Zhao et al.

DARU Journal of Pharmaceutical Sciences (2017) 25:21

DOI 10.1186/s40199-017-0188-7

RESEARCH ARTICLE Open Access

Beneficial effects of Heqi san on rat model

of polycystic ovary syndrome through the
PI3K/AKT pathway
Hengxia Zhao1, Daocheng Zhou1*, Ye Chen2, Deliang Liu1, Shufang Chu1 and Shimao Zhang1

Abstract
Background: Heqi San, a traditional Chinese medicine (TCM) has been reported to regulate hormone levels in
patients with metabolic disease, suggesting a potential clinical application. In the current study, we aimed to
elucidate the effect of Heqi San on rat model of polycystic ovary syndrome (PCOS).
Method: PCOS model was established in female SD rats. Rats were randomly divided into four groups: the control,
untreated PCOS model, Heqi San treated PCOS model (8.1 g/kg) and metformin (MET) treated PCOS model (135 mg/kg)
groups. All animals were subcutaneously injected with 6 mg/100 g dehydroepiandrosterone (DHEA) in the neck once a
day for 20 consecutive days. The serum hormone levels were measured by ELISA. The ovarian tissues were stained with
hematoxylin and eosin (HE) to undergo pathological examination. The expression levels of GLTU4 and PTEN mRNA were
examined by real time PCR. The crucial proteins in the PI3K/APT pathway were analyzed by western blotting. Then, the
functions of the target genes were analyzed using bioinformatics approaches.
Results: We found that Heqi San was able to recover the serum hormone levels and improve insulin resistance in PCOS
rat model. A morphological lesion of the ovary was also restored with the Heqi San treatment. More importantly, we
discovered a correlation between the PI3K/AKT signaling pathway and the beneficial effects of Heqi San, demonstrating
that its application could alter the expression levels of p-ERK, p-AKT, p-GSK3β, IRS-1, PTEN and GLTU4, all key factors in the
PI3K/APT pathway. Through a bioinformatical analysis, we predicted the related gene function and pathway of the
pathological mechanism of PCOS and found miRNAs that are likely to be critical in PCOS occurrence, including rno-miR-
144-3p, rno-miR-30c-2-3p, rno-miR-486, rno-miR-3586-3p and rno-miR-146b-5p.
Conclusion: The beneficial effects of Heqi on PCOS, including alter serum hormone levels, recover ovary morphological
lesions and improve insulin resistance, which is mediated through the PI3K/AKT pathway.
Keywords: Polycystic ovary syndrome, Heqi san, PI3K/AKT pathway, miRNA PTEN

Background in women with PCOS are hyperandrogenism and insulin

Polycystic ovary syndrome (PCOS) is a common and resistance [5]. The etiology of PCOS is still unknown,
multifactorial disease associated with both endocrine although environmental, genetic, and hormonal factors
and metabolic disorder. It affects approximately 4%–18% are all thought to be important in its development [6].
of all reproductive-aged women in the world [1, 2]. Since PCOS has clinically heterogeneous characteristics,
PCOS is characterized by hyperandrogenism and ovarian its treatment is complex and elicits variable responses
abnormalities, resulting from a disruption in the hypo- among PCOS patients [7]. One of the most widely used
thalamic–pituitary–ovarian axis [3, 4]. Clinically, the medicines for PCOS treatment is metformin, an insulin-
main cause for reproductive and metabolic abnormalities sensitizing drug [8], which can increase the insulin
sensitivity of ovaries to enhance glucose uptake [9].
Additionally, other types of medicine have also been ap-
* Correspondence: 369377040@qq.com
1
Department of Endocrine, Traditional Chinese Medicine Hospital of
plied to PCOS. For example, 3-iodothyronamine was
Shenzhen, Shenzhen, Guangdong 518033, China found to reprogram lipid metabolic pathways [10], and
Full list of author information is available at the end of the article

© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 2 of 12

soy isoflavones had beneficial effects through the inhib- Methods

ition of aromatase activity [11]. Furthermore, physical PCOS model
therapy, such as acupuncture, has been shown to be Forty female Sprague–Dawley (SD) rats (aged 3 months,
effective in improving the insulin resistance of PCOS weighting 300 ± 20 g) were obtained from the Laboratory
patients [12]. Animal Centre of Guangzhou University of Chinese
In China today, traditional Chinese medicine (TCM) is Medicine (Guangzhou, China). Animals were kept in
often administered as a complement to western medi- groups with free access to food and water and a controlled
cine. For example, a common preparation used to im- temperature of 22 ± 2 °C with a 12 h light/12 h dark cycle.
prove sexual performance in men with sexual and All rats used in this study had normal estrous cycles prior
erectile dysfunction is Curculigo orchioides Gaertn. [13]. to treatment, as confirmed by examination of vaginal
TCM has recently been reported to exert clinical effects smears under a light microscope for two sequential cycles
in PCOS treatment. Origanum majorana tea may regu- (about 8–10 days). The PCOS rat model was established
late hormone levels in women with PCOS [14]. Aloe has according to a previous study [24]. Briefly, the animals
been shown to restore lipid profiles in a PCOS rat model were subcutaneously injected with 6 mg/100 g dehydro-
[15]. The biochemical and clinical parameters of a PCOS epiandrosterone (DHEA) in the neck once a day for 20
rat model were improved with chamomile extract treat- consecutive days. Rats were randomly divided into four
ment [16]. Furthermore, Labisia pumila (Myrsinaceae), groups (n = 10 per group): the control (saline treatment),
known as “Kacip Fatimah”, was demonstrated to have untreated PCOS model, Heqi San treated PCOS model
beneficial metabolic effects in a PCOS rat model [17]. and metformin (MET) treated PCOS model.
Taking the limited side effects of traditional herbal
medicine into consideration, all of the above data Heqi san or metformin treatment
demonstrate the potential role of TCM in the man- The Heqi San was provided by the Traditional Chinese
agement of PCOS. Some of the physiological mecha- Medicine Hospital of Shenzhen (Shenzhen, China). The
nisms behind the efficacy of most TCMs are still Heqi San formula is shown in Table 1. Its preparation
unknown for PCOS, partially due to the fact that was as follows: 25% weight of a mixture of Schisandra
most TCMs contain multiple components, although chinensis (Turcz.) Baill., Cynanchum otophyllum C. K.
some have been proposed. For example, Salvia mil- Schneid., and Hordeum vulgare L. was crushed into
tiorrhiza Bunge has been shown to significantly im- powder and sieved. After blending with other compo-
prove glucose tolerance in a prenatally androgenized nents, the mixture was dissolved in 30,000 ml ddH2O
rat model of PCOS [18]. Rhizoma coptidis and Oci- and heated for 1.5 h with a boiling heater, then the
mum basilicum induced ovulation through estrogenic liquids were leached, 24,000 ml ddH2O was added into
effects when used to treat PCOS [19]. the dregs and reheated for 1.5 h, then the liquids were
Curculigo orchioides Gaertn., Cuscuta chinensis Lam., again leached, merged into an unguent with a relative
and Poncirus trifoliata (L.) Raf. have commonly been density of 1.25–1.30, and were formed into pills by
used to treat impotence [20], Cynanchum otophyllum C. mixing with 1 g activated charcoal coat. In the control
K. Schneid. has been proven in Chinese literature to re- and untreated PCOS model groups, saline was used
plenish the blood [21]. Traditional Chinese physicians as control solution. In Heqi San treated PCOS (Heqi)
believed that the basic pathology of PCOS is kidney and metformin (MET) treated PCOS groups, Heqi
deficiency and blood stasis. Thus, the TCM treatment San or metformin was dissolved in saline and orally
for PCOS mainly focuses on how to remove blood administered. The conversion of the equivalent drug
stasis [22]. The basic philosophy of Heqi San for dose from human to rats is based on body surface
PCOS treatment lies in nourishing the liver, kidney, area (BSA), dose of drugs in rats = dose of drugs in
spleen, and blood, and in promoting blood circulation human × (BSA of rats/ BSA of human) [25]. Heqi
to overcome stasis, supplement “qi”, and nourish San was given at 8.1 g/kg by a cannula in PCOS rats,
“yin”. In addition, the flavor theory of this TCM is while metformin was given at 135 mg/kg in PCOS
“Gan, Wen, and Ziyin”, which has been shown to be rats based on the previous study [26]. Animal were
safe in PCOS therapy [23]. treated for 30 consecutive days.
In this study, we demonstrated the application of
Heqi San, a traditional Chinese medicine (TCM) in a Measurement of hormone levels
PCOS rat model. Heqi San has been reported to have We used enzyme-linked immunosorbent assay (ELISA)
beneficial effects on the treatment of diabetes and kits (Cloud-Clone Corp., Houston, USA) to measure the
other metabolic diseases, making it likely to function serum concentrations of gonadotropins, including follicle
as a candidate for the treatment of metabolic disease stimulating hormone (FSH) and luteinizing hormone
in PCOS. (LH), and steroid hormones, including 17β-estradiol (E2),
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 3 of 12

Table 1 The formula of Heqi San

Number Components Weight (g) Pharmacological effects
1 Curculigo orchioides Gaertn. 200 enhance natural immune function; inhibit thrombus formation; sedative
effect; antibacterial activity
2 Schisandra chinensis (Turcz.) Baill. 200 improve nervous system cell function; promote the synthesis of cAMP,
proteins, and glycogen; anti-stress effect; improve reproductive function
3 Cynanchum otophyllum C. K. Schneid. 200 regulate the innate immune system; enhance memory; protect the liver;
act as an anti-inflammatory; endanger early pregnancy
4 Citrus medica L. var. sarcodactylis Swingle 200 calming effect in the central nervous system; expectorant action; anti-
inflammatory effect; promote the secretion of digestive juices
5 Crataegus pinnatifida Bunge 600 reduce blood fat and blood pressure; antibacterial activity; scavenge free
radicals; increase immune function
6 Rhus chinensis Mill. 180 antibacterial activity; pro-hemostasis; anti-tumor effect; improve myocardial
ischemia
7 Clinopodium megalanthum (Diels) 300 used for the treatment of trichomonas vaginitis; sex hormone-like activities;
C. Y. Wu & Hsuan ex H. W. Li anti-asthmatic; expectorant; antibacterial activity; anti-arrhythmic; anti-irritant;
anti-osteoporotic; anti-inflammatory
8 Cuscuta chinensis Lam. 400 increase immune function; improve myocardial ischemia; improve sexual
function; promote uterine health
9 Poncirus trifoliata (L.) Raf. 200 expectorant; digestive aid
10 Hordeum vulgare L. 1000 digestive aid; relieve breast pain; reduce blood sugar level; vasoconstrictor
11 Polygala tenuifolia Willd. 200 expectorant; sedative; promote uterine health; reduce blood pressure;
antibacterial activity; anti-tumor effect
12 Epimedium davidii Franch. 200 Gonadotropin action; improve endocrine function; bidirectional regulatory
effect on the immune system; reduce blood pressure; antibacterial activity;
reduce blood sugar; treat erectile dysfunction

progesterone (P), testosterone (T), and insulin. Insulin re-

sistance was calculated to assess changes in insulin sensi-
tivity according to the previous report [27].

Histology
All rats were sacrificed after 30 days and the ovarian tis-
sues were used for histology analysis. Ovarian tissues
were fixed in 4% paraformaldehyde and embedded in
paraffin. The sections were stained by hematoxylin and
eosin (H&E) according to standard procedures. The
ovary volume was measured and calculated using Image
J software (NIH, USA).

Real time quantitative PCR

Real-time quantitative PCR was used to measure the
mRNA expression levels of GLUT4 and PTEN in the
PI3K/AKT signaling pathway. Total RNA extraction was
performed using TRIzol reagent (Life Technologies,
USA) according to the manufacturer’s instruction. Two
microgram of total RNA extracted from ovarian tissues
was subjected to reverse transcription (RT) and cDNA
synthesis was performed using a one-step RT-PCR kit
from Takara (Takara, Japan). SYBR Green (Toyobo,
Japan), RT-PCR amplification and real time fluorescence
detection were performed using the ABI 7300 real-time
PCR thermal cycle instrument (ABI, USA), according to
the supplied protocol. The relative gene expression was
calculated using the 2-ΔΔCt method and the relative ex-
pression levels were normalized to the expression of en- Fig. 1 Establishment of PCOS model. a Testosterone concentration
in serum was increased in PCOS model. b FINS level was elevated in
dogenous GAPDH. The primers used in this study were:
PCOS model. *p < 0.05 vs. control
GLUT4 (F) 5′- GATCGGCTCTGAAGATGGGG-3′, G
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 4 of 12

LUT4 (R) 5′- GGAGGAAATCATGCCACCCA-3′; PTEN Gene ontology analysis

(F) 5′-AGACCATAACCCACCACAGC-3′, PTEN (R) 5′- The functions of the target genes were analyzed using
CAGGGCCTCTTGTGCCTTTA-3′; GAPDH (F) 5′- bioinformatics. First, a gene ontology (GO) enrichment
GGTATCGTGGAAGGACTCATGAC-3′, GAPDH (R) analysis was performed using DAVID (https://david.n-
5′-ATGCCAGTGAGCTTCCCGT TCAGC-3′. cifcrf.gov/) [28]. The related pathways of the target genes
were identified using the Kyoto Encyclopedia of Genes
and Genomes (KEGG) databases.
Western blotting
The protein expression levels of p-ERK, p-AKT, p- Statistical analysis
GSK3β, IRS-1, PTEN and GLTU4 was detected by Data were presented as mean ± SEM. All the data were
western blotting. First, 2 μg tissue lysates were loaded on analyzed with Graphpad Prism 6.0. Paired Student’s t-
each lane of 10% polyacrylamide gel, and then blotted tests and one-way ANOVA were used to determine
onto a polyvinylidene difluoride (PVDF) membrane. significant differences. A p value less than 0.05 is consid-
After blocking with a PBST containing 5% nonfat dry ered to be significantly different.
milk, the membrane was incubated with specific primary
antibodies (Cell Signaling Technologies, USA). Results
Peroxidase-linked IgG (Life Technologies) were used as Heqi alleviated the disruption of serum hormone levels in
secondary antibodies. These proteins were visualized PCOS model
with an ECL western blotting detection kit (Amersham We first evaluated whether the PCOS model had been suc-
Biosciences). cessfully established. We found that the serum testosterone

Fig. 2 Application of Heqi San restored serum hormone levels in the PCOS model, including (a) luteinizing hormone (LH), (b) Testosterone (T), (c)
estradiol (E2), and (e) follicule-stimulating hormone (FSH), but not (e) progesterone (P). *p < 0.05 vs. control, #p < 0.05 vs. PCOS
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 5 of 12

(T) and fasting insulin (fins) levels increased after the

DHEA injection when compared with control rats (Fig. 1a,
b), demonstrating that the established model reflected the
primary symptoms of polycystic ovary syndrome. Next,
we determined whether the traditional Chinese medicine
Heqi San had any effects on these symptoms. LH and T
levels increased in the PCOS model group, while the
application of metformin and Heqi were shown to
counteract the increased LH and T levels (Fig. 2a, b). A
similar result was obtained the level of E2. However, the
alterations in E2 and P level were not statistically different
(Fig. 2c, e). By contrast, we did not observe any change in
FSH in either the PCOS model or the Heqi-treated
animals (Fig. 2d). Collectively, these data indicate that the
serum hormone level was disrupted in the PCOS model,
while the application of Heqi San alleviated the alteration
in hormone levels.

Heqi changed the HOMA-IR and IRI in the PCOS model

We then determined whether or not the application of
Heqi San could change the homeostasis model
assessment-insulin resistance index (HOMA-IR) or the
insulin sensitivity index (ISI) in the PCOS model. The
HOMA-IR was increased in the PCOS model compared
with that in control group (Fig. 3a). Both Heqi San and
MET treatment were able to offset the increasing Fig. 3 Heqi San treatment changed the insulin sensitivity in the
HOMA-IR in the PCOS model (Fig. 3a). In contrast, PCOS model. a HOMA-IR was alleviated in both Heqi San-treated
the ISI was significantly decreased in the PCOS and MET-treated PCOS model. b Insulin sensitivity index (ISI) was
decreased in the PCOS model, while Heqi San counteracted this
model (Fig. 3b), Heqi San and MET were able to
effect. Heqi: Heqi San, MET: metformin. *p < 0.05 vs. control,
significantly increase the ISI level compared to that in #
p < 0.05 vs. PCOS
the untreated PCOS model (Fig. 3b). These data
demonstrate that Heqi San can antagonize the in-
creasing HOMA-IR and the decreasing ISI in the MET, the structure was partially recovered. As shown
PCOS model and that this effect is comparable to in the Fig. 4, the oocytes were once again found in
that of metformin. follicles and the number of granule cell layers in-
creased in both groups. Based on these data, we con-
Heqi san leads to morphological recovery in the ovary cluded that Heqi San was able to reverse the
Since Heqi San could modulate the serum hormone morphological disorder in ovarian tissues.
levels, we investigated whether it could restore the ovar-
ian morphological changes in the PCOS model. We
found that the ovarian volume was slightly increased in Heqi restored the ovarian disorder through the PI3K/AKT
the PCOS model, but that the application of either Heqi pathway
San or MET decreased the volume (Fig. 4a). Meanwhile, In order to confirm the involvement of the PI3K/AKT
the organ coefficient was reduced in the untreated PCOS pathway in Heqi San-induced ovarian recovery in the
model. However, the application of Heqi San or MET PCOS model, we determined the expression alteration
only slightly restored the organ coefficient (Fig. 4b). of key genes in the PI3K/AKT pathway, including
H&E staining showed ovarian follicles at different GLUT4 and PTEN. The real-time quantitative PCR data
developmental stages in the control group (Fig. 4c). In demonstrated that GLUT4 and PTEN mRNA expression
contrast, the structure of ovarian tissue in the PCOS levels were significantly decreased in the PCOS model
group was in a state of disorder, with apparent cystic when compared with the control group (Fig. 5a, b),
dilatation in the ovarian follicles (Fig. 4c). Further- while the application of either Heqi San or MET drastic-
more, the oocytes in the follicles disappeared and the ally increased their expression levels (Fig. 5a, b). Those
number of granule cell layers decreased significantly results indicate that the effects of Heqi San on PCOS are
(Fig. 4c). Upon treatment with either Heqi San or correlated with the PI3K/AKT pathway.
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 6 of 12

Fig. 4 Morphological alteration in the ovary after Heqi San treatment. a Ovarian volume (mm3) was slightly changed after Heqi San treatment. b
Organ coefficiency (mg/g) improved after Heqi San treatment in the PCOS model. c Compared with the control, the PCOS model showed apparent
lesions in the ovary, Heqi San or MET treatment significantly restored the morphological damage in the PCOS model. Heqi: Heqi San, MET: metformin

Insulin resistance was alleviated with the treatment of (Table 2). Therefore, we identified the expression of rno-
Heqi san miR-144-3p in different groups, and found that its
Since insulin resistance is an important pathological mRNA expression level was significantly increased in
feature in PCOS, we then checked whether Heqi San the PCOS model compared to the control (Fig. 7a).
treatment could alleviate the insulin resistance in the Treatment with either Heqi San or MET led to the
PCOS model. In the control group, insulin stimulation decrease of the rno-miR-144-3p expression level in the
increased the expression levels of phosphorylated ERK, PCOS model (Fig. 7a). This revealed that PTEN likely
AKT and GSK3β (Fig. 6a).Nevertheless, the significant plays a critical role in PCOS pathology, and that it is
increase was not found in the PCOS model after insulin regulated through rno-miR-144-3p. Furthermore, GO
stimulation. The insulin resistance was alleviated when analysis indicated the target genes involved in PCOS
either Heqi San or MET was applied. The expression pathology were mostly abundant in the category of bind-
levels of p-ERK and GSK3β were increased significantly ing and catalytic function. In terms of biological process,
after insulin stimulation (Fig. 6a). Furthermore, the the functions of these target genes included response to
expression levels of insulin receptor substrate-1 (IRS-1) stimulus, biological regulation, and cellular process,
and PTEN decreased significantly after insulin stimula- among others (Fig. 7b). The Go enrichment analysis also
tion in the control group (Fig. 6b). In contrast, we did showed that the involved signaling pathways included
not observe any alteration in IRS −1 or PTEN expression the inflammation and apoptosis pathways (Fig. 7c).
levels in the insulin-treated PCOS model. Treatment We then used the bioinformatics analysis to identify
with either Heqi San or MET decreased the expression certain differences in miRNA between the control group
levels of IRS-1 and PTEN in the insulin-treated PCOS and PCOS groups, and some of the identified miRNAs
model (Fig. 6b). However, we did not observe any alter- involved in the P13K/AKT pathway are listed in Table 3.
ation in GLUT4 or p-IRS-1 expression, indicating its Accordingly, we selected four miRNAs (rno-miR-30c-2-
irrelevance in insulin resistance. Collectively, these data 3p, rno-miR-146b-5p, rno-miR-486 and rno-miR-3586-
demonstrate that Heqi San alleviated insulin resistance 3p) and determined their expression levels in the
through the PI3K/AKT signaling pathway. different groups. The primers used for the miRNAs ex-
pression analysis are shown in Table 4. The real time
Differential miRNA expression contributed to the quantitative PCR results indicated that the expression
pathological process in the PCOS model levels of rno-miR-30c-2-3p, rno-miR-486 or rno-miR-
We used sequencing and bioinformatics analysis to pre- 3586-3p were significantly higher in the PCOS model
dict that PTEN was the target gene of rno-miR-144-3p (Fig. 8a–d), while Heqi San or MET treatment could
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 7 of 12

Fig. 5 The effects of Heqi San on the PCOS model was mediated
through the PI3K/AKT pathway. Heqi San treatment increased the
expression levels of GLUT4 (a) or PTEN (b) in the PCOS model,
where both of key signals were significantly down-regulated. Heqi:
Heqi San, MET: metformin. *p < 0.05 vs. control, #p < 0.05 vs. PCOS

decreased the expression levels of all three miRNAs

when compared with the untreated PCOS group
(Fig. 8a–d). In contrast, the expression level of rno--
miR-146b-5p was decreased in the PCOS model (Fig.
8b), and treatment with either Heqi San or MET in-
creased its expression level (Fig. 8b). These results
are consistent with our sequencing data, indicating
Fig. 6 Insulin resistance was changed by Heqi San treatment in the
the critical role of the PI3K/AKT pathway in the
PCOS model. a Treatment with either Heqi San or MET significantly
pathology of PCOS in our model. improved the response to insulin stimulation, leading to the
up-regulation of p-ERK, p-AKT, or GSK3β in the PCOS model.
Discussion b Heqi San treatment recovered the decrease in IRS-1 and PTEN
In this study, we elucidated the beneficial effects of Heqi expression levels, which were inhibited in the PCOS model. Heqi:
Heqi San, MET: metformin
San for PCOS through the establishment of a disease
model in rats. We found that treatment with Heqi San
alleviated the serum hormone imbalance and improved
insulin resistance. This effect was comparable with that levels such as with LH and androgens, and increasing in-
of the widely used medicine metformin and thus shows sulin resistance [29]. Therefore, any medicine that can
great promise in the application of Heqi San for PCOS safely improve the above symptoms would be an ideal
treatment. Furthermore, its potential effects are likely candidate for PCOS therapy. However, not all PCOS pa-
mediated by the PI3K/AKT pathway. PCOS has several tients are suitable for metformin treatment [30]. TCM can
clinical manifestations, mainly including chaotic hormone be used as a dietary herbal supplement for PCOS
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 8 of 12

Table 2 The prediction of target genes of miRNAs potential treatment in order to decrease the side effects of some
correlated with pathological mechanism of PCOS western medicine.
miRNA ID Target Gene In this study, we found that Heqi San has both func-
rno-miR-124-3p Bdnf tions. Firstly, it can regulate the serum hormone levels
rno-miR-124-3p Itgb1 in PCOS. It can regulate gonadotropins including follicle
rno-miR-124-3p Lamc1 stimulating hormone and luteinizing hormone, as well
rno-miR-124-3p Neurod1 as steroid hormones including 17β-estradiol, progester-
rno-miR-124-3p Stat3 one, and testosterone. TCM consists of a large number
rno-miR-141-3p Zeb2 of herbal medicines, which may regulate hormone levels.
rno-miR-142-5p BTG3 Some components have a two-way regulating effect on
rno-miR-144-3p Celf2 hormone levels through compatibility effects [31]. A
rno-miR-144-3p PTEN major characteristic of PCOS is an elevated serum
rno-miR-151-5p Fndc1 androgen level; orally administered Heqi San could

Fig. 7 Analysis of the potential roles of miRNAs in PCOS pathogenesis. a The potential role of rno-miR-144-3p, the target gene of PTEN, was eluci-
dated through real time PCR in the PCOS model and the Heqi-treated group. **p < 0.01 vs. control, #p < 0.05 vs. PCOS. b GO analysis disclosed
the functions of target genes. c GO enrichment analysis demonstrated the signal pathways potentially involved in pathological mechanism of
PCOS. Heqi: Heqi San, MET: metformin
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 9 of 12

Table 3 Lists of miRNAs involved in PI3K/AKT pathway

mRNA protein gene ID control-Expression PCOS-Expression Up-Down-Regulation (contol/NPCOS) p-value
PTEN PTEN miR-494-3p 75 36 Up 0.1878728
PTEN PTEN miR-132-3p 353 163 Up 0.0199686
Slc2a4 GLUT4 miR-133a-3p 140 49 Down 0.7730520
Slc2a4 GLUT4 miR-133b-3p 97 46 Up 0.1579726
PTEN PTEN miR-144-3p 260 423 Up 0.0000000
PTEN PTEN miR-212-3p 66 27 Down 0.6160000
Rela NFkB miR-21-5p 170,370 45,208 Down 0.0000000
PTEN PTEN miR-216a-5p 17 7 Down 0.7146180
PTEN PTEN miR-26a-5p 206,732 46,330 Down 0.0000000
PTEN PTEN miR-26b-5p 9174 3703 Down 0.0000100
Mapk1 Mapk miR-290 3 3 Up 0.1814094
Rela NFkB miR-29a-3p 14,732 9573 Up 0.0000000

reduce the abnormal secretion of androgen and achieve many PCOS patients are obese, which may cause sugar
a physiological androgen balance. It contains a variety of metabolism disorders and pregnancy complications [38].
components, such as Epimedium davidii Franch. and Poncirus trifoliata (L.) Raf., Hordeum vulgare L., and
Cuscuta chinensis Lam., which can regulate the sex Crataegus pinnatifida Bunge have been shown to aid
gland-adrenal gland axis to reduce the androgen level digestion, reduce blood sugar levels, and may even help
and induce ovulation [32]. We speculate these action are with weight loss [39–41].
probably due to its effect on the androgen receptor One of the important findings in this work was the in-
(AR), thereby regulating androgens-gonadotropin inter- volvement of the PI3K/AKT pathway in the Heqi
actions [33]. Secondly, Heqi San can improve insulin San-induced beneficial effects on PCOS. The role of the
resistance, which is most likely due to its regulation of PI3K/AKT signaling pathway in PCOS pathogenesis has
the correlation between insulin resistance and thyroid- been reported previously, and is probably due to the fact
stimulating hormone. Insulin resistance and the dysregu- that the activation of AKT leads to the enhanced insulin
lation of glucose metabolism are common in PCOS resistance [42]. Several important elements in the PI3K/
patients [34]. The effect of Heqi San on insulin resist- AKT pathway were regulated in our rat PCOS model by
ance may also be due to an improvement in beta cell insulin stimulation, a process potentially modifiable by
function, which is directly responsible for insulin secre- Heqi San treatment. These results are consistent with
tion [35]. As two of the components of Heqi San, the previous finding that PI3K inhibition has beneficial
Schisandra chinensis can promote the synthesis of effects on PCOS [43]. This beneficial effect lead to im-
cAMP, proteins, and glycogen and can enhance glycogen provements in insulin, testosterone, and luteinising
metabolism [36] and Polygala tenuifolia Willd. protected hormone levels, and is comparable with the findings of
diabetic rats from hippocampal injury [37]. In addition, the current study. Since phosphorylation of ERK, AKT
and GSK3βis significantly affected in insulin resistance
after Heqi San treatment, further work will be focused
Table 4 The primers used for miRNAs expression analysis on the pharmaceutical inhibition of phosphorylation in
Name primers sequences (5′-3′) key signals of the PI3K/AKT pathway.
rno-miR-30c-2-3p F: GCTGGGAGAAGGCTGTT Through the bioinformatics analysis, we found that
R:TGTCGTATCCAGTGCAGGGTCCGAG there were certain miRNAs that seemed to play import-
GTATTCGCACTGGATACGACAGAGTA ant roles in Heqi San-induced therapeutic effect on the
rno-miR-146b-5p F: GGGTGAGAACTGAATTCCA PCOS model. Previous work has demonstrated that ex-
pression of miRNAs in the uterus of a rat PCOS model
R:TGTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACACAGCC was significantly altered [44]. This is consistent with the
rno-miR-486 F: GGGGATACTAGACTGTGAGCT general concept that the abnormal expression of miR-
NAs is correlated with various disorders [45]. Through
R:TGTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACTCGAGG the same bioinformatics work, we predicted several miR-
NAs that were differentially expressed between the
GAPDH F: GGTATCGTGGAAGGACTCATGAC
control and treatment groups, and found that their
R: ATGCCAGTGAGCTTCCCGT TCAGC
target genes are important factors in the PI3K/AKT
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 10 of 12

Fig. 8 Differential expression levels of miRNA participating in PCOS pathogenesis, including miR-30c-2-3p (a), miR-146b-5p (b), miR-486 (c), and
miR-3586-3p. **p < 0.01 vs. control, #p < 0.05 vs. PCOS

pathway. In fact, miRNAs have been reported to regulate hormone; GO: Gene ontology; H&E: Hematoxylin and eosin; HOMA-
cellular processes, such as cell proliferation and differen- IR: Homeostasis model assessment-insulin resistance index; ISI: Insulin
sensitivity index; KEGG: Kyoto encyclopedia of genes and genomes; LH: Luteinizing
tiation [46]. Combined with the GO analysis, our hormone; MET: Metformin; P: Progesterone; PCOS: Polycystic ovary syndrome;
prediction indicated that some miRNAs may regulate PVDF: Polyvinylidene difluoride; T: Testosterone
proliferation, differentiation, and apoptosis, correlat-
ing with PCOS pathogenesis. To prove this hypoth- Acknowledgements
None.
esis, direct genetic manipulation of these miRNAs
will be conducted in PCOS models, in order to Funding
provide evidence to clarify their role in the patho- This study was supported by the Shenzhen Science and Technology Plan
genesis of PCOS. Project (JCYJ20150401163841053).

Availability of data and materials

Conclusion Materials described in the manuscript, including all relevant raw data, will be
In summary, we reported on the beneficial effects of freely available to any scientist wishing to use them for non-commercial
Heqi San in a PCOS rat model, including improve- purposes, without breaching.
ments in serum hormone levels, ovarian morpho-
Authors’ contributions
logical recovery and insulin resistance. This effect is HZ and DZ wrote this manuscript; DZ designed this study; DL, SC and YC
likely mediated by the PI3K/AKT pathway. We also performed the experiments; SZ analyzed the data. All authors read and
identified important miRNAs that are potential approved the final manuscript.
involved in the therapeutic effect of Heqi San and in
Ethics approval
the pathogenesis of PCOS. This work provides experi- The animal study was approved by the Animal Ethics Committee of the
mental evidence to support the potential application Guangzhou University of Chinese Medicine.
of Heqi San, putting forward a new methodology for
PCOS treatment. Consent for publication
All authors agree to publish our manuscript.
Abbreviations
AR: Androgen receptor; E2: 17β-estradiol; ELISA: Enzyme-linked Competing interests
immunosorbent assay; Fins: Fasting insulin; FSH: Follicle stimulating The authors have declared no conflict of interest.
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 11 of 12

Publisher’s Note and pharmacology of an important traditional herbal medicine. J

Springer Nature remains neutral with regard to jurisdictional claims in Ethnopharmacol. 2014;157:292–308.
published maps and institutional affiliations. 21. Zhang L. Zhao Bj, Yuan Jr, Wang Cf, Zhao D, Feng L, et al. Comparation on
effects of Moutan cortex, Paeoniae Rubra radix and Paeoniae Alba radix on
Author details acute blood stais model rats (in Chinese). Chin Tradit Herb Drugs.
1
Department of Endocrine, Traditional Chinese Medicine Hospital of 2016;47(15):2676–83.
Shenzhen, Shenzhen, Guangdong 518033, China. 2Longhua Central Hospital 22. Zhou X, Zhou L, Sun Z. Research progress in mechanism of traditional Chinese
of Shenzhen, Shenzhen, Guangdong 518000, China. medicine treatment of PCOS. China J Chin Materia Medica. 2016;41(20):3715–20.
23. Zhou D, Wu M, Zhao H, Li H, Zheng X, Liu Y, et al. Heqi san combined with
Received: 7 June 2017 Accepted: 2 October 2017 metformin for obese polycystic ovary syndrome (in Chinese). Int J Trad Chin
Med. 2017;39(7):592–6.
24. Tessaro I, Modina SC, Franciosi F, Sivelli G, Terzaghi L, Lodde V, et al. Effect
of oral administration of low-dose follicle stimulating hormone on
References
hyperandrogenized mice as a model of polycystic ovary syndrome.
1. Curi DD, Fonseca AM, Marcondes JA, Almeida JA, Bagnoli VR, Soares JM Jr,
J Ovarian Res. 2015;8(1):64.
et al. Metformin versus lifestyle changes in treating women with polycystic
25. Administration FD. Guidance for industry: estimating the maximum safe starting
ovary syndrome. Gynecol Endocrinol. 2012;28(3):182–5.
dose in initial clinical trials for therapeutics in adult healthy volunteers. 2005.
2. Moran LJ, Hutchison SK, Norman RJ, Teede HJ. Lifestyle changes in women with
26. Yan L, Kang B, Li G, Yin Z, Wang Y. Effects of metformin on serum levels of
polycystic ovary syndrome. Cochrane Database Syst Rev. 2011;2(7):CD007506.
sex hormone, leptin and insulin in ovariectomized Sprague-Dawley rats. Die
3. Franks S. Animal models and the developmental origins of polycystic ovary
Pharmazie. 2009;64(12):834–5.
syndrome: increasing evidence for the role of androgens in programming
27. DeUgarte CM, Bartolucci AA, Azziz R. Prevalence of insulin resistance in the
reproductive and metabolic dysfunction. Endocrinology. 2012;153(6):2536–8.
polycystic ovary syndrome using the homeostasis model assessment. Fertil
4. Glintborg D. Endocrine and metabolic characteristics in polycystic ovary
Steril. 2005;83(5):1454–60.
syndrome. Dan Med J. 2016;63(4):B5232.
28. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of
5. Rosenfield RL, Ehrmann DA. The pathogenesis of polycystic ovary syndrome
large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4(1):44–57.
(PCOS): the hypothesis of PCOS as functional ovarian Hyperandrogenism
revisited. Endocr Rev. 2016;37(5):467–520. 29. Ulloa-Aguirre A, Portocarrero L, Zariñán T, Olivares A, Carranza-Lira S, Veldhuis
6. Coles CE, Donovan E, Haviland J, Yarnold J. Intensity-modulated radiotherapy JD, et al. Effects of metformin on inappropriate LH release in women with
for the treatment of breast cancer. Clin Oncol (R Coll Radiol). 2013;25(3):215. polycystic ovarian syndrome and insulin resistance. Reprod BioMed Online.
7. Palomba S, de Wilde MA, Falbo A, Koster MP, La Sala GB, Fauser BC. 2006;12(6):669–83.
Pregnancy complications in women with polycystic ovary syndrome. Hum 30. Stadtmauer LA, Wong BC, Oehninger S. Should patients with polycystic
Reprod Update. 2015;21(5):575–92. ovary syndrome be treated with metformin?Benefits of insulin sensitizing
8. Figurova J, Dravecka I, Petrikova J, Javorsky M, Lazurova I. The effect of drugs in polycystic ovary syndrome—beyond ovulation induction. Hum
alfacalcidiol and metformin on metabolic disturbances in women with Reprod. 2002;17(12):3016–26.
polycystic ovary syndrome. Horm Mol Biol Clin Investig. 2017;29(3):85–91. 31. Zhang JH, Zhu Y, Fan XH, Zhang BL. Efficacy-oriented compatibility for
9. Foretz M, Guigas B, Bertrand L, Pollak M, Viollet B. Metformin: from component-based Chinese medicine. Acta Pharmacol Sin. 2015;36(6):654–8.
mechanisms of action to therapies. Cell Metab. 2014;20(6):953–66. 32. Gui Sq, Yu J. Experimental Study of Effect on Tonifying Kidney herbs in
10. Selen Alpergin ES, Bolandnazar Z, Sabatini M, Rogowski M, Chiellini G, Pitultary Ovary Adrenal Gland of Androgen Sterilized Rats (in Chinese).
Zucchi R, et al. Metabolic profiling reveals reprogramming of lipid metabolic Chinese J Integr Med. 1997;(12):735–8.
pathways in treatment of polycystic ovary syndrome with 3- 33. Dewailly D, Robin G, Peigne M, Decanter C, Pigny P, Catteau-Jonard S.
iodothyronamine. Physiol Rep. 2017;5(1):e13097. Interactions between androgens, FSH, anti-Mullerian hormone and estradiol
11. Rajan RK. M SS, Balaji B. Soy isoflavones exert beneficial effects on letrozole- during folliculogenesis in the human normal and polycystic ovary. Hum
induced rat polycystic ovary syndrome (PCOS) model through anti- Reprod Update. 2016;22(6):709–24.
androgenic mechanism. Pharm Biol. 2017;55(1):242–51. 34. Li W, Li Q. Dysregulation of glucose metabolism even in Chinese PCOS
12. Li J, Ng EH, Stener-Victorin E, Hu Z, Shao X, Wang H, et al. Acupuncture women with normal glucose tolerance. Endocr J. 2012;59(9):765.
treatment for insulin sensitivity of women with polycystic ovary syndrome 35. Jensterle M, Goricar K, Janez A. Add on DPP-4 inhibitor alogliptin alone or
and insulin resistance: a study protocol for a randomized controlled trial. in combination with pioglitazone improved beta-cell function and insulin
Trials. 2017;18(1):115. sensitivity in metformin treated PCOS. Endocr Res. 2017;21:1–8.
13. Chauhan NS, Rao C, Dixit VK. Effect of Curculigo Orchioides rhizomes on 36. Yang J, Wu Y, Wang Q, Zhou G. The chemical components and
sexual behaviour of male rats. Fitoterapia. 2007;78(7–8):530. pharmacological effects of Fructus Schisandrae and its application Prospect.
14. Haj-Husein I, Tukan S, Alkazaleh F. The effect of marjoram (Origanum Majorana) Biomirror. 2011;2(11):1–10.
tea on the hormonal profile of women with polycystic ovary syndrome: a 37. Li Y, Ma H, Xue J. Effects of polygala on the expression of apoptosis-
randomised controlled pilot study. J Hum Nutr Diet. 2016;29(1):105–11. related proteins in hippocampus nerve cells of diabetic rats.
15. Desai BN, Maharjan RH, Nampoothiri LP. Aloe Barbadensis mill. formulation Chin J Anat. 2013;36(2):206–9.
restores lipid profile to normal in a letrozole-induced polycystic ovarian 38. Harborne L, Fleming R, Lyall H, Norman J, Sattar N. Descriptive review of the
syndrome rat model. Pharm Res. 2012;4(2):109–15. evidence for the use of metformin in polycystic ovary syndrome. Lancet.
16. Farideh ZZ, Bagher M, Ashraf A, Akram A, Kazem M. Effects of chamomile 2003;361(9372):1894–901.
extract on biochemical and clinical parameters in a rat model of polycystic 39. Jurikova T, Sochor J, Rop O, Mlcek J, Balla S, Szekeres L, et al. Polyphenolic
ovary syndrome. J Reprod Infertil. 2010;11(3):169–74. profile and biological activity of Chinese hawthorn (Crataegus Pinnatifida
17. Manneras L, Fazliana M, Wan Nazaimoon WM, Lonn M, Gu HF, Ostenson CG, BUNGE) fruits. Molecules. 2012;17(12):14490.
et al. Beneficial metabolic effects of the Malaysian herb Labisia pumila var. 40. Shim WS, Back H, Seo EK, Lee HT, Shim CK. Long-term administration of an
alata in a rat model of polycystic ovary syndrome. J Ethnopharmacol. aqueous extract of dried, immature fruit of Poncirus Trifoliata (L.) Raf.
2010;127(2):346–51. Suppresses body weight gain in rats. J Ethnopharmacol. 2009;126(2):294–9.
18. Yang X, Zhang Y, Wu X, Bae CS, Hou L, Kuang H, et al. Cryptotanshinone 41. Wang X, Zhou J, Jin X, Dai C. Pharmacological research and clinical
reverses reproductive and metabolic disturbances in prenatally androgenized application of Hordeum Vulgare L. (in Chinese). Chin Trad Patent Med.
rats via regulation of ovarian signaling mechanisms and androgen synthesis. 2007;29(11):1677–9.
Am J Physiol Regul Integr Comp Physiol. 2011;300(4):R869. 42. Li T, Mo H, Chen W, Li L, Xiao Y, Zhang J, et al. Role of the PI3K-Akt
19. Rajakhan N, Stenervictorin E, Wu X, Legro RS. The physiological basis of signaling pathway in the pathogenesis of polycystic ovary syndrome.
complementary and alternative medicines for polycystic ovary syndrome. Reprod Sci. 2017;24(5):646–55.
Am J Physiol Endocrinol Metab. 2011;301(1):E1. 43. Shah KN, Patel SS. Phosphatidylinositide 3-kinase inhibition: a new potential
20. Donnapee S, Li J, Yang X, Ge AH, Donkor PO, Gao XM, et al. Cuscuta target for the treatment of polycystic ovarian syndrome. Pharm Biol.
Chinensis lam.: a systematic review on ethnopharmacology, phytochemistry 2016;54(6):975–83.
Zhao et al. DARU Journal of Pharmaceutical Sciences (2017) 25:21 Page 12 of 12

44. Li C, Chen L, Zhao Y, Chen S, Fu L, Jiang Y, et al. Altered expression of

miRNAs in the uterus from a letrozole-induced rat PCOS model. Gene.
2017;598(20):20–6.
45. Chen H, Zhang Z. Similarity-based methods for potential human microRNA-
disease association prediction. BMC Med Genet. 2013;6(1):12.
46. Pan Q, Luo X, Toloubeydokhti T, Chegini N. The expression profile of micro-
RNA in endometrium and endometriosis and the influence of ovarian
steroids on their expression. Mol Hum Reprod. 2007;13(11):797–806.

Submit your next manuscript to BioMed Central

and we will help you at every step:
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research

Submit your manuscript at

www.biomedcentral.com/submit