:208. contrasting evolutionary potentials: highest within
[7]Bull et al. (2011). Phytopathology, 101:847. phylotype I, lowest within IIB. Given its worldwide
S4-O1 Molecular epidemiology and virulence prevalence, high virulence variability, and evolutionary
typing of Ralstonia solanacearum raise new potential, phylotype I thus may constitute the priority
prospects for sustainable control of Solanaceae group to control.
bacterial wilt The ecological dynamics of phylotype I was thus further
b,c a
Aya Carine N’Guessan , Flora Pensec ,Christophe Lemaire , d investigated using fast-evolving minisatellite (VNTR)
Pierre Lefeuvrea, Emmanuel Wickera markers, developed thank to genomic resources available
a
CIRAD, UMR ”Peuplements Végétaux et bioagresseurs at GENOSCOPE. Using the 26 VNTR loci identified,
en Milieu Tropical” CIRAD –Université de la Réunion, four phylotype-specific MLVA schemes were designed.
Pole de Protection des Plantes, F-97410 Saint Pierre, The phylotype I-specific 13 loci-MLVA scheme
Réunion Island, France identified 11 clonal complexes (CC) within the global
b
Université Péléforo Gon Coulibaly de Khorogo, Côte collection, among which seven were specific to Africa
d’Ivoire and five to Cote d’Ivoire. The CC06, prevalent in
cUniversité Félix Houphouët-Boigny, Cocody campus, South-Africa, Kenya and Cote d’Ivoire, gathered highly
Abidjan, Côte d’Ivoire virulent and aggressive strains, bypassing the main
d
Université d’Angers, UMR077 PaVé, France tomato and eggplant resistance sources, and whose
wicker@cirad.fr putative avirulence type III effector repertoire was
specific. The promising prospects offered by MLVA
Intensification of inter-continental trade exchanges have typing for source tracing and monitoring population
favored the migration of plant pathogens over global evolution to host resistance will be discussed.
scales on quiet short time frames. Implementation of
efficient and durable strategies for management of plant Acknowledgement: R.solanacearum genomic resources
were made available thank to Dr. Philippe Prior, leader
91
ICPPB2014 Abstracts
of the RalstoniaScope project (platform MicroScope). rhizobacteria, specifically two strains of Pseudomonas
putida and a strain of Bacillus megaterium, did not
S4-O2 Rhizobacteria isolated from bean negatively affect A. thaliana seed germination and, when
produce volatiles that inhibit plant pathogens applied after seed germination, in in vitro conditions,
and support plant health promoted plant growth. The strain of B. megaterium was
Giorgio Aa, Lo Cantore Pa, De Stradis Ab, Lamorte Da, Bakker most effective in promoting plant growth resulting in up
PAHMc, Nicola Sante Iacobellisa* to 800% fresh weight increase.
a
Scuola di Scienze Agrarie, Forestali, Alimentari ed Finally, volatiles produced by strains of P. putida and the
Ambientali, Università degli Studi della Basilicata, Viale strain of B. megaterium were demonstrated to elicit ISR
dell’Ateneo Lucano 10, 85100 Potenza, Italy in A. thaliana against X. campestris pv. amoriaceae and,
b
Istituto di Virologia Vegetale CNR, UOS Bari, Via by using some A. thaliana lines deficient in either
Amendola 165/A, 70126 Bari, Italy salicylic acid, jasmonic acid, or ethylene
c
Plant-Microbe Interactions, Institute of Environmental responsiveness, the signaling pathways involved were
Biology, Utrecht University, Padualaan 8, 3584 CH elucidated.
Utrecht, The Netherlands
nicola.iacobellis@unibas.it S4-O3 Comparative genomics approaches for
detection and identification of
Part of the communication of beneficial rhizobacteria Ralstoniasolanacearum race 3 bv 2
towards their surrounding environment occurs through
the production of volatile compounds. In this study Xiang (Sean) Lia*, Kat (Xiaoli) Yuana, JingbaiNiea, ZakyAdamb,
effects of volatiles produced by six bacterial strains, James Tambongb, Wen Chenb, Christopher T.Lewisb, Solke H.
belonging to the genera Pseudomonas and Bacillus, on in De Boera and C. André Lévesqueb
a
vitro growth of plant pathogens and on plant Canadian Food Inspection Agency, Charlottetown
performance were evaluated. The bacterial strains were Laboratory, 93 Mt Edward Rd, Charlottetown, PE
isolated from the rhizosphere of common bean and can C1A5T1, Canada;
b
protect bean plants against Xanthomonas campestris pv. Agriculture and Agri-Food Canada (AAFC), 960 Carling
phaseoli var. fuscans, most likely through induced Ave, Ottawa, K1A 0C6, Canada
systemic resistance (ISR). sean.li@inspection.gc.ca
Effects of bacterial volatiles on the in vitro growth of a For more than a century,Ralstoniasolanacearum(Smith,
range of (mostly soil borne) plant pathogenic fungi, were Yabuuchi et al,1896) [1]species complex has been one of
investigated in two compartment Petri dishes. A strain the most economically important phytopathogenic
of Sclerotinia sclerotiorum selected for further studies bacteria due to its lethality, complex host profile,
was especially sensitive to the bacterial volatiles, that worldwide distribution and persistent survival in soil and
completely or partially inhibited mycelial growth. waterways. This bacterium causes vascular wilt in more
Microscopic analysis of S. sclerotiorum mycelium than 200 plant species belonging to over 54 families in
exposed to the volatiles, using light microscopy, SEM tropical and subtropical regions [2, 3]. R. solanacearum
and TEM, revealed damage to either hyphal membranes race 3 biovar 2 (R3Bv2) strains, which cause brown rot
or to cell organelles. The bacterial volatiles also inhibited and bacterial wilt of potato, Southern wilt of geranium,
germination of sclerotia. and bacterial wilt of tomato and other solanaceous crops,
were classified as phylotype II sequevars 1 and 2 on the
Volatile compounds produced by the bacteria were basis of phylogeny of endoglucanase gene sequences.
indentified by GC-MS. Subsequently effects of some Different from other strains of the R. solanacearum
commercially available pure compounds were studied. species complex, R3Bv2 strains have adapted to a
Growth of S. sclerotiorum mycelium was inhibited by temperate climate, and have caused significant losses to
most of the pure compounds, but at different Minimal the potato industry throughout Europe during the last
Inhibitory Concentrations (MICs). The bioactive decade. Latently infected geranium cuttings from Kenya
volatiles, applied at their MIC, caused the alteration of and Central America were believed to be the cause of
hyphae structures, as determined by light microscopy substantial damage in greenhouse-grown crops in
and TEM observations demonstrating their contribution Belgium, Germany, the Netherlands, and the United
to fungal growth inhibition and the cell target involved. States [4, 5]. So far, the commercial movement of infected,
Effects of bacterial volatiles on germination of Broccoli generally asymptomatic, planting material represents the
and Arabidopsis thaliana seeds and on growth of A. most significant route by which the pathogen has spread
thaliana seedlings were studied. On Broccoli all the on a global scale. Eradication becomes difficult or
bacteria caused inhibition of seed germination, whereas impossible once the bacterium is established in local soil
germination of A. thaliana seed was inhibited only and irrigation systems. Strict quarantine regulations are
byPseudomonas brassicacearum subsp. brassicacearum applied in many countries for R. solanacerum R3Bv2. As
strains, most likely due to hydrogen cyanide production a result, R. solanacearum R3Bv2 is considered to be a
by these strains. Volatiles produced by the other quarantine pathogen in Europe and Canada, and is listed
92
ICPPB2014 Abstracts
as a select agent in the US Agroterrorism Protection Act [3]G.Cellier,P.Prior,(2010).Phytopathol., 100, 1250-1261
of 2002. [4]J.L. Swanson, J. Yao, J. Tans-Kersten, C. Allen.
(2005). Phytopathol., 95, 136-143
In this study, draft genome sequence of R. solanacearum [5]T.P. Denny,(2006). Plant pathogenic Ralstonia species.
R3Bv2 NCPPB909 was decoded using paired-end Pages 573-644 in Plant-Associated Bacteria. S.S.
IlluminaHiSeq sequencing technology with TrueSeq V3 [6]Gnanamanickam (Ed.). Springer, University of
chemistry (National Research Council Canada, Madras, Netherlands.
Saskatoon, Saskatchewan, Canada). A total of [7]J.T. Simpson, K. Wong, S.D. Jackmanet al. (2009).
27,309,024 reads, totaling 2,758,211,424 bp, were Genome Research, 19, 1117.
obtained from 300 bp inserts to provide approximately [8]M. Boetzer, C.V. Henkel, H.J. Jansen, et al. [2011].
475X genome coverage. After quality checking and Bioinformatics, 27, 578.
initial de novo assembly using ABYSS [7], the final draft [9]Boetzer M, Pirovano W. 2012. Toward almost closed
genome size is 4,563,671 bp consisting of 1,558 contiqs. genomes with GapFiller. Gen. Biol., 13, R56.
The G+C content of draft genome is 65.5%. Annotation [10]Aziz RK, Bartels D, Best AA, et al. (2008). BMC
was conducted on the RAST server using the Glimmer 3 Genomics, 9, 75.
option[10]and predicted 4,071 protein-coding genes,
including 75 noncoding RNA genes and 158 possibly S4-O4 Diagnostics through
missing genes. A number of predicted virulence related Ralstonia solanacearum genomics: grasping the
factors, phage-related loci, motility and chemotaxis broad diversity of a complex plant pathogen
genes were identified in the genome, which may
Gilles Celliera*, Florent Aillouda,b, Bruno Hostachya, Philippe
facilitate its specific pathogenicity in specific
Priorb,c, Isabelle RobèneSoustradeb
environment. a
Anses–Plant Health Laboratory (LSV), 7 chemin de
Comparative genomics analysis of R. solanacearum l'IRAT, Saint-Pierre, La Réunion, 97410, France
b
R3Bv2 NCPPB909 (Phylotype II), GMI1000 (Phylotype Cirad UMR PVBMT, 7 chemin de l'IRAT, Saint-Pierre,
I), CMR15 (Phylotype III), PS107 (Phylotype IV), was La Réunion, 97410, France ; 3 Inra SPE, Département
executed using MAUVE (v2.3.1). Detailed comparisons Santé des Plantes et Environnement, France
with UW551 (Phylotype IIA), CFBP2957 (Phylotype gilles.cellier@anses.fr
IIA), Molk2 (Phylotype IIB-3), and Po82 (Phylotype
IIB-4) for hypervariable regions are included in Table 1. The ancient soil borne plant vascular pathogen
Twenty four different loci were classified as INDEL rich Ralstonia solanacearum evolved and adapted to cause
andhypervariable regions bearing pathogenicity related severe damage on an unusually wide range of plants,
factors, among which, eleven loci have unique sequences while being characterized as a species complex.Hence,
for developing primers/probesfor specific real-time diagnostic methods should consider such complexity and
PCRassays. Further evaluation of selected being developed as a “multi-organism approach” in order
primers/probes indicated that 5 pairs of primers/probes to produce a robust, user friendly, and timesaving
demonstrated high specificity against all R. protocol.Based on 27sequenced genomes of
solanacearum R3Bv2 strain tested, and one pair of Ralstonia solanacearum, diagnostic microarrays were
primers/probe can differentiate all pathogenic R3Bv2 designed to identify 17 phylogenetic clusters of
strains tested from a single non-pathogenic R3Bv2 strain. diagnostic interest, including species, phylotype or
These primers/probes are suitable for further evaluation as sequevar-specific probes along with control probes.
highly specific assays for detection and identification of Highlight was given on three ecotypes in the phylotype II:
pathogenic R. solanacearum R3Bv2 strains. Further (i) Brown rot strains from sequevars IIB-1; (ii) Moko
analysis of these strains and available genome sequence disease-causing strains from sequevars IIB-3, IIB-4,
data with their associated hosts and geographic origins IIA-6 and IIA-24, that cause wilt on banana, plantain,
will provide detailed insight on virulence, functionality, and Heliconia; and (iii) new pathogenic variants from
and plant/pest interactions of this widely distributed sequevar IIB-4NPB that lacks pathogenicity to banana
regulatory pathogen. Cavendish but can infect many other plant species,
including Cucurbitacae.As a first step, a spotted array
Acknowledgement: This study was funded by Canadian glass slide format was chosen for its probe screening
Safety and Security Program (CRTI 09-462RD).We want capacity, where the 100 best 50mers probes out of more
to acknowledge Heidi Arsenault, Julie Chapados and than 1000 were selected on 80 strains for switching to a
Ekaterina Ponomareva for preparing samples for next more convenient microarray format, based on the “Array
generation sequencing and Andrew Sharpe at NRC Tube” technology from Alere Technologies, which
(Saskatoon) for providing Illumina sequencing. allows micro-reactions within a vial. Several advantages
to switch to this technology will be presented along with
Reference: first results.
[1]E. Yabuuchi, Y. Kosaco, H. Oyaizu, et al., (1995).
Microbiol. Immunol., 39, 897.
[2]A.C. Hayward,(1991).Annu. Rev. Phytopathol., 29, 65
93
ICPPB2014 Abstracts
S4-O5 Protection of tomato seedlings from greenhouse experiment, it is assumed that mechanism/s
bacterial wilt (Ralstonia solanacearum) with other than antibiosis play important role in the disease
rhizosphere bacteria suppression.
Triwidodo Arwiyantoa*,Bambang Hendro Sunarmintob Acknowledgement: This research was supported by the
a
Department of Plant Protection,Faculty of Directorate General of Higher Education through
Agriculture,University of Gadjah Mada, Jl Flora Penelitian Kerjasama Luar Negeri dan Publikasi
Bulaksumur, Yogyaarta, Indonesia-55281 Internasional Scheme with contract number
b
Department of Soil Science, Faculty of 057/SP2H/PL/Dit.Litabmas/V/2013 tanggal 13 Mei
Agriculture,University of Gadjah Mada, Jl Flora 2013.
Bulaksumur, Yogyaarta, Indonesia-55281
tarwiyanto@yahoo.com References:
[1]Mansfield, J., Genin, S., Magori, S., Citovsky, V.,
Ralstonia solanacearum causing bacterial wilt disease of Sriariyanum, M., Ronald, P., Dow, M., Verdier, V. and
many plants is difficult to be controlled and is Beer, S.V., Machado, M.A., Toth, I., Salmond, G., and
categorized as the second of the most important of plant Foster, G.D (2012). Mol.Pl.Pathol. 13, 614
pathogenic bacteria [1]. Bacterial wilt disease of tomato
occured almost in any tomato-producing area in the S4-O6 A MLVA genotyping scheme for global
world. The most effective control measure is by the use surveillance of the citrus pathogen
of resistance variety. However, creating a resistance Xanthomonascitri pv. citri suggests a worldwide
variety take a long time while the disease always threaten geographical expansion of a single genetic
every year. Thus, an alternative control of the disease is lineage
desirable. Biological control based on antagonism Olivier Pruvosta*, M Magnea, K Boyera, A Leduca, CTourterel bc,
between rhizosphere bacteria and the pathogen was C Drevetc, V Ravignéd, L Lionel Gagnevina, F Guérina, F
conducted. Pseudomonas putida Pf-20 which is isolated Chiroleua, R Koebnik b, V Verdierb, C Vernièrea
from the rhizosphere of Mimosa invisa suppressed the a
UMR PVBMT, CIRAD-Université de la Réunion
development of bacterial wilt disease of tobacco, F-97410 Saint Pierre, La Réunion, France
eggplant, and chilli in a greenhouse and some degree in b
UMR RPB, IRD, 911 Avenue Agropolis BP 64501,
the field condition. Tomato seed which was treated with F-34394 Montpellier Cedex 5, France
P. putida Pf-20 exhibited lower bacterial wilt disease c
Institut de Génétique et Microbiologie, UMR 8621,
incidence compared with untreated seed when planted in Université de Paris-Sud-CNRS, Orsay F-91405, France
the soil invested with R. solanacearum. P. putida Pf-20 d
UMR BGPI, CIRAD, F-34398 Montpellier, France
was combined with avirulent strain of R. solanacearum olivier.pruvost@cirad.fr
for seedling treatment, bacterial wilt disease of tomato
and eggplant decreased. When the P. putida Pf-20 was MultiLocus Variable number of tandem repeat Analysis
added into the root system of tomato, there were (MLVA) has been extensively used to examine
population changes of some rhizopshere bacteria. To epidemiological and evolutionary issues on
enhance the degree of control we tried to screen some monomorphic human pathogenic bacteria, but not on
additional rhizosphere bacteria which have ability to bacterial plant pathogens of agricultural importance
suppress the development of tomato bacterial wilt albeit such tools would improve our understanding of
disease. The tomato seedlings were treated with P. their epidemiology, as well as of the history of epidemics
putida Pf-20 by drenching then rhizosphere bacteria on a global scale. Xanthomonas citri pv. citri is a
belong to the genus Bacillus and Streptomycetes were quarantine organism in several countries and a major
isolated. Tomato seedlings (30 days old) were dipped threat for the citrus industry worldwide. We screened
separately for 30 minutes into each of the water the genomes of Xanthomonas citri pv. citri strain
suspension of isolated Bacillus and Streptomycetes then IAPAR 306 and of phylogenetically related
planted into pot which contained soil invested with a xanthomonads for tandem repeats. From these in silico
highly virulent of R. solanacearum (race 1, biovar 3, data, an optimized MLVA scheme was developed to
phylotype 1). The disease development was observed assess the global diversity of this monomorphic
weekly for one month and antagonism in vitro of the bacterium. Thirty-one minisatellite loci (MLVA-31)
isolated bacteria against R. solanacearum was performed. were selected to assess the genetic structure of 129
Some rhizosphere bacteria showed protection effect strains representative of the worldwide pathological and
against bacterial wilt disease. The reductions of bacterial genetic diversity of X. citri pv. citri. Based on
wilt disease were 20% (5 isolates), 25% (3 isolates, Discriminant Analysis of Principal Components (DAPC),
including P. putida Pf-20), around 30% (one isolate), and four pathotype-specific clusters were defined. DAPC
40% (3 isolates). All isolated rhizosphere bacteria cluster 1 comprised strains that wereimplicated in the
demonstrated have no antibiosis activity against the major geographical expansion of X. citri pv. citri during
pathogen. While there was no positive correlation the 20th century. A subset of 12 loci (MLVA-12)
between antagonism in vitro and protection effect in the resolved 89% of the total diversity and matched the
94
ICPPB2014 Abstracts
a,b,c,d a,b,c d
genetic structure revealed by MLVA-31. MLVA-12 is Amandine Cunty *, Sophie Cesbron , Rivoal Carène ,
d a,b,c
proposed for routine epidemiological identification of Françoise Poliakoff , Marie Agnès Jacques , Joël
e d
X. citri pv. citri, whereas MLVA-31 is proposed for Vanneste , Charles Manceau
a
phylogenetic and population genetics studies. INRA, UMR1345 Institut de Recherche en Horticulture
MLVA-31 represents an opportunity for international et Semences, F-49071 Beaucouzé, France
b
X. citri pv. citrigenotyping and data sharing. The AGROCAMPUS OUEST, UMR1345 Institut de
MLVA-31 data generated in this study was deposited in Recherche en Horticulture et Semences, F-49045 Angers,
the Xanthomonas citri genotyping database France
c
(http://www.biopred.net/MLVA/). Université d’Angers, UMR1345 Institut de Recherche en
Horticulture et Semences, SFR 4207 QUASAV, F-49045
S4-O7 Insights to the pathogenicity and Angers, France
control of Pseudomonas syringaepv. aesculi, an d
Plant Health Laboratory, French Agency for Food,
epidemic tree pathogen environmental and occupational health and safety -
a a b
Sarah LJames , Federico Dorati , Dawn LArnold , Benjamin Anses, 7 rue Jean Dixméras, 49044 Angers, France
e
a a c
WNeuman , Ian MJones , Glynn Percival , Michael A The New Zealand Institute for Plant1Food Research
d
Brockhurst , Robert WJackson *
a Ltd., Bisley Road, NZ-3214 Hamilton, New Zealand
a
School of Biological Sciences, University of Reading, amandine.cunty@angers.inra.fr
Whiteknights, Reading, RG6 6AJ, UK First outbreaks of bacterial canker of kiwifruit caused by
b
Centre of Research in Biological Sciences, University of Pseudomonas syringae pv. actinidiae (Psa) was detected
the West of England, Bristol, BS16 1QY, UK in France in June 2010. Severe symptoms like leaf spots,
c
Bartletts Tree Experts, University of Reading, die-back, and canker that sometimes lead to the death of
Whiteknights, Reading, RG6 6AJ, UK the vine, have been observed in the main region of
d
Department of Biology, University of York, Wentworth kiwifruit production (south of France). Furthermore, in
Way, York, YO10 5DD, UK old orchards especially located in the northwest of
r.w.jackson@reading.ac.uk France, leaf spots have been observed with no canker or
Bleeding canker of European Horse Chestnut shoot die back. During surveys implemented over the last
(Aesculushippocastanum) has swept through continental four years 300 Psa strains were isolated from cankers and
north western Europe and into the British Isles in the last leaf spots as well. Identification and characterization of
decade. Symptoms of the disease include necrotic-like the bacterial strains were performed using phenotypic
lesions on the trunk and branches of trees, which ooze a tests, PCR-based tests [1, 2] and rep-PCR (BOX PCR)
brown-black exudates giving the appearance of bleeding. analysis. The virulence of the strains was assessed on
The causal agent is Pseudomonas syringaepv. aesculi Actinidia deliciosa and on Actinidia chinensis. A Multi
(Pae), which can infect xylem and phloem of the tree, Locus Sequenced Analysis (MLSA) based on four
and if the pathogen girdles the entire tree, it can kill it. housekeeping genes (gapA, gltA also called cts, gyrB and
We sought to improve our understanding of the virulence rpoD) was conducted on a panel of 72 strains isolated
of the pathogen and to investigate a potential control from different Actinidia species and geographical regions
mechanism. Aided by the genome sequence of Pae, we representative of the bacterial diversity collected within
were able to identify putative virulence genes and the French orchards since 2010. Two phylogenetic
through a series of pathogenicity tests, we have identified lineages were delineated: one corresponding to the
a number of genes that are important for virulence to biovar 3 and the other to the biovar 4 as described by
plants.Moreover, we have investigated the feasibility of Vanneste et al. [3]. The lineage corresponding to biovar 3
developing a phage therapy for the bleeding canker was steadily clonal whereas the lineage corresponding to
disease. We isolated a range of phage from the soil biovar 4 was polymorphic. A Multi Locus VNTR
around healthy and diseased Horse Chestnut trees. Analysis (MLVA) was conducted on the same set of
Electron microscopy, RAPD-PCR and sequence analysis strains in order to track the spread of the epidemics in
identified a Myovirus and a Podovirus. Using France. Five repeated elements loci were selected on the
experimental co-evolution of the Myovirus with Pae, we chromosomal DNA on the strain of Psa biovar 4
identified new phage genotypes capable of infecting Pae. ICMP18807. The VNTRs were PCR amplified with
Application of phage cocktails onto Horse Chestnut trees labeled primers allowing the determination of the
infected with Pae resulted in the reduction of Pae number of repeats at each locus. A minimum spanning
numbers and disease lesion size only when the evolved tree was constructed in accordance with the number of
phage was used. These data show the potential for phage tandem repeats of the 5 loci. The structure of the tree
therapy to be used in the control of tree disease. confirmed the genetic structure obtained with the MLSA.
The clonality of Psa biovar 3 supported the status of high
S4-O8 Characterization and phylogeny of virulent emergent pathogen but it was not possible to
Pseudomonas syringae pv. actinidiae strains identify the origin of the introduction of Psa biovar 3 in
isolated from kiwifruit in France France. The polymorphism within Psa biovar 4 was
increased in comparison with the MLSA and geographic
95
ICPPB2014 Abstracts
lineages (France, New Zealand and Australia) were different model projections. We show thata consensus
identified. modelwhich relies on agreement of model
projections,can indicate likelihood of establishment in
Acknowledgement: Anses (French Agency for Food, target regions andhighlight areas with higher risk of Psa
environmental and occupational health and safety) and establishment both globally and locally. These results can
region Pays de la Loire for financial support and the provide useful information for Psa management such as
French Collection of Plant-associated Bacteria highlighting the climatically susceptible areas in USA,
(CIRM-CFBP) for providing and maintaining bacterial Iran, Greece, Belgium, Denmark, Belgium and specially
strains. South Africa all regions with recent commercial planting
Refernces: of kiwifruit.
[1]J. Rees-George, J.L. Vanneste, D.A. Cornish, I.P.S. Acknowledgement: We would like to thank the
Pushparajah, J. Yu, M.D. Templeton, K.R. Everett, following Bio-Protection Research Centre personnel for
(2010). Plant Pathology, 59, 453. their contribution to this study: SenaitSenay, Tasha
[2]A. Gallelli, A. L’Aurora, S. Loreti, (2011). Journal of Shelby, Jennifer Pannell and Federico Tomasetto, as well
Plant Pathology, 93, 425. as David Logan from Plant & Food Research and
[3]J.L. Vanneste, J. Yu, D.A. Cornish, D.J. Windner, R. ZESPRI® International Limited for providing
Chapman, J.R. Taylor, J.F. Mackay, S. Dowlut, (2013). information regarding kiwifruit. This study was funded
Plant Disease, 97, 708. by B3, an unincorporated joint venture of four science
S4-O9 Consensus model to project agencies – Plant & Food Research, AgResearch, Scion
thepotentialglobal habitat suitability of kiwifruit and the Bio-Protection Research Centre at Lincoln
bacterial canker (Psa) University –and three end-user partners – the Ministry
for Primary Industries, the Department of Conservation
a a b
HA Narouei Khandan , SP Worner , EE Jones , SLH Villjanen and the New Zealand Forest Owners Association. We
c d d d
Rollinson , L Gallipoli , AMazzaglia , GM Balestra also would like to thank Australasian Plant Pathology
a
Bio-Protection Research Centre, Lincoln University, P Society (APPS) for their support to attend
O Box 85084,Christchurch, New Zealand 13thICPPB2014.
b
Faculties of Agriculture and Life Sciences, Lincoln
University, Christchurch, New Zealand References:
c
The New Zealand Institute for Plant & Food Research [1]S. P. Worner (1988). Journal of economic entomology
Limited, Private Bag 4704, Christchurch 8140, New 81: 973.
Zealand [2]S. P. Worner, Tak Ikeada (2008). MAF Biosecurity
d
Departments of Science and Technologies for New Zealand Technical Paper No: 2010/21.
Agriculture, Forestry, Nature and Energy (DAFNE), [3]H. A. Narouei Khandan, S. P. Worner, E. E. Jones, S.
University of Tuscia, Viterbo, Italy L. H. Villjanen-Rollinson, L. Gallipoli, et al. (2013). N Z
hakhandan@gmail.com Plant Prot 66: 184.
[4]J. Franklin, F. W. Davis, M. Ikegami, A. D. Syphard,
Following the incursion of a damaging plant pathogen in L. E. Flint, et al. (2013). Glob Chang Biol 19: 473.
a new area, the first step is to determine local priority [5]K. O. Maloney, D. E. Weller, D. E. Michaelson, P. J.
zones to control the spread of the pathogen. In such Ciccotto (2013). Environmental Modeling & Assessment
instances, studies that have already projected the habitat 18: 1.
suitability of target pests or pathogens can be very [6]J. Elith, J. R. Leathwick (2009). Annual Review of
beneficial [1,2]. In recent decades, species distribution Ecology, Evolution, and Systematics 40: 677.
models have been used in many ecological, [7]J. Elith, J. Simpson, M. Hirsch, M. Burgman (2013).
environmental and climate-change research studies to Australasian Plant Pathology 42: 43.
model invasive species establishment and spread [3,4,5]. [8]Q. Guo, M. Kelly, C. H. Graham (2005). Ecol Modell
These models associate recorded locations of species 182: 75.
with environmental variables[6]. Nevertheless, the few [9]G. M. Balestra, A. Mazzaglia, A. Quattrucci, M. Renzi,
studies that attempt to model the habitat suitability of A. Rossetti (2009). Australas Plant Dis Notes 4: 34.
plant pathogens before their arrival into the new areas, [10]G. Greer, C. Saunders (2012). Agribusiness and
mainly rely on a single model projection[7,8]. In this study, Economics Research Unit Report, Lincoln University,
we used eleven species distribution models (correlative New Zealand: 75
and mechanistic models) to project the habitat suitability
of kiwifruit bacterial canker (Psa) which has caused S4-O10 The multiplicity of an enterobacterial
significant global damage, especially in Italy and New pectinolytic phytopathogen in a specific
Zealand in recent years[9,10]. Since different models may commodity: a Pectobacterium carotovorum
result in different projections, and because each model species complexin seed potatoes.
may contain useful information, a consensus model (a a* a
Johan Van Vaerenbergh , Steve Baeyen , Cinzia Van
variant of committee average) was built to benefit from a b
Malderghem , Paul De Vos , Martine Maes
a
96
ICPPB2014 Abstracts
a
Plant Sciences Unit - Crop Protection , Institute for Acknowledgement:The work presented is funded by the
Agricultural and Fisheries Research (ILVO), Burg. Van Government of Flanders, Fonds voor Landbouw en
Gansberghelaan 96, Merelbeke, Belgium. Visserij.
b
Laboratory of Microbiology, University of Ghent, K.L.
Ledeganckstraat 35, Ghent, Belgium References:
johan.vanvaerenbergh@ilvo.vlaanderen.be [1]M. Slawiak et al. (2009). European Journal of Plant
Pathology 124:245-261.
The cultivation of seed potatoes is a small but valuable [2]J. van der Wolf et al. (2014). International Journal of
niche in the potato sector in Belgium. Although Systematic and Evolutionary Microbiology 64: 768-774.
multiplication from minitubers is mainstream for the [3]E. de Haan et al. (2008). European Journal of Plant
production of pre-basic seed, a significant volume of Pathology 122: 561-569.
high grade basic seed is habitually imported every year [4]B. Ma et al. (2007). Phytopathology 97: 1150-1163.
from several EU countries to be multiplied for several [5]Parkinson et al. (2009). International Journal of
field generations. This remarkable variety of origins Systematic and Evolutionary Microbiology 59:
elicits the introduction of a diversity of pectinolytic 2388-2393
enterobacteria which may be associated with the seed [6]M.-N. Yap et al. (2004). Applied and Environmental
tubers. After the emergence of a highly virulent Dickeya Microbiology 70: 3013-3023.
variant, i.e. D. solani, in the first decade of the century [1, [7]M. Waleron et al. (2008). European Journal of Plant
2]
, more aggressive Pectobacterium variants are now Pathology, 121: 161-172.
increasingly being diagnosed in seed potatoes [3]. The
disorders are commonly displayed as blackleg, stem rot S4-O11 Identification and characterization of
and tuber maceration. Xylella fastidiosa isolated from coffee plants in
France
Pectobacterium isolates obtained from seed potato a a a*
Bruno Legendre , Stelly Mississipi , Valérie Olivier ,
cultivations in the past few years were analyzed in b b c
Emmanuelle Morel , Dominique Crouzillat , Karine Durand ,
taxon-specific PCR, displaying P. atrosepticum as major c c a
Perrine Portier , MarieAgnès Jacques , Françoise Poliakoff
blackleg pathogen and confirming the common presence a
of P. wasabiae. However, a substantial number of Plant Health Laboratory,French Agency for Food,
isolates were assigned to Pectobacterium carotovorum environmental and occupational health and safety -
(Pc) and the majority of these isolates were identified as Anses, 7 rue Jean Dixméras, 49044 Angers, France.
b
P.carotovorum ssp. brasiliensis (Pcb). Their identity was Nestlé, Research and Developpment center, 101 Av.
investigated more extensively. Gustave Eiffel Notre Dame d’Oé, B.P. 49716, 37097
Tours, France.
c
First, a phylogenetic backbone was constructed based on INRA, UMR1345, IRHS, 42 rue Georges Morel BP
MLSA of ten core genes [4, 5, 6, 7] for a set of thirty-two 60057, 49071 Beaucouzé, France.
Pectobacterium reference strains obtained from certified valerie.olivier@anses.fr
culture collections, and nine Pectobacterium strains for
which genomic sequence data are available (NCBI). The Xylellafastidiosa(Xf)is a xylem-limited bacteriumpresent
Pcb cultures clustered in a clade separate from the other in the Americas, but that recently emerged in Taiwan and
Pc cultures in the analysis of concatenated sequences in Italy. More than 200 plant species has been reported as
when the threshold of similarity was set at 96%. Second, susceptible hosts for Xylella in the Americas. Some of
phylogenies were developed with sequences of the these plants have a major economical impact as fruit
periplasmic pectate lyase gene (pelY) and the dspE crops (Vitisvinifera, Prunus persica, Citrus sinensis,
effector gene. The derived clades were congruent and Olea europaea, Coffea spp., etc.), ornementals (Nerium
corresponded with the MLSA classification. Remarkably, oleander, Platanus occidentalis, etc.) and forest trees
the Pectobacterium carotovorum isolates associated with (Quercus spp., Ulmus spp., etc.). X. fastidiosa is a
potato displayed considerable pelY sequence diversity at quarantine bacterium for the European Union (EU) and
the nucleotide level. Although the isolates identified as as such is listed on the directive 2000/29/EC. A risk of
Pcb clustered with the Pcb reference strains, they were introduction is still pending due to the high number of
distant from the Pcb type strain isolated in Brazil. plant hosts which are imported from contaminated areas
Sequences of the virulence genes were also used to and to the presence of contaminated asymptomatic plants.
design a TaqMan real-time PCR assay for Pcb. The In 2012 in France, the Plant Health Laboratory
genetic distance of the Pcb isolates and the Pcb type (Anses-LSV) detected four Xf-infected coffee plants
strain was also reflected in biological features, i.e. (Coffea arabica and C. canephora) growing in a
antibiosis properties. The virulence of Pcb isolates was confined facilities. This outbreak was eradicated (EPPO
determined in infectivity titrations in chicory leaves and RS N° 8 2012/165).
in potato tubers. Several vegetables and ornamentals The objective of the present study was to isolate the
were also inoculated to assess more generally the pathogen, confirm its identification, to decipher its
observed highly virulent nature of Pcb. phylogenetic relationships with other X. fastidiosa coffee
97
ICPPB2014 Abstracts
infecting strains, and to set up detection methods to to infect several members of Dickeya spp. We have
reinforce control on introduced plant material. Three Xf sequenced and annotated the phage D5 genome: it
strains were isolated from these plants confirming the consists of 155346 bp of double-stranded DNA with the
previous diagnostic based on immunofluorescence. The GC content of 49.7% and with the predicted 196 putative
strains were characterized by multiplex PCR and by genes. To our knowledge this is the first report of a broad
multilocus sequence analysis / typing (MLSA / MLST) host range Dickeya spp.-infecting bacteriophage and its
based on 7 housekeeping genes. Two strains isolated complete genome sequence. We think this information
from C. arabica imported from Ecuador were allocated will proof useful in advance molecular studies on the
to a new genetic lineage closely related to X. f. subsp. infection and interaction of phage D5 with Dickeya spp.
pauca and the third strain, which was isolated from C. host.
canephora imported from Mexico, was allocated to X. f.
subsp. fastidiosa. This study confirms the global Acknowledgements: The work was financially
diversity of Xylella fastidiosa and highlights the diversity supported by the National Science Centre, Poland via
of Xf strains isolated from coffee.Detection methods research grant FUGA 1 UMO-2012/04/S/NZ9/00118 to
were set up based on end point PCR and real time PCR R.C.
on various plant matrix such as coffee (Coffea spp.), References:
grapevine (Vitis vinifera), peach (Prunus persica) and [1]I.K.Toth, J. M.van der Wolf, G.Saddler, E.Lojkowska,
orange (Citrussinensis) in order to provide efficient tools V.Hélias, M.Pirhonen, L.Tsror, J. G.Elphinstone. Plant
for testing imported plants. Pathology, 3: 385-399.
Acknowledgement: Authors want to thanks Dr. Wenling [2]R.Czajkowski,M.C.M.Pérombelon,J.A.van
Deng for providing DNA of PD5-2 strains and Dr Veen,J.M.van der Wolf. PlantPathology,60: 999-1013.
Rodrigo P. P. Almeida for advice concerning the isolation [3]R.Czajkowski, Z.Ozymko,E.Lojkowska.
of Xylella.fastidiosa. PlantPathology,DOI: 10.1111/ppa.12157.
S4-O12 Isolation and genetic and morphological S4-O13 Genetic diversityof plant pathogenic
characterization of a new soil-borne, broad host Streptomyces spp.
lytic bacteriophage D5 infecting Dickeya spp. a a b b
MI Lapaz , MI Siri , JC Huguet Tapia , R Loria ,
a*
María Julia Pianzzola
Robert Czajkowski*, Zofia Ozymko, Ewa Lojkowska a
Department of Biotechnology, Intercollegiate Faculty of Department of Biosciences, Facultad de
Biotechnology, University of Gdansk and Medical Química-Universidad de la República, Av.General
University of Gdansk, Kladki 24, 80-822 Gdansk, Flores 2124, Montevideo, Uruguay.
b
Poland. Plant Pathology Department, University of
Robert.czajkowski@biotech.ug.edu.pl Florida,1444 Fifield Hall, Gainesville, United States.
mpianzzo@fq.edu.uy
In Europe Dickeya spp. bacteria cause severe losses in
crop production [1]. The effective strategies to control The Streptomyces genus is one of the most diverse taxa
these bacteria have not yet been developed in bacteria and currently contains approximately 591
[2]
.Consequently, the management of Dickeya spp. in species. The identification and classification of members
agriculture is based mainly on the exclusion of infected of this genus is difficult because streptomycete taxonomy
plant material and the use of hygienic practices during has been subject to over-speciation as producers of novel
plant cultivation and in storage.In our previous study we antibiotic compounds were described as new species and
have characterized several lytic bacteriophages infecting patented as part of the antibiotic discovery process [1].
Dickeyaspp [3]. Here, we present detailed information of Plant pathogenicity is rare in the genus Streptomyces.
the selected phage D5. This phage has a typical However, a group of Streptomyces is able to infect plants
morphology of the members of the Myoviridae family and cause potato common scab (CS). This disease is
and Caudovirales order with a diameter of head of ca. characterized by necrotic lesions on the potato tuber
90-100 nm and the length of the tail of ca. 120-140 surface [2]. Scab lesions reduce the market value of the
nm.D5 was prone to inactivation by pH 2.0, temperature potato crop and result in significant economic losses to
of 85qC and by UV illumination but it was stable in the growers. Several Streptomyces spp. are responsible for
presence of chloroformand elevated osmolarity. The the disease, among them S. scabies which is the
phage D5 was characterized for optimal multiplicity of best–characterized. Another important pathogenic
infection, burst size and for the rate of the adsorption to species is S. acidiscabies, which was isolated from acid
the D. solanicells. Adsorption of phage D5 to D. solani soils where S. scabies is normally suppressed [3]. In this
cells after 20 min. was 78%, optimal multiplicity of study, we characterized a collection of 94 pathogenic
infection was 0.01 and the burst size was 72±6. The Streptomyces spp. Isolates were obtained from necrotic
phage was able to stop the growth of D. solaniin vitro lesions of potato tubers and soil samples from different
and to protect potato tuber tissue from maceration caused regions in Uruguay. We used (i) rep-PCR fingerprinting
[4]
by the bacterium. The phage has a broad host range able (ii) sequencing of the taxonomic gene rpoB (RNA
98
ICPPB2014 Abstracts
[4]
polymerase B subunit) and (iii) Multilocus Sequences representative strains of the four phylotypes has
Analysis (MLSA) [5]. We identified four different improved the knowledge of the taxonomy of this species
clusters of pathogenic Streptomyces. The first cluster complex significantly [5]. Using a polyphasic approach on
contained 10 S. acidiscabies isolates containing the extensive set of representative strains, this current study
pathogenicity genes coding for the pythotoxin thaxtomin provides evidence for a taxonomic and nomenclature
(txtAB), the necrotic factor (nec1) and the revision of this species complex. Data obtained from
glycosylase-tomatinase (tomA). The second cluster phenotypic assays, molecular, phylogenetic and
grouped 15 S. acidiscabies isolates lacking pathogenicity chemotaxonomic evidences support the DNA-DNA
markers. The lack of these genes leads us to propose the hybridisation results which have resulted in the
presence of novel virulence factors in these isolates. The separation of the members of R. solanacearum species
third cluster contained 12 S. scabies strains, and the complex into three genospecies. These three species
fourth cluster was represented by a S. europaescabies include the existing species R. solanacearum limited to
strain. Phylogenetic analyses of the rpoB gene provided a phylotype II strains, the existing species R. syzygii
greater discrimination at the species level but not all (phylotype IV) expanded to include the BDB strains and
species were identified by this method. Through MLSA phylotype IV “R. solanacearum” strains, and a new
analysis it was possible to identify and characterize the genomic species to incorporate “R. solanacearum”
strains. Phylogenetic trees generated through rep-PCR, strains belonging to phylotypes I and III. The following
the phylogenetic analyses of rpoB gene and MLSA taxonomic proposals are made: emendation of the
displayed the same cluster composition. Our results descriptions of R. solanacearum and R. syzygii,
indicated that MLSA was the best method to identify and descriptions of Ralstonia syzygii subsp. syzygii comb.
characterize plant pathogenic Streptomyces spp. nov. (R 001T = LMG 10661T = NCPPB 3446T) for the
current R. syzygii strains, Ralstonia syzygii subsp.
Acknowledgement: ANII, CSIC, CAP, PEDECIBA indonesiensis subsp. nov. (UQRS 464T = LMG 27703T =
Biología DSM 27478T) for the current R. solanacearum phylotype
References: IV strains, Ralstonia syzygii subsp. celebensis subsp. nov.
[1]P. Laskaris, T. Sekine and E.M. H. Wellington (2012), (UQRS 627T = LMG 27706T = DSM 27477T) for the
PLoS One, 7, e35756. BDB strains and Ralstonia pseudosolanacearum sp. nov.
[2]D.R.D. Bignell, J.C. Huguet-Tapia, M.V. Joshi, G.S. (UQRS 461T = LMG 9673T = NCPPB 1029T) for the R.
Pettis and R. Loria (2010), Antonie van Leeuwenhoek, solanacearum phylotype I and III strains.
DOI 10.1007/s10482-010-9429-1. Acknowledgments: This research was supported by the
[3]R. Loria, J. Kers and M. Joshi (2006). Annu Rev. Australian Centre for International Agricultural Research
Phytopathol. 44, 469. (ACIAR), the University of Queensland, and the
[4]R. St-Onge, C. Goyerb, R. Coffinc, M. Filiona (2008). BCCM/LMG Bacteria Collection, laboratory of
Systematic and Applied Microbiology, 31, 474. Microbiology, Ghent University. Financial support is
[5]D.P. Labeda (2011). Int J Syst Evol Microbiol, 61, acknowledged for AusAID and the Directorate General
2525. of Higher Education of Indonesia (DGHE/DIKTI) for
S4-O14 A revised circumscription of the scholarships to Irda Safni.
Ralstonia solanacearum species complex based References:
on polyphasic taxonomy analysis [1]Fegan, M. and P. Prior, How complex is
a* b b a
Irda Safni , Ilse Cleenwerck , Paul De Vos , Mark Fegan , theRalstoniasolanacearum species complex", in
a
Lindsay Sly , Ulrike Kappler
a Bacterial Wilt Disease and the Ralstonia solanacearum
a
School of Chemistry and Molecular Biosciences, Species Complex C. Allen, A.C. Hayward, and P. Prior,
Faculty of Science, The University of Queensland, QLD Editors. 2005, APS Press: St. Paul, Minnesota, USA. p.
4072, Australia 449-461.
b
BCCM/LMG Bacteria Collection, Laboratory of [2]Prior, P. and M. Fegan, Recent developments in the
Microbiology, Ghent University, K.L. Ledeganckstraat phylogeny and classification of Ralstonia solanacearum,
35, B-9000 Ghent, Belgium in Proceedings of the 1st International Symposium on
irda.safni@uqconnect.edu.au Tomato Diseases, M.T. Momol, P. Ji, and J.J. B., Editors.
2005: Orlando. p. 127-136.
The members of the Ralstonia solanacearum species [3]De Vos, P., A new classification of the genus
complex that are phenotypically diverse have been Pseudomonas based on DNA-rRNA hybridisation, in
divided into four genetic groups, called phylotype, based Zoology, Physiology, and Biochemistry 1980, University
on the geographical origin of each strain [1, 2]. It had been of Ghent: Ghent.
previously suggested that high DNA homology values [4]Palleroni, N.J. and M. Doudoroff, Phenotypic
were also found among the R. solanacearum biovars 1, 2 characterization and deoxyribonucleic acid homologies
and 3 strains (currently assigned as either phylotypes I, II of Pseudomonassolanaceaum. Journal of Bacteriology,
and III) [3, 4]. Genome sequencing of more than 10 1971. 107(3): p. 690-696.
99
ICPPB2014 Abstracts
[5.Genin, S. and T.P. Denny, Pathogenomics of the management was also evaluated regarding HLB
Ralstoniasolanacearum species complex. Annual Review incidence through the years (2007 to 2013). The
of Phytopathology, 2012. 50: p. 70-89. cumulated HLB incidence varied from 3.8% to 21.4%
among the citrus blocks in that farm. The most affected
S4-O15 Influence of primary inoculum on blocks were those located at the borders of the farm,
Huanglongbing spread in managed citrus areas distant 0.8 and 1.6 kilometers from non-commercial
a b b b
Ferreira RV , Paiva PEB , Yamamoto PT , Bergamin Filho A , areas with no HLB control. D. citri dispersion was
a
Wulff NA , Belasque J
b* evaluated up to 744 meters from the border of the
a
Fundo de Defesa da Citricultura (Fundecitrus), Avenida HLB-managed farm, and 64.1%, 74.4%, and 94.9% of
Doutor Adhemar Pereira de Barros, 201, 14807-040, total adults detected occurred at 100 meters, 200 meters,
Araraquara, Brazil and 300 meters, respectively. Non-commercial citrus
b
Escola Superior de Agricultura “Luiz de Queiroz”, areas can also act as very effective sources of HLB
Universidade de São Paulo, Avenida Pádua Dias, 11, inoculum and more effective HLB management demands
13.418-900, Piracicaba, Brazil actions in the neighboring citrus areas where plant
belasque@usp.br eradication and insecticide sprays are not performed.
Huanglongbing (HLB), caused by Ca. Liberibacter spp., Acknowledgement: This project is supported by
has reached in 2012 more than 64% of citrus orchards FAPESP (Process 2013/20296-1).
and 6.9% of citrus plants in São Paulo state, Brazil. São S4-P1 Monitoring Ralstonia solanacearum
Paulo is the main orange juice producer worldwide and strains causing potato brown rot in Taiwan and
the current HLB epidemic is a challenge for the Brazilian their virulence on tomato, eggplant, and pepper
citrus business. The recommended HLB management is
a a b b
based on: i) pathogen-free nursery plants; ii) eradication Chihhung Lin , Jawfen Wang , Yeafang Wu , Anhsiu Cheng
a
of symptomatic citrus trees (roguing); and iii) intensive Bacteriology, AVRDC – The World Vegetable Center,
chemical control of its vector (Diaphorina citri). Though Shanhua, Tainan, Taiwan
b
eradication of less than 1% to 2% of trees per year are Tainan District Agricultural Research and Extension
common in citrus farms adopting this recommended Station, Council of Agriculture, Hsinhua, Tainan, Taiwan
HLB management, most citrus growers in São Paulo chih-hung.lin@worldveg.org
state does not follow it, especially the eradication of
symptomatic plants. By consequence, since 2005, HLB Potato brown rot caused by phylotype II race 3 biovar 2
is spreading in all regions of the state. Regional HLB strains of Ralstonia solanacearum is mostly present in
management was recently showed to be more effective temperate regions and tropical highland areas. The strain
for disease control than local management. Local was first identified in Taiwan in 1999 in the central
management is less effective in reason of D. citri western lowlands [2]. A severe epidemic of potato brown
dispersion from commercial and non-commercial HLB rot occurred further south in 2006 in Yunlin [3]; since then,
affected areas where symptomatic trees and/or absence the disease has occurred sporadically in this area. Potato
of vector control are common. In the present study we is cultivated in the fall after paddy rice in Yunlin, when
aim to determine the distance and magnitude of influence other solanaceous crops like tomato, pepper, and
of HLB-inoculum areas on well-managed citrus eggplant are cultivated. Monitoring was conducted from
producing farms. Citrus orchards in five neighboring 2007 to 2009 to evaluate the pathogen’s potential to
citrus areas were evaluated about their D. citri survive in the agro-ecosystem. Ten potato fields with a
populations by 120 points with yellow stick traps. Two known history of brown rot in Yunlin were selected for
of the citrus farms regularly remove their symptomatic monitoring. When using the direct plating method on the
plants (≥4 times per year) and frequently spray selective medium MSM-1, the pathogen density ranged
insecticides (≥19 sprays per year), however the other from not detectable to 2.2 × 105 CFU per gram of dry
three areas presented none or some plant eradication (<4 soil in the 2007 crop, and disease incidence ranged from
times per year) and vector control (≤12 sprays per year). 0 to 85%. In 2008 the pathogen was not detected in any
From October 2012 to November 2013 146 adults of D. of the fields, and disease incidence was low (0 to 2%). In
citri were detected in the 120 yellow traps and 32 of 2009, the pathogen was detected in five fields, and
them (22%) were PCR positive for Ca. Liberibacter spp. disease incidence was 0 to 40% over the ten fields. No
Through all this period the average number of D. citri clear association was found between the soil pathogen
adults per yellow trap was 0.013 and 0.007 in the two density and the disease incidence. The same soil samples
HLB-managed farms, 0.077 in the farm with poor HLB were tested using enriched polymerase chain reaction
management, and 0.203 and 0.242 in the two areas (PCR) [1]. The pathogen was detected in several fields not
without any insecticide application and symptomatic tree showing disease symptoms over the three years. The
eradication. However, the proportion of adults PCR+ for results suggest that the cropping system by rice rotation
Ca. Liberibacter spp. varied only from 21% to 29% in in Yunlin does not favor the survival of R. solanacearum
each farm, indicating vector dispersion from HLB-source phylotype II race 3 biovar 2 strains. The primary
areas. The biggest citrus farm adopting HLB inoculum source of potato brown rot is most probably
100
ICPPB2014 Abstracts
contaminated seed tubers. Large variation in virulence detected based onagar plating assays. For the research of
among phylotype II race 3 biovar 2 strains was reported VBNC state,an accurate,rapid and stable detection
on potato, tomato and eggplant. Thus, Taiwanese potato method is needed to quantifythe viable cells. In this study,
strains on tomato, eggplant and pepper were evaluated we developed a method combined with
under high and low temperature conditions during membrane-permeant nucleic aciddyes, flow cytometry
summer and fall seasons in the greenhouse. A total of 45 andTruCount tube. The total cells could be stained by
potato strains collected from Yunlin were inoculated on SYTO9,while only dead cells stained by PI. BDTruCount
known susceptible and resistant varieties against tube and the BD FACSCalibur flow cytometer (FCM)
phylotype I strains. Overall, the tested strains showed were used for counting.The number of VBNC cellswas
high virulence on tomato and eggplant. Higher severity calculated by subtracting the number of culturable cells
was observed in the summer trial (25 to 30 °C) except (by agar plating) from viable cells (subtracting the
for the resistant eggplant variety EG203. Under low number of PI-stained cells from that of SYTO 9-stained
temperature conditions (14 to 22 °C), the percentage of cells). The results showed that mixed suspensions of
wilted plants ranged from 17 to 100% on L390, the viable and dead cells could be detected and counted
susceptible tomato variety, and 0 to 33% on Hawaii 7996, through the established method. The appropriate
the resistant variety. Mean severity increased to 100% on population range of Xcc for FCM detecting was 105-108
L390 and from 25 to 92% on Hawaii 7996 under high CFU/mL. The final concentrations were 6 μmol/L for
temperature conditions. Similar results were observed on SYTO 9 and 30μmol/L for PI, respectively. The
eggplant, with the exception of EG203, which showed incubation time of the two dyes was 30 min.The settings
higher severity under low temperatures. Most of the of FCM were as follows: amplifier mode, Log; voltage
tested strains did not cause visual symptoms on resistant of FSC, E00; voltage of SSC, 435; voltage of FL1 for
(PBC066) or susceptible (PBC1367) varieties of pepper. SYTO 9, 686; voltage of FL2 for PI, 600; speed, medium.
However, the pathogen was detected in the stem base of This method can be used to detect the viable cells of
asymptomatic pepper plants (16 to 100% on PBC1367 Xcc.
and 0 to 100% on PBC066). Our results showed
phylotype II race 3 biovar 2 strains could be a potential Acknowledgement: This work was supported by Beijing
threat to tomato and eggplant, but not to pepper in Engineering Research Center of Seed and Plant Health
southern Taiwan. and Beijing KeyLaboratory of Seed Disease Testing and
Control.
Acknowledgement:
This research was supported by Bureau of Animal and References:
Plant Health Inspection and Quarantine, Council of [1]J.I.Ghezzi, T.R.Steck(1999). FEMS microbiology
Agriculture of Taiwan and National Science Council of ecology, 30(3): 203-208.
Taiwan. [2]T.Berg,L.Tesoriero,D.L.Hailstones(2005).Plant
Pathology,54(3):416 -427.
References:
[1]C.-H. Lin (2009). Eur. J. Plant Pathol. 124, 75. S4-P3 R & D and Commercialization of novel
[2]Y.-S. Chiuo (2002). Master’s thesis, National Chung effective microbial pesticides for controlling
Hsing University. plant diseases--the series products of
[3]Y.-F. Wu et al. (2010). Plant Pathol. Bull., 19, 87. Paenibacillus polymyxa HY96-2
a b a a
Yuanguang Li *, Sulan Li , Yuanchan Luo , Daojing Zhang ,
S4-P2 A flow cytometric method for counting b a a
Xunyi Huang , Jie Chen , Panxi Liu
viable Xanthomonascampestrispv.campestris a
State Key Laboratory of Bioreactor Engineering, East
a, b a, b a, b a, b*
Xin Xu , Xiaowei Huang , Laixin Luo , Jianqiang Li China University of Science and Technology, Shanghai
a
Department of Plant Pathology, China Agricultural 200237, China
b
University, Beijing, P. R. 100193, CHINA Shanghai Zeyuan Marine Biotechnology Company Ltd,
b
Beijing Engineering Research Center of Seed and Plant Shanghai 200237, China
Health (BERC-SPH) /Beijing Key Laboratory of Seed ygli@ecust.edu.cn
Disease Testing and Control (BKL-SDTC), Beijing, P. R.
100193, CHINA With the improved quality of life, people are concerned
lijq231@cau.edu.cn more and more about food safety. Microbial pesticide has
got great development in recent years due to their less
Xanthomonas campestris pv.campestris(Xcc) is the negative effects and better environmental compatibility.
causal agent of black rot on a wide range of cruciferous As the most important class of microbial pesticide, many
plants, including cabbage, radish, broccoli and products of microbial fungicide and bactericide have
cauliflower. It has been reported thatXcc could be been registered all over the world so far.
induced into the viable but non-culturable(VBNC)state
by nutrient starvation.Xcc in that state fails to produce a A novel microbial pesticide, 0.1×108 cfu/g granular
visible colony on nonselective media, andcan’t be formulation(PPFG) of Paenibacillus polymyxa, was
firstly developed and commercialized by our research
101
ICPPB2014 Abstracts
team, Shanghai Zeyuan Marine Biotechnology Company pv. syringae (Pss), P. syringae pv. morsprunorum race1
and Zhejiang Tonglu Biotechnology Company. PPFG (Psm1) and P. syringae pv. morsprunorum race2 (Psm2),
was registered for controlling bacterial wilt of tomato, the atypical group of strains, not producing esculine and
pepper, eggplant, and tobacco in 2004(LS20040563, utilizing L-lacate as Pss strains but showing atypical
PD20096844). The certificate of PPFG production pathogenic abilities as Psm were found. This group of
approval (old No.:HNP31069-D3535, new No: atypical strains, named Pss(A) originates from sour
HNP33077-D3535) was also obtained by cooperate cherry, This group of strains was distinct in phenotypic
company. tests (similar to Pss), genetic diversity analysis with
rep-PCR, PCR MP and MLST as well as in pathogenicity
An upgrade product of PPFG-1×109 cfu/g wettable assay (they caused superficial lesions as strains of Psm1
powder of P. polymyxa (PPWP) was developed and 2). This new, not described yet group of isolates, was
successfully. PPWP was registered for controlling found to be highly homogenic. Their phylogenetic
tomato bacterial wilt, watermelon fusarium wilt, position, between Pss and Psm strains is still not well
cucumber bacterial angular leaf spot, and watermelon defined but it suggests that their constitute an
anthracnose (LS20110203, PD20140273) in 2011.The intermediate form between these two taxa. The study
production approval (HNP 33077-D4604) of PPWP towards description of this taxon are conducted.
wasalso obtained.
S4-P5 Research and Development of the novel
The third product of P. polymyxaHY96-2, 5×109 cfu/g marine microbial pesticides for controlling plant
technical material of P. polymyxa (PPTC) was disease-- the series product of Bacillus marinus
recognized by registration certificate (LS20110205, B-9987
PD20140421) in 2011. And the production approval of
a* a b
PPTC might be obtained at the end of this year. Yuanchan Luo ,Yuanguang Li , Sulan Li , Daojing
a b a a c,d
Zhang ,Xunyi Huang , Jie Chen ,Panxi Liu , Tiam Li
The series products of P. polymyxa HY96-2 have been a
State Key Laboratory of Bioreactor Engineering, East
sold in China since 2004. The sales of the series products China University of Science and Technology, Shanghai
increased year by year. And the series products are well 200237, China
known in the field of microbial fungicide and bactericide,
b
especially in the field of bio-control of soil-borne Shanghai Zeyuan Marine Biotechnology Company Ltd,
diseases. Shanghai 200237, China
c
The First Institute of Oceanography, Qingdao, 266061,
The series products of P. polymyxa HY96-2 have been
China
tested, demonstrated and popularized since 1998. The d
Qingdao University of Science and Technology,
results showed that the average control efficacies of
Qingdao, 266061, China
PPWP on tomato bacterial wilt (10.2kg/ha.), watermelon
luoyanc@163.com
fusarium wilt (10.2kg/ha.), cucumber bacterial angular
leaf spot(3kg/ha.), and watermelon anthracnose(3kg/ha.) Field salinization is getting more and more serious in
were 83.50%, 79.83%, 76.95% and 72.03%, respectively, China. The bio-control microbes of the registered
indicating PPWP was better than the corresponding microbial pesticides were all from terrene. There is no
chemical pesticides. report about microbial pesticides developed from marine
microbes until now. Considering this situation and the
The results of the demonstration tests showed that the
natural salt tolerance of marine microbe, marine microbe
series products of P. polymyxa HY96-2 were the most
is the most ideal target to be developed as microbial
ideal pesticides for controlling the soil-borne diseases,
pesticide applied in salinized field.
especially bacterial wilt and fusarium wilt.
A marine microbe, Bacillus marinus B-9987, was
S4-P4 Characteristics of the new group of
isolated from roots of Suaeda salsa in the intertidal zone
Pseudomonas spp. causing bacterial canker on
of Bohai by our research team. Using this microbe as the
cherry in Poland – phylogenetic position of
bio-control agent, the novel series microbial pesticide,
known pathovars and races
1×109 cfu/g wettable powder of Bacillus marinus
Monika Kaluzna*, Joanna Pulawska (Chinese patent: CN101331881A) and 5×109 cfu/g
Research Institute of Horticulture, Pomology Division, technical material of Bacillus marinus (BMTC), were
Pomologiczna 18., 96-100 Skierniewice, Poland firstly developed by our research team ˈ Shanghai
monika.kaluzna@inhort.pl Zeyuan Marine Biotechnology Company, The First
Institute of Oceanography and Zhejiang Tonglu
During monitoring conducted in 2007-2011, from 25 of Biotechnology Company. This study was funded by the
63 orchards of stone fruit trees located in different 11th five-year plan national 863 project (2007AA091507).
regions of Poland, 153 Pseudomonas isolates were The certificate of 1×109 cfu/g wettable powder of
obtained. Based on results of LOPAT, GATTa and Bacillus marinus˄BMWP˅for the field test approval of
L-lactate tests despite well-known strains of P.syringae tomato bacterial wilt(SY201102557) and the cucumber
102
ICPPB2014 Abstracts
gray mold (SY201100409) were obtained in 2011. And a Boulevard, St-Jean-sur-Richelieu (Quebec), J3B 3E6,
pilot scale production line of BMWP was established by Canada
the support of this national 863 project. Vicky.Toussaint@agr.gc.ca
The industrialization of Bacillus marinus series product Squash production, especially Spaghetti squash
was funded by the 12th five-year plannational 863 project (Cucurbita pepo L.), has developed significantly over the
(2011AA09070402). The “2 year 4 places” field test of last decade in Quebec, Canada. However, this plant is
BMWP was accomplished in 2012-2013. The average affected by several diseases which can cause severe
control efficacy of BMWP on tomato bacterial wilt economic losses when environmental conditions are
(10.2kg/ha.) and cucumber gray mold (3kg/ha.) were conducive to disease development. Since 2007, unusual
73.9% and 75.5%, respectively, indicating BMWP was symptoms have been observed on twigs, leaves and fruits
better than the corresponding chemical pesticides. The of Spaghetti squash. These symptoms are characterized
results of toxicology showed that BMWP and BMTC by necrosis on leaves, cankers on twigs and green halo
were slightly toxic pesticides. And a production line (200 spots of about 0.5 cm in diameter on the fruit peel. In
tons per year) of BMWP has been established several cases, these spots hide a deep cavity in the fruit
recently.The application materials for the pesticide flesh. In 2007, a survey suggested the causal bacteria to
registration certificate of BMWP and BMTC were be Pseudomonas syringae[1]. In recent years, we were
submitted to Ministry of Agriculture of China. And the engaged in a deeper characterization of the causal agent
acceptance notifications of BMWP and BMTC were and related organisms recovered from the infected tissues.
obtained in February 2014. The official registration Fluorescent Pseudomonads were isolated from fruit and
certificate of BMWP and BMTC might be obtained at leaf samples collected in six commercial squash fields
the end of 2014. located in the Monteregie region (Quebec, Canada). A
biochemical identification of a subset of 55 isolates using
Bacillus marinus B-9987 showed a good salt tolerance LOPAT scheme [2] was followed by a phylogenetic
on salt plate and salinized soil. And BMWP has better analysis using the four housekeeping genes cts, gapA,
control efficacies on cucumber root rot and peanut gyrB and rpoD[3, 4] with neighbor-joining method. In
bacterial wilt in salinized field than those of terrestrial addition, 25 strains from an international collection
microbial pesticide. covering 22 Pseudomonassyringae pathovars and DNA
In addiction, three novel lipopeptide (BM-1, BM-2, and sequences of seven other Pseudomonas species retrieved
BM-3) were isolated from Bacillus marinus B-9987 from GenBank were used in the analysis. These strains
(Chinese patent: ZL 201019063051.8, CN102060914A, diverged into four distinct Clusters (I, II, III and IV).
CN101838314A; PCT patent: PCT/CN2011/070507). Cluster I included all the P. syringae strains which can
The pot test showed that the control efficacies of BM on be further divided into different intraspecific subgroups.
cucumber gray mold and cucumber powdery mildew Seventeen of our isolates were grouped in this cluster.
were better than those of the corresponding registered Cluster II is composed of P. entomophila, P. monteilii
chemical pesticides. BM showed a great potential to be and P. putida, together with seven of the isolates. Cluster
developed as bio-pesticide. And the industrialization of III was formed by P. mendocina and one of our isolates.
BM was funded by the 12th five-year plan national Finally, Cluster IV was further split into three subclusters,
science and technology support project the P. fluorescens with 18 isolates, the P.
(2011BAE06B04). brassicacearum, and a distinct subgroup of nine isolates.
The 17 isolates in Cluster I, were grouped respectively in
After much effort, “Novel microbial pesticides--the P. syringae pv. syringae and pv. aptata-pv. pisi
series products of Paenibacillus polymyxa and Bacillus sub-branches. All these isolates were pathogenic on
marinus” has been well received and was recognized by Spaghetti squash. Interestingly, the isolate B08-049,
the bronze award of “2011 China international industry pathogenic on squash, was distant from P. syringae but
fair”. very close to P. viridiflava.
BMWP is hopeful to be the first registered marine Acknowledgement: The technical assistance provided by
microbial pesticide all over the world. Considering the Mélanie Cadieux and Marie Ciotola for field sampling
good salt tolerance of Bacillus marinus B-9987, the and bacteria isolation and Marie-Michèle Bernier for
soil-borne diseases in salinized field are expected to be laboratory work is gratefully acknowledged. The authors
controlled by BMWP. would like to thank the National Institute of
Agrobiological Science, Japan for providing us
S4-P6 Genetic diversity among strains of Pseudomonas reference strains. This work was funded by
fluorescent Pseudomonads isolated from Agriculture and Agri-Food Canada.
squash fruits and leaves
References:
Dong Xu, Vicky Toussaint*
[1]V. Toussaint, M. Cadieux, M. Ciotola, C.E. Morris
Horticultural Research and Development Center, (2008). Phytopathology 98:S158.
Agriculture and Agri-Food Canada, 430 Gouin [2]N.W. Schaad, J.B. Jones, W. Chun (2001). Laboratory
103
ICPPB2014 Abstracts
Guide for Identification of Plant Pathogenic Bacteria, 3rd Combined the detection sensitivity, specificity, efficiency
edition. APS Press, St.Paul, MN, USA. pp. 373. and speed, the LAMP is a promising method for
[3]S.F. Sarkar, D. S. Guttman (2004). Appl. Environ. detecting Cmm cells from seed extract and plant tissue.
Microbiol. 70:1999.
[4]Morris, C.E., D.C. Sands, J.L. Vannestem J. Montarry, S4-P8 The impact of environmental conditions
B. Oakley, C. Guilbaud and C. Glaux (2010). mBio 1:1. on survival of bacteria Clavibacter
michiganensis subsp. sepedonicus.
S4-P7 Detection of Clavibacter michiganensis
Anna Mackowiak Sochacka*, Krzysztof Krawczyk
subsp. michiganensis in tomato seed by
loop-mediated isothermal amplification based Institute of Plant Protection National Research Institute,
on chpC gene sequence Department of Virology and Bacteriology, Wegorka 20
Street 60-318 Poznan, Poland
a,b a,b a,b
Qingyang Lv , Yumin Kan , Na Jiang, Jianqiang Li , anna.sochacka@vp.pl
a,b
Laixin Luo *
a
Department of Plant Pathology, China Agricultural Clavibacter michiganensis subsp. sepedonicus (Cms),
University, No. 2 Yuanmingyuan West Road, Beijing, the cause ofpotato ring rot is a quarantine organism and
China according toapplicableregulationsof manycountries
b
Beijing Engineering Research Center of Seed and Plant potato tubers infected with Cms must be utilized [1].
Health / Beijing Key Laboratory of Seed Disease Testing Utilization of large amount of potatoes is problematic;
and Control, Beijing, China therefore it became necessaryto develop newmethods of
luolaixin@cau.edu.cn safe disposal, based on survival rate of bacteria.
Bacterial canker of tomato is a significant quarantine The aim of our studies was to examine the survival of C.
seed-borne disease which has been reported at all major michiganensis subsp. sepedonicus (Cms) in the
producing region of tomato worldwide. The casual conditionsprevailingduring the composting or biogas
agentClavibacter michiganensis subsp. michiganensis production. The most important factorin the
(Cmm) can be spread through long distance by infected eliminationof harmful microorganismsin thebiological
or contaminated seeds. The conventional detection treatment is thehigh temperatureduringphase of intensive
method for Cmm from tomato seed is Bio-PCR, which degradation of plant waste, therefore in our
combines the advantages of semi-selective medium and researchspecial emphasiswas put on various temperature
DNA-based method, and shows favorable result but range.
takes 2-3 weeks to finish the test with low efficiency and As a result ofour research we found, thatbactericidal
more labor work. In this study, a new method was effectappeared after30 minutes incubation of Cms of at
developed for detecting Cmm from tomato seed based on 70°Cand a relative humidityof about99%. Reduction of
loop-mediated isothermal amplification (LAMP) to short humidityto 15%increased survivaltime of bacteria at
process and improve efficiency. 70°Cto about48 hours. At a temperature of50°Cand 15%
humidity,Cms survival time was 28days.Increasing
The design of LAMP primer was based on the chpC gene thehumidityup to99% causedbactericidal effect at 50°C
sequence located on pathogenic island of Cmm genome after 48 hours. As result of incubation at 35°C, survival
DNA. The reaction system was optimized through time of bacteria was 30 days (in the medium with 99%
regulating the concentration of each reagent in the humidity) and over 90 days at 15% humidity.
mixture, the specificity and sensitivity of LAMP primer Tests results proved that the most important factor for the
were tested by 89 Cmm strains, which isolated from survival of Cms is temperature: the higher, the shorter
infected tomato plants or seeds in different provinces in the survival time of the bacteria. The increase in
China from 2003 to 2013. The results showed that the moisture content is a factor that reduces the survival of
LAMP primer have great specificity, which discriminated bacteria in relation to bacteria grown in the same
all 89 Cmm strains from tested 103 plant pathogenic temperature. In the studied temperatures, the pH of the
bacterial strains. The detection sensitivity were 4.3×105 substrate is a secondary factor for the survival of the
CFU/mL for boiled Cmm cell samples and 1.8×10-2 bacteria C. michiganensis subsp. sepedonicus.
ng/μL for Cmm DNA samples, respectively. The LAMP Biological treatmentthat utilizestechnologies such
method was tested by 1 Cmm-inoculated and 25natural ascomposting orbiogas productionseems to the
tomato seed samples, using conventional PCR and mostfeasibleway todisposeinfectedtubers [2].The results
Bio-PCR as control. The detection limit for LAMP was of thisstudydo notlead to the definite conclusionwhether
105 CFU/g of Cmm, while 106 CFU/g by conventional thesemethods arereasonably safemethodof disposalof
PCR and 104 CFU/mL by Bio-PCR. The artificially contaminatedpotato tubers, therefore further research in
inoculated seed sample was Cmm-positive tested by this area is needed.
three methods. Two of 25 natural seed samples were
positive by Bio-PCR detection, but all samples were Acknowledgement: This work was supported by the
negative by LAMP and direct PCR methods. Polish Ministry of Agriculture and Rural Development
(Long term programme of IPP- NRI “Protection of
104
ICPPB2014 Abstracts
cultivated plants with the consideration of food safety, 5111 bp of upstream anddownstream sequences were
reduction of yield losses and threat to humans, farm obtained. The total 5992 bp sequences containeda
animals and the environment”. complete rRNA operon, composed of a 16S rRNA gene,
a tRNAIlegene, a 23S rRNA gene and a 5S rRNA gene
References: followed by eight tRNA genes.Phylogenetic analysis and
[1]Clavibacter michiganensis subsp. sepedonicus.2011. virtual restriction fragment length polymorphismanalysis
EPPO Bulletin, Volume 41, Issue 3, pages 385–388 indicatedthat the phytoplasma detected in this study was
[2]D. Kaemmerer. 2008. Quantification of viable cells of a variant (16SrII-A*) ofphytoplasma subgroup 16SrII-A.
Clavibacter michiganensis subsp. sepedonicus in These results showed that a 16SrII-A* phytoplasma
digester material after heat treatment by could be detected in grapefruit trees with HLB-like
TaqMan®BIO-PCR Journal of Plant Diseases and symptoms in Guangxi Province.
Protection, 116(1), 10–16
Acknowledgement: This work was supported by grants
S4-P9 A 16SrII-A*phytoplasma detected in from NationalNatural Science Foundation of China
grapefruit (Citrus paradisi) showing (31301635), and Guangxi Natural Science Foundation
Huanglongbing-like syptoms in Guangxi, P. R. (2013GXNSFBA019110).
China
a b a a
References:
Binghai Lou *, Xianjin Bai , Yaqin Song , Chongling Deng ,
a
[1]J. M. Bové (2006). Journal of Plant Pathology 88:7.
Chuanwu Chen
a
[2]D. C. Teixeira, N. A. Wulff, E. C. Martins, E. W.
Guangxi Key Laboratory of Citrus Biology, Guangxi Kitajima, R. Bassanezi, A. J. Ayres, S. Eveillard, C.
Citrus Research Institute, 40 Putuo Road, Qixing District, Saillard, J. M. Bové (2008). Phytopathology, 98: 977.
Guilin, Guangxi 541004, P. R. China [3]J. Chen, X. Pu, X. Deng, S. Liu, H. Li, E. Civerolo.
b
Guangxi Academy of Agricultural Sciences, 174 Daxue Phytopathology, 99: 236.
East Road, Xixiangtang, Nanning, Guangxi530007, P.
R.China S4-P10 Bacterial communities associated with
Binghai.Lou@hotmail.com surfaces of leafy greens: temporal development
shifts and host specificity
Huanglongbing (HLB), previously also refered to as
greening disease, is one of the most destructive diseases Merete Wiken Dees*, Erik Lysøe, BeritNordskog, May
in citrus industry worldwide. Bacteria of three species of BenteBrurberg
genus Candidatus Liberibacter, Ca. L. asiaticus, Ca. L. Bioforsk - Norwegian Institute for Agricultural and
africanus and Ca. L. americanus, are consistently Environmental Research, Plant Health and Plant
considered to be associated with HLB [1]. However, the Protection Division, N-1430Aas, Norway
etiology of HLB is not completely clear yet, since plhmwd@bioforsk.no
Koch’s postulates have not been fulfilled. Recently,
phytoplasmas were reported in São Paulostate, Brazil[2], The phyllosphere comprisesthe aerial parts of plants and
and GuangdongProvince, P. R. China [3], associated this habitat is colonized by a wide variety of bacteria,
withblotchy-mottle leaf symptoms, the typical yeasts and fungi [1]. It is harboring epiphytes, as well as
symptomsof HLB on citrus. In this study, we performed plant pathogenic bacteria and even human pathogens.
a survey to detect phytoplasmas in a HLB-infected Resident bacteria on the leaves can have either neutral,
grapefruit (Citrus paradisi) orchard in Guangxi Provincr, negative or positive influences on their host plants by
P. R. China in 2010. 87 leaf samples with symptoms of serving as pathogens, preventing leaf colonization by
blotchy mottle were collected from symptomatic pathogens or acting as growth promoters [2]. Insight into
grapefruit trees, and 320 leaf samples from symptomless the phyllosphere communities is useful in the promotion
trees adjacent to the symptomatic trees. Nested of plant growth and plant protection [3].Understanding
polymerase chain reaction (PCR) using universal the ecology of the phyllospheremicrobiota is also
phytoplasma primer set P1/P7 followed by primer set important in the context of food safety [4], as
fU5/rU3 identified 7 (8.0%) positive samples from contamination of fresh horticultural products with
symptomatic samples but none from symptomless foodborne pathogens has become an increasing concern
samples.Chi-square test indicated that phytoplasma was worldwide [5]. We investigated the bacterial diversity of
significantly correlated with HLB-like symptoms on leafy greens shortly after planting (3 weeks) and at
grapefruit trees (P< 0.001). Of the 87 symptomatic harvest (5-7 weeks after planting), using culture or
samples, 77 (88.5%) were positive for Ca. L. asiaticus culture-independent analysis (IlluminaMiseq).
and 5 for both phytoplasma and Ca. L. Conventionally grown lettuce (Lactuca sativa) and
asiaticus.Sequence analysis indicated that seven 881-bp rocket salad (Diplotaxistenuifolia) were collected from
amplicons, amplified bynested phytoplasma primer sets two different farms in south-eastern Norway during the
P1/P7 and fU5/rU3, shared 100.0%sequence identity growing season of 2013 (April-September), for microbial
with each other. Genome walking was then profiling of the phyllosphere inhabiting bacteria. In this
performedbased on the 881 bp known sequences, and study, we identified Proteobacteria, Bacteroidetes,
105
ICPPB2014 Abstracts
Actinobacteria and Firmicutes as the most prevalent position in the field of plant pathology. RT-qPCR is often
phyla in the phyllosphere of leafy greens regardless of used to quantify the gene expression in Cmm and other
culture or culture-independent analysis. Across all plant pathogenic bacteria. However, accurate
samples, we found that the bacterial diversity of the L. quantification analysis requires stable reference genes,
sativa samples were significantly greater shortly after whose expression do not change during the experimental
planting (3 weeks) than at harvest (5-7 weeks after period. Here, we present a study to evaluate the
planting) for all samples. Moreover, Actinobacteria was expression stability of six housekeeping genes in Cmm.
the dominating phylum in the samples collected at 3
weeks, while Proteobacteria was most abundant at Six housekeeping genes, gyrB, rpoB, tufA, bipA, gapA
harvest. Genera identified in this study include important and pbpA, were tested in five kinds of microcosms and
plant pathogens like Pseudomonas, Xanthomonas, evaluated by two most popular softwares, geNorm and
Pantoea, Rhizobium and Rhodococcus. Thegenera NormFinder. The LB broth and mM9 medium were on
Salmonella and Escherichia which include potentially behalf of artificial nutrient conditions for bacterial
harmful human pathogens were not found in our study. growth. Tomato seedling homogenate (TSH) was used to
mimic the host environment in which Cmm interacted
A notable degree of variability in distribution of with its host. The 0.85% NaCl solution was absolute
phyllosphere communities could be observed in the D. oligotrophic microcosm. The 0.85% NaCl supplemented
tenuifoliasamples compared to the L. sativa samples at with CuSO4 solution was a special condition to induce
harvest. A comprehensive knowledge of the drivers of the viable but nonculturable (VBNC) state of Cmm.
bacterial community structure in the phyllosphere is
utmost important in developing new strategies for plant Of six reference gene candidates, gyrB, bipA, gapA and
protection. To determine the abundance structure of rpoB expressed stably in artificial nutrient environment.
phyllosphere bacterial populations we suggest that PbpA, tufA and gyrB could be used as reference genes for
host-microbe and/or microbe-microbe interactions play a studying of interaction between Cmm and its host.
role over time in shaping niches favoring the growth of Whereas, the other three genes, bipA, rpoB and gapA
particular taxa. could be used in the oligotrophic microcosm. Specially,
gyrB, pbpA, rpoB and gapA were selected and served as
References: the normalization factors in quantification of gene
[1]S.E.Lindow, M.T.Brandl(2003)..Microbiology of the expression in Cmm VBNC mechanism research.
phyllosphere. Applied and Environmental Microbiology
69:1875-1883. S4-P12 Evaluation of cross-priming
[2]J.M.Whipps, P.Hand, D.Pink, G.D.Bending (2008). amplification method for on-site detection of
Journal of Applied Microbiology, 105:1744-1755. Acidovorax citrulli
[3]J.A. Vorholt (2012). Nature Reviews a b a a
Qian Tian , Jing Zhang , ShuifangZhu ,WenjunZhao *,
Microbiology,10:828-840. FengquanLiu
b
[4G.Rastogi, G.L.Coaker,J.H.J.Leveau(2013). FEMS a

Institute of Plant Quarantine, Chinese Academy of
Microbiology Letters, 348:1-10. Inspection and Quarantine, Beijing 100029, China
[5]L.D.Dinu,S. Bach (2011). Applied and b
College of Plant Protection, Nanjing Agricultural
Environmental Microbiology, 77:8295-8302. University, Nanjing 210095, China
S4-P11 Evaluation of six housekeeping genes wenjunzhao@188.com
for normalization in RT-qPCR analysis in Acidovoraxcitrulliis the causative agent of bacterial fruit
Clavibacter michiganensis subsp. blotch (BFB) of watermelon[1]. Due to its economic
michiganensisin vitro importance, A. citrulli is regarded as a bacterium with
plant quarantine significance in U.S., China and Europe.
a,b a,b a,b a,b
Na Jiang , Sining Han , Jianqiang Li , Laixin Luo * Current available detection methods are time-consuming
a
Department of Plant Pathology, China Agricultural or require specific equipment[2, 3]. Here one rapid and
University, No. 2 Yuanmingyuan West Road, Beijing, affordable diagnosticmethod suitable for on-site
China detection method was evaluatedby using Cross-priming
b
Beijing Engineering Research Center of Seed and Plant amplification (CPA) method.CPA is a class of isothermal
Health / Beijing Key Laboratory of Seed Disease Testing amplification reactions that is carried out by a strand
and Control, Beijing, China displacement DNA polymerase and does not require an
luolaixin@cau.edu.cn initial denaturation step or addition of a nicking
enzyme[4]. The detection of amplified products is
Clavibacter michiganensis subsp. michiganensis (Cmm), visualized on a lateral flow strip housed in an enclosed,
the causal agent of bacterial canker of tomato, is a sealed plastic device to prevent the leakage of amplicons.
representative Gram-positive plant pathogenic bacterium. Visible bands on the test strips indicate positive
Because of the essential economic losses and its distinct reactions[5]. One set of five primers were designed as
pathogenesis, Cmm was used as a model for follows:
understanding phytobacteria and holds an important ACLF3: GGCTAACTACGTGCCAGC,
106
ICPPB2014 Abstracts
ACLB3: ACGCATTTCACTGCTACA, Eucalyptus species. Bacterial wilt of Eucalyptus was first
ACLBIP:CAGATGTGAAATCCCCGGGCTCTGCCGT reported in Brazil and has subsequently been reported in
ACTCCAGCGAT, other tropical or sub-tropical areas of the world including
ACDF5b1:BIOTIN-GCAAGCGTTAATCGGAATTAC, China, India, Australia and South Africa [1, 2]. Ralstonia
ACDF5f2:FITC-CAACCTGGGAACTGCATTTGT. solanacearum, the causal agent of bacterial wilt, is
Our results showed that the detection limit for the kit was considered to represent a ‘species complex’. Fegan and
about 7.4 bacterium per reaction. The specificity of the Prior (2005) developed a molecular protocol, known as
CPA assay was evaluated by detecting 18 A. phylotyping, for the classification of isolates belonging
citrullistrains and 22 reference strains from othergenera. to this complex[3]. This protocol makes use of a multiplex
Positive results were only obtained from Acidovorax spp. PCR which, depending on the resulting amplicon size,
strains. Though the CPA assay could not differentiate allocates isolates to one of four phylotypes that have also
closely-related Acidovoraxstrains from each other, we been linked to geographic regions. R. solanacearum
believe the CPA assay could still be used for detection of isolates can be further classified in sequence variants or
A. citrulli, considering that A. citrulli is only limited to ‘sequevars’ by partially sequencing the endoglucanase
plants in the Cucurbitaceae family. 12 batches of (egl) gene. In addition, the transcriptional regulator
watermelon seeds naturally infected with A. citrulli from (hrpB) gene can be sequenced as part of a multi-locus
fields and 5 batches of healthy watermelon seeds were sequence analysis (MLSA) scheme [3]. In this study we
tested by CPA and normal PCR. Positive results were phylotyped isolates from diseased Eucalyptus spp.,
obtained from all infected seeds, but not from healthy which had first been identified as R. solanacearum,
seeds, which were similar to the results from normal based on 16S rRNA gene sequences. In addition, the
PCR. The amplicons is detected in a simple, self endoglucanase (egl) gene was partially sequenced to
contained disposable DNA strip without opening the determine the sequevars of these isolates and the hrpB
amplification tube, so post amplification contamination gene was sequenced as part of a MLSA scheme. The
can be effectively eliminated. In the entire procedure, results of this study grouped isolates from Brazil in
from sample preparation to visual readout, only a Phylotype II and the remaining isolates from China,
portable battery powered heater and small centrifuge are Africa and Indonesia in Phylotype I. This is consistent
needed. Thus, the method are shorter turn-around time, with previous studies [3] where isolates from the
no need of specific equipment, and easy to interpret Americas were placed in Phylotype II and those from
results for on-site detection. Asia in Phylotype I, however, isolates from Africa
typically group in Phylotype III. The egl gene tree did
Acknowledgement:The work was supported by the not reveal any new sequevars and the egl and hrpB gene
National Science and Technology Support Program trees confirmed the phylotyping results. These results
(2012BAK11B02). provide insight into the distribution of this R.
References: solanacearum on Eucalyptus spp.
[1]N. W. Schaad, E. Postnikova, P. References:
Randhawa(2003).Biology and Genetics, 573. [1]X. Zhou and M.J. Wingfield (2011).Australasian
[2]G. V.Minsavage, R. J. Hoover, T. A.Kucharek, R. E. Plant Pathology, vol. 40, 339.
Stall(1995). Phytopathology, 85, 1162. [2]T.A. Coutinho, J. Roux, K-H.Riedel, J. Terblanche
[3]S. A. Weller, D. E. Stead(2002). Journal of Applied and M.J. Wingfield(2000).Forest Pathology, vol. 30, 205
Microbiology, 92, 118. [3]M. Fegan and P. Prior (2005).American
[4]G Xu,L Hu, HZhong, H Wang, S Yusa, T. C. Weiss, P. Phytopathology Society, USA, 449.
J. Romaniuk, S. Pickerill, Q You (2012). ScientificReport,
2, 246. S4-A1 Epidemiology of Dickeya solani on
[5]H Kong, T Ranalli, B Lemieux(2007). IVD potato grown under hot climate conditions
Technology,13, 35. a b a a
Tsror (Lahkim) Leah *, ChalupowiczL , LebiushS , OErlich ,
b
S4-P13 Phylotyping Ralstonia solanacearum ManulisSassonS
a
isolates associated with bacterial wilt of Department of Plant Pathology and weed Research,
Eucalyptus spp. Agricultural Research Organization (ARO), Gilat
Research Centre, MP Negev 85280, Israel.
Carstensen, G.D., Venter S.N., Wingfield M.J ,Coutinho,T.A.* b
Department of Plant Pathology and weed Research,
Department of Microbiology and Plant Pathology, ARO, Volcani Center, Bet Dagan 50250, Israel.
Forestry and Agricultural Biotechnology Institute (FABI), tsror@agri.gov.il
University of Pretoria, Pretoria 0002, South Africa.
Teresa.coutinho@fabi.up.ac.za Dickeya solanicauses increasing economic lossesin
potato grown in different Europeancountries and in Israel.
Bacterial wilt is an economically important disease of It is transmitted mostly by latently infected potato seed
numerous herbaceous hosts. There are also infrequent tubers. Disease symptoms vary with climate, including
reports of the disease occurring on trees including pre-emergence tuber rot leading to black leg in cool
107
ICPPB2014 Abstracts
temperatures and wilt symptoms in higher temperatures. cellular defense responses, including accumulation of
D. solani can grow at both low and high temperature up defense-related enzymes, such as phenylalanine
to 390C and has a higher maximal growth temperature ammonia-lyase (PAL), polyphenol oxidase, chalcone
compared with D. dianthicola. Therefore, development synthase (CHS), and oxidative stress-relatedproteins
and expression of the disease in field crops may be such as peroxidase (POX), and polyphenol oxidase(PPO),
particularly favored under hot-climate conditions.A and lipoxygenase, and strengthened expression level of
protocol for detecting Dickeya-latent infection in seed defense-related genes.The known defense genes in rice
lots by enrichment PCR was developed and used during mainly encodePR proteins such as PR1a, PR4, and
recent years to assess potential infection in seed lots PR10a.
imported from Europe to Israel for the spring season.
Field survey carried out in 2013 indicated that: 55.8% of In previous study, Bacillusamyloliquefaciens Lx-11
negative seed lots had no disease symptoms in fields, strain have been shown to control bacterial leaf streak
18.6% of positive lots had symptoms (up to 35% DI), disease effectively. To investigate possible biocontrol
with 13.9% of seed lots we got false negative and with mechanisms, several related defense-related genes and
11.6% false positive. In a field trial with 17 seed lots defense enzymes were evaluated in a separately
selected with various levels of seed infection (13 were experiment. We examined the induced expression of
positive in the lab testing and the 4 negatives were with some known defense genes, the activities of
symptoms in the field (23.5% false negative). Only one someantioxidant enzymes, and H2O2levels and MDA
lot was false positive. Daughter tubers from all seed lots levels atthe booting stage in Jinggang 30after treated by
were infected.Pectolytic activity (at 330C), expressed as Lx-11 strain and lipopeptides.In this study, we used
macerated tuber tissue weight, was significantly higher Bacillus amyloliquefaciens strain Lx-11 antagonistic to
with inoculation of D. solani strain 2187, isolated from Xooc to control the bacterial leaf streak (BLS) under
plants grown in Israel compared with strain 3207 isolated greenhouse conditions. The possible mechanism of
from seed tubers imported from the Netherlands. No inducing resistance by the antagonistic bacteria was also
pectolytic activity was obtained with both strains at 150C. evaluated. The application of biocontrol agents
These data further support the hypothesis that although D. significantly reduced the incidences of BLS (63.2-74.5%)
solani strains isolated in Israel are also clonal, they compared to the control. Rice leaves treated with cell
appear to be more virulent than strains isolated in suspension of Lx-11 followed by challenge inoculation
Europe.This phenomenon was observed in eight potato with Xooc increased the activities of polyphenol oxidase,
cultivars, with the highest pectolytic activity obtained in phenylalanine ammonialyase, and peroxidase compared
cv. Rosanna, followed byMondial, Jelly, Nicola, Siffra to the untreated control. Furthermore, the expressions of
and Vivaldi. The lowest pectolytic activity was obtained the marker genes POX, PAL and PR4 in leaves treated
in Desiree and Mozart. with Lx-11 in response to inoculated pathogen were
significantly higher. This study suggests that strain
S4-A2 The antagonistic strain Bacillus Lx-11 increased enzyme activities and expression of
amyloliquefaciens Lx-11 induces resistance and defense genes in plants indicated that the antagonistic
controls the bacterial leaf streak of rice bacteria induced the plant resistance, which was the
potential biocontrol mechanism of BLS.
Rongsheng Zhang*, XH Dai, XY Wang, CP Luo, ZY Chen
Institute of plant protection, Jiangsu Academy of S4-A3 Activity of a novel bactericide, zinc
Agricultural Sciences, Nanjing, Jiangsu, China thiazole against Xanthomonas oryzae pv. oryzae
r_szhang@163.com in Anhui Province of China
a,b,c a,b,c
Rice bacterial leaf streak is caused by the Gram-negative Yu Chen , Tongchun Gao *
a
bacterium Xanthomonas oryzae pv. oryzicola (Xooc) that Institute of Plant Protection and Aro-Products Safety,
seriously threatens the production of rice. Since BLS was Anhui Academy of Agricultural Sciences, Hefei 230031,
discovered in the Philippines in 1918, it has become a China;
b
widespread and economically important disease in parts Laboratory of Quality & Safety Risk Assessment for
of Asia and Africa. The importance of BLS is increasing Agro-Products (Hefei), Ministry of Agriculture, China
c
due to large-scale cultivation of susceptible hybrid rice Scientific Observing and Experimental Station of Crop
cultivars worldwide, especially in Southeast China, and Pests in Hefei, Ministry of Agriculture, China.
due to efficient measures against other rice-infecting gtczbs@sina.com
microbes. In addition to antagonism and competition for
space and nutrients, Bacillus spp. may mediate biological Bacterial leaf blight of rice (BLB), caused by
control indirectly by inducing systemic resistance (ISR) Xanthomonas oryzae pv oryzae, is one of the most
against a number of plant diseases. Bacillus spp. has serious bacterial diseases in China [1]. Presently,
been demonstrated in tobacco, tomato, Arabidopsis spp., bismerthiazole has been the major bactericide for the
watermelon, and cucumber trigger ISR against fungal control of BLB, however, bismerthiazole–resistant
and bacterial pathogens. Biocontrol agents trigger ISR by strains of X. oryzae pv. oryzae have appeared in the field
priming the plant for the potentiated activation of various in China [2]. Zinc thiazole is a novel bactericide with
108
ICPPB2014 Abstracts
strong antibacterial activity against Xanthomonas spp [3]. bacterial wilt and canker of tomato, C.
In this study, sensitivity of 109 X. oryzae pv. oryzae michiganensisnebraskensis (Cmn) induces wilt and blight
strains to zinc thiazole was determined. The EC50 values of maize, C. michiganensis insidiosus (Cmi) causes
for zinc thiazole in inhibiting bacterial growth of the 109 wilting and stunting in alfalfa and C. michiganensis
X. oryzae pv. oryzae strains were 0.53-9.62 μg/ml with tessellarius(Cmt) causes leaf freckles and leaf spots in
the average EC50 value of 4.82 ± 1.86 μg/ml. The wheat [1]. Four subspecies of Cms, Cmm, Cmn and Cmi
minimum inhibitory concentration (MIC) values of zinc are regarded as plant quarantine pests in China, in
thiazole against the 109 X. oryzae pv. oryzae strains were consideration of the economic importance.It is reported
assessed and the results showed that the MIC values of that the main detection methods are PCR, qPCR,
zinc thiazole for completely inhibiting the growth of southern hybridization and ELISA, which have their
these 109 strains ranged from 5.0 to 40.0 μg/ml. In the disadvantages either false-positive due to the template
evaluation of protective and curative acitivity test, zinc contamination or time-consuming. Cross-priming
thiazole exhibited great activity against BLB and amplification (CPA) is an isothermal amplification
provided more than over 88% control efficacy (at 300 reaction by strand displacement DNA polymerase and
μg/ml) 1 d and 3d before or after inoculations, which was the advantages of CPA methods are high-sensitivity, less
also higher than that of bismerthiazol in the time-consuming, independent of special instrument [2]. In
corresponding treatments. Our field trials showed that our study, a set of five primers were designed based on
zinc thiazole at 300 g.a.i/ha provided over 70% control the ITs sequences five subspecies of
efficacy in 2012 and over 80% control efficacy in 2013 Clavibactermichiganensis. After isothermal
at both sites and moreover, in all the four field trials, zinc amplification under 58ć for 60min,the products were
thiazole at 250 g.a.i/ha provided higher control efficacy detected by using a lateral flow strip in an enclosed
than that of bismerthiazol at 250 g.a.i/ha. Taken together, plastic box, which can prevent the diffusion of amplicons.
zinc thiazole is therefore an appropriate tool for the In our study, the primers set could detect all the four
management of BLB. quarantine plant bacteria, but not to the other 11 negative
control bacteria mainly infect tomato, potato, maize,
Acknowledgment: This research was supported by: (i) alfalfa. Therefore, the CPA method could be used to
Special Fund for Agro-Scientific Research in the Public screen the four quarantine plant diseases specifically.
Interest from the Ministry of Agriculture, China The sensitivity of CPA assay was tested by means of a
(201303015 & 201303023), (ii) National Natural Science serial ten-fold dilution of pure culture of Cms, Cmm,
Foundation of China (31201550 & 31272073), (iii) Rice Cmn and Cmi. Our results showed that the limitations for
Industrial System of Anhui Province and (iv) Innovation Cms, Cmm, Cmn and Cmi were 1.48×104cfu/mL,
Team of Anhui Academy of Agricultural Sciences 1.32×104cfu/mL, 2.35×104cfu/mL and 4.75×103cfu/mL,
(12C1105 & 13C1113). respectively. In comparison, the CPA assay for
References: Clavibactermichiganensis was more sensitive than
[1]G. Y. Chen, L. F. Zou, X. P. Wang, Y. Xiang, J. S. common PCR methods, and was almost equivalent to
Wang (2004). Sci Agric Sin, 37, 1301. qPCR.
[2]X. F. Zhu, Y. Xu, D. Peng, Y. Zhang, T. T. Huang, J. X. Acknowledgement: The work was supported by the
Wang, M. G. Zhou (2013).Crop Protection, 2013, 47, 24. National Science and Technology Support Program
[3]F. Wei, J. Dai, G. Zhu, H. Zhu (2008). World (2012BAK11B02).
Pesticides 30, 47.
References:
S4-A4 Rapid and sensitive detection of [1]R.Eichenlaub, K.H.Gartemann, A.Burger(2006).
Clavibacter michiganensis by cross-priming Plant-Associated Bacteria,p385.
amplification method [2]G.Xu, L.Hu, H.Zhong, et al (2012). Scientific Reports,
a a b
Haiqing Mou *, Qian Tian , Xia Xu , 2:246.
a b
WenjunZhao ,XiaolanLiao
a
S4-A5 Isolation and characterization of
Institute of Plant Quarantine, Chinese Academy of antagonistic endophytic bacteria in
Inspection and Quarantine, Beijing100029, China. Arecacatechu L.
b
College of Bio-safety Science & Technology, Hunan
Agricultural University, Changsha 410128, China. Weiwei Song*, Hui Zhu, FengyuYu, XiaoqingNiu,
mouhaiqing@163.com QinghuaTang, WeiquanQin
Coconut Research Institute, Chinese Academy of
The Gram-positive bacteria Clavibacter michiganensis Tropical Agricultural Science,Wenchang, China, 571339
could infect various important agricultural plantsand songweiwei426@aliyun.com
cause significant losses in agriculture. It contains five
subspecies according to different hosts, including C. Areca catechu L. is the main economic crop in Hainan,
michiganensissepedonicus (Cms) causes ring rot of which is one of the most important southern herbal
potato, C. michiganensis michiganensis (Cmm) causes medicine resources. For founding new type of
109
ICPPB2014 Abstracts
agro-chemicals controlling plant disease, a total of 10 National Natural Science Foundation of China (NSFC
endophytic bacteria were isolated from the healthy leaves 31201555) and Jiangsu Academy of Agricultural
and flowers of areca plants with traditional cultural Innovation funds [CX (13) 5027].
methods. Of which, 9 strains were isolated from leaves,
and 1 strain was isolated from flowers. Then we screened S4-A7 Bacterial canker of kiwifruit in Shaanxi
the high efficient endophytic bacteria against province of China
arecaanthracnoseby the plate confrontation tests. The Zhibo Zhao, Xiaoning Gao, Huqiang Qin, Qiling Huang, Lili
results showed that there were 3 strains with obivious Huang*
antifungal bioactivity against areca anthracnose. College of Plant Protection, Northwest A&F University,
Furthermore, the 3 strains of endophytic bacteria were State Key laboratory of Crop Stress Biology for Arid
identified according to the characteristics of morphology, Areas, Yangling, China
physiology and biochemistry tests and 16S rDNA huanglili1@hotmail.com
sequence analysis. About 1500 bp fragments of 16S
rDNA were amplified by PCR method using the Bacterial canker of kiwifruit, caused by Pseudomonas
extracted genomic DNA as the template. According to syringaepv.actinidiae(Psa), has caused severe losses in
sequences analysis and comparison with the data of kiwifruit production worldwide [1]. This disease has been
GenBank by BLAST, they were classed to Bacillus threatening kiwifruit cultivation in Shaanxi province,
genera, the identities were from 97% to 99%. where covering over half of Chinese kiwifruit cultivation
and production, since its first outbreak in this area in
Acknowledgement: This work was supported by the 1992 [2].
Key Project of Hainan Province (ZDZX2013008-2).
Our investigation data showed 10.9-37.8% of disease
S4-A6 The secG gene required for antibiotic incidence on five main cultivars in Shaanxi during
activities of Pseudomonas sp. strain YL23 2010-2012, and a highest incidence of 37.8% on
against Erwinia amylovora and Dickeya Actinidia chinensis cv. Hongyang. The pathogen was
chrysanthemi identified as Psa which showed high similarities with the
Youzhou Liu
a, b b a a
, Sonya M. Baird , Junqing Qiao , Yan Du ,
current global-outbreak Psa population, and Psa was
Shien Lu
b* considered the dominating pathogenic microbe
a
Institute of Plant Protection, Jiangsu Academy of responsible for kiwifruit canker, based on the detection
Agricultural Sciences, Nanjing, China results by a multiplex PCR for detection of Psa, P.
b
Department of Biochemistry, Molecular Biology, syringae pv. syringae (Pss) and a less virulent P. syringae
Entomology and Plant Pathology, Mississippi State strain M209, all of which could infect kiwifruit trees.Psa
University, Mississippi State, USA, 39759 infection progress was investigated using the light,
shitouren88888@163.com fluorescent and transmission electron microscope with a
GFPuv-labeled Psa strain, which showed no difference
Strain YL23 was isolated from soybean root tips and on pathogenicity with the wild-type strain. The results
identified to be Pseudomonas sp. This strain showed showed that Psa could infect host through lenticel and
broad-spectrum antibacterial activity against bacterial wound on canes, stoma on leaves and epidermis cell on
pathogens that are economically important in agriculture. roots, subsequently colonize within parenchym, phloem
In order to characterize the genes dedicated to and occasionallyxylem vessels of canes, mesophyll and
antibacterial activitiesagainst microbial phytopathogens, vein of leaves and parenchym and vascular bundle of
a Tn5-mutation library of YL23 was constructed. Plate roots, and cause disruption of host cell and middle
bioassays revealed that the mutant YL23-93 lost its lamella in the colonization sites. Psa could move
antibacterial activities against Erwinia amylovora and systemicallyvia the leaf petiole, and showed a faster
Dickeya chrysanthemi as compared with its wild type migration at 4ºC than that at 16ºC and 25º. In addition,
strain. Genetic and sequencing analysis localized the the prevalence dynamics of the disease were investigated
transposon in a homolog of the secG gene in the mutant by three-year field investigation in Shaanxi. Diseased
YL23-93. Constitutive expression plasmid pUCP26-secG woody canes were mostly found in late winter to early
was constructed and electroporated into the mutant spring (>80%) and autumn, and diseased leaves were
YL23-93. Introduction of the plasmid pUCP26-secG mainly found in late spring to early summer and late
restored antibacterial activities of the mutant YL23-93 to autumn. The lower temperature in winter, especially
E. amylovora and D. chrysanthemi. As expected, empty lower than 0 ºC in average of a day was in favor of Psa
plasmidpUCP26 could notcomplement the phenotype of infection on woody canes. Noticeably, the wing fly is
the antibacterial activity in the mutant. Thus the secG potentially an important vector for dispersing Psa within
gene, belonging to the Sec protein translocation system, and between orchards in early spring, and kiwifruit roots
is required for antibacterial activity of strain YL23 may be in favor of Psa survival during summer based on
against E. amylovora and D. chrysanthemi. results of monitoring Psa survival on
artificial-inoculating kiwifruit seedlings from March to
Acknowledgment: This work was supported by the August.
110
ICPPB2014 Abstracts
All the results above promote our understanding of the chicory leaves. The isolates able to attenuate maceration
disease in Shaanxi province and help to improve the of tuber tissue caused by the pathogens belonging to
control strategyof the disease in a wider region. Pectobacterium genus were identified as Pseudomonas
spp. Despite their inability to inhibit tissue maceration
Acknowledgement: This research was supported by caused by Dickeya spp. strains on potato slices, they
grants 2010NKC-08 (Agricultural Science and were highly effective against Dickeya spp. when tested
Technology Innovation Program of ShaanxiProvince), on the chicory leaves. The AHL-inactivating isolate
2012KTJD03-02 and No. B07049 (the 111 Project). classified as Ochrobactrum sp. was active mostly against
References: Pectobacterium sp. strains, contrary to the Bacillus spp.
[1]H. C. McCann, E. H. A. Rikkerink, F. Bertels et al. isolates whichwere active against most of the pathogenic
(2013). PLoS Pathog ,9(7), e1003503. strains from both Dickeya and Pectobacterium spp. This
[2]Y. M. Liang, X.Y. Zhang, C.M.Tian, et al. (2000). observation is particularly interesting due to the fact that
Journal of Northwest Forestry University, 15, 37. QS mechanism does not play such an important role in
the pathogenicity of Dickeya sp. as it is known for
S4-A8 Antagonistic activity of selected bacteria from Pectobacterium genus.
rhizosphere isolates towards plant pathogenic
bacteria The obtained isolates successfully colonised potato
rhizosphere when applied to the seed tubers [3], therefore
Sylwia Jafra*, Dorota Krzyżanowska, Adam Ossowicki they may potentially serve as biocontrol agents of
Laboratory of Biological Plant Protection, pectinolytic plant pathogens.
Intercollegiate Faculty of Biotechnology, University of
Gdansk and Medical University of Gdansk, Kladki 24, Acknowledgement: Conference participation supported
80-822 Gdansk, Poland by the FP7 project MOBI4Health.
sylwia.jafra@biotech.ug.edu.pl References:
Plant pathogens are spread worldwide and cause [1]S. Jafra, J. Przysowa, R. Czajkowski, A. Michta, P.
important economic losses in crops production. To Garbeva, J. M. van der Wolf (2006). Canadian Journal of
prevent the plant disease development, the good Microbiology, 52, 1006
agronomic and horticultural practices were supplemented [2]D.M. Krzyżanowska, M. Potrykus, K. Polonis, A.
and with time replaced by the application of the chemical Gwizdek-Wiśniewska, E. Łojkowska, S. Jafra (2012).
fertilizers and pesticides. Excessive use of these Journal of Plant Pathology, 94, 36
chemicals influenced natural environment and had an [3]D.M. Krzyżanowska, M. Obuchowski, M. Bikowski,
impact on human, animal and plant health. Therefore, M. Rychłowski, S. Jafra (2012). Sensors 12, 17608
strict regulations on the use of chemical pesticides and S4-A9 Studies on Pathotype Diversity of
their replacement by safe and environmental friendly Xanthomonas oryzae pv. oryzae in South China
agents are needed for the contemporary pest management.
a,b a,b a,b
The application of natural factors (e.g. microorganisms) Liexian Zeng *, Congying Wang , Xiaoyuan Zhu , Shen
a,b a,b a,b a,b
beneficial for plants and their environment is one of the Chen , Jianyuan Yang , Jing Su , Aiqing Feng , Wenjuan
a,b
alternative strategies. Wang
a
The Plant Protection Research Institute, Guangdong
This study presents the selection of beneficial bacteria Academy of Agricultural Sciences, Guangzhou, 510640,
originating from the rhizosphere of various vegetable China
crops. The selection criterion was antagonistic activities b
Guangdong Provincial Key Laboratory of High
towards plant pathogenic bacteria: Pectobacterium Technology for Plant Protection,Guangzhou,
atrosepticum, P. carotovorum subsp. carotovorum and 510640,China
Dickeya spp. [1, 2] zengliexian@tom.com
Out of more than a thousand isolates, the most effective Isolates of Xanthomonasoryzae pv. oryzae (Xoo)
were chosen on the basis of their ability to inhibit growth collected from different rice-cropping regions in South
of the tested pathogens in a plate assay, the production of China have been tested for pathotype diversity. Two sets
strong iron chelators and biosurfactants, and/or of Xoo race-rice cultivar identification system, including
inactivation of acyl-homoserine lactone (AHL) signal one set of Chinese system and one set of international
molecules important for quorum sensing (QS) system, were evaluated respectively in this study. The
mechanisms involved in production of pectinolytic Chinese system includs 5 differentiating cultivars: IR26,
enzymes by tested pathogens. The isolates were Java14, Nangeng15, Tetep and Jingang30. The
taxonomically classified to Bacillus, Pseudomonas and international system includs a series of near isogenic
Ochrobactrum genera. The ability of these isolates to lines carrying different resistant genes: IRBB5, IRBB13,
inhibit maceration of potato tubers tissue caused by IRBB3, IRBB14, IRBB2 and IR24. The leaf-clipping
Dickeya spp. and/or Pectobacterium spp. was tested in a method was performed for bacterial blight inoculation at
tuber slices assay and in case of Dickeya spp. also on the rice booting stage. Accoding to their disease reaction
111
ICPPB2014 Abstracts
models, the tested isolates were divided into 6 pathotypes analyses were performed to uncover the effect of
by the Chinese identification system, including ĉ, Ċ, application of B. subtilis PTS-394 on rhizo-microbiota
ċ, Č, čand đ. Meanwhile, the tested isolates were community at 14 days interval. Our analysis revealed
divided into 7 races by the international differentiating that PTS-394 exerted only a transient impact on the
rice cultivars, including R1, R2, R3, R4, R5, R8 and R10. microbiota community of tomato rhizosphere. The
The pathotype č and Č, or race R8 and R5 of the Xoo duration of effect of PTS-394on eukaryota was the
populations are prevailing forms in South China. The longest among three communities, both bacterial and
virulence of the pathogens exhibited quantitivly weak to fungi communities were almost similar and up to 3 days.
strong in the following order: pathotypeĉ, Ċ, ċ, Č. Moreover, a clear temporal shift in bacterial, eukaryota
Strong and reciprocal reactions were observed in the and fungi community over a time period of from 1 to 14
pathotype Č and č with their differentiating rice days after transplanted was observed. These results
cultivars. The pathotype đ was virulent to all the inferred that B. subtilis PTS-394 is not aggressive to the
differentiating rice cultivars. Compared with historical microbiota community of tomato rhizosphere and is good
research data, the strong virulent pathotype č increased candidate for development of commercial product in
rapidly, and became dominant population in South China. future. Finally, we suggested that the niche ecological
It is important to note that the new pathotype đ, a more adaptation and ecological safety of PGPR should be
virulent population, also develop rapidly. The strong investigated before the development of commercial
virulent pathotype č and đ were both first identified in product for sustainable agriculture.
South China, and then spread around. The Xoo
population from South China exhibited a faster variation Acknowledgment: This work was supported by the
rate, more abundant diversity, and stronger virulent. National Natural Science Foundation of China (NSFC
31201556), Natural Science Foundation of Jiangsu
Acknowledgement: Special Fund for Agro-scientific Province (BK2012373) and Jiangsu Academy of
Research in the Public Interestδ201303015ε,Special Agricultural Innovation funds [CX (13) 5028].
project of modern agricultural technology system
construction (Yuecaijiao[2009] No. 356, ARS-01-24),and
Program of Guangdong Provincial Science and
Technology (2011B020301005).
S4-A10 Effects of Bacillus subtilis PTS-394 on
tomato growth and root colonization and its
impact on the rhizosphere microbiota
community
a* b a a
Junqing Qiao , Yanfei Xia , Youzhou Liu , Xuejie Liang , Yan
a
Du
a
Institute of Plant Protection, Jiangsu Academy of
Agricultural Sciences, Nanjing 210014, jiangsu province,
China;
b
Forestry College, Henan University of Science and
Technology, Luoyang 471003, Henan Province, China
junqingqiao@hotmail.com
Plant growth promotion, suppression of plant disease and
excellent rhizosphere competence (root colonization and
survival) of plant growth promoting rhizobacteria (PGPR)
had been considered as critical requisites for a
development of potential commercial product. In the
present study, we investigated the tomato growth
promotion, root colonization and influence of
rhizosphere microbiota community exerted by Bacillus
subtilis PTS-394 which was isolated from rhizosphere of
tomato and owned an excellent biocontrol activity on
soil-born pathogens. The results showed that PTS-394
was an excellent colonizer and can promote the tomato
growth significantly. The greenhouse experiments
indicated that not only B.subtilis PTS-394 was
contributed to growth promotion individually but also the
complex functional rhizosphere microbiome
communities together. Roche 454 Pyrosequencing
112
Abstract Index
Participant Abstract Participant Abstract

Adam Ossowicki S3-P3, S4-A8 Fangfang Wang S2-P2
Amandine Cunty S4-O8, S3-P10 Fen Lu S3-A5, S3-P8
Andres Mäe S1-P3 Fengquan Liu S4-P12
Andrew Pitman S1-O4, S3-O14 Frank Jörg Vorhölter S1-O7, S1-P12
Anna Mackowiak-
S4-P8 Frédérique Van Gijsegem S2-O5
Sochacka
Arnaud Indiana S2-O4, S2-O7 Gabrielle Carstensen S1-O6, S4-P13
Baishi Hu S1-P1, S2-A12 Gilles Cellier S4-O4
S1-P1, S1-P5, S1-P11, S2-A8,
Bandulla Kelaniyangoda S2-P20 Gongyou Chen
S2-A9, S2-P1, S2-P4, S3-A2, S3-O6
Bart Cottyn S3-O7 Guanghai Ji S1-A3, S3-O6
Bin Li S1-O3, S2-O2, S3-P7 Guanlin Xie S1-O3, S2-O2
Bing Yang CS2, S4-K1 Guofen Wang S1-P7
Binghai Lou S2-P18, S4-P9 Guoxun Wang S3-K2
Bo Liu S2-A10 Haiqing Mou S1-A2, S4-A4
Bole Jiang S1-K4, S2-A2, S2-O10 Hengan Lin S3-P4
Boris Vinatzer S1-K1, S1-K2, Hongli Luo S3-P6
Caitilyn Allen S1-O1, S2-K4 Haiyun Li S2-P10
Carolee T. Bull S4-K3 Hossein Ali Narouei Khandan S4-O9
Casiana M. Vera Cruz S1-O8, S3-O13 Hua Lu S3-O12
Chang Sik Oh S1-P4 Huasong Zou S2-P1
Chaoying Chen S3-P13 Ian Toth S1-K3, S2-P22
Chaozu He S3-P6 Irda Safni S4-O14
Chatterjee Subhadeep S2-O9 Iris Yedidia S2-O14
Chenyang He S2-A1, S2-P6, S2-P10 Isaac Barash S2-P9, S3-O11
Chih Hung Lin S4-P1 Jacob Dirk Janse CS1
Chinghong Yang S2-A1, S2-K3, S2-P6 James Alfano S2-K2
Chungyun Bae S1-P4 James T. Tambong S1-O12, S4-O3
Chunwei Wang S3-P11 Jan Leach S3-O1, S3-O4
Cindy E. Morris S4-K2 Jean Martin van der Wolf S1-O10
Congfeng Song S2-P3 Jeong Gu Kim S2-P23
Congying Wang S4-A9 Jianmin Zhou S3-K2
David S. Guttman S3-K1 Jianqiang Li S1-P1, S4-P2, S4-P7, S4-P11
Dehong Zheng S2-P8 Jiayuan Wang S2-P11
Dousheng Wu S2-P14 Jichun Wang S3-P11
Duck Hwan Park S1-P4 Jiliang Tang S1-A1, S1-K4
Eisse G. de Haan S1-O10 Jing Guo S2-P1
Emmanuel Wicker S4-O1 Jingsheng Xu S3-A7
Eshetu Derso Kidanu S1-P9 Joanna Pulawska S3-P5, S4-P4
S2-O3, S2-P19,
Ewa Lojkowska Joël Vanneste S3-P10, S4-O8
S4-O7
113
Johan Van Vaerenbergh S4-O10 Na Jiang S4-P7, S4-P11
Max Dow S2-O6 Natalia Kaczyńska S2-P19

José Belasque S4-O15 Nian Wang S4-K1
Junqing Qiao S4-A6, S4-A10 Nicola Sante Iacobellis S4-O2
Kaijun Zhao S3-O3 Noam Eckshtain Levi S3-P2
Kenneth Mburu S3-O5, S3-P12 Pavel Beran S2-A4
S1-P1, S4-P2, S4-P7,
Laixin Luo Philippe Prior S1-O1, S2-K4, S4-O4
S4-P11
Laura Chalupowicz S2-P9, S3-O11, S4-A1 Pu Liu S3-P1

Leah Tsror S4-A1 Qian Tian S4-A4, S4-P12
Leena Tripathi S3-O5, S3-P12 Qianli An S1-P8

Leitao Tan S3-P6 Qinghua Tang S1-P10, S4-A5
Lê Mai Nhất S2-A11 Qingquan Luo S2-P5
Lena Hersemann S1-P12 Ramesh Venkata Sonti S2-K1

Li Wang S2-P2 Ricardo Oliva S1-O8, S3-O13
Lian Zhou S2-P11, S2-P24 Robert Czajkowski S2-P19, S4-O12
Liang Liu S3-A2, S3-O6, Robert Jackson S4-O7

Lichao Yang S2-A2 Robert Ryan S2-O6, S2-O8, S3-A1
LieXian Zeng S4-A9 Roberto Buonaurio S1-P2

Lifang Ruan S2-P8 Rongsheng Zhang S4-A2
S1-P1, S1-P5, S1-P11,
Lifang Zou Sandra Visnovsky S1-O4
S2-A9, S2-P4, S3-A2, S3-O6
Lijuan Liu S3-A4, S3-P8, Saul Burdman S2-O1, S2-P9, S3-P2

Lin Wang S2-A2, S2-O10 Seiji Tsuge S2-P7
Linda Garlant S1-O13 Shan Ho Chou S3-A1

Lindsay Triplett S3-O1, S3-O4 Shanzhi Wang S3-A5, S3-P8
Liping Liu S3-O8 Shengyang He S3-K3
Liqun Zhang S2-P17 Shiqi An S2-O6, S2-O8
Lucy Moleleki S2-P21, S3-O9 Shuai Li S3-A4

Lulu Cai S2-A8, S2-P4, S3-A2, S3-O6 Shulamit Manulis Sasson S2-P9, S3-O11, S4-A1
Magdalen Lindeberg S1-K2 Siphathele Sibanda S2-P21

María Julia Pianzzola S4-O13 Stephanus Venter S1-O6, S1-P6, S4-P13
S2-O4, S2-O7, S4-O8,

Marie Agnès Jacques Steven Lindow CS3
S4-O11
Matthew Templeton S1-O2 Yujing Sun S1-P5, S2-A8, S3-A2
Meihao Sun S2-A5, S2-A9 Surantha Salgadoe S2-P20
Mengying Deng S3-A6 Susu Fan S2-P6

Mengyu Ge S1-O3, S2-O2 Sylwia Jafra S3-P3, S4-A8
Merete Wiken Dees S4-P10 Tania Weller Stuart S2-P22

S1-O6 , S1-P6 , S2-P21,
Ming Li S2-P11 Teresa Coutinho
S2-P22, S3-O9, S4-P13
Mingyue Chen S1-P8 Tiina Alamäe S1-P3
Monika Kaluzna S4-P4 Tingchang Zhao S1-P1
Muhammad Zakria S1-P11, S3-O6 Tongchun Gao S4-A3
114
Triwidodo Arwiyanto S4-O5 Yasufumi Hikichi S2-O12, S2-P13, S2-P14
Tsutomu Kawasaki S3-K4 Yawen He S2-P11, S2-P24
Valérie Olivier S4-O11 Ye Tao S3-O10
Vicky Toussaint S4-P6 Ying Xu S2-P5
Vivian Angelica Bernal
S1-O11 Yinhua Chen S1-P7, S3-P6
Galeano
Wei Guo S2-A5, S2-A9 Yolanda Petersen S1-O5
Wei Qian S2-O11, S2-P2 Yong Zhang S2-O12, S2-P14
Weihong Zhang S3-P9 Yonghoon Lee S2-16
Weiwei Song S1-P10, S4-A5 Yongjun Lu S3-A6
Wendi Jiang S2-A7 Youfu Zhao S2-A13
Wenjun Zhao S1-A2, S4-A4, S4-P12 Youzhou Liu S4-A6, S4-A10
Wenxian Sun S2-A7, S3-A4, S3-A5, S3-P8 Yu Chen S4-A3
Wenxiang Yang S3-P9 Yuan-chan Luo S4-P3, S4-P5
S1-P5, S2-A8, S2-P4,
Wenxiu Ma Yuanguang Li S4-P3, S4-P5
S3-A2
Xian Wu S3-P11 Yujing Zhu S2-A10
Xiang Li S4-O3 Yuka Mori S2-P13
Xiangna Niu S1-A1 Yuki Ichinose S2-O13
Xiao Liu S1-O9 Yumi Ikawa S2-P7
Xiaobo Xue S2-A8, S2-P4 Yunhao Sun S3-A6
Xiaojing Fan S2-A3, S2-P1 Zhaolin Ji S3-A3
Xiaoman She S2-P12 Zhe Dai S2-A6
Xingyu Wang S2-P11 Zhibo Zhao S4-A7
Xinhua Ding S3-O2 Zhiyang Liu S2-P4
Xuewen Gao S2-P15 Zhiyuan Ji S1-P11, S2-P4, S3-O6
Yang Hu S4-K1 Zhouqi Cui S1-O3, S3-P7
Yanhua YU S1-A1 Zifu He S2-P12
Yanping Wang S3-A4 Ziniu Deng S3-O8
Yaqin Song S2-P18, S4-P9
115
Participants in ICPPB2014, Shanghai, China
Adam Ossowicki Bin Li Changmin Hui

Uniwersytet Gdański Zhejiang university Research Institute of Vegetables and Flowers Science
Rumia, Poland Hangzhou, China Changchun, China
adam.ossowicki@ug.edu.pl libin0571@zju.edu.cn huichm65@163.com
Alan Poplawsky Bin Yuan Chaoying Chen
University of Idaho Hubei Academy of Agricultural Science National Taiwan University
Moscow, USA Wuhan, China Taipei, Taiwan
alpop@uidaho.edu yuanbin2000@139.com cychen@ntu.edu.tw
Amandine Cunty Bing Yang Chaozu He
Anses - INRA Iowa State University Hainan University
Angers, France Ames, USA Haikou, China
amandine.cunty@angers.inra.fr byang@iastate.edu czhe@hainu.edu.cn
Andres Mäe Binghai Lou Chatterjee Subhadeep
University of Tartu Guangxi Citrus Research Institute Centre for DNA Fingerprinting and Diagnostics
Tartu, Estonia Guilin, China Hyderabad, India
amae@ebc.ee Binghai.Lou@hotmail.com subhadeep@cdfd.org.in
Andrew Pitman Bo Liu Chenyang He
Bio-Protection Research Centre Institute of Plant Protection, CAAS CAAS
New Zealand Beijing, China Beijing, China
andrew.pitman@lincoln.ac.nz fzliubo@163.com hechenyang@caas.cn
Anna Mackowiak- Sochacka Bole Jiang Chih Hung Lin
Institute of Plant Protection Guangxi University AVRDC - The World Vegetable Center
Poznan, Poland Nanning, China Tainan, Taiwan
anna.sochacka@vp.pl jbl1971@gxu.edu.cn chih-hung.lin@worldveg.org
Arnaud Indiana Boris Vinatzer Chinghong Yang
INRA, UMR1345 IRHS Virginia Tech University of Wisconsin
Beaucouzé, France Blacksburg, USA Milwaukee, USA
arnaud.indiana@gmail.com vinatzer@me.com chyang@uwm.edu
Baishi Hu Caitilyn Allen Chungyun Bae
Nanjing Agricultural University University of Wisconsin-Madison Kyung Hee University
Nanjing, Chnia Madison, USA Gyeonggi-do, Republic of Korea
hbs@njau.edu.cn cza@plantpath.wisc.edu castalys@hanmail.net
Bandulla Kelaniyangoda Carolee T. Bull Chunhao Jiang
Wayamba University of Sri Lanka USDA/ARS Nanjing Agricultural University
Makandura, Sri Lanka Salinas, USA Nanjing, Chnia
kelaniyangoda@gmail.com Carolee.Bull@ars.usda.gov jchunhao@163.com
Baohui Lu Casiana M. Vera Cruz Chunwei Wang
Jilin Agricultural University IRRI Jilin Agricultural University
Changchun, China Los Banos, Philippines Changchun, China
lbh860110@126.com C.VeraCruz@irri.org chunwei314319@163.com
Bart Cottyn Chang Sik Oh Cindy E. Morris
ILVO Kyung Hee University INRA
Merelbeke, Belgium Yongin, South Africa Montfavet, France
bart.cottyn@ilvo.vlaanderen.be co35@khu.ac.kr cindy.morris@avignon.inra.fr
116
Congfeng Song Fen Lu Guisheng Du
Nanjing Agricultural University China Agricultural University Beijing Multigrass Formulation Co., Ltd.
Nanjing, Chnia Beijing, China Beijing, China
cfsong@njau.edu.cn 15210904930@126.com 1766060975@QQ.com
Congying Wang Fengquan Liu Guofen Wang
Guangdong Academy of Agricultural Chinese Academy of Tropical Agricultural
Nanjing Agricultural University
Sciences Science
Guangzhou ,China Nanjing, Chnia Haikou, China
congyingwang@gmail.com fqliu20011@sina.com guofenwang7810@163.com
David S. Guttman Frank Jörg Vorhölter Guoliang Qian
University of Toronto Bielefeld University Nanjing Agricultural University
Toronto, Canada Bielefeld, Germany Nanjing, Chnia
david.guttman@utoronto.ca frank@cebitec.uni-bielefeld.de glqian@njau.edu.cn
Dehong Zheng Frédérique Van Gijsegem Guoxun Wang
Huazhong Agricultural University IEES IGDB
Wuhan, China France Beijing, China
dehong1573@126.com vangijse@agroparistech.fr wangguoxun2003@gmail.com
Dousheng Wu Gabrielle Carstensen Haiqing Mou
Chinese Academy of Inspection and
Southwest University University of Pretoria
Quarantine
Beibei, China Pretoria, South Africa Beijing, China
swudousheng@163.com gabrielle.carstensen@fabi.up.ac.za mouhaiqing@163.com
Duck Hwan Park Gilles Cellier Haiyang Zhang
Kangwon National University Anses Science Press
Chuncheon, Republic of Korea Saint-Pierre, Reunion Beijing, China
dhp@kangwona.ac.kr gilles.cellier@anses.fr 1833971680@qq.com
Eisse G. de Haan Gongyou Chen Haiyun Li
NAK Shanghai Jiao Tong University Institute of Plant Protection, CAAS
Emmeloord, Netherlands Shanghai, China Beijing, China
ehaan@nak.nl gyouchen@sjtu.edu.cn yousliyun@163.com
Emmanuel Wicker Guanghai Ji Hancheng Wang
Guizhou Tobacco Science Research
CIRAD Key lab for phytopathoogy
Institute
Saint Pierre, Reunion Kunming, China Guiyang, China
wicker@cirad.fr jghai001@aliyun.com xiaobaiyang126@hotmail.com
Eshetu Derso Kidanu Guangying Zhang Hansong Dong
EIAR Guangxi University Nanjing Agricultural University
Bole Sub-city, Ethiopia Nanjing, China Nanjing, Chnia
eshetudrs4@gmail.com marge.zhang@163.com hsdong@njau.edu.cn
Ewa Lojkowska Guanlin Xie Hao Zhang
University of Gdansk Zhejiang University Institute of Plant Protection, CAAS
Gdańsk, Poland Hangzhou, China Beijing, China
ewa.lojkowska@biotech.ug.edu.pl glxie@zju.edu.cn hzhang@ippcaas.cn
Fangfang Wang Guichun Wu Hao Zhou
Institute of Microbiology, CAS Nanjing Agricultural University Guangxi University
Beijing, China Nanjing, Chnia Nanning, China
wangff@im.ac.cn 2013202010@njau.edu.cn htmyth@126.com
117
Hengan Lin Irda Safni Jianqiang Li
National Taiwan University University of North Sumatra China Agricultural University
Taipei, Taiwan Medan, Indonesia Beijing, China
r02633002@ntu.edu.tw irda.safni@uqconnect.edu.au lijq231@cau.edu.cn
Higor de Castro Monteiro Iris Yedidia Jiaqin Fan
Univerdidade Federal dos Vales do
Agricultural research Organization Nanjing Agricultural University
Jequitinhonha e Mucuri
Presidente Juscelino, Brazil Bet Dagan, Israel Nanjing, China
higordecastro@yahoo.com.br irisy@volcani.agri.gov.il fanjq@njau.edu.cn
Hongjing Li Isaac Barash Jiayuan Wang
China National Seed Group Co.,Ltd. Tel-Aviv University Shanghai Jiao Tong University
Wuhan, China Tel-Aviv, Israel Shanghai, China
lihongjing@sinochem.com isaaci@post.tau.ac.il jywang1237@163.com
Hongli Luo Jacob Dirk Janse Jichun Wang
Hainan University Dutch General Inspection Service Jilin Academy of Agricultural Sciences
Haikou, China Ede, Netherlands Changchun, China
lhl_w@163.com jjanse@nak.nl wangjichun@cjaas.com
Hongwei Zhao James Alfano Jie Feng
Nanjing Agricultural University University of Nebraska Institute of Plant Protection, CAAS
Nanjing, China Lincoln, USA Beijing, China
hzhao@njau.edu.cn jalfano2@unl.edu jfeng@ippcaas.cn
Hongxia Liu James T. Tambong Jie Gao
Nanjing Agricultural University Agriculture and Agri-Food Canada Jilin Agricultural University
Nanjing, China St-Jean-sur-Richelieu, Canada Changchun, China
hxliu@njau.edu.cn tambongj@agr.gc.ca jiegao115@126.com
Hossein Ali Narouei Khandan Jan Leach Jie Zhang
Christchurch Colorado State University Institute of Microbiology, CAS
Canterbury, New Zealand Fort Collins, USA Beijing, China
hakhandan@gmail.com Jan.Leach@colostate.edu zhangjie@im.ac.cn
Hua Lu Jean Martin van der Wolf Jiliang Tang
University of Maryland Baltimore County Plant Research International Guangxi Universiry
Baltimore, USA Wageningen, Netherlands Nanning, China
hualu@umbc.edu Jan.vanderWolf@wur.nl jltang@gxu.edu.cn
Huan Wang Jeong Gu Kim Jin Xu
Nanjing Agricultural University National Academy of Agricultural Science Fujian Academy of Agricultural Sciences
Nanjing, China Suwon, Republic of Korea Fuzhou, China
2013202022@njau.edu.cn jkim5aug@korea.kr jinxu@ippcaas.cn
Huasong Zou Jia Liu Jing Guo
Yun Yang Optoelectronics (Shenzhen) Co.,
Fujian Aguriculture and Forestry University Shanghai Jiao Tong University
Ltd. - Wuxi Branch
Fuzhou, China Wuxi, China Shanghai, China
huasongzou@gmail.com service@labguide.com.cn gjyeah2012@gmail.com
Huilin Zheng Jianhua Guo Jingsheng Xu
Shanghai Majorbio Bio-pharm Technology
Nanjing Agricultural University Institute of Plant Protection, CAAS
Co.,Ltd.
Shanghai, China Nanjing, China Beijing, China
huilin.zheng@majorbio.com jhguo@njau.edu.cn jingshengxu@126.com
Ian Toth Jianmin Zhou Jingxin Zhang
Institute of Genetics and Developmental Guangdong Academy of Agricultural
James Hutton Institute
Biology Sciences
Dundee, United Kingdom Beijing, China Guangzhou, China
ian.toth@hutton.ac.uk jmzhou@genetics.ac.cn chougu@126.com
118
Jinlong Wang Kyu Seok Han Lifang Ruan
Institute of Genetics and Developmental
Kangwon National University Huazhong Agricultural University
Biology, CAS
Beijing, China Chuncheon, Republic of Korea Wuhan, China
jinlongwang@genetics.ac.cn kyusuk321@nate.com ruanlifang@mail.hzau.edu.cn
Jiqin Li Laixin Luo Lifang Zou
Shanghai OE Biotech Co.,Ltd. China Agricultural University Shanghai Jiao Tong University
Shanghai, China Beijing, China Shanghai, China
jiqin.li@oebiotech.com luolaixin@cau.edu.cn zoulifang202018@gmail.com
Jitender Singh Laura Chalupowicz Lihua Geng
Sardar Vallabhbhai Patel University of A&T Volcani Center Beijing Vegetable Research Center
Meerut, India Bet Dagan, Israel Haidian, China
jeets80@gmail.com laura@volcani.agri.gov.il genglihua@nercv.org
Joanna Pulawska Leah Tsror Lijuan Liu
Research Institute of Horticulture Agricultural Research Organization China Agricultural University
Skierniewice, Poland Gilat, Negev, Israel Beijing, China
joanna.pulawska@inhort.pl tsror@agri.gov.il melody_alpha@163.com
Joël Vanneste Leena Tripathi Lin Wang
Plant & Food Research Ltd International Institute of Tropical Agriculture Guangxi University
Hamilton, New Zealand Nairobi, Kenya Nanning, China
Joel.Vanneste@plantandfood.co.nz L.Tripathi@cgiar.org 49345671@qq.com
Johan Van Vaerenbergh Leitao Tan Linda Garlant
ILVO Hainan University University of Helsinki
Merelbeke, Belgium Haikou, China Helsinki, Finland
johan.vanvaerenbergh@ilvo.vlaanderen.be 791309992@qq.com linda.garlant@helsinki.fi
José Belasque Lena Hersemann Lindsay Triplett
University of São Paulo Agroscope ISS Colorado State University
Piracicaba, Brazil Zurich, Switzerland Fort Collins, USA
belasque@usp.br lena.hersemann@agroscope.admin.ch lindsay.triplett@colostate.edu
Juan Zhang Li Wang Long Zhang
Journal of Integrative Agriculture Institute of Microbiology, CAS Zhejiang Longwan Chemicals Co., Ltd
Beijing, China Beijing, China Wenzhou, China
zhangjuan@caas.cn jennywangli@im.ac.cn longwanchem@foxmail.com
Juling Hua Lian Zhou Liping Liu
Jiangxi Academy of Agricultural Science Shanghai Jiao Tong University Jilin Agricultural University
Nanchang, China Shanghai, China Changchun, China
huajl2000@126.com lianzhou@sjtu.edu.cn zhou_237@163.com
Junqing Qiao Liang Liu Liping Liu
Jiangsu Academy of Agricultural Sciences Shanghai Jiao Tong University National Center for citrus improvement
Nanjing, China Shanghai, China Changsha, China
junqingqiao@hotmail.com liuliangsjtu@gmail.com llp31302@163.com
Kaijun Zhao Lichao Yang Liqun Zhang
Institute of Crop Science, CAAS Guangxi University China Agricultural University
Beijing, China Nanning, China Beijing, China
zhaokaijun@caas.cn 554109876@qq.com zhanglq@cau.edu.cn
Kenneth Mburu LieXian Zeng Liuke Yang
Guangdong Academy of Agricultural
Kenyatta university Nanjing Agricultural University
Sciences
Nairobi, Kenya Guangzhou, China Nanjing, China
kenmburu@gmail.com zengliexian@tom.com 2012102011@njau.edu.cn
119
Liuti Cai Meihao Sun Nian Wang
Zhejiang Normal university University of Florida
Institute
Guiyang, China Jinhua, China Lake Alfred, USA
Cailiuti01@163.com mhsun@zjnu.cn nianwang@ufl.edu
Lucy Moleleki Meili Feng Nicola Sante Iacobellis
University of Pretoria Jiangsu Flag Chemical Industry Co., Ltd. Università della Basilicata
Pretoria, South Africa Jiangsu, China Potenza, Italy
lucy.moleleki@up.ac.za fengmeili@flagchem.com nicola.iacobellis@unibas.it
Lulu Cai Mengying Deng Noam Eckshtain Levi
School of life sciences, Sun Yat-sen
Shanghai Jiao Tong University The Hebrew University of Jerusalem
University
Shanghai, China Guangzhou, Chnia Rehovot, Israel
cailulusjtu@gmail.com 247325266@qq.com noam.levi2@mail.huji.ac.il
Luyao Wang Mengyu Ge Nzubechukwu Eugene Ogazi
Scientific and Agricultural Research
Nanjing Agricultural University Zhejiang University
institute
Nanjing, Chnia Hangzhou, China Otta, Nigeria
wangluyaoggg@hotmail.com cythiage@163.com melcurt2013@gmail.com
Magdalen Lindeberg Merete Wiken Dees Olivier Pruvost
Cornell University Bioforsk CIRAD
Ithaca, USA Aas, Norway Saint Pierre, France
ml16@cornell.edu plhmwd@bioforsk.no olivier.pruvost@cirad.fr
Maosheng Wang Ming Li Olufunke Omotayo Oremuyiwa
Shanghai Jiao Tong University Patmelina Research institute
Institute
Guiyang, China Shanghai, China Otta, Nigeria
wangmaosheng9801@163.com mingli.sdnu@gmail.com joymelina2000@gmail.com
María Julia Pianzzola Mingyue Chen Patience Akhidenor
Institute of Biotechnology, Zhejiang
Facultad de Química Patmelina Research institute ltd
University
Montevideo, Uruguay Hangzhou, China Otta, Nigeria
mpianzzo@gmail.com chenmy2007525@163.com Kellynewton02@gmail.com
Marie Agnes Jacques Monika Kaluzna Pavel Beran
IRHS - INRA Research Institute of Horticulture University of South Bohemia
Beaucouzé, France Skierniewice, Poland Ceske Budejovice, Czech Republic
marie-agnes.jacques@angers.inra.fr monika.kaluzna@inhort.pl pavel.beran@centrum.cz
Matthew Templeton Muhammad Zakria Pejman Khodaygan
Plant and Food Research Shanghai Jiao Tong University Vali-e-asr University of Rafsanjan
Auckland, New Zealand Shanghai, China Rafsanjan, Iran
matt.templeton@plantandfood.co.nz rmzakria@gmail.com pezhman_khodaygan@yahoo.com
Max Dow Na Jiang Pengfei Zhang
University College Cork China Agricultural University Nanjing Agricultural University
Ireland Beijing, China Nanjing, Chnia
m.dow@ucc.ie jn2009@139.com 2012102012@njau.edu.cn
Mei yue Natalia Kaczyńska Philippe Prior
Journal of Integrative Agriculture University of Gdańsk Inra-Cirad
Beijing, China Gdańsk, Poland Saint-Pierre, Reunion
yuemei@caas.cn natalia.kaczynska@biotech.ug.edu.pl philippe.prior@cirad.fr
120
Ping Li Robert Czajkowski Shengyang He
Shanghai University University of Gdansk Michigan State University
Shanghai, China Gdańsk, Poland Okemos, USA
lp9835@staff.shu.edu.cn robert.czajkowski@biotech.ug.edu.pl hes@msu.edu
Popoola Olajumoke Robert Jackson Shicheng Xu
Melcurt Nig ltd.scientific & agricultural
University of Reading East west seed
research institute
Otta, Nigeria Reading, United Kingdom Nanning, China
classroyallimited@yahoo.com r.w.jackson@reading.ac.uk siyuan4671@gmail.com
Pu Liu Robert Ryan Shiqi An
School of Horticulture University of Dundee University of Dundee
Hefei, China Dundee, United Kingdom Dundee, United Kingdom
puliu@ahau.edu.cn rpryan@dundee.ac.uk s.an@dundee.ac.uk
Qi Wang Roberto Buonaurio Shuai Li
Dipartimento di Scienze Agrarie, Alimentari
China Agriculture University China Agricultural University
e Ambientali
Beijing, China Perugia, Italy Beijing, China
icppb000@163.com roberto.buonaurio@unipg.it aries_li@qq.com
Qian Tian Rongsheng Zhang Shulamit Manulis Sasson
Jiangsu Academy of Agricultural sciences ARO, Volcani Center
Quarantine
Beijing, China Nanjing, Chnia Rishon Le-Zion, Israel
tianqiancc@163.com r_szhang@163.com shulam@volcani.agri.gov.il
Qianli An Runjin Liu Shuming Wan
Institute of Biotechnology, Zhejiang Heilongjiang Academy of Agricultural
Qingdao Agricultural University
University Sciences
Hangzhou, China Qingdao, China Harbin, China
an@zju.edu.cn liurjsswwl@126.com wanshuming_22@163.com
Qinghua Tang Sandra Visnovsky Shunhua Song
The New Zealand Institute for Plant & Food
Coconut Research Institute, CATAS Beijing Vegetable Research Center
Research Ltd
Wenchang, China Christchurch, New Zealand Haidian, China
tchuna129@163.com sandra.visnovsky@plantandfood.co.nz songshunhua@nercv.org
Qingquan Luo Saul Burdman Siphathele Sibanda
Shanghai landsape gardening research
The Hebrew University of Jerusalem University of Pretoria
institute
Shanghai, China Rehovot, Israel Pretoria, South Africa
dickluo999@126.com saul.burdman@mail.huji.ac.il Phathie.Sibanda@fabi.up.ac.za
Qiuping Liu Seiji Tsuge Stephanus Venter
southwest University Kyoto Prefectural University University of Pretoria
Beibei, China Kyoto, Japan Pretoria, South Africa
liu.qiuping@gmail.com s_tsuge@kpu.ac.jp fanus.venter@up.ac.za
Ramesh Venkata Sonti Shan Ho Chou Steven Lindow
Centre for Cellular and Molecular Biology National Chung Hsing University University of California
Hyderabad, India Taichung, Taiwan Berkeley, USA
sonti@ccmb.res.in shchou@nchu.edu.tw icelab@berkeley.edu
Ricardo Oliva Shanzhi Wang Surantha Salgadoe
IRRI China Agricultrue University Wayamba University of Sri Lanka
Los Banos, Philippines Beijing, China Makandura, Sri Lanka
r.oliva@irri.org 0801080926@cau.edu.cn surantha_a@yahoo.com
121
Susu Fan Vivian Angelica Bernal Galeano Wenxiang Yang
Institute of Plant Protection, CAAS Universidad DE Los Andes Agricultural University of Hebei
Beijing, China BOGOTÁ D.C., Colombia Baoding, China
1986fansusu@163.com va.bernal35@uniandes.edu.co wenxiangyang2003@163.com
Sylwia Jafra Viviana Viviana Rivera Wenxiu Ma
Intercollegiate Faculty of Biotechnology UG
North Dakota State University Shanghai Jiao Tong University
& GUMed
Gdańsk, Poland Fargo, USA Shanghai, China
sylwia.jafra@biotech.ug.edu.pl viviana.rivera@ndsu.edu mwxxz@163.com
Tania Weller Stuart Wei Ding Xia Yan
College of Plant Protection, Southwest
Fabi Hainan University
University
Pretoria, South Africa Beibei, China Haikou, China
tania.weller@fabi.up.ac.za dwing818@163.com 2379749396@qq.com
Teresa Coutinho Wei Guo Xian Wu
University of Pretoria Zhejiang normal university Jilin Academy of Agricultural Sciences
Pretoria, South Africa Jinhua, China Changchun, China
teresa.coutinho@up.ac.za weiguo817@gmail.com fangshoushi@163.com
Tielin Wang Wei Qian Xiang Li
Institute of plant protection, CAAS Institute of Microbiology, CAS Canadian Food Inspection Agency
Beijing, China Beijing, China Charlottetown, Canada
wtl82@163.com qianw@im.ac.cn sean.li@inspection.gc.ca
Tiina Alamäe Wei Tian Xiangna Niu
University of Tartu Nanjing Agricultural University Guangxi University
Tartu, Estonia Nanjing, Chnia Nanning, China
talamae@ebc.ee 2012102035@njau.edu.cn huashu_8545@qq.com
Tingchang Zhao Wei Yang Xiao Liu
Institute of Plant Protection, CAAS Huaiyin Normal college BIO-TECH
Beijing, China Huai'an, China Shanghai, China
zhaotgcg@163.com yangw107@gmail.com slb@boyuanbio.com
Tongchun Gao Weihong Zhang Xiaobo Xue
Anhui Academy of Agricultural Sciences Agricultural University of Hebei Shanghai Jiao Tong University
Hefei, China Baoding, China Shanghai, China
gtczbs@sina.com Zhwh80@163.com xb03100228@sjtu.edu.cn
Triwidodo Arwiyanto Weiwei Song Xiaojing Fan
Universitas Gadjah Mada Coconut Research Institute, CATAS Fujian Aguriculture and Forestry University
Yogyakarta, Indonesia Wenchang, China Fuzhou, China
tarwiyanto@yahoo.com songweiwei426@aliyun.com fanxiaojing01@126.com
Tsutomu Kawasaki Wendi Jiang Xiaoman She
Guangdong Academy of Agricultural
Kinki University China Agricultural University
Sciences
Nara, Japan Beijing, China Guangzhou, Chnia
t-kawasaki@nara.kindai.ac.jp jiayoujiang@126.com lizer126@126.com
Valérie Olivier Wenjun Zhao Xingping Xiong
Anses - Plant Health Laboratory Zhejiang Longwan Chemicals Co., Ltd
Quarantine
Angers, France Beijing, China Wenzhou, China
valerie.olivier@anses.fr wenjunzhao@188.com xxingping@sina.com
Vicky Toussaint Wenxian Sun Xingyu Wang
Agriculture and Agri-Food Canada China Agricultural University Shanghai Jiao Tong University
St-Jean-sur-Richelieu, Canada Beijing, China Shanghai, China
Vicky.Toussaint@agr.gc.ca 08042@cau.edu.cn yuaiji4ever@163.com
122
Xinhua Ding Yanping Wang Yongfeng Liu
Shanghai Jiao Tong University China Agriculture University Jiangsu Academy of Agricultural Sciences
Taian, China Beijing, China Nanjing, Chnia
xhding@sdau.edu.cn wang_yanping123@163.com liuyf@jaas.ac.cn
Xiufeng Wang Yanxia Liu Yonghoon Lee
Jilin Province Academy of Vegetable and Guizhou Tobacco Science Research
Chonbuk National University
Flower Science Institute
Changchun, China Guiyang, China Iksan, Republic of Korea
mailwxf@126.com liuyanxia306@163.com yonghoonlee@jbnu.ac.kr
Xudong Zhou Yaqin Song Yongjun Lu
FuturaGene Biotechnology (Shanghai) Co., School of life sciences, Sun Yat-sen
Guangxi Citrus Research Institute
Ltd. University
Shanghai, China Guilin, China Guangzhou, Chnia
cerc.zhou@gmail.com loubinhai000000@163.com luyj@mail.sysu.edu.cn
Xueqing Geng Yasufumi Hikichi Youlun Xiao
Shanghai Jiao Tong University Kochi University Hunan Plant Protection Institute
Shanghai, China Nankoku, Japan Changsha, China
xqgeng@hotmail.com yhikichi@kochi-u.ac.jp xiaoylun2003@aliyun.com
Xuewen Gao Yawen He Youzhou Liu
Nanjing Agricultural University Shanghai Jiao Tong University Jiangsu Academy of Agricultural Sciences
Nanjing, Chnia Shanghai, China Nanjing, China
gaoxw@njau.edu.cn yawenhe@sjtu.edu.cn shitouren88888@163.com
Xueyun Wang Ye Tao Yu Chen
Shanghai Majorbio Bio-pharm Technology Shanghai Majorbio Bio-pharm Technology
Anhui Academy of Agricultural Sciences
Co.,Ltd. Co.,Ltd.
Shanghai, China Shanghai, China Hefei, China
xueyun.wang@majorbio.com ye.tao@majorbio.com chenyu66891@sina.com
Yan Li Ying Xu Yuanchan Luo
Shanghai Landscape Gardening Research East China University of Science and
China Agricultural University
Institute Technology
Beijing, China Shanghai, China Shanghai, China
icppb001@163.com xuying2002@gmail.com luoyuanc@163.com
Yan Wang Yinhua Chen Yuanguang Li
East China University of Science and
Jilin Agricultural University Hainan University
Technology
Changchun, China Haikou, China Shanghai, China
yan314319@163.com yhchen@hainu.edu.cn ygli@ecust.edu.cn
Yang Hu Yiqiao Ma Yuchao Wang
Institute of Genetics and Developmental Jilin Province Academy of Vegetable and Shanghai Superb Business Conference &
Biology, CAS Flower Science Exhibition Services
Beijing, China Changchun, China Shanghai, China
huyang@genetics.ac.cn xiaoquezai@163.com charlie@sbces.com
Yanhua Yu Yolanda Petersen Yu Chen
Shanghai Superb Business Conference &
Guangxi University Agricultural Research Council
Exhibition Services
Nanning, China Stellenbosch, South Africa Shanghai, China
tim38264@hotmail.com peterseny@arc.agric.za fisher@sbces.com
Yanli Tian Yong Zhang Yujing Sun
Nanjing Agricultural University Southwest University Shanghai Jiao Tong University
Nanjing, China Beibei, China Shanghai, China
2011202012@njau.edu.cn bioyongzhang@swu.edu.cn sunyujing008@gmail.com
123
Yujing Zhu Zhaolin Ji Zhiyang Liu
Fujian Academy of Agricultural Sciences Yangzhou University Shanghai Jiao Tong University
Fuzhou, China Yangzhou, China Shanghai, China
957942886@qq.com zhlji@yzu.edu.cn zhiyang2002@sina.com
Yuka Mori Zhaoyang Zhou Zhiyi Chen
Institute of Genetics and Developmental
Kochi University Jiangsu Academy Agricultural Sciences
Biology, CAS
Nankoku, Japan Beijing, China Nanjing, China
sky0903@hotmail.co.jp zhaoyangzhou@genetics.ac.cn chzy84390393@163.com
Yuki Ichinose Zhe Dai Zhiyuan Ji
National Key Laboratory of Crop Genetic
Okayama University Shanghai Jiao Tong University
Improvement
Okayama, Japan Wuhan, China Shanghai, China
yuki@okayama-u.ac.jp dzhe@webmail.hzau.edu.cn zhiyuanji@gmail.com
Yumi Ikawa Zhengchun Zhang Zhouqi Cui
Kyoto Prefectural University Guangxi University Zhejiang University
Kyoto, Japan Nanning, China Hangzhou, China
y_kametani@kpu.ac.jp chun828@163.com twelue@163.com
Yunhao Sun Zhibo Zhao Zifu He
School of life sciences, Sun Yat-sen Guangdong Academy of Agricultural
Northwest A&F University
University Sciences
Guangzhou, Chnia Xi'an, China Guangzhou, Chnia
sunyunhaoscope@163.com zhaozhibol@nwsuaf.edu.cn hezf@gdppri.com
Yunpeng Wang Zhiwei Song Ziniu Deng
Huaiyin Institute of Technology Nanjing Agricultural University National Center for citrus improvement
Huai'an, China Nanjing, Chnia Changsha, China
ypypwang@gmail.com 2012202008@njau.edu.cn deng7009@163.com
Yuwen Yang
Institute of plant protection ,CAAS
Beijing, China
yangyuwen@126.com
124
服务热线：400-660-1216
最终解释权归美吉生物所有网址：www.majorbio.com
邮箱：marketing@majorbio.com
地址：上海市浦东新区国际医学园区康新公路3399弄3号楼

ICPPB2014 Program&Abstracts - China

Uploaded by

Copyright:

Available Formats

ICPPB2014 Program&Abstracts - China

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

ICPPB2014 Program&Abstracts - China

Uploaded by

Copyright:

Available Formats

Table of Contents

General Information ................................................................................................................................. 5

Sunday, June 8 8:30–20:30

Monday, June 9 8:30–15:30

On-site Registration Fee

Instructions for Poster Preparation

Monday, June 9 08:30–17:30 Poster setup

8:30-9:00 CS1 8:30-9:00 S2-K2

Dr. Philippe Prior

10:20-10:40 Coffee Break

10:40-11:10 S2-K1 10:40-11:10 S3-K2

11:10-11:30 S2-O1 11:10-11:30 S3-O4

11:50-12:10 S2-O3 Sonti 11:50-12:10 S3-O6 Zhou

12:10-12:30 S2-P1 to S2-P12 12:10-12:30 S3-O7

12:30-13:30 Lunch 12:30-13:30 Lunch

13:30-14:00 S3-K1 13:30-14:00 S4-K2

14:00-14:20 S3-O1 14:00-14:20 S4-O4

14:40-15:00 S3-O3 Guttman 14:40-15:00 S4-O6 Dr. Cindy Morris

15:00-15:20 S3-P1 to S3-P13 15:00-15:20 S4-O7

15:20-15:40 Coffee Break 15:20-15:40 Coffee Break

15:40-16:10 S4-K1 15:40-16:10 S1-K2

16:10-16:30 S4-O1 16:10-16:30 S1-O3 Dr. Wenxian

17:10-17:30 S4-P1 to S4-P13 17:10-17:30 S1-P1 to S1-P12

17:30-20:30 Poster Reviewing 17:30-20:30 Poster Reviewing

8:30-9:00 CS2 8:30-9:00 CS3

9:00-9:30 S3-K3 9:00-9:20 S4-O12

10:10-10:30 S3-O10 10:00-10:20 S4-O15

10:30-10:40 Coffee Break 10:30-10:40 Coffee Break

10:40-11:10 S4-K3 10:40-11:10 S1-K4

11:10-11:30 S4-O8 11:10-11:30 S1-O10

12:30-13:30 Lunch 12:30-13:30 Lunch

13:30-14:00 S1-K3 13:30-14:00 S2-K4

14:00-14:20 S1-O6 14:00-14:20 S2-O11

15:00-15:20 S1-O9 15:00-15:20 S2-O14

15:20-15:40 Coffee Break 15:20-15:40 Coffee Break

15:40-16:10 S2-K3 15:40-16:10 S3-K4

16:10-16:30 S2-O7 16:10-16:30 S3-O11

CS, Conference-invited keynote speaker (25-minute talk + 5-minute discussion);

Conference special talk

S2: Pathogenesis & Regulation

S3: Disease Resistance & Effector Biology

15:20 Coffee break

S4: Taxonomy, Epidemiology, Ecology & Control

S2-P22 Identification and characterisation of pili mediating attachment of Pantoea ananatis to

S3: Disease Resistance & Effector Biology

S4: Taxonomy, Epidemiology, Ecology & Control

S1: Omics & Evolution

Conference special talk

S4: Taxonomy, Epidemiology, Ecology & Control

S2: Pathogenesis & Regulation

S1: Omics & Evolution

S2: Pathogenesis & Regulation

S3: Disease Resistance & Effector Biology

References: S1-P5 Transcriptomic analysis of Nicotiana

Marie Agnès Jacques*, Jean François Guimbaud, Arnaud References:

Pavel Berana*, Marta Zemanovaa, Pavel Krizb, Ivan Mraza

S3-O14 The differentential responses of potato References:

S3-A1 Novel Function of cGMP in Bacterial References:

[4G.Rastogi, G.L.Coaker,J.H.J.Leveau(2013). FEMS a

Participant Abstract Participant Abstract