The Polymerase Chain Reaction (PCR)

DNA Replication in vivo Requires Many Enzymes

Strand separation Synthesis of short RNA primers Synthesis of new DNA strands

DNA Synthesis in vitro Requires One Enzyme

dATP Denature DNA by heating Chemically synthesized DNA oligonucleotides (primers) dNTPs DNA polymerase (DNA POL)
g b a

DNA Polymerase Adds Nucleotides to the 3 End

Both DNA & RNA synthesis occurs 5 - 3 RNA is translated 5 - 3 DNA is replicated 5 - 3 By convention, DNA sequence is presented in the 5 -3 direction

Synthesis of Both Strands of a Specific DNA Sequence in vitro

5 3

TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG

3 5

Forward primer
3

dNTPs

TTGAGAAAGGAATAAGC DNA POL AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG

3 5

5 3

TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG

Synthesis of Both Strands of a Specific DNA Sequence in vitro

5 3

TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG

5 3 3

TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC DNA POL TCTTTAGCTCATATACG

5 Reverse primer

dNTPs

5 5

GCATATACTCGATTTCT

3
3

TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG

PCR: What is it?

Polymerase Chain Reaction: a means of amplifying relatively short, specific pieces of DNA Primary tool of molecular biology, increasing importance in other disciplines Advantages:
Simple, rapid, largely inexpensive Specifically target particular DNA sequences of varying length A large number of copies can be obtained from very small amounts of DNA, even when the source is relatively of poor quality

The process is exquisitely sensitive

PCR requires very little starting material This makes it useful for basic research and commercial uses
Genetic identity testing Forensics Industrial quality control In vitro diagnostics

The PCR Process: Components of the Reaction

The Template Most PCR uses DNA rather than RNA as target DNA is stable, easy to isolate Only criteria are: At least 1 intact DNA strand of interest should be present, Any impurities are sufficiently diluted (1:5 dilution optimal) Primers

Short, specific segments of DNA, provide SPECIFICITY

dNTPs namely dATP, dTTP, dCTP, dGTP Thermostable DNA polymerase (e.g., Taq, Pfu) Buffer and salts (KCl, MgCl2) Optional: BSA, DMSO, Formamide

The PCR Process: How it Works

Huge excess of primers, dNTPs, and enzyme relative to the template Repeated cycles of melting (strand separation), primer annealing, and primer extension by cycling temperatures
Need a tough enzyme to deal with high temperatures Polymerases isolated from thermophilic bacteria (Thermus aquaticus, Pyrococcus furiosus)

The Process:

http://www.dnalc.org/ddnalc/resources/pcr.html

94-950C for 1-2 min

40-600C for 1min

720C, allow 1 min for every 1Kb to be amplified

A PCR cycle theoretically doubles the amplicon 10 cycles a factor of 1000 20 cycles >1 million fold

The Plateau Effect

Accumulation of products is not indefinately exponential
Depletion of substrates (dNTPs, primers) Reduction in denaturation efficiency Inneficiency in primer annealing Instability of reactants (dNTPs, enzyme) by thermal inactivation Limiting enzyme concentration Product re-annealing after danaturation Competition for reactants by non-specific products, these may start to amplify preferentailly

General Considerations
PCR is very sensitive to contamination Nonspecific amplification is often a problem
Polymerase is active even at lower temperatures (e.g., while setting up reactions) Hot start PCR is an option

Amplification is often possible using primers designed for other species

Degenerate primers (multiple versions with different bases in key places: gacgt, gacga, gacgg, gacgc) Touchdown PCR with reduced stringency in early cycles

Maximum product size is about 5000 bases for standard PCR: Long PCR kits go up to 35 kb

Primer Design
Primers should usually be 20-25 bases long

Need as much sequence information as possible outside target

3 end of primer is most important: best to have g or c at end Aim for 40-60% g + c content Primers should have approximately equal melting temperatures; Tm = 2(A+T) + 4(G+C)

Primer Design
50% of the primers will anneal at Tm
Avoid repetitive sequences Avoid complementarity within or between primers Start with 1M final concentration for optimisation

Primer Design

Sample sequence and primers

Note how sequence of reverse primer relates to that of target sequence: remember 5 to 3 convention! Target Sequence (priming sites underlined):
5TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCAT

ATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGGAGA GACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAA CCAGTTAAAGAGTGTGCCAGTAGAG 3 Forward Primer: 5ATG GAT GAG AAA TGC TTG TG3 Reverse Primer: 5ACT GGC ACA CTC TTT AAC TGG3

Primer design
Can include restriction sites at 5 end for subsequent cloning Atleast 3 bases upstream of recognition site to facilitate restriction
5
GAGCGGATCCTTGAGAAAGGAATAAGC

3
DNA POL

AGTAAGCATCAACTCTTTCCTTATTCGTCTTAAGCAAGGTTCTCATATACG

You can design your primers on the web

Primer3 http://frodo.wi.mit.edu/primer3/ GeneFisher http://bibiserv.techfak.uni-bielefeld.de/cgibin/gf_submit?mode=STARTUP&qid=na&sample =dna PCR Now (for real time PCR primer design) http://pathogene.swmed.edu/rt_primer/

Calculating primer molarity

Oligonucleotide primers supplied as OD units/ml The concentration of ssDNA giving OD of 1 at 254nm in a 1cm cuvette is 37g/ml
i.e. 1 OD254 (ssDNA) = 37g/ml Alternatively, 1 OD260 (ssDNA) = 33g/ml

MW of ssDNA is 330daltons per nucleotide e.g. If supplied a 17mer oligo with 12.6 OD units MW=17 x 330 = 5610

concentration=12.6 x 37=446 g/ml=0.466g/l

Molarity=0.466/5610=0.000083=83 M

Cycle parameters: Annealing temperature is critical Depends on Tm Annealing temp Should be as high as possible to minimize non specific primer annealing

increase amount of specific product

reduce primer-dimer formation Start at 50C below any calculated Tm

Preparation of Master Mix Final Component Purpose Conc. Water 1X 200M Buffer dNTPs keeps reaction at the proper pH Energy and nucleosides for the PCR Add equal amounts of dATP, dTTP, dCTP, dGTP to prevent mismatches 20-30 bases, bind to DNA template allowing Taq to initiate incorporation of the dNTPs. A heat stable enzyme that adds the dNTPs to the DNA template.

0.2-1.0M Primers 2.5U/100l Taq

0.05-1.0g Template

The DNA to be amplified

PCR Optimization; MgCl2

Taq polymerase is inactive in absence of adequate free magnesium The amount of free magnesium is affected by: Template DNA Chelating agents (EDTA, citrate) dNTPs Proteins

Yet excess magnesium reduces enzyme fidelity, thereby increasing nonspecific amplification Empirical determination of optimal MgCl2 using reaction series containing13mM Mg2+ in 0.5mM increaments Frozen MgCl2 forms a concn gradient , vortex upon thawing

PCR Optimization
The template
Reagents used to purify DNA are potent inhibitors of polymerases e.g.

Salts
Guanidine Proteases Organic solvents SDS A final ethanol precipitation to eliminate inhibitors Keep final DNA concn in reaction at <10ng/l Nested PCR can be used to increase sensitivity

PCR Optimization: DNA polymerases

Taq polymerase most popular, least expensive 1.25U Taq in a 50l reaction products with A overhangs at 3 end, easy cloning into T-vectors which have T overhangs e.g. pGEM-T Easy

Excess enzyme, long extension time leads to smearing in the gel due to artifacts
Taq/ AmpliT aq
5-3 Exonucl. Activity 3-5 Exonuclease Activity RT Activity Resulting DNA Ends Weak 3A Yes 3A Yes 3A No >95% Blunt n.a. n.a. n.a. Blunt No No No Yes Yes Yes Yes Yes Yes No No No

Tfl

Tth

VentR/ Tli

Pfu

Pwo

PCR Optimization
Component Annealing Temperature MgCl2 KCl Enzyme, Primer pH Formamide depends Lower Stringency Higher Stringency

Main focus on annealing temperature and MgCl2:

Try combinations of 3 levels of each

PCR Optimization: The Taguchi Array

Reaction Variable 1 Variable 2 Variable 3 Variable 4 Tube (dNTPs) (MgCl2) (Primer concn) (Taq Concn)
1 2 3 4 5 6 7 8 9 A A A B B B C C C A B C A B C A B C A B C B C A C A B A B C C A B B C A

Examples of concentrations for use in the optimization assays

A Primer (pMoles) MgCl2 (mM) dNTPs (M) Enzyme (U) 7.5 0.5 50 0.5 B 15 1.5 100 2 C 30 3 200 5

Hot start PCR

Aims to eliminate non-specific amplification and primerdimer formation Limit availability of 1 component up to beyond 600C Can be done manually This is tedious Contamination risk Polymerase added in wax beads, released upon melting of

the wax
Polymerase coupled to antibody, released at high temp.

Recommended Volumes of Components for PCR. Components Nuclease-Free Water (to a final volume of 50l) 10X Reaction Buffer dNTP mix (10mM of each dNTP) Taq DNA polymerase (5u/l) 25mM MgCl2 Downstream Primer Upstream Primer Template
1

Volume

Final Concentration

Xl 5l 1l 0.25l 3l 50pmol 50pmol Yl

2 1 1

1X 0.2mM each 0.025u/l 1.5mM 1M 1M

A general formula for calculating the number of nanograms of primer equivalent to 50pmol is: 50pmol = 16.3ng x b; where b is the number of bases in the primer.
2

If possible, start with >10 copies of the target sequence to obtain a signal in 2530 cycles, but keep the final DNA concentration of the reaction at <=10ng/l. Less than 10 copies of a target can be amplified (15), but more cycles may be required to detect a signal by gel electrophoresis. Additional cycles may increase nonspecific amplification,

General precautions
DNA/RNA carry over from another experiment is a common
problem Use separate areas (Rooms) and pipettes for pre and postamplification steps Positive displacement pipettes or

Aerosol resistant tips to reduce contamination during pipetting

Wear gloves, change them often Sterilize all equipment, tips, rxn tubes e.t.c.

ONE WAY STREET!

Lab 3 OUT PCR Area Detection Area

Lab 2 Specimen preparation

Lab 1 Super Mix preparation

IN

Real-Time PCR

Allows the scientist to actually view the increase in the amount of DNA as it is amplified.

Uses a probe with a reporter (R) fluorophore at 5 end and a quencher (Q) flourophore at 3
Q (red) reduces flourescence from R (green) by FRET (without proton emission)

Real-Time PCR
After denaturation, the probe anneals as well as primers During extension, Taq displaces the reporter by 5 -3 exonuclease activity Reporter then flouresces The light emitted is displayed in graphic form on computer

PCR: other types

"Touch-down" PCR - start at high annealing temperature, then decrease annealing temperature in steps to reduce non-specific PCR product. Nested PCR PCR using a outer set of primers and the product of this PCR is used for further PCR reaction using an inner set of primers. Inverse PCR - for amplification of regions flanking a known sequence. DNA is digested, the desired fragment is circularized by ligation, then PCR using primers complementary to the known sequence extending outwards. AP-PCR (arbitrary primed)/RAPD (random amplified polymorphic DNA) - methods for creating genomic fingerprints from species with littleknown target sequences by amplifying using arbitrary oligonucleotides. It is normally done at low and then high stringency to determine the relatedness of species or for analysis of Restriction Fragment Length Polymorphisms (RFLP).

PCR: other types

RACE (rapid amplificaton of cDNA ends) - used where information about DNA/protein sequence is limited. Amplify 3' or 5' ends of cDNAs generating fragments of cDNA with only one specific primer each . Overlapping RACE products can then be combined to produce full cDNA. DD-PCR (differential display) - used to identify differentially expressed genes in different tissues. First step involves RT-PCR, then amplification using short, intentionally nonspecific primers. Get series of band in a high-resolution gel and compare to that from other tissues, any bands unique to single samples are considered to be differentially expressed. Multiplex-PCR - 2 or more unique targets of DNA sequences in the same specimen are amplified simultaneously. One can be used as control to verify the integrity of PCR. Can be used for mutational analysis and identification of pathogens.

Reverse Transcriptase PCR (RT-PCR)

The most sensitive and versatile technique for measuring gene expression in tissues and cells Avian myeloblastosis virus (AMV) or Moloney murine leukemia virus (MMLV or MuLV) reverse transcriptases for first strand cDNA synthesis Second strand cDNA synthesis with Taq DNA polymerase after RT inactivation

Promega's Access RT-PCR System

Incorporates AMV RT for first strand cDNA synthesis and Thermus flavus (Tfl) DNA Polymerase for second strand cDNA synthesis and DNA amplification. The system includes an optimized single-buffer

system that
permits extremely sensitive detection of RNA

transcripts

No requirement for buffer additions between the

reverse transcriptase and PCR amplification steps.

RT-PCR Optimisation
RNA transcripts exhibiting significant secondary structure must be denatured for efficient reverse transcription. Viral reverse transcriptases (e.g., MuLV and AMV) are inactivated at elevated temperatures. First strand synthesis reactions must be performed at 37-48C. The (MuLV at 42C. AMV RTat 45C).

RT-PCR Optimisation
3 RT-PCR kits; MuLV/Taq RNA PCR Kit, Tth RNA PCR Kit, and the Promega Access RTPCR System (AMV/Tfl ) The two-enzyme methods using MuLV/Taq or AMV/Tfl are each 100- to 1,000-fold more sensitive than the one-enzyme Tth method Single buffer systems, e.g Promega's optimized AMV/Tfl reaction buffer and PerkinElmer's bicine buffer eliminate the requirement for opening the reaction vessel between steps

Primer design
Depends on target mRNA length and secondary structure formation.

Oligo dT primers only suitable for short mRNAs.

Random haxamers prime RT at several points along the mRNA Suitable for long mRNAs with complex secondary structure However, sequence specific primers should preferred to limit amplification to target mRNA be

1M final primer concentration in a 50l reaction as a starting point for optimization

RT-PCR Cycle Parameters

Denature template/primer mixture at 94C for 2 minutes. (Do not incubate the AMV Reverse Transcriptase at 94C!) Cool the template/primer mixture to 45C and add to the RT-PCR reaction mix for the reverse transcription Incubate at 45C for 20-60 minutes (45 optimal). Following the reverse transcription incubation, 2 minute incubation at 94C to denature the RNA/cDNA hybrid, inactivate the AMV Reverse Transcriptase and dissociate the AMV from the cDNA. Perform PCR for 30-45 cycles Analyse product on ethidium stained gels

Recommended Volumes for Use with the Access RT-PCR System.

Components Nuclease-Free Water (to a final volume of 50l) AMV/Tfl 5X Reaction Buffer dNTP Mix (10mM of each dNTP) Downstream Primer Upstream Primer 25mM MgSO4 AMV Reverse Transcriptase (5u/l) Tfl DNA Polymerase (5u/l) RNA Sample

Volume

Final Concentration

Xl 10l 1l 50pmol1 50pmol1 2l 1l 1l yl2 1X 0.2mM each 1M 1M 1mM 0.1u/l 0.1u/l

How do you confirm that your product is the genuine one?

Nested PCR Hybridization onto Southern Blot RFLP

Sequencing

Troubleshooting PCR & RT-PCR

Symptoms
Low yield or no (PCR or RT-PCR)

Possible Causes Comments

Insufficient number Template degraded Return reactions to thermal cycler for 5 or more cycles. Verify the integrity of the DNA by electrophoresis after incubation in the presence of Mg2+. Thermal cycler programmed incorrectly in some positions of thermal cycler open Inhibitor present Verify that times and temperatures are correct. Use step cycles, not hold segments. determine if certain positions in the thermal cycler give low yields. heating and cooling. Reduce the volume of sample in the reaction. Ethanol precipitate to remove inhibitors. Improper reaction conditions Missing reaction component Mineral oil problem Reduce the annealing temperature or allow longer extension times for longer amplicons. Check the reaction components and repeat the reaction. The reaction must be overlaid with high quality, nuclease-free light mineral oil. Do not use autoclaved mineral oil. Reaction tubes not autoclaved Poor primer design Autoclaving tubes eliminates contaminants that inhibit amplification. Make sure primers are not selfcomplementary or complementary to each other. Try a longer primer. Incorrect primer specificity Verify that the primers are complementary to the appropriate strands.

amplification product of cycles

Temperature too low Perform a set of control reactions to

Top of thermal cycler The top must be closed for correct

Primer concentration too low

Verify primer concentration in the reaction. Increase primer concentration in the reaction

Suboptimal reaction conditions

Optimize Mg2+ concentration, annealing temperature and extension time. Always vortex the Mg2+. Store solution prior to use. Verify that primers are present in equal concentration.

Nucleotides degraded Keep nucleotides frozen in aliquots, thaw quickly and keep on ice once thawed. Avoid multiple freeze/thaw cycles. Target sequence in target DNA Redesign experiment of target DNA. genuinely not present or try other sources

Amplification product Genomic DNA has a higher than expected molecular weight (RT-PCR) Multiple, nonspecific (PCR or RT-PCR) Poor primer design the RNA template contaminate the RNA preparation Suboptimal reaction

Treat the RNA sample with RQ1 RNase-

sequences related to Free DNase.

Optimize MgSO4/MgCl2 concentration, annealing temperature, size extension time and cycle number to minimize nonspecific priming. Make sure primers are not selfcomplementary or complementary to each other, especially near the 3'-ends. Try a longer primer. Avoid using three consecutive G or C nucleotides at the 3'-end of a primer.

amplification products conditions

Primer concentration Verify primer concentration in the too high Contamination by another target RNA/DNA reaction. Try a lower concentration in the reaction. Use positive displacement pipets or aerosol-resistant tips to reduce crosscontamination during pipetting. Use a separate work area and pipettor for preand post-amplification. Wear gloves and change them often. Use UNG (14) or another sterilization technique to prevent DNA carry-over to subsequent reactions.

Low yield or no first strand product (RTPCR)

RNA degraded

Verify the integrity of the RNA by denaturing agarose gel electrophoresis. Ensure that reagents, tips and tubes are RNase-free. Isolate the RNA in the presence of a ribonuclease inhibitor (e.g., Promegas RNasin Ribonuclease Inhibitor).